Rice grains with thickened aleurone

Abstract

The present invention relates to rice grains having thickened aleurone. Additionally, a rice plant is provided comprising at least one gene variant that reduces the activity of at least one ROS1a gene in the plant. The grains of the present invention, or the aleurone derived therefrom, have improved nutritional properties and are therefore particularly useful for human and animal feed products.

Description

Technology Field

[0001] The present invention relates to a rice grain having a thickened aleurone. In addition, at least one type of from a plant ROS1a A rice plant comprising at least one gene variant that reduces the activity of the gene is provided. The grain of the present invention, or the grain derived therefrom, has improved nutritional properties and is therefore particularly useful for human and animal feed products. Background Technology

[0002] Globally, grain kernels, such as wheat, rice, and corn, and to a lesser extent, barley, oats, and rye, are the primary source of human caloric intake from the starch components of the kernels. Grain kernels are also important in supplying other nutritional components, such as protein, vitamins, minerals, and dietary fiber. Different parts of the kernel contribute differently to these nutritional components. Starch is stored in the starchy endosperm of the grain kernel, whereas other nutritional components are more concentrated in the embryo and bran (Buri et al., 2004). However, the bran is usually removed before the grain is used as food, particularly as rice, which is then consumed as white rice.

[0003] Grain kernels arise from the event of double fertilization between a maternal gametophyte and a paternal gametophyte. Of the two sperm cells from the pollen tube, one fuses with the egg to produce a zygote that develops into an embryo, while the other sperm cell fuses with the diploid centrosome of the female gametophyte to produce a primary endosperm nucleus, from which a genetically triploid endosperm develops. Thus, the endosperm containing aleurone is triploid, possessing two copies of the maternal haploid genome and one copy of the paternal haploid genome. In dicotyledonous seeds, the endosperm is consumed by the developing embryo, whereas in monocotyledonous plants, such as rice, the endosperm continues to constitute the bulk of the mature kernel.

[0004] The mature endosperm of grains has four cell types with distinct characteristics: the starchy endosperm, characterized by a rich content of starch granules and storage proteins; the epidermal-like aleurone, the most common single cell layer of thickness surrounding most of the starchy endosperm; the transitional cells at the base of the seed across the main maternal vascular structure; and the embryo-surrounding cells, which initially form a lining for the embryo during grain development but subsequently only surround the suspensor connecting the embryo and the starchy endosperm (Beraft et al., 2001a). The embryo is formed within a cavity in the starchy endosperm. Thus, the grain aleurone tissue contains the outermost layer(s) of the endosperm in the grain and surrounds parts of the starchy endosperm and the embryo.

[0005] Aleurone cells are distinguished from starchy endosperm by their morphology, biochemical composition, and gene expression profile (Becraft and Yi, 2011). Aleurone cells are rich in oil and protein and secrete enzymes that allow for the mobilization of endosperm preservation during seed germination. Each aleurone cell is thicker than the endosperm cell wall, is composed mainly of arabinoxylan and beta-glucan in varying proportions, and is enclosed within a highly autofluorescent fibrous cell wall. The aleurone layer is sometimes the only layer of endosperm colored with anthocyanins in grains.

[0006] Grain aleurone is only a single cell layer thick in wheat and wild-type maize (Buttrose 1963; Walbot, 1994), mostly one to three or fewer cell layers in the posterior region of the endosperm in rice (Hoshikawa, 1993), and three cell layers in wild-type barley (Jones, 1969). In typical endosperms, aleurone is extremely regular, and the pattern of cell division is highly organized. Wild-type mature aleurone cells are nearly rectangular in flakes, having dense cytoplasm containing inclusion bodies, small vacuoles, and inclusion bodies composed of proteins, lipids, and phytin, or proteins and carbohydrates. In mature grain kernels, aleurone is the only viable endosperm tissue, but it is in a dormant, inactive form. Upon imbibition, the embryo produces gibberellin, which is released into the starchy endosperm to break down storage compounds and induce the synthesis of amylase and other hydrolytic enzymes through aleurone, which forms sugars and amino acids to facilitate the initial growth of the embryo into a seedling.

[0007] The regulation of aleurone formation in grain kernels has been reviewed in the literature [Becraft and Yi (2011)]. Gene regulation at various levels controls aleurone cell fate, differentiation, and organization, and while numerous genes are involved in this process, only some of them have been identified. For example, defective corn kernels ( defective kernal ) 1 ( dek1 Loss-of-function mutants lack an aleurone layer, indicating that the wild-type Dek1 polypeptide requires the specification of the outer cell layer as aleurone (Becraft et al., 2002). The Dek1 polypeptide is a large, essential membrane protein with a 21-membrane-spanning domain and a cytoplasmic domain containing an active calpain protease. Another gene in maize, CRINKLY4 (CR4), encodes a receptor kinase that functions as a positive regulator of aleurone fate, and cr4The mutant has reduced egg white (Becraft et al., 2001b).

[0008] Although several examples of thickened aleurone in grain mutants have been reported in the literature, they have not been proven useful due to plyotrophic effects, or crop and production problems.

[0009] In the literature [Shen et al. (2003)], an excess aleurone layer ( supernumerary aleurone layers ) 1 ( room1 The identification of maize mutants in the ) gene has been reported, which had 2 to 3 or 7 or fewer layers of aleurone cells instead of normal single-layer cells in different mutants. The SAL1 polypeptide was identified as a class E vacuolar sorting protein. Homozygous room1 -1 mutant grains failed to sprout and had defective embryos with significantly reduced starchy endosperm. room1 Less complete mutants homozygous for the -2 allele exhibited two cell-layer alveoli. However, the mutant plants grew to only 30% of the height of the wild type, had reduced root mass, and performed poorly in seed setting (Shen et al. 2003). These plants were not agronomically useful.

[0010] In the literature [Yi et al. (2011)], thick aleurone 1 ( thk1 The identification of a ) mutant has been reported. The kernels of this mutant exhibited multilayered eggshells. However, the kernels of this mutant lacked a well-developed embryo and did not germinate upon sowing. Wild type Thk1 The gene encoded the Thk1 polypeptide, which acts downstream of the Dek1 polypeptide required for aleurone development in maize (Becraft et al., 2002).

[0011] Corn extra cell layer (extra cell layer) ( Xcl ) gene mutants were identified by their effect on leaf morphology. It produced a double aleurone layer as well as a multilayered leaf epidermis (Kessler et al., 2002). Xcl The mutation was a semi-dominant mutation that disrupted cell division and differentiation patterns in corn, producing thick, narrow leaves with an abnormal shiny appearance.

[0012] Disogal disorgal )1 and Disogal2( dil1 and dil2 Maize mutants of the ) gene exhibited aleurone with varying numbers of layers containing cells of irregular shape and size (Lid et al., 2004). However, homozygous dil1 and dil2 The mutant grains shriveled due to reduced starch accumulation, and the mature mutant grains sprouted at a low rate and did not grow into living plants.

[0013] From barley, elo2 The mutants exhibited similarly unorganized cells and irregularities in the aleurone layer, which resulted from abnormal periphery cell division (Lewis et al., 2009). The plants also displayed an increased cell layer in the leaf epidermis and had bulging and distorted cells on the epidermis. Importantly, the homozygous mutant plants were dwarf and produced less than 60% of the grain weight of the wild type, making them unsuitable for grain production.

[0014] In rice, two transcription factors that control the expression of seed storage proteins also influence eggshell cell fate (Kawakatsu et al., 2009). Reduced expression by a co-repressor construct of the gene encoding the rice prolamin box binding factor (RPBF) polypeptide (which belongs to the DOF zinc finger transcription factor class) produced idiopathic multilayer eggshells consisting of large, diseased cells. Significant reductions in seed storage protein expression and accumulation were also present, and starch and lipids accumulated at significantly reduced levels. The expression of rice homologues of the maize Dek1, CR4, and SAL1 genes was also reduced, indicating that the RPBF and RISBZ1 factors acted via the same regulatory pathways as these genes.

[0015] DNA의 탈메틸화

[0016] In a completely different area of ​​plant science, DNA demethylation is now summarized. Plants methylate some cytosine nucleotides within nuclear DNA at carbon 5 of a pyrimidine ring to form 5-methylcytosine (5-meC). Methylated cytosine can be produced in any of three circumstances: CG, CHG (where H=A, C, or T), and CHH methylation, each catalyzed by a different methyltransferase. At least Arabidopsis thaliana ( Arabidopsis thalianaIn methyl glycans and likely in most plants, including rice (Zemach et al., 2010), methyl glycans are catalyzed by the methyltransferase 1 (Met1) family, CHG methylations are catalyzed by methylases of the chromomethylase family, and CHH methylations occur through RNA-mediated reactions catalyzed by Domains Rearranged Methylase (DRM) using a small RNA as a guide sequence (Law and Jacobsen, 2010). Cytosine methylation, which occurs in only a small proportion of all cytosines, most commonly takes place in heterochromatin DNA and in regions rich in repetitive DNA and transposons, thereby inhibiting their activity. It also occurs in transcribed regions of nuclear DNA, including the promoter regions of genes, and is involved in the control of the expression of numerous genes.

[0017] Cytosine methylation of DNA is reversible through demethylation, which can occur passively through DNA replication or actively through the activity of demethylase enzymes. In plants, one pathway for active DNA demethylation is the base cleavage repair (BER) pathway using DNA glycosylase enzymes. These enzymes remove 5-meC from the double-stranded DNA backbone and then cleave the DNA backbone (lyase activity) at the abasic site through successive β- and δ-elimination reactions. The repair is completed by the insertion of unmethylated cytosine nucleotides via DNA polymerase activity.

[0018] Four types of 5-meC DNA glycosylases / lyases exist in the Arabidopsis genome, designated as Demeter (DME), Demeter-like 2 (DML2), Demeter-like 3 (DML3), and Repressor of Silencing (ROS1). Genetic and biochemical analyses have indicated that all four function as DNA demethylators (Gong et al., 2002; Agius et al., 2006; Morales-Ruiz et al., 2006), with DME primarily functioning in oocytes and endosperms, while the others function in other tissues. Other plants exhibit similarly diverse demethylators (Zemach et al., 2010).

[0019] There is also a demand for rice grains with thickened aleurone from phenotypically normal and agronomically useful plants, particularly rice plants.

[0020] In one aspect, the present invention provides a grain of a rice plant, the grain comprising aleurone, starchy endosperm, ROS1a encoding a polypeptide ROS1a genes and (i) at least one species in each plant when compared to the corresponding wild-type rice plant. ROS1a It contains one or more gene variants that reduce the activity of the gene, and / or (ii) the aleurone is thicker compared to the aleurone from the corresponding wild-type grain.

[0021] In an embodiment, ROS1a The polypeptide has DNA glycosylase activity. In an embodiment, ROS1a The polypeptide is the corresponding wild type ROS1a A polypeptide and / or amino acid having the sequence presented in SEQ ID NO. 2 ROS1a It has a level of DNA glycosylase activity that is 2% to about 60% of the level of DNA glycosylase activity of the polypeptide.

[0022] In another embodiment, ROS1a Polypeptides are corresponding wild types with different amino acid sequences. ROS1a It is a variant of a polypeptide. In a preferred embodiment, the rice grain has the amino acid sequence provided as SEQ ID NO. 1. ROS1a (Ta2) comprises a variant polypeptide, wherein the amino acid sequence of the polypeptide is provided as SEQ ID NO. 2, and the wild type ROS1a It is a variant of a polypeptide.

[0023] In an embodiment, the grain is of the corresponding wild-type grain ROS1a 2% to about 60% of what is present in the grain compared to polypeptide levels ROS1a It has the level of polypeptides.

[0024] In an embodiment, the thickened aleurone comprises at least 2, at least 3, at least 4, or at least 5 cell layers, about 3, about 4, about 5, or about 6 cell layers, or 2 to 8, 2 to 7, 2 to 6, or 2 to 5 cell layers. In an embodiment, the grain is derived from a rice plant, and the thickened aleurone comprises 5 to 8, 5 to 7, 5 to 6, or 2 to 5 cell layers. In an embodiment, the thickness of the aleurone layer is increased by about 100%, or about 150%, or about 200%, or about 250% compared to the aleurone of a wild-type rice grain.

[0025] At least one species of plant ROS1a A gene variant that reduces the activity of, preferably the introduced gene variant, is in rice grains ROS1a It may be any type of genetic modification that reduces or impairs the production of the polypeptide at wild-type levels. Examples of such genetic variations include, but are not essentially limited to, the following:

[0026] (a) wild type ROS1a A mutant having reduced DNA glycosylase activity compared to polypeptide (SEQ No. 2) ROS1aencoding a polypeptide ROS1a gene;

[0027] (b) Reduced levels of wild-type when expressed ROS1a A wild type that produces a polypeptide, for example, whose cDNA sequence is provided as SEQ ID NO. 8 ROS1a Compared to genes, ROS1a Includes splice-site mutations that cause reduced expression levels of the gene ROS1a Genes, or ROS1a The gene is the aforementioned wild type ROS1a Compared to genes, the above ROS1a The above, comprising a mutation in its promoter that causes reduced expression of the gene ROS1a gene;

[0028] (c) In the above rice plant ROS1a An exogenous nucleic acid construct encoding a polynucleotide that reduces gene expression, wherein, preferably, the nucleic acid construct comprises a DNA region encoding said polynucleotide operably linked to a promoter expressed in a developing grain of said rice plant at least at a time point between the time of flowering and 7 days after flowering; and

[0029] (d) ROS1a As a gene, said gene including an early translation stop codon in its protein-coding region is wild type ROS1a Encodes a polypeptide that is truncated relative to the polypeptide, but which can or cannot produce it, ROS1a gene.

[0030] In a preferred embodiment, the rice grain comprises (i) aleurone, (ii) starchy endosperm, and (iii) wild type ROS1a In rice plants compared with genes ROS1a including gene variants that reduce gene activity ROS1a The above, comprising a gene, wherein the gene variant comprises ROS1a The gene is a variant compared to sequence number 2 ROS1a Encodes a polypeptide, wherein the aleurone is thickened compared to the aleurone from the corresponding wild-type rice grain. In an embodiment, ROS1a A genetic variant within a gene is an introduced genetic modification. In a preferred embodiment, the variant ROS1a The polypeptide differs in its amino acid sequence from the sequence provided as SEQ ID NO. 2 in that at least one amino acid is inserted, deleted, or substituted compared to SEQ ID NO. 2. In a more preferred embodiment, a variant ROS1a The polypeptide differs in its amino acid sequence from the sequence provided as SEQ ID NO. 2 by insertion of one or more amino acids or single amino acid substitution, e.g., one of the amino acid substitutions listed in Table 3. The rice grain may be treated so that it can no longer sprout, e.g., cooked, or it may not be treated as such so that it sprouts and grows, thereby providing the rice plant of the present invention. In the most preferred embodiment, the aleurone of the rice grain is colored, e.g., the rice grain is black rice as defined herein.

[0031] In another preferred embodiment, the rice grain comprises (i) aleurone, (ii) starchy endosperm, and (iii) wild type ROS1a In rice plants compared with genes ROS1a including gene variants that reduce gene activity ROS1a The above, comprising a gene, wherein the gene variant comprises ROS1a The gene has an amino acid sequence of the wild type. ROS1a Polypeptide, for example, identical to, for example, SEQ ID NO. 2 ROS1a Encodes a polypeptide, where the above ROS1a The gene is wild type ROS1aThe gene is expressed in rice plants at a reduced level, whereby the aleurone becomes thicker compared to the aleurone from the corresponding wild-type rice grain. In an embodiment, ROS1a Gene mutations within the gene are expressed at reduced levels ROS1a It is an introduced genetic modification that generates a gene. In an embodiment, the genetic modification is (i) a wild type in which the cDNA sequence provided as SEQ ID NO. 8. ROS1a Compared to the gene, at a reduced level ROS1a (ii) Splice-site mutations that produce gene expression, (ii) wild type ROS1a Compared to genes, ROS1a Generating reduced gene expression ROS1a Gene promoter mutations, and (iii) in rice plants ROS1a It is selected from a group consisting of exogenous nucleic acid molecules that encode RNA polynucleotides that reduce gene expression, preferably incorporated within the nuclear genome of a rice plant. The rice grain may be treated so that it can no longer germinate, e.g., by cooking, or it may not be treated in this way so that it germinates and grows, thereby producing the rice plant of the present invention. In the most preferred embodiment, the aleurone of the rice grain is colored, e.g., the rice grain is black rice as defined herein.

[0032] In an embodiment, the rice plant has a level of DNA glycosylase activity in its developing grain that is 2% to about 60% of the level of DNA glycosylase activity in the developing grain of the corresponding wild type. In a preferred embodiment, the rice plant has a level of DNA glycosylase activity in its developing grain that is 2% to 50%, or 2% to 40%, or 2% to 30%, or 2% to 20% of the level of DNA glycosylase activity in the developing grain of the corresponding wild type.

[0033] In an embodiment, at least one type of rice plant ROS1a The activity of the gene is reduced in one or more or all of the aleurone, pericarp, nucellar projection, ovary, seed coat, and starchy endosperm of the developing grain.

[0034] In an embodiment, ROS1a The activity of the gene is reduced at least at the time point between flowering and 7 days post-flowering and / or in pre-flowering oocytes. In an embodiment, an exogenous nucleic acid molecule can be operably linked to a promoter expressed at least at the time point between flowering and 7 days post-flowering, so that the encoded RNA polynucleotide is in the rice plant during that time. ROS1a Reduces gene expression.

[0035] In an embodiment, the rice plant is hermaphroditic.

[0036] In an embodiment, the rice plant exhibits delayed grain maturation. In an embodiment, grain maturation is delayed by 2 to 10 days or 2 to 15 days compared to the wild-type rice plant.

[0037] In an embodiment, the grain comprises one or more or all of the following, each based on weight when compared to a corresponding wild-type grain:

[0038] i) a higher mineral content, preferably the mineral content is one or more or all of zinc, iron, potassium, magnesium, phosphorus, and sulfur,

[0039] ii) Higher antioxidant content,

[0040] iii) Higher phytate content,

[0041] iv) A higher content of one or more or all of vitamins B3, B6, and B9,

[0042] v) Higher dietary fiber content and / or insoluble fiber content,

[0043] vi) Starch content of about 90% to about 100% by weight relative to the starch content of the corresponding wild-type grain;

[0044] vii) Higher sucrose content,

[0045] viii) Higher monosaccharide content, and

[0046] ix) A lipid content of at least 90% or at least 100% compared to the lipid content of the corresponding wild-type grain. In an embodiment, the content of the component is increased by 10 to 50% or preferably 10 to 100% compared to the corresponding content in the wild-type rice grain.

[0047] In an embodiment, the grain includes an embryo.

[0048] In an embodiment, the grain is a whole grain or a cracked grain.

[0049] In an embodiment, the grain is preferably processed by heat treatment so that it no longer sprouts. For example, the grain is cooked with water at 100°C for at least 5 minutes. In an embodiment, the grain is split grain or milled grain.

[0050] In an alternative embodiment, the grain has a germination rate of about 70% to about 100% compared to the germination rate of the corresponding wild-type grain. That is, a collection of at least 100 grains has an average germination rate of 70% to 100% compared to the wild type. When the grain sprouts and grows, the rice plant of the present invention is produced.

[0051] In an embodiment, the grain preferably has DNA glycosylase activity in one or more of the aleurone, seed coat, and starchy endosperm of the grain. ROS1a encoding a polypeptide ROS1a It contains a gene, wherein it has DNA glycosylase activity. ROS1a The polypeptide is preferably a mutant ROS1a It is a polypeptide.

[0052] In another embodiment, the grain is of the corresponding wild type ROS1a Mutant having reduced DNA glycosylase activity when expressed in rice plants compared to polypeptide ROS1a It comprises a polypeptide, preferably wherein a mutant ROS1a The polypeptide is the corresponding wild type ROS1a It includes one or more amino acid substitutions, deletions, or insertions that reduce DNA glycosylase activity compared to the polypeptide. Mutant ROS1a Polypeptides may not possess DNA glycosylase activity, but a single grain may have another that possesses DNA glycosylase activity ROS1a It contains polypeptides. For example, ROS1a The gene is two through alternative splicing ROS1a They can encode polypeptides, one of which has DNA glycosylase activity, while the others do not. In a preferred embodiment, the mutant ROS1a Polypeptide, for example, a mutant in which the amino acid sequence is provided as SEQ ID NO. 1 ROS1a polypeptides are wild type ROS1a It has 7 amino acid insertions compared to the polypeptide.

[0053] In an additional embodiment, the grain is a reduced total amount compared to the corresponding wild-type grain. ROS1a It has a polypeptide which is preferably reduced in one or more of the aleurone, seed coat, and starchy endosperm of the grain, provided that the grain has DNA glycosylase activity. ROS1a encoding a polypeptide ROS1a It includes genes. ROS1a The total amount of polypeptides can also be reduced in the pollen of rice plants.

[0054] In another embodiment, the gene mutation, preferably the introduced gene mutation, is in the rice plant ROS1aAn exogenous nucleic acid construct encoding a polynucleotide that reduces gene expression, which is preferably reduced in said rice plants at least at the time between flowering and 7 days post-flowering, provided that said grains have glycosylase activity ROS1a At least one type encoding a polypeptide ROS1a It contains genetic DNA.

[0055] In an embodiment, the grain is colored in its outer layer(s), for example, the grain is a brown or black grain of a rice plant, and the grain is (i) aleurone having a thickness of at least two cell layers, or two to seven cell layers, and (ii) a corresponding wild-type rice ROS1a Comprising one or more amino acid substitutions, insertions, or deletions that reduce DNA glycosylase activity compared to polypeptides ROS1a mutants encoding polypeptides ROS1a Reduced DNA glycosylase activity, including the gene, occurs in rice plants at least between the time of flowering and 7 days after flowering, provided that at least between the time of flowering and 7 days after flowering, the rice plants have DNA glycosylase activity levels of 2% to about 60% in developing grains compared to wild-type rice plants.

[0056] In an embodiment, the grain is colored in its outer layer(s), for example, the grain is a brown or black grain of a rice plant, and the grain is (i) aleurone having a thickness of at least two cell layers, or two to seven cell layers, and (ii) from a rice plant ROS1aThe exogenous nucleic acid construct encodes a polynucleotide that reduces gene expression, wherein the exogenous nucleic acid construct encodes a DNA region encoding a polynucleotide operably linked to a promoter expressed in a developing grain of a rice plant at least between the time of flowering and 7 days post-flowering, such that at least between the time of flowering and 7 days post-flowering, the rice plant has a DNA glycosylase activity level in the developing grain of 2% to about 60% compared to a wild-type rice plant. In a preferred embodiment, the promoter is a promoter that is not a constitutive promoter, e.g., a promoter expressed in the endosperm of a developing seed. In the most preferred embodiment, the promoter is an LTP promoter.

[0057] In another embodiment, ROS1a The polypeptide comprises amino acids whose sequence is at least 95% identical to SEQ ID NO. 2, or ROS1a Polypeptide(s) comprises amino acids whose sequence is at least 95% identical, at least 97.5% identical, or at least 99% identical to SEQ ID NO. 2, and this sequence is the corresponding wild type ROS1a It differs from the amino acid sequence of the polypeptide.

[0058] In an embodiment, ROS1a The polypeptide comprises one or more or all of the following: DHGSIDLEWLR (SEQ No. 44), GLGLKSVECVRLLTLHH (SEQ No. 45), AFPVDTNVGRI (SEQ No. 46), VRLGWVPLQPLPESLQLHLLE (SEQ No. 47), ELHYQMITFGKVFCTKSKPNCN (SEQ No. 48) and HFASAFASARLALP (SEQ No. 49).

[0059] The present invention also includes each of the same gene variant(s) as described in the above embodiments, the same ROS1a Genes, identical ROS1aProvides a population of rice grains containing a polypeptide and / or having the same characteristics. That is, the population is genetically and / or phenotypically uniform. Such a population of rice grains may be obtained or derived from a single ancestral rice plant or grain, and may be derived, for example, from at least two, at least three, or at least four generations of descendants from the ancestral plant or grain.

[0060] The inventors have a variant having reduced glycosylase activity ROS1a A polypeptide was identified. Accordingly, in another aspect, the present invention relates to a wild type having a corresponding amino acid sequence. ROS1a Different from the amino acid sequence of the polypeptide and the corresponding wild type ROS1a Purified and / or recombinant DNA glycosylase activity reduced, or preferably inactive, compared to polypeptides. ROS1a Provides polypeptides.

[0061] In the embodiments, purified and / or recombinant ROS1a The polypeptide comprises amino acids having a sequence that is at least 95% identical, at least 97.5% identical, or at least 99% identical to SEQ ID NO. 2.

[0062] In another aspect, the present invention is the present invention ROS1a Provides isolated and / or exogenous polynucleotides encoding polypeptides.

[0063] In an additional aspect, the present invention, when present in rice plants, ROS1a Provides isolated and / or exogenous polynucleotides that reduce gene expression.

[0064] A person skilled in the art will be widely aware of different types of polynucleotides that can be used to reduce the expression of target genes and ways in which these polynucleotides can be designed. Examples include, but are not limited to, antisense, polynucleotides, sense polynucleotides, catalytic polynucleotides, microRNAs, double-stranded RNA (dsRNA) molecules, or processed RNA products thereof.

[0065] In an embodiment, the polynucleotide is at least 95% identical to the complement of SEQ ID NO. 7 or 8 (thymine (T) is uracil (U)), or the amino acid sequence is provided as SEQ ID NO. 1 or 2. ROS1a It is a dsRNA molecule containing at least 19 consecutive nucleotides that are at least 95% identical to the complement of mRNA encoding a polypeptide, or a processed RNA product thereof.

[0066] In another embodiment, the dsRNA molecule is a microRNA (miRNA) precursor and / or, where the processed RNA product thereof is miRNA.

[0067] In an embodiment, the polynucleotide is in a developing grain of a rice plant at least at the time between the flowering time and 7 days after flowering. ROS1a It is used to reduce gene expression.

[0068] In a further aspect, the present invention provides a nucleic acid construct and / or vector encoding a polynucleotide of the present invention, wherein the nucleic acid construct or vector comprises a DNA region encoding a polynucleotide operably linked to a promoter expressed in a developing grain of a rice plant at least at a time point between the time of flowering and 7 days after flowering.

[0069] In a further aspect, the present invention provides a recombinant cell comprising the exogenous polynucleotide of the present invention, or the nucleic acid construct and / or vector of the present invention.

[0070] In an embodiment, the cell is a rice plant cell, for example, a rice grain, preferably a rice grain cell.

[0071] In an embodiment, an exogenous polynucleotide, nucleic acid construct, or vector is incorporated into the cell genome, preferably the nuclear genome.

[0072] also ROS1a encoding a polypeptide ROS1a At least one type of gene in the cell when compared to the corresponding wild-type cell. ROS1a A rice plant cell containing a gene variant that reduces the activity of a gene, preferably an introduced gene variant, is provided.

[0073] In an embodiment, the cell is an aleurone, pericarp, central process, ovary, seed coat, or starchy endosperm cell.

[0074] In another aspect, the present invention provides a rice plant or a group of rice plants comprising the grain of the present invention, the polypeptide of the present invention, the polynucleotide of the present invention, the nucleic acid construct of the present invention and / or vector, or the cell of the present invention. In an embodiment, the rice plant is each.

[0075] Additionally, a population of at least 100 or at least 1,000 rice plants of the present invention growing in farmland is provided. In a preferred embodiment, the rice plants in the farmland are mostly (more than 50%), preferably all, of the rice plants of the present invention. In the most preferred embodiment, at least 100 or at least 1,000 rice plants are genetically and / or phenotypically identical and contain, for example, the same genetic variant.

[0076] In another aspect, the present invention provides a method for producing cells of the present invention, the method comprising the step of introducing an exogenous polynucleotide of the present invention or a nucleic acid construct and / or vector of the present invention into a cell, preferably a rice cell.

[0077] In a further aspect, the present invention provides a method for producing a rice plant of the present invention or a genetically modified grain derived therefrom, the method comprising the following steps:

[0078] i) a step of introducing the exogenous polynucleotide of the present invention, or the nucleic acid construct and / or vector of the present invention into rice cells,

[0079] ii) a step of obtaining a genetically modified rice plant from the cells obtained from step i), wherein the genetically modified rice plant is genetically modified for an exogenous polynucleotide, nucleic acid construct or vector or a part thereof, step, and

[0080] iii) a step of optionally harvesting grains from the plant of step ii), wherein the grains are genetically modified for an exogenous polynucleotide, nucleic acid construct, or vector, step, and

[0081] iv) a step of producing one or more generations of genetically modified offspring plants from randomly genetically modified grains, wherein the offspring plants are genetically modified for an exogenous polynucleotide, nucleic acid construct, or vector;

[0082] By this, rice plants or genetically modified grains are produced.

[0083] In another aspect, the present invention provides a rice plant of the present invention or a method for producing grains therefrom, the method comprising the following steps:

[0084] i) In rice cells, endogenous ROS1a Mutated by introducing a gene mutation ROS1a A step in which the gene encodes the ROS1a polypeptide of the present invention, or does not encode the ROS1a polypeptide,

[0085] ii) A step of obtaining rice plants from the cells obtained from step i), wherein the rice plants are endogenous ROS1a Steps including gene mutations, and

[0086] iii) A step of harvesting grains from the plant of step ii) at random, wherein the grains are endogenous ROS1a Steps including gene mutations, and

[0087] iv) A stage of producing one or more generations of offspring plants from a grain at will, wherein the offspring plants are endogenous ROS1a Step including a mutation in a gene;

[0088] Rice plants or grains are produced by this.

[0089] In an embodiment, the rice plant or grain has DNA glycosylase activity. ROS1a At least one type encoding a polypeptide ROS1a It includes genes.

[0090] In a further aspect, the present invention provides a method for selecting a rice plant or rice grain of the present invention, the method comprising the following steps:

[0091] i) for the production of the grains of the present invention or ROS1a For the presence of a mutation within a gene or the presence of the rice grain of the present invention, the step of selecting a population of rice plants or grains obtained from mutagenic treatment of ancestral rice cells, grains, or plants, respectively; and

[0092] ii) Produce the grains of the present invention from the population of step (i) or mutants ROS1a A step of selecting a rice plant containing a gene, or a rice grain of step (i) which is a rice grain of the present invention;

[0093] Rice plants or grains are selected based on this.

[0094] The method comprises the steps of producing one or more offspring plants or grains, or at least two generations of offspring plants, from a selected rice plant and / or harvesting grains from the offspring plants. Preferably, the offspring plants are homozygous for the genetic variation.

[0095] In a further aspect, the present invention provides a method for selecting a rice plant of the present invention, the method comprising the following steps:

[0096] i) A stage of producing one or more offspring plants from a rice grain, wherein the rice grain is derived from the crossbreeding of two parent rice plants,

[0097] ii) a step of selecting one or more offspring plants from step i) for the production of the grains of the present invention, and

[0098] iii) A step of selecting offspring plants that produce grains;

[0099] Rice plants are selected by this. In a preferred embodiment, the rice grain is a black rice grain.

[0100] In an embodiment, the screening step i) or step ii) comprises one or more or all of the following steps:

[0101] i) a step of analyzing a sample containing DNA from a progeny plant for genetic variation,

[0102] ii) a step of analyzing the thickness of the aleurone of the grains obtained from the offspring plants, and

[0103] iii) A step of analyzing the nutrient content of the grain or a part thereof.

[0104] Preferably, the gene variant is an introduced gene variant.

[0105] In an embodiment, step iii) comprises one or more or all of the following steps:

[0106] i) a step of selecting offspring plants homozygous with respect to a gene mutation, wherein the gene mutation reduces DNA glycosylase activity in rice plants compared to the corresponding wild-type rice plants,

[0107] ii) A step of selecting offspring plants having increased aleurone thickness compared to the corresponding wild-type grain,

[0108] iii) A step of selecting offspring plants having a modified nutrient content compared to the corresponding wild-type grain or part thereof.

[0109] In additional embodiments, the method further comprises the following steps:

[0110] i) a step of crossbreeding two parent rice plants, wherein preferably one of the parent rice plants produces the grain of the present invention, or

[0111] ii) a step of backcrossing one or more offspring plants from step i) with a plant having the same genotype as a first parent rice plant that does not produce the grains of the present invention a sufficient number of times to produce a plant that has most of the genotype of the first parent rice plant but produces the grains of the present invention, and

[0112] iii) A step of selecting a progeny plant that produces grains according to the present invention.

[0113] In addition, rice plants and rice grains produced using the method of the present invention, and products derived therefrom are provided.

[0114] Additionally, uses of the exogenous polynucleotide of the present invention, or the nucleic acid construct and / or vector of the present invention are provided for producing recombinant cells, genetically modified rice plants, or genetically modified grains.

[0115] In an embodiment, the use is to manufacture the rice grains of the present invention.

[0116] In a further aspect, the present invention provides a method for identifying a rice plant that produces grains according to the present invention, the method comprising the following steps:

[0117] i) a step of obtaining a nucleic acid sample from a rice plant, and

[0118] ii) In plants compared to the corresponding wild-type rice plant ROS1aA step of screening samples for the presence or absence of gene variants that reduce gene activity.

[0119] In an embodiment, the gene variation is one or both of the following:

[0120] a) When present in rice plants ROS1a A nucleic acid construct expressing a polynucleotide that reduces gene expression, or a polynucleotide encoded by the same, and

[0121] b) Reduced ROS1a mutants with polypeptide activity ROS1a A gene expressing a polypeptide, or mRNA encoded by it.

[0122] In an embodiment, the presence of a gene mutation indicates that the plant grain has a thickened egg white compared to the corresponding plant without the gene mutation(s).

[0123] In another aspect, the present invention provides a method for identifying a rice plant that produces grains according to the present invention, the method comprising the following steps:

[0124] i) a step of obtaining grains from a rice plant, and

[0125] ii) A step of sorting the grain or a portion thereof for one of the following:

[0126] a) Thickened white pigment,

[0127] b) from the grain ROS1a Amount and / or activity of polypeptide, and

[0128] c) from the grain ROS1a The amount of mRNA encoded by a gene.

[0129] In an embodiment, the method identifies the rice plant of the present invention.

[0130] In another aspect, the present invention provides a method for producing a rice plant part, preferably a grain, the method comprising the following steps:

[0131] a) a step of growing the rice plants of the present invention, or at least 100 of such rice plants, in farmland, and

[0132] b) A step of harvesting a part of a rice plant or a rice plant from a rice plant.

[0133] In a further aspect, the present invention provides a method for producing rice flour, bran, whole wheat, malt, starch, or oil obtained from grains, the method comprising the following steps;

[0134] a) a step of obtaining grains of the present invention, and

[0135] b) A step of processing grains to produce flour, bran, whole wheat, malt, starch, or oil.

[0136] In another aspect, the present invention provides a grain of the present invention, or a rice plant of the present invention, or a product produced from a part of said grain or rice plant.

[0137] In an embodiment, the product ROS1a It includes one or more or all of a gene, a gene variant (preferably an introduced gene variant), an exogenous nucleic acid construct, and a thickened aleurone.

[0138] In the embodiment, the part is rice bran.

[0139] In embodiments, the product is a food ingredient, a beverage ingredient, a food or beverage product. Examples include, but are not limited to, the following:

[0140] i) Food ingredients or beverage ingredients are selected from the group consisting of whole wheat, flour, bran, starch, malt, and oil, or

[0141] ii) Food products are selected from the group consisting of fermented or unfermented bread, pasta, noodles, animal feed, breakfast cereals, snack foods, cakes, pastries, and foods containing flour-based sauces, or

[0142] iii) The beverage product is a packaged beverage or a beverage containing ethanol.

[0143] In a further aspect, the present invention provides a method for producing a food or beverage ingredient of the present invention, the method comprising the step of processing a grain or bran, flour, whole wheat, malt, starch, or oil from a grain of the present invention to produce a food or beverage ingredient.

[0144] In another aspect, the present invention provides a method for manufacturing a food or beverage product of the present invention, the method comprising the step of mixing the grain of the present invention, or bran, flour, whole wheat, malt, starch, or oil derived from the grain, with another food or beverage ingredient. Preferably, the weight of the grain, bran, flour, whole wheat, malt, starch, or oil used in the method is at least 10% by weight of the food product.

[0145] In addition, uses of the grain or part thereof of the present invention, or the rice plant or part thereof of the present invention, are provided for use as animal feed or food, or for manufacturing food for animal consumption or human consumption.

[0146] In a further aspect, the present invention provides a composition comprising one or more of the polypeptide of the present invention, the polynucleotide of the present invention, the nucleic acid construct and / or vector of the present invention, or the cell of the present invention, and one or more acceptable carriers.

[0147] Any embodiment in this specification may be applied to any other embodiment with only minor modifications to the necessary parts, unless specifically stated otherwise.

[0148] The scope of the present invention is not limited by the specific embodiments described herein, which are intended merely for illustrative purposes. Functionally equivalent products, compositions, and methods are clearly included within the scope of the present invention as described herein.

[0149] Throughout this specification, unless otherwise specifically stated or the context otherwise requires, a single step, composition of a material, group of steps, or group of compositions of a material may include one and a plurality (i.e., one or more) of these steps, compositions of a material, group of steps, or group of compositions of a material.

[0150] The present invention is described below by the following non-limiting examples and with reference to the accompanying drawings. Brief explanation of the drawing

[0151] 도 1. ta2 Schematic diagram of map-based gene cloning. The numbers below each line indicate markers and ta2 Indicates the number of recombinations in the mapping population, representing recombination between genes. The solid line on the third line represents the extent of the coding region on the rice chromosome. The solid line on the fourth line represents the protein coding region within the gene; the line in between represents introns (Intron 1 is located within the 5'UTR and is not shown here). The asterisk indicates within Intron 14 at position Chr1: 6451738, with reference to the rice genome sequence. ta2 It indicates the location of the mutation. 도 2. Nucleotide sequences of DNA corresponding to mRNA obtained from developing grains of the wild type (WT) and developing grains of the ta2 genotype. Dash symbols in two of the WT and ta2 sequences indicate the absence of nucleotides. Most of the ta2 mRNA had 21 nucleotide insertions. The wild type sequence is SEQ NO. 10, and the mutant sequence is SEQ NO. 11. 도 3.Predicted amino acid sequences from cDNA corresponding to mRNA obtained from a developing grain of wild type (top amino acid sequence, SEQ NO. 12) and a developing grain of ta2 (bottom sequence, SEQ NO. 13). The dash symbol in the WT sequence indicates the absence of an amino acid corresponding to a 7-amino acid insertion (CSNVMRQ; SEQ NO. 14) within the ta2 polypeptide. An asterisk below the sequence indicates that the same amino acid was present in the wild-type polypeptide and mutant polypeptide at these positions. 도 4 . Arabidopsis DME (NM001085058.1), Arabidopsis ROS1a (NM129207.4) and rice ROS1a Amino acid sequence alignment of homologues. Asterisks below the alignment indicate conserved amino acid positions in all three polypeptides. Double dots indicate completely conserved amino acid changes, while single dots indicate partially conserved amino acid changes. 도 5. Arabidopsis ROS1a (NM129207.4) and rice ROS1a Amino acid sequence alignment of homologues. Asterisks below the alignment indicate conserved amino acid positions in all three polypeptides. Double dots indicate completely conserved amino acid changes, while single dots indicate partially conserved amino acid changes. 도 6. Real-time RT-PCR results showing the relative expression of the rice TA2 gene in multiple tissues. 주요 서열 목록 Sequence No. 1 - Rice ROS1a Mutant (Ta2) polypeptide. Sequence No. 2 - Wild-type rice ROS1a polypeptide Sequence No. 3 - Wild-type rice ROS1b polypeptide. Sequence No. 4 - Wild-type rice ROS1c polypeptide. Sequence No. 5 - Wild-type rice ROS1d polypeptide. Sequence No. 6 - Arabidopsis demeter polypeptide. Sequence No. 7 - Rice ROS1a Full-length cDNA encoding the mutant (Ta2) polypeptide. The open reading frame spans from nucleotides 341 to 6220. Sequence No. 8 - Rice ROS1a Full-length cDNA encoding a polypeptide. The open reading frame spans from nucleotides 341 to 6199. Sequence No. 9 - Rice ROS1a Gene. Promoter and 5'UTR: nucleotides 1-4726, translation start codons ATG 4727-4729; translation stop codons TAG 15867-15869; 3'-UTR from 15870-16484, downstream of the gene from 16485-16885. Nucleotide positions of introns are as follows: Intron 1, 7494-7724; 2, 7816-7909; 3, 9426-9571; 4, 9652-10452; 5, 10538-10628; 6, 10721-10795; 7, 10865-10951; 8, 10989-11069; 9, 11153-11834; 10, 12282-12385; 11, 12423-12508; 12, 12567-12650; 13, 12791-13017; 14, 13084-13201; 15, 13317-14668; 16, 14708-15732.-11006. The sequence contains 401 nucleotides at the 3' end that do not form part of the gene. Sequence No. 10 - Partially wild-type rice provided in FIG. 2 ROS1a cDNA sequence. Sequence No. 11 - Partial mutant (Ta2) rice provided in Fig. 2 ROS1a cDNA sequence. Sequence No. 12 - Partially wild-type rice provided in Fig. 3 ROS1a Protein sequence. Sequence No. 13 - Partial mutant (Ta2) rice provided in Fig. 3 ROS1aProtein sequence. Sequence No. 14 - When compared to the wild type (Sequence No. 2) ROS1a Additional amino acids in mutant (Ta2) polypeptide. SEQ ID NOs 15 to 43 - Oligonucleotide primers. Sequence Nos. 44 to 49 - Wild-type rice ROS1a A highly conserved amino acid motif within the glycosylase domain of a polypeptide. Sequence No. 50 - Arabidopsis ROS1a polypeptide Specific details for implementing the invention

[0152] 일반적인 기술 및 정의

[0153] Unless otherwise specifically defined, all technical and scientific terms used herein shall be understood to have the same meaning as generally understood by a person skilled in the relevant technical field (e.g., cell culture, molecular genetics, plant molecular biology, protein chemistry, and biochemistry).

[0154] Unless otherwise indicated, the recombinant proteins, cell cultures, and immunological techniques used in the present invention are standard procedures widely known to those skilled in the art. These techniques are based on the literature of sources, e.g., J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984); J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989); TA Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991); DM Glover and BD Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996); and FM Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. It is described and explained in the entirety of Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0155] The term "and / or," for example, "X and / or Y," should be understood to mean either "X and Y" or "X or Y," and should be understood as providing clear support for both meanings or either one of them.

[0156] As used herein, the term “about” refers to + / - 10%, more preferably + / - 5%, more preferably + / - 2.5%, and even more preferably + / - 1% of the stated value, unless otherwise stated. The term “about” includes the actual stated value.

[0157] Throughout this specification, the word “comprising,” or variations such as “comprising” or “comprising,” shall be understood to mean the inclusion of the mentioned element, integer or step, or group of element, integer or step, and shall not exclude any other element, integer or step, or group of element, integer or step.

[0158] 선택된 정의

[0159] The terms “aleurone” and “aleurone layer” are used interchangeably herein. The aleurone layer is the outermost layer of the endosperm of a rice grain, distinct from the inner starchy endosperm, and surrounds the starchy endosperm and the husk. Thus, the cells constituting the aleurone layer are the outermost cells of the endosperm, that is, the starchy components of the grain. Although it is technically part of the endosperm, sometimes referred to as the peripheral endosperm, aleurone is considered part of the bran from a practical standpoint because it is removed along with the bran's pericarp and seed coat. Unlike the cells of the starchy endosperm, aleurone cells survive at grain maturity. The aleurone layer is an important part of the nutritional value of the rice grain, containing minerals, vitamins such as vitamins A and B complex, phytochemicals, and fiber.

[0160] Embodiments of the present invention relate at least partially to varying numbers of "cell layers," because the cell layers observed at any single point in any cross-section of the grain of the present invention, or at any single point within the cross-section or between cross-sections, may vary to some extent. More specifically, for example, aleurone having seven cell layers may not have seven layers surrounding the entire inner starchy endosperm, but may have seven layers surrounding at least half of the inner starchy endosperm.

[0161] The term "thickened" is a relative term used when comparing the grain of the present invention to a corresponding wild-type grain when used in relation to the aleurone of the grain of the present invention. The aleurone of the grain of the present invention has an increased number of cells and / or an increased number of cell layers when compared to the aleurone of the corresponding wild-type grain. By this, the thickness of the aleurone is increased as measured in millimeters. In an embodiment, the thickness is increased by at least 50%, preferably at least 100%, and may be increased by as much as 500% or 600%, each percentage is understood to be an average increase over the ventral side of the grain, preferably over the entire grain. In an embodiment, the thickness of the aleurone layer is determined across the entire cross-section of the grain. In an embodiment, the thickness of the aleurone is determined by analysis at least on the ventral side of the grain. In another embodiment, the thickened aleurone of the grain of the present invention comprises cells of various sizes and irregular orientations compared to those of the corresponding wild-type grain, which generally have regularly oriented rectangular cells.

[0162] 폴리펩타이드

[0163] As used herein, the term "ROS1 polypeptide" refers to a member of the protein family of DNA glycosylase-related molecules associated with the amino acid sequences of SEQ ID NOs. 1 to 5, in that it is at least 95% identical to one or more of the amino acid sequences presented in SEQ ID NOs. 1 to 5. The ROS1 polypeptide is of wild-type rice (including naturally occurring variants and mutant forms thereof). ROS1a , ROS1b, ROS1c and ROS1d It includes polypeptides. ROS1 The polypeptide includes such polypeptides found in wild-type rice plants, as well as variants thereof found in either Indica rice plants or Japonica rice plants, which are artificially produced or found in nature, and which have or do not have DNA glycosylase activity, including ROS1 polypeptides having a reduced level compared to the corresponding wild-type ROS1 polypeptide. Examples of ROS1 polypeptides of wild-type rice plants include those having the amino acid sequence presented in any one of SEQ ID NOs 2 to 5, as well as variant polypeptides having an amino acid sequence that is at least 95%, at least 97%, or preferably at least 99% identical to one or more of the amino acid sequences presented in SEQ ID NOs 2 to 5, and those found in nature. As used herein, the ROS1 polypeptide does not contain the Demeter (DME) polypeptide, which is an related DNA glycosylase family that is much less identical to SEQ ID NOs 1 to 5 in amino acid sequence than 95%.

[0164] As used in this specification, the term " ROS1a"Polypeptide" means a DNA glycosylase-related molecule whose amino acid sequence is at least 95% identical to SEQ ID NO. 2, preferably at least 97% identical, or more preferably at least 99% identical to SEQ ID NO. 2. ROS1a The polypeptides include polypeptides found in wild-type rice plants, as well as variants thereof that are artificially produced or found in nature, and may or may not have DNA glycosylase activity, provided that they have the required level of amino acid sequence identity with respect to SEQ ID NO. 2. For example, the sequence provided as SEQ ID NO. 1 ROS1a Although polypeptides are thought not to possess DNA glycosylase activity, they are as defined herein ROS1a It is a polypeptide. In a preferred embodiment, ROS1a The polypeptide has some degree of DNA glycosylase activity, but the amino acid sequence is the wild type provided as SEQ ID NO. 2. ROS1a It is a reduced level compared to polypeptides. For example, Table 3 shows that which are thought to have reduced DNA glycosylase activity ROS1a List the mutant polypeptides.

[0165] A person of ordinary skill in the art, for example, 인실리코 Using phylogenetic and protein alignment, from other structurally related proteins, e.g., other ROS1 polypeptides, specifically ROS1b, ROS1c and ROS1d From polypeptides, ROS1a Known techniques can be readily used to distinguish polypeptides. Therefore ROS1a Polypeptides are based solely on structural features. ROS1a It can be identified as a polypeptide. For example, please refer to FIG. 4 and 5 of this specification. The present invention ROS1a Polypeptides may or may not have DNA glycosylase activity, or are wild-type ROS1aCompared to polypeptides having the amino acid sequence presented in SEQ ID NO. 2, it may have reduced DNA glycosylase activity.

[0166] As used herein, the term "sequence corresponding wild type" ROS1a The phrase "different from, or similar to, the amino acid sequence of the polypeptide" of the present invention ROS1a It is a comparative term indicating that the amino acid sequence of a polypeptide differs from the amino acid sequence of the most closely related protein from which it originated or exists in nature. In an embodiment, ROS1a The amino acid sequence of the polypeptide has one or more insertions, deletions, or amino acid substitutions (or combinations thereof) compared to the corresponding wild-type amino acid sequence. ROS1a The polypeptide is the corresponding wild type ROS1a It may have 2, 3, 4, 5, or 6 to 10 amino acid substitutions compared to the polypeptide. In a preferred embodiment, ROS1a The polypeptide has only a single insertion, a single deletion, or a single amino acid substitution compared to the corresponding wild-type polypeptide. In this context, "single insertion" and "single deletion" involve the insertion or deletion of multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) adjacent amino acids, respectively, and "corresponding wild-type polypeptide" means the wild-type polypeptide that is the natural polypeptide from which the variant is derived and / or to which the variant is most closely related. ROS1a Polypeptides, for example, are of the wild type from which they originated. ROS1a Proteins containing an early translation stop codon within their open reading frame compared to genes ROS1a Fractured that can be encoded by genes ROS1a It may be a polypeptide, or ROS1a The polypeptide is the full length, that is, the corresponding wild type ROS1aIt may have the same number of amino acid residues as the polypeptide. Naturally occurring (wild type) ROS1a An example of a polypeptide is one whose amino acid sequence is presented at SEQ ID NO. 2, and which is a variant having only a single insertion, deletion, or amino acid substitution. ROS1a Examples of polypeptides are provided in Sequence No. 1 and Table 3.

[0167] As used herein, the term “DNA glycosylase activity” refers to an enzyme involved in base excision repair (classified under EC number EC 3.2.2). This enzyme typically also possesses DNA lyase activity, wherein DNA bases are excised and backbone DNA strands are cleaved. In embodiments, “DNA glycosylase activity” relates to active demethylation in which a 5-methylcytosine residue is excised and replaced with unmethylated cytosine, as used in the context of the present invention. In a preferred embodiment, the present invention having DNA glycosylase activity ROS1a The polypeptide has at least five identifiable motifs. One is a helix-hairpin-helix (HhH) motif (e.g., amino acids 1491 to 1515 in SEQ ID NO. 2 or the homologous amino acid sequence). Another is a glycine / proline-rich motif to hold the [4Fe-4S] cluster in place, followed by a conserved aspartic acid (GPD), and four conserved cysteine ​​residues (in the region of amino acids 1582 to 1598 in SEQ ID NO. 2). A lysine-rich domain (e.g., amino acids 87 to 139 in SEQ ID NO. 2 or the homologous amino acid sequence) is also present. Unlike other members of the HhH DNA glycosylase superfamily, ROS1a Polypeptide-family members contain additional divalent conserved domains (domains A and B) flanked to the central glycosylase domain. ROS1aIn polypeptide (SEQ No. 2), domain A occurs at amino acids 859 to 965, the glycosylase domain occurs at amino acids 1403 to 1616, and domain B occurs at amino acids 1659 to 1933. Domain A contains repeating mixed-charge clusters at amino acids 882 to 892. DNA glycosylase activity can be measured using standard techniques known in the art, such as those described in Example 8.

[0168] Wild rice ROS1a The highly conserved amino acid motifs within the glycosylase domain of the polypeptide include DHGSIDLEWLR (SEQ No. 44, amino acids 1467 to 1477 in SEQ No. 2), GLGLKSVECVRLLTLHH (SEQ No. 45, amino acids 1493 to 1509 in SEQ No. 2), AFPVDTNVGRI (SEQ No. 46, amino acids 1511 to 1521 in SEQ No. 2), VRLGWVPLQPLPESLQLHLLE (SEQ No. 47, amino acids 1523 to 1543 in SEQ No. 2), ELHYQMITFGKVFCTKSKPNCN (SEQ No. 48, amino acids 1569 to 1590 in SEQ No. 2) and HFASAFASARLALP (SEQ No. 49, amino acids 1600 to 1613 in SEQ No. 2). One or two amino acid substitutions may or may not occur in these motifs. Other conserved amino acids are wild-type rice ROS1a The amino acid sequence for (SEQ No. 2) of Arabidopsis thaliana (SEQ No. 6) and / or A. thaliana ( A. thaliana ) ROS1a DME from polypeptides can be easily identified by aligning to polypeptides (see Figures 4 and 5). Further guidance on the identification of conserved amino acids can be obtained from the literature [Kapazoglou et al. (2012)].

[0169] As used herein, the term "corresponding wild type" ROS1a "Reducing DNA glycosylase activity compared to polypeptides", "corresponding wild type ROS1a "having reduced DNA glycosylase compared to polypeptides, or preferably not having DNA glycosylase activity," or similar phrases are variants / mutants ROS1a DNA glycosylase activity of a polypeptide is a relative term lower than that of the most closely related protein from which it is derived or exists in nature. For example, as will be recognized by a person skilled in the art, the rice Ta2 mutant (SEQ No. 1) described herein corresponds to the corresponding wild-type rice ROS1a It has reduced DNA glycosylase activity compared to polypeptide (SEQ No. 2). Having reduced DNA glycosylase activity ROS1aOther examples of polypeptides are mutations / variants corresponding to the amino acids described in Table 3 that confer a thickened aleurone phenotype, e.g., substitution of serine at the amino acid position corresponding to amino acid number 156 of SEQ ID NO. 2 with another amino acid, e.g., phenylalanine; substitution of serine at the amino acid position corresponding to amino acid number 214 of SEQ ID NO. 2 with another amino acid, e.g., phenylalanine; substitution of serine at the amino acid position corresponding to amino acid number 1413 of SEQ ID NO. 2 with another amino acid, e.g., asparagine; substitution of alanine at the amino acid position corresponding to amino acid number 441 of SEQ ID NO. 2 with another amino acid, e.g., valine; substitution of serine at the amino acid position corresponding to amino acid number 1357 of SEQ ID NO. 2 with another amino acid, e.g., phenylalanine; substitution of lysine at the amino acid position corresponding to amino acid number 501 of SEQ ID NO. 2 with another amino acid, e.g., serine; and amino acid corresponding to amino acid number 482 of SEQ ID NO. 2. It includes arginine at the site being substituted with another amino acid, e.g., lysine. In a particularly preferred embodiment, the grain has at least some DNA glycosylase activity, preferably some of ROS1a DNA glycosylase activity is present because evidence suggests that the absence of DNA glycosylase activity during egg cell and early seed development is fatal to rice plants. In an embodiment, the grain has DNA glycosylase activity that is about 30% to 98%, or about 40% to 98%, or about 40% to 90%, or about 40% to 85%, or about 40% to 80% lower than that of a grain from a corresponding allogeneic plant without a gene mutation (preferably an introduced gene mutation) that reduces DNA glycosylase activity in the grain.

[0170] "Substantially purified polypeptide" or "purified polypeptide" generally means a polypeptide separated from lipids, nucleic acids, other peptides, and other contaminating molecules associated with the polypeptide in its native state. Preferably, the substantially purified polypeptide is free from at least 90% of other components associated with it in nature. In an embodiment, the polypeptide of the present invention is naturally occurring ROS1a It has an amino acid sequence that is different from the polypeptide, that is, an amino acid sequence variant as defined above.

[0171] The grains, plants, and host cells of the present invention may comprise exogenous polynucleotides encoding the polypeptide of the present invention. In these examples, the grains, plants, and cells produce a recombinant polypeptide. In the context of polypeptides, the term “recombinant” refers to a polypeptide encoded by an exogenous polynucleotide when the polynucleotide is produced by a cell into which the polynucleotide has been introduced by recombinant DNA or RNA technology, e.g., by transformation. Typically, the cell comprises a non-endogenous gene that causes a modified amount of polypeptide to be produced. In an embodiment, the “recombinant polypeptide” is a polypeptide produced by the expression of an exogenous (recombinant) polynucleotide in a plant cell.

[0172] The terms "polypeptide" and "protein" are generally used interchangeably.

[0173] The % identity of the polypeptide is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) using a gap creation penalty of 5 and a gap extension penalty of 0.3. The query sequence is at least 1,000 amino acids long, and the GAP analysis aligns two sequences over a region of at least 1,000 amino acids. More preferably, the query sequence is at least 1,250 amino acids long, and the GAP analysis aligns two sequences over a region of at least 1,250 amino acids. More preferably, the query sequence is at least 1,500 amino acids long, and the GAP analysis aligns two sequences over a region of at least 1,500 amino acids. Even more preferably, the GAP analysis aligns two sequences over its entire length, ROS1a In the case of polypeptides, there are about 1,800 to 2,100 amino acid residues.

[0174] With respect to the defined polypeptide, it will be recognized that a higher percentage identity value than provided above will include a preferred embodiment. Accordingly, where applicable, in light of the minimum percentage identity value, the polypeptide preferably comprises an amino acid sequence that is at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and more preferably at least 99.9% identical to the associated designated sequence number.

[0175] As used herein, the phrase “at the position corresponding to the amino acid number” or variations thereof refers to the relative position of an amino acid compared to a surrounding amino acid. In this regard, in some embodiments, the polypeptide of the present invention may have a substitution mutation or a deletion mutation that alters the relative positioning of amino acids when aligned, for example, with respect to SEQ ID NO. 2. Determining the corresponding amino acid position between two closely related proteins is well within the scope of the ability of a person skilled in the art.

[0176] Amino acid sequence mutants of the polypeptide of the present invention may be produced by introducing appropriate nucleotide changes into the nucleic acid of the present invention or by the in vitro synthesis of the desired polynucleotide. Such mutants include, for example, deletions, insertions, or substitutions of residues within the amino acid sequence. A final peptide product may be reached by combining deletions, insertions, and substitutions, provided that the final peptide product possesses the desired characteristics. Preferred amino acid sequence mutants have only one, two, three, four, or fewer than ten amino acid changes compared to the reference wild-type polypeptide. The mutant polypeptide of the present invention corresponds to the naturally occurring wild-type. ROS1a Reduced when compared to a polypeptide, for example, a polypeptide containing amino acids having the sequence presented in SEQ ID NO. 2. ROS1a It has polypeptide activity.

[0177] Mutant (modified) polypeptides may be prepared using any technique known in the relevant art, for example, using directed evolution or rational design strategies (see below). A product derived from mutated / modified DNA may be easily selected using the techniques described herein to comprise amino acids having the sequence provided in SEQ ID NO. 2. ROS1aThis is reduced when compared to one or more or all of the polypeptides ROS1a It is possible to determine polypeptide activity, e.g., whether it has reduced DNA glycosylase activity. For example, the method comprises the steps of producing a genetically modified plant expressing mutated / altered DNA, and the effect of the mutated / altered DNA on aleurone thickness and ii) ROS1a It may include a step to determine whether the gene has been mutated or altered.

[0178] When designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on the feature(s) to be modified. The mutation site may be modified individually or sequentially, for example, by (1) substitution with a non-conservative amino acid selection, (2) deletion of a target residue, or (3) insertion of another residue adjacent to the site.

[0179] The amino acid sequence deletion is generally in the range of about 1 to 15 residues, more preferably about 1 to 10 residues, and typically about 1 to 5 adjacent residues.

[0180] The substitution mutant has at least one amino acid residue in the removed polypeptide molecule and a different residue inserted therein. It is desirable to perform non-conservative substitutions where it is not desirable to maintain a specific activity or to reduce a specific activity, particularly at amino acid sites that are significantly conserved in the related protein family. Examples of conserved substitutions are shown in Table 1, and thus non-conservative substitutions are not shown in Table 1.

[0181] In an embodiment, the mutant / variant polypeptide has one, two, three, or four amino acid changes compared to the naturally occurring polypeptide. In a preferred embodiment, this change is different from those provided herein. ROS1aIt exists among polypeptides, particularly within known conserved structural domains, within one or more of highly conserved motifs. As a person skilled in the art would recognize, it can be reasonably predicted that such changes alter the activity of the polypeptide when expressed in cells.

[0182] Variants / mutants thereof can be designed using the primary amino acid sequence of the polypeptide of the present invention based on comparison with closely related enzymes, particularly DNA glycosylases. As will be recognized by a person skilled in the art, among closely related proteins, highly conserved residues are more likely to be altered by particularly non-conserved substitutions and have reduced activity than less conserved residues (see above).

[0183]

[0184] Within the scope of the present invention also includes polypeptides of the present invention that can be separately modified after synthesis, for example, by post-translational modification in cells, for example by phosphorylation, which can regulate activity.

[0185] Polynucleotides and Genes

[0186] The present invention refers to various polynucleotides. As used herein, “polynucleotide,” “nucleic acid,” or “nucleic acid molecule” means a polymer of nucleotides, which may be DNA or RNA and include genomic DNA, mRNA, cRNA, dsRNA, and cDNA. It may be DNA or RNA of synthetic origin produced in cells, genomes, or, for example, on an automated synthesizer, and may be combined with carbohydrates, lipids, proteins, or other materials labeled with fluorescent or other groups or attached to a solid support to perform specific activities defined herein, or it may include one or more modified nucleotides not found in nature that are widely known to those skilled in the art. The polymer may be single-stranded, essentially double-stranded, or partially double-stranded. Base pairing refers to standard base pairings between nucleotides, including G:U base pairs, as used herein. "Complementarity" means that two polynucleotides can pair (hybridize) bases along a portion of their length or along the full length of one or both. "Hybridized polynucleotide" means that the polynucleotide is actually paired with its complement. The term "polynucleotide" is used interchangeably with the term "nucleic acid" in this specification. A preferred polynucleotide of the present invention encodes the polypeptide of the present invention.

[0187] "Isolated polynucleotide" generally refers to a polynucleotide separated from a polynucleotide sequence that is linked or linked in its native state (where the polynucleotide is found in nature). Preferably, when the isolated polynucleotide is found in nature, at least 90% of its naturally linked components are absent. Preferably, the polynucleotide does not occur in nature, for example, by covalently linking two shorter polynucleotide sequences in a manner not found in nature (chimeric polynucleotide).

[0188] The present invention includes the reduction of gene activity and the construction and use of chimeric genes. As used herein, the term “gene” includes any deoxyribonucleotide sequence that includes a protein-coding region or is transcribed in a cell but not translated, as well as associated non-coding regions and regulatory regions. These associated regions are typically located adjacent to the coding or transcribed region on both the 5’ end and the 3’ end for a distance of about 2 kb on one of the two ends. In this regard, the gene may include a control signal naturally associated with the given gene, such as a promoter, enhancer, termination and / or polyadenylation signal, or a heterogeneous control signal (in which case the gene is referred to as a “chimeric gene”). A sequence located at the 5’ end of the coding region and present on the mRNA is referred to as the 5’ untranslated sequence. A sequence located at or downstream of the coding region and present on the mRNA is referred to as the 3’ untranslated sequence. The term “gene” includes both cDNA and the genomic form of the gene.

[0189] "Allele" refers to a specific form of a gene sequence (e.g., a gene) within a cell, individual plant, or population, which differs from the rest of the same gene in the sequence of at least one, and often more than one, variant region within the gene sequence. The sequences in these variant regions that differ between different alleles are referred to as "variance" or "polymorphism." "Polymorphism" refers to a variation in the nucleotide sequence between alleles at the gene locus of the present invention, of different species, varieties, or individuals of plants as used herein. "Polymorphic site" is a predetermined nucleotide site within the gene sequence where a sequence difference occurs. In some cases, gene polymorphism causes a variation in the amino acid sequence within the polypeptide encoded by the gene, and thus the polymorphic site may cause the location of the polymorphism in the amino acid sequence at a predetermined site within the polypeptide sequence. In other examples, polymorphic regions may exist within non-polypeptides encoding regions of a gene, or within promoter regions, thereby affecting the expression levels of the gene. Typical polymorphisms are deletions, insertions, or substitutions. These may include a single nucleotide (single nucleotide polymorphism or SNP) or two or more nucleotides.

[0190] As used herein, "mutation" is a polymorphism that produces a phenotypic change in a plant or a part thereof. As known in the art, some polymorphisms are silent, meaning they are single nucleotide changes in protein-coding regions that do not alter the amino acid sequence of the encoded polypeptide due to duplication of the genetic code. Diploid plants will typically have one or two different alleles of a single gene, but will have only one if both copies of the gene are identical—that is, if the plant is homozygous for the allele. Polyploid plants generally have more than one homoeolog of any particular gene. For example, hexaploid wheat has three subgenomes (usually referred to as "genomes") labeled as genomes A, B, and D, and thus has three homoeologs of most of its genes, one for each of the A, B, and D genomes.

[0191] Term " ROS1a encoding a polypeptide ROS1a "Gene" or " ROS1a "Gene" as used herein and as defined herein ROS1a It refers to a nucleotide sequence that encodes a polypeptide. ROS1a The gene may be an endogenous, naturally occurring gene, or comprises a gene variant as defined herein (preferably an introduced gene variant). In the grain of the present invention ROS1a encoding a polypeptide ROS1a Genes may or may not have introns. In one example, the grain of the present invention is derived from rice, and ROS1a At least one allele of the gene is from a corresponding wild-type rice plant (e.g., comprising a sequence of amino acids as provided in SEQ ID NO. 2). ROS1a Having reduced DNA glycosylase activity compared to polypeptides ROS1aIt encodes a polypeptide. These having reduced DNA glycosylase activity ROS1a An example of a polypeptide is the rice Ta2 mutant (sequence number 1).

[0192] As used in this specification, phrase "or" ROS1a "Gene inactivation" or " ROS1a "Decrease in gene expression" or modification thereof is functional ROS1a It refers to any genetic variant that (partially) reduces or completely prevents the expression of a gene encoding a polypeptide. Such genetic variants are, for example, ROS1a It includes mutations in the promoter region of a gene that reduce the transcription of the gene to be transcribed by using gene editing to delete or substitute nucleotides from the promoter of the gene, or intron splicing mutations that form mRNA by changing the amount or location of splicing.

[0193] A genomic form or clone of a gene containing a transcribed region may be interrupted by a non-coding sequence referred to as an "intron," "intermediate region," or "intermediate sequence," which may be homologous or heterologous with respect to the gene's "exon." An "intron" is a segment of a gene that is transcribed as part of a primary RNA transcript as used herein but is not present in a mature mRNA molecule. The intron is removed or "spliced ​​out" from the nucleus or primary transcript; thus, the intron is not present in the messenger RNA (mRNA). An "exon" refers to a DNA region corresponding to an RNA sequence present in a mature mRNA or mature RNA molecule (where the RNA molecule is not translated) as used herein. mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term "gene" comprises a synthetic or fusion molecule encoding all or part of the protein of the present invention as described herein and a nucleotide sequence complementary to any one of the above. Genes can be introduced into a suitable vector for extrachromosomal maintenance in cells or into the host genome for integration.

[0194] As used herein, "chimeric gene" refers to any gene comprising a covalent sequence not found combined in nature. Typically, a chimeric gene comprises a regulatory sequence and a transcribed sequence or protein coding sequence not found together in nature. Thus, a chimeric gene may comprise a regulatory sequence and a coding sequence derived from different origins, or a regulatory sequence and a coding sequence derived from the same origin but aligned in a manner different from that found in nature. In embodiments, ROS1a The protein-coding region of a gene is ROS1aIt is operably linked to a heterologous promoter or polyadenylation / terminator region for the gene, thereby forming a chimeric gene. In an alternative embodiment, when present in a rice plant grain, from the grain ROS1a A gene encoding a polynucleotide that downregulates the production and / or activity of a polypeptide is operably linked to a promoter or polyadenylation / terminator region that is heterogeneous to the polynucleotide, thereby forming a chimeric gene.

[0195] The term “endogenous” is used herein to refer to a substance that is generally present or produced in unmodified plants at the same developmental stage as the plant at the time of investigation. “Endogenous gene” refers to a native gene at its original location within the organism’s genome. As used herein, “recombinant nucleic acid molecule,” “recombinant polynucleotide,” or a modification thereof refers to a nucleic acid molecule produced or modified by recombinant DNA technology. The terms “external polynucleotide,” “exogenous polynucleotide,” “heterogeneous polynucleotide,” etc., refer to any nucleic acid introduced into the genome of a cell by experimental modification.

[0196] External or exogenous genes may be genes inserted into a non-native organism, genes introduced into a new location within a native host, or chimeric genes. "Transplanted genes" are genes introduced into the genome by a transformation procedure. The term "genetically modified" includes introducing a gene into a cell by transformation or transduction, mutating a gene in a cell, and altering or adjusting the regulation of the gene in the cell or organism or its offspring on which it acts.

[0197] Additionally, in the context of polynucleotides (nucleic acids), the term “exogenous” refers to polynucleotides within a cell that, where present, do not contain polynucleotides in nature. The cell may be a non-endogenous polynucleotide that causes the production of a modified amount of the encoded polypeptide, for example, a cell containing an exogenous polynucleotide that increases the expression of the endogenous polypeptide, or a cell that does not produce the polypeptide in its native state. Increased production of the polypeptide of the present invention is also referred to herein as “overexpression.” The exogenous polynucleotides of the present invention include polynucleotides that are not isolated from other components of a genetically modified (recombinant) cell or from a cell-free expression system in which they exist, and polynucleotides produced in such cells or a cell-free system purified from at least some other components. The exogenous polynucleotide (nucleic acid) may be an adjacent stretch of nucleotides existing in nature, or comprises two or more adjacent stretches of nucleotides from different sources (naturally occurring and / or synthetic) combined to form a single polynucleotide. Typically, such chimeric polynucleotides comprise at least an open reading frame encoding the polypeptide of the present invention, which is operably linked to a promoter suitable for inducing transcription of the open reading frame in a cell of interest.

[0198] The % identity of the polynucleotides is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) using a gap generation penalty of 5 and a gap extension penalty of 0.3. The query sequence is at least 3,000 nucleotides long, and the GAP analysis aligns two sequences over a region of at least 3,000 nucleotides. More preferably, the query sequence is at least 3,750 nucleotides long, and the GAP analysis aligns two sequences over a region of at least 3,750 nucleotides. More preferably, the query sequence is at least 4,500 nucleotides long, and the GAP analysis aligns two sequences over a region of at least 4,500 nucleotides. More preferably, the GAP analysis aligns two sequences over its entire length.

[0199] With respect to the defined polynucleotide, it will be recognized that a higher percentage identity value than provided above will include preferred embodiments. Accordingly, where applicable, in light of the minimum percentage identity value, the polynucleotide preferably comprises a nucleotide sequence that is at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and more preferably at least 99.9% identical to the associated designated sequence number.

[0200] The present invention also relates to the use of oligonucleotides, for example, in a method for selecting polynucleotides encoding the polynucleotides of the present invention or the polypeptides of the present invention. As used herein, "oligonucleotide" is a polynucleotide of up to 50 nucleotides in length. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on the nucleic acid molecule of the present invention. This may be RNA, DNA, or a combination or derivative thereof. Typically, oligonucleotides are relatively short single-stranded molecules of 10 to 30 nucleotides, generally 15 to 25 nucleotides in length. When used as a probe or primer in an amplification reaction, the minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on a target nucleic acid molecule. Preferably, the oligonucleotide is at least 15 nucleotides long, more preferably at least 18 nucleotides, more preferably at least 19 nucleotides, more preferably at least 20 nucleotides, and even more preferably at least 25 nucleotides. The oligonucleotide of the present invention used as a probe is typically conjugated with a label, e.g., a radiolabel, an enzyme, biotin, a fluorescent molecule, or a chemiluminescent molecule.

[0201] The present invention comprises oligonucleotides that can be used, for example, as probes for identifying nucleic acid molecules or as primers for producing nucleic acid molecules. The probes and / or primers may be used to clone homologues of the polynucleotides of the present invention from other species. Additionally, hybridization techniques known in the art may also be used to select genomes or cDNA libraries of such homologues.

[0202] The polynucleotides and oligonucleotides of the present invention comprise hybridizing to one or more of the sequences provided as SEQ ID NO. 1 or 2 under strizent conditions. As used herein, strizent conditions comprise (1) using 0.015 M NaCl / 0.0015 M sodium citrate / 0.1% NaDodSO4 at a low ion concentration and high temperature, e.g., 50°C, for washing; (2) using a denaturant, e.g., formamide, e.g., 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer (pH 6.5) containing 750 mM NaCl, and 50% (vol / vol) formamide containing 75 mM sodium citrate at 42°C during hybridization; Or (3) 50% formamide in 0.2 x SSC and 0.1% SDS at 42°C, 5 x SSC (0.75M NaCl, 0.075M sodium citrate), 50mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50g / ml), 0.1% SDS and 10% dextran sulfate.

[0203] The polynucleotides of the present invention may possess one or more mutations, which are deletions, insertions, or substitutions of nucleotide residues, when compared to naturally occurring molecules. Mutants may occur naturally (i.e., isolated from natural sources) or be synthesized (e.g., by performing site-directed mutagenesis on nucleic acids). Variants of the polynucleotides or oligonucleotides of the present invention may be reference polynucleotide or oligonucleotide molecules defined herein, preferably endogenous ROS1aIt includes molecules of various sizes of the rice genome that are close to that of the gene and / or molecules that can hybridize thereto. For example, the variant may include additional nucleotides (e.g., 1, 2, 3, 4 or more) or fewer nucleotides, as long as it still hybridizes to the target region. Additionally, some nucleotides may be substituted without affecting the ability of the oligonucleotide to hybridize to the target region. Furthermore, a variant that hybridizes, for example, within 50 nucleotides, close to the region of the plant genome where the specific oligonucleotide defined herein hybridizes can be easily designed. In particular, this includes polynucleotides that encode the same polypeptide or amino acid sequence but have different nucleotide sequences due to duplication of the genetic code. The terms "polynucleotide variant" and "variant" also include naturally occurring allelic variants.

[0204] Gene mutation

[0205] As used herein, the term “genetic variation” refers to one or more cells of the grain of the present invention having a genetic variation that can be introduced by humans or can occur naturally in rice plants (e.g., crossed to produce the plant of the present invention), preferably cells in at least one or all of the aleurone, pericarp, nucleus, ovary, seed coat, and starchy endosperm of a developing grain or plant or part thereof.

[0206] As used herein, the term “one or more introduced genetic variations” refers to one or more cells of the grain of the present invention having a genetic variation introduced by a human, preferably cells in at least one or all of the aleurone, pericarp, nucleus, ovary, seed coat, and starchy endosperm of a developing grain or plant or part thereof. In a preferred embodiment, all cells of the grain or plant or part thereof contain the introduced genetic variation. As understood by a person skilled in the art, for example, without limitation ROS1a Nuclear constructs encoding exogenous polynucleotides that reduce gene expression (e.g., dsRNA molecules or microRNA), and wild-types with corresponding amino acid sequences ROS1a wild type that differs from and corresponds to the amino acid sequence of the polypeptide ROS1a Having reduced DNA glycosylase activity compared to polypeptides (preferably having some degree of activity, but may not have any) ROS1a There exist multiple different types of genetic modifications from which nuclear constructs encoding exogenous polynucleotides encoding polypeptides can be produced, and the genome is endogenous ROS1a By gene editing to reduce gene activity, and by introducing mutations, reduced ROS1a Plants that produce grains with polypeptide DNA glycosylation activity are selected and adjusted using tilling.

[0207] As used herein, the term "at least one of" ROS1a "Reduces gene activity" refers to genes expressed by a gene when compared to a corresponding wild-type rice plant, as if it relates to "one or more gene variants" or "one or more introduced gene variants." ROS1aIt refers to a gene variant in which the amount or activity of a polypeptide is reduced. In an embodiment, the grain has at least some DNA glycose activity. ROS1a It includes polypeptides.

[0208] In an embodiment, the gene mutation is non- ROS1a The DNA glycosylase activity of the polypeptides is not downregulated. For example, the gene mutation does not reduce the DNA glycosylase activity of each of the ROS1b, ROS1c, and ROS1d polypeptides in the rice plants of the present invention by more than 10% or 30%. Alternatively, the gene mutation reduces the DNA glycosylase activity of at least one of the ROS1b, ROS1c, and ROS1d polypeptides by at least 30%.

[0209] RNA interference

[0210] RNA interference (RNAi) is particularly useful for specifically reducing gene expression, inducing the reduced production of specific proteins when the gene encodes a protein. While not intended to be limited to theory, the literature [Waterhouse et al. (1998)] provides a model of a mechanism by which protein production can be reduced using dsRNA (duplex RNA). This technique depends on the presence of a dsRNA molecule containing a sequence essentially identical to the mRNA of the gene of interest or a portion thereof. Conveniently, dsRNA can be produced from a single promoter in a recombinant vector or host cell, where the sense and antisense sequences are flanked by an unrelated sequence to form a loop structure, enabling the hybridization of the sense and antisense sequences to form a dsRNA molecule with an unrelated sequence. The design and production of suitable dsRNA molecules, particularly [Waterhouse et al. (1998), Smith et al.] Considering (2000)], international patents WO 99 / 32619, WO 99 / 53050, WO 99 / 49029 and WO 01 / 34815, they are well contained within the capabilities of a person skilled in the art in the relevant technical field.

[0211] In an example, ROS1aDNA is introduced to induce the synthesis of at least partially double-stranded RNA product(s) that are homologous to the gene. Thus, the DNA contains both a sense sequence and an antisense sequence that, when transcribed into RNA, can hybridize to form a double-stranded RNA region. In one embodiment of the present invention, the sense sequence and the antisense sequence are separated by a spacer region containing an intron that is spliced ​​out when transcribed into RNA. This arrangement has been shown to produce higher efficiency of gene silencing (Smith et al., 2000). The double-stranded region may contain one or two RNA molecules transcribed from one or two DNA regions. The presence of the double-stranded molecule is thought to trigger a response from the endogenous system that destroys both the double-stranded RNA and the homologous RNA transcript from the target gene, thereby efficiently reducing or eliminating the activity of the target gene.

[0212] The lengths of the hybridized sense sequence and antisense sequence should each be at least 19 adjacent nucleotides, preferably at least 30 or at least 50 adjacent nucleotides, more preferably at least 100 or at least 200 adjacent nucleotides. Generally, a sequence of 100 to 1,000 nucleotides corresponding to a region of the target gene mRNA is used. A full-length sequence corresponding to the entire gene transcript may be used. The degree of identity of the sense sequence with respect to the target transcript (and thus also the identity of the antisense sequence with respect to the complement of the target transcript) should be at least 85%, at least 90%, or 95 to 100%, and preferably identical to the target sequence. The RNA molecule may include unrelated sequences capable of functioning to stabilize the molecule. The RNA molecule may be expressed under the control of an RNA polymerase II or RNA polymerase III promoter. Examples of the latter include tRNA or snRNA promoters.

[0213] A preferred small interfering RNA ("siRNA") molecule contains a nucleotide sequence identical to about 19 to 25 adjacent nucleotides of the target mRNA. Preferably, the siRNA sequence begins with the dinucleotide AA and contains a GC content of about 30 to 70% (preferably 30 to 60%, more preferably 40 to 60%, more preferably about 45% to 55%), and, for example, when determined by a standard BLAST search, does not have a high percentage identity with any non-target nucleotide sequence within the genome of the organism to be introduced.

[0214] DsRNA useful for the present invention can be easily produced using routine procedures.

[0215] MicroRNA

[0216] MicroRNA (abbreviation miRNA) is a non-coding RNA molecule, typically 19 to 25 nucleotides in length (typically about 20 to 24 nucleotides in plants), derived from a larger precursor that forms an incomplete stem-loop structure. miRNA is typically fully complementary to the region of the target mRNA whose expression is to be reduced, but it does not need to be fully complementary.

[0217] miRNAs bind to complementary sequences on target messenger RNA transcripts (mRNAs), typically causing translation repression or targeted degradation and gene silencing. As is widely known in the relevant technical field, artificial miRNAs (amiRNAs) can be designed based on natural miRNAs to reduce the expression of any gene of interest.

[0218] In plant cells, miRNA precursor molecules are believed to be largely processed in the nucleus. Pri-miRNA (containing one or more localized double-stranded or "hairpin" regions, as well as the conventional 5' "cap" and polyadenylated tail of mRNA) also contains a stem-loop or fold-back structure and is processed into a shorter miRNA precursor molecule referred to as "pre-miRNA." In plants, pre-miRNA is cleaved by distinct DICER-like (DCL) enzymes to yield miRNA:miRNA* duplexes. Before receiving from the nucleus, these duplexes are methylated.

[0219] In the cytoplasm, miRNA strands from miRNA:miRNA duplexes are selectively incorporated into the Active RNA-Induced Silencing Complex (RISC) for target recognition. The RISC complex contains a specific subset of Argonaute proteins that exert sequence-specific gene repression (see, for example, the literature [Millar and Waterhouse, 2005; Pasquinelli et al., 2005; Almeida and Allshire, 2005]).

[0220] MicroRNAs useful for the present invention can be easily produced using routine procedures. For example, ROS1a The design of amiRNA (artificial microRNA) constructs can be based on the general method described in the literature [Fahim et al. (2012)]. Using WMD3 software (www.wmd3.weigelworld.org / ) ROS1a Suitable amiRNA targets can be identified from the gene. AmiRNA targets are selected according to the following four criteria: 1) relative 5' instability caused by using a sequence that is AT-rich at the 5' end and GC-rich at the 3' end; 2) U at site 1 and A at the cleavage site (between sites 10 and 11); 3) maximum mismatches 1 and 4 at sites 1 through 9 and 13 through 21, respectively; and 4) -30 kcal mol when the amiRNA hybridizes to the target RNA -1 It has a predicted free energy (G) of less than (Ossowski et al., 2008). For gene-specific reduction of expression, candidate amiRNA sequences are OsROS1a It is selected from the region exhibiting the lowest homology when aligning all homologs of, and therefore ROS1 It reduces the possibility of off-target reduction of expression of homologues and homoeologs. The rice miR395 precursor (Guddeti et al., 2005; Jones-Rhoades and Bartel, 2004; Kawashima et al., 2009) can be selected as an amiRNA backbone for the insertion of amiRNA sequences. To design and manufacture constructs, five endogenous miRNA targets in miR395 were replaced with five amiRNA targets for TA2 knockdown.

[0221] Cosuppression

[0222] Genes can suppress the expression of related endogenous genes and / or transplant genes already present in the genome, and this phenomenon is referred to as homology-dependent gene silencing. Most examples of homology-dependent gene silencing belong to two categories: those functioning at the transcriptional level of the transplant gene, and those operating post-transcriptionally.

[0223] Post-transcriptional homology-dependent gene silencing (i.e., co-repression) explains the loss of expression of transplant genes and associated endogenous or viral genes in transplanted plants. Co-repression usually occurs when transplant gene transcripts are abundant, though not always, and it is generally thought to be triggered at the level of mRNA processing, localization, and / or degradation. Several models explain how co-repression works (see reference [Taylor, 1997]).

[0224] Co-repression involves introducing an extra copy of a gene or a fragment thereof into a plant in a sense orientation with respect to a promoter for its expression. The size of the sense fragment, its correspondence to the target gene region, and the degree of its sequence identity with respect to the target gene may be determined by a person skilled in the art. In some examples, an extra copy of the gene sequence interferes with the expression of the target plant gene. For methods of implementing the co-repression approach, refer to International Patent No. WO 97 / 20936 and European Patent No. EP 0465572.

[0225] antisense polynucleotide

[0226] The term "antisense polynucleotide" should be understood to mean a DNA or RNA molecule that is complementary to at least a portion of a specific mRNA molecule encoding an endogenous polypeptide and can interfere with post-transcriptional events, such as mRNA translation. The use of antisense methods is widely known in the relevant technical field (see, for example, the literature [G. Hartmann and S. Endres, Manual of Antisense Methodology, Kluwer (1999)]). The use of antisense techniques in plants has been reviewed in the literature [Bourque (1995)] and [Senior (1998)]. The literature [Bourque (1995)] lists numerous examples of the use of antisense sequences in the plant kingdom as a method of gene inactivation. The literature [Bourque] also notes that achieving 100% inhibition of any enzyme activity may not be essential, because partial inhibition is likely to result in measurable changes in that system. The literature [Senior (1998)] states that the antisense method is currently a very widely established technique for regulating gene expression.

[0227] In one embodiment, the antisense polynucleotide hybridizes under physiological conditions, that is, the antisense polynucleotide (which is completely or partially single-stranded) is endogenous in the cell under normal conditions. ROS1a It is possible to form at least double-stranded polynucleotides and mRNA encoding polypeptides.

[0228] The antisense molecule may include a sequence corresponding to a structural gene or a sequence that performs control over gene expression or splicing events. For example, the antisense sequence may correspond to a targeted coding region of an endogenous gene, or to a 5'-untranslated region (UTR), a 3'-UTR, or a combination thereof. It may be partially complementary to an intron sequence, which may be spliced ​​out only to the exon sequence of the target gene during or after transcription, preferably. In terms of the generally greater divergence of UTRs, targeting these regions provides greater specificity for gene inhibition.

[0229] The length of the antisense sequence must be at least 19 adjacent nucleotides, preferably at least 30 or at least 50 nucleotides, more preferably at least 100, 200, 500, or 1000 nucleotides. A full-length sequence complementary to the entire gene transcript may be used. The length is most preferably 100 to 2000 nucleotides. The degree of identity of the antisense sequence with respect to the targeted transcript must be at least 90%, more preferably 95 to 100%, typically 100% identical. The antisense RNA molecule may include unrelated sequences capable of functioning to stabilize the molecule.

[0230] Genome editing using site-specific nucleases

[0231] Genome editing utilizes engineered nucleases composed of sequence-specific DNA binding domains fused to non-specific DNA cutting modules. These chimeric nucleases enable efficient and precise genetic modification by stimulating the cell's endogenous DNA repair mechanisms to induce targeted DNA double-strand breaks that repair induced breaks. These mechanisms include, for example, error-prone non-homologous end joining (NHEJ) and homology-directed repair (HDR).

[0232] In the presence of a donor plasmid having an extended homologous arm, HDR leads to the introduction of one or more transplant genes, which can correct or replace existing genes. In the absence of a donor plasmid, NHEJ-mediated repair generates small insertion or deletion mutations of the target that cause gene interference.

[0233] Engineered nucleases useful in the method of the present invention include zinc finger nucleases (ZFN), transcriptional activator-like (TAL) effector nucleases (TALEN), and CRISPR-Cas9 type site-specific nucleases.

[0234] Typically, nuclease-encoding genes are delivered into cells via plasmid DNA, viral vectors, or mRNA transcribed in vitro. The use of fluorescent surrogate receptor vectors also enriches ZFN-, TALEN-, or CRISPR-modified cells.

[0235] Complex genomes typically contain multiple copies of sequences that are identical or highly homologous to the intended DNA target, potentially leading to off-target activity and cytotoxicity. To address this, structure-based (Miller et al., 2007; Szczepek et al., 2007) and selection-based (Doyon et al., 2011; Guo et al., 2010) approaches can be used to generate improved ZFN and TALEN heteromers with optimized cleavage specificity and reduced toxicity.

[0236] In order to target gene recombination or mutation by a ZFN according to a preferred embodiment of the present invention, two 9-bp zinc finger DNA recognition sequences must be identified in the host DNA. These recognition sites exist in an inverted orientation relative to each other and will be separated from each other by about 6 bp of DNA. Subsequently, a zinc finger combination that specifically binds to DNA at a target locus is designed and produced, and a ZFN is generated by linking the zinc finger to a DNA cutting domain.

[0237] Transcriptional activator-like (TAL) effector nucleases (TALENs) include a TAL effector DNA binding domain and an endonuclease domain.

[0238] TAL effectors are proteins of plant pathogenic bacteria that are injected into plant cells by pathogens, where they translocate to the nucleus and function as transcription factors to stimulate specific plant genes. The primary amino acid sequence of a TAL effector describes the nucleotide sequence to which it binds. Therefore, target sites can be predicted for TAL effectors, and TAL effectors can be manipulated and generated for the purpose of binding to specific nucleotide sequences.

[0239] Fusion to the TAL effector-coding nucleic acid sequence is a sequence encoding a nuclease or part of a nuclease, typically a non-specific cleavage domain from a type II endonuclease, e.g., FokI (Kim et al., 1996). Other useful endonucleases are, for example, Hha I, Hin dIII, Nod , Bbv CI, Eco RI, Bgl I and Alw It may include I. Some endonucleases (e.g., Fok The fact that I) functions only as a dimer can be utilized to enhance the target specificity of the TAL effector. For example, in some cases, each Fok The monomer can be fused to a TAL effector sequence that recognizes different DNA target sequences, and only when two recognition sites are in close proximity do the inactive monomers work together to produce a functional enzyme. By requiring DNA binding to activate the nuclease, highly site-specific restriction enzymes can be produced.

[0240] Sequence-specific TALENs can recognize specific sequences within a pre-selected target nucleotide sequence present in a cell. Thus, in some embodiments, target nucleotide sequences can be scanned against nuclease recognition sites, and specific nucleases can be selected based on the target sequences. In other cases, specific cell sequences can be targeted by manipulating the TALEN.

[0241] nucleic acid composition

[0242] The present invention comprises a nucleic acid construct comprising a polynucleotide of the present invention or a polynucleotide useful for the present invention, a vector and a host cell containing the same, a method for producing and using the same, and uses thereof.

[0243] The present invention relates to operablely linked or connected elements. "Operably linked" or "operably connected," etc., refer to a linkage of polynucleotides in a functional relationship. Typically, operablely linked nucleic acid sequences are connected adjacently and, if necessary, combine two protein coding regions adjacently and into a reading frame. A coding sequence is "operably linked" to another coding sequence when RNA polymerase transcribes the two coding sequences into a single RNA, and then, when translated, it is translated into a single polypeptide having amino acids derived from the two coding sequences. The coding sequence does not need to be adjacent to the remainder, as long as the expressed sequence is ultimately processed to produce the desired protein.

[0244] As used herein, the terms “cis-action sequence,” “cis-action element,” “cis-regulatory region,” “regulatory region,” or similar terms should be understood to mean any sequence of nucleotides which, when appropriately positioned and followed relative to an expressive gene sequence, can at least partially regulate the expression of the gene sequence. A person skilled in the art will recognize that a cis-regulatory region can activate, silence, enhance, inhibit, or otherwise alter the level of expression and / or cell-type specificity and / or developmental specificity of the gene sequence at the transcriptional or post-transcriptional level. In a preferred embodiment of the invention, the cis-action sequence is an activator sequence that enhances or stimulates the expression of an expressive gene sequence.

[0245] "Operatorically connected" a promoter or enhancer to a transcriptional polynucleotide means placing a transcriptional polynucleotide (e.g., a protein-coding polynucleotide or other transcript) under the regulatory control of a promoter, which subsequently controls the transcription of that polynucleotide. When constructing a heterogeneous promoter / structure gene combination, it is generally desirable to place the promoter or a variant thereof at a distance from the transcription start site of the transcriptional polynucleotide that is approximately equal to the distance between the promoter and the protein-coding region it controls in its natural setting, i.e., the gene from which the promoter is derived. As is known in the art, some variants can be accommodated at such a distance without loss of function. Similarly, the preferred positioning of a regulatory sequence element (e.g., operator, enhancer, etc.) to be placed under its control for the transcriptional polynucleotide is defined by the positioning of the element in its natural setting; i.e., the positioning of the gene from which it is derived.

[0246] "Promoter" or "promoter sequence" refers, as used herein, to a region of a gene, generally an RNA-coding region upstream (5'), which controls the initiation and level of transcription in the cell of interest. The "promoter" includes transcriptional regulatory sequences of traditional genomic genes, such as TATA box and CCAAT box sequences, as well as additional regulatory elements (i.e., upstream activation sequences, enhancers, and silencers) that alter gene expression in response to developmental and / or environmental stimuli, or in a tissue-specific or cell-type-specific manner. The promoter is typically located upstream of the structural gene whose expression it regulates, but is not necessarily so (e.g., some PolIII promoters). Additionally, the regulatory element containing the promoter is typically located within 2 kb of the start site of the gene's transcription. The promoter may contain additional specific regulatory elements located further away from the start site to further enhance expression in the cell and / or alter the timing and inducibility of expression of the structural gene to which it is operably followed.

[0247] "Constitutive promoter" refers to a promoter that induces the expression of a transcribed sequence operably linked in multiple or all tissues of an organism, such as a plant. As used herein, the term constitutive does not necessarily imply that a gene is expressed at the same level in all cell types; the gene is expressed in a wide range of cell types, but some variation in level is often detectable. "Selective expression" refers, as used herein, to expression almost exclusively in specific organs of a plant, such as, for example, endosperm, embryo, leaf, fruit, tuber, or root. In a preferred embodiment, the promoter is expressed selectively or preferentially in the plant, preferably in the grain of a rice plant. Thus, selective expression may be contrasted with constitutive expression, which refers to expression in multiple or all tissues of the plant under most or all conditions experienced by the plant.

[0248] Selective expression can also induce compartmentalization of the products of gene expression in specific plant tissues, organs, or developmental stages. Compartmentalization in specific subcellular locations, such as plastids, cytosols, vacuoles, or apoplastic spaces, can be achieved by incorporating the gene product of an appropriate signal for transport to the required cellular compartment, such as a signal peptide, into the structure, or, in the case of semi-autonomous organelles (plastids and mitochondria), by incorporating a transplant gene with an appropriate regulatory sequence directly into the organelle genome.

[0249] A "tissue-specific promoter" or "organ-specific promoter" is a promoter that is preferentially expressed in one tissue or organ compared to multiple other tissues or organs, preferably most but not all, for example, in plants. Typically, the promoter is expressed at a level 10-fold higher in the specific tissue or organ than in other tissues or organs.

[0250] Suitable seed-specific promoters for the present invention are the adipose seed rapeseed lappa nafin gene promoter (US Patent No. 5,608,152), Vicia fava ( Vicia faba ) USP promoter (Baumlein et al., 1991), Arabidopsis Oleosin promoter (International Patent No. WO 98 / 45461), Phaseolus vulgaris ( Phaseolus vulgaris) Pazeolin promoter (US Patent No. 5,504,200), Brassica ( Brassica These include the Bce4 promoter (International Patent No. WO 91 / 13980) or the legumin B4 promoter (Baumlein et al., 1992), and promoters leading to seed-specific expression in rice. Suitable notable promoters are the barley LPT2 or LPT1 gene promoters (International Patents No. WO 95 / 15389 and WO 95 / 23230) or the promoter described in International Patent No. WO 99 / 16890 (promoter from the barley hordain gene). Other promoters include those described in the literature [Broun et al. (1998)], [Potenza et al. (2004)], and U.S. Patents No. US 20070192902 and US 20030159173. In an embodiment, the seed-specific promoter is preferentially expressed in a limited part of the seed, e.g., the endosperm, preferably in the developing aleurone. In a further embodiment, the seed-specific promoter is not expressed or is expressed only at a low level after the seed has germinated.

[0251] In an embodiment, the promoter is at least active at the time point between the time of flowering and 7 days after flowering, or is fully active during this period. Examples of such promoters are ROS1a It is a gene promoter.

[0252] In an embodiment, ROS1a The promoter operably linked to the exogenous polynucleotide that reduces gene expression is not a high MW glutenin promoter.

[0253] The promoter considered in the present invention may be native to the host plant to be transformed, or may be derived from an alternative source in which the region is functional in the host plant. Other sources include Agrobacterium ( Agrobacterium ) T-DNA genes, such as promoters of genes for the biosynthesis of nophalin, octapin, and mannofin, or other opin promoters; tissue-specific promoters (see, e.g., U.S. Patents No. US 5,459,252 and WO 91 / 13992); promoters from viruses (including host-specific viruses), or partially or completely synthetic promoters. Various promoters isolated from plants and viruses, such as cauliflower mosaic virus promoters (CaMV 35S, 19S), and numerous promoters functional in monocots and dicots are widely known in the art (see, e.g., literature [Greve, 1983; Salomon et al., 1984]; [Garfinkel et al., 1983]; [Barker et al., 1983]). Non-limiting methods for evaluating promoter activity are disclosed in the literature [Medberry et al. (1992 and 1993)], the aforementioned literature [Sambrook et al. (1989)] and U.S. Patent No. US 5,164,316.

[0254] Alternatively or additionally, the promoter may be an inducible promoter or, for example, a developmentally regulated promoter capable of inducing the expression of the introduced polynucleotide at an appropriate developmental stage of the plant. Other cis-action sequences that may be used include transcription and / or translation enhancers. The enhancer region is widely known to those skilled in the art and may include an ATG translation start codon and an adjacent sequence. If included, the start codon may correspond to the reading frame of the coding sequence associated with the exogenous or exogenous polynucleotide to ensure the translation of the entire sequence when it is translated. The translation start region may be provided from a source of the transcription start region or from the exogenous or exogenous polynucleotide. The sequence may also be derived from a source of the promoter selected to induce transcription and may be specifically modified to increase the translation of the mRNA.

[0255] The nucleic acid construct of the present invention may comprise a 3' untranslated sequence of about 50 to 1,000 nucleotide base pairs that may include a transcription termination sequence. The 3' untranslated sequence may contain a transcription termination signal that may or may not include any other regulatory sequence capable of achieving a polyadenylation signal and RNA processing. The polyadenylation signal functions to add a polyadenylic acid tract to the 3' end of an mRNA precursor. The polyadenylation signal is generally recognized by the presence of homology to the canonical form 5' AATAAA-3', but variations are uncommon. A transcription termination sequence that does not contain a polyadenylation signal comprises a terminator for PolI or PolIII RNA polymerase containing four or more runs of thymidines. An example of a suitable 3' untranslated sequence is Agrobacterium tumefaciens ( Agrobacterium tumefaciens )'s octopine synthase ( ocs) gene or nophalin synthase( nos It is a 3' transcribed untranslated region containing a polyadenylation signal from a gene (Bevan et al., 1983). A suitable 3' untranslated sequence may also be derived from a plant gene, e.g., the ribulose-1,5-bisphosphate carboxylase (ssRUBISCO) gene, but other 3' elements known to a person skilled in the art may also be used.

[0256] A specific leader sequence may be used for the DNA sequence inserted between the transcription initiation site and the beginning of the coding sequence, i.e., the untranslated 5' leader sequence (5'UTR), because it can affect gene expression when it is transcribed as well as translated. A suitable leader sequence includes a sequence selected to induce optimal expression of an external or endogenous DNA sequence. For example, such a leader sequence includes a desirable consensus sequence that can increase or maintain mRNA stability and prevent improper initiation of translation, as described, for example, in the literature [Joshi (1987)].

[0257] vector

[0258] The present invention involves the use of a vector for coordinating or delivering a genetic construct. A “chimeric vector” means a nucleic acid molecule derived from, for example, a plasmid, bacteriophage, or plant virus, preferably a DNA molecule, into which a nucleic acid sequence can be inserted or cloned. The vector is preferably double-stranded DNA, contains one or more unique restriction sites, and can replicate autonomously in a defined host cell, including a target cell or tissue or an ancestor cell or its tissue, or can be incorporated into the genome of a defined host so that the cloned sequence is reproduced. Thus, the vector may be an autonomously replicating vector that is a replica independent of chromosomal replication, i.e., a vector existing as an extrachromosomal entity, for example, a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means to ensure self-replication. Alternatively, when the vector is introduced into a cell, it may be incorporated into the genome of the recipient cell so that it replicates along with the chromosome(s) into which it is incorporated. A vector system may comprise a single vector or plasmid, or two or more vectors or plasmids, which together contain the entire DNA to be introduced into the host cell genome or transposon. The selection of a vector will typically depend on the compatibility of the vector with the cell into which it will be introduced. The vector may also contain selection markers, such as antibiotic resistance genes, herbicide resistance genes, or other genes that can be used for the selection of suitable transformants. Examples of such genes are widely known to those skilled in the art.

[0259] The nucleic acid construct of the present invention may be introduced into a vector, such as a plasmid. A plasmid vector, such as a pUC-derived vector, a pSK-derived vector, a pGEM-derived vector, a pSP-derived vector, a pBS-derived vector, or a binary vector containing one or more T-DNA regions, typically comprises additional nucleic acid sequences that provide easy selection, amplification, and transformation of the expression cassette in prokaryotic and eukaryotic cells. The additional nucleic acid sequences include a replication origin that provides autonomous replication of the vector, a selectivity marker gene, preferably a gene encoding antibiotic or herbicide resistance, a unique multiple cloning site providing multiple sites for inserting the gene encoded in the nucleic acid sequence or nucleic acid construct, and a sequence that enhances transformation in prokaryotic and eukaryotic (particularly plant) cells.

[0260] A "marker gene" refers to a gene that confers a distinct phenotype to cells expressing the marker gene, thereby distinguishing these transformed cells from cells that do not possess the marker. Selective marker genes confer traits that allow for "selection" based on resistance to selectors (e.g., herbicides, antibiotics, radiation, heat, or other treatments that damage untransformed cells). Selective marker genes (or reporter genes) confer traits that can be identified through observation or testing, that is, by "selection" (e.g., β-glucuronidase, luciferase, GFP, or other enzyme activity not present in untransformed cells). The marker gene and the nucleotide sequence of interest do not need to be linked.

[0261] To enable the identification of transformants, the nucleic acid construct preferably comprises a selective or selective marker gene as an exogenous or exogenous polynucleotide or in addition thereto. The actual selection of the marker is not important as long as it is functional (i.e., selective) in combination with the selected plant cell. The marker gene of interest and the exogenous or exogenous polynucleotide do not need to be linked, because, for example, as described in U.S. Patent No. 4,399,216, co-transformation of unlinked genes is also an efficient process in plant transformation.

[0262] Examples of bacterial selectivity markers are markers that confer antibiotic resistance, e.g., ampicillin, erythromycin, chloramphenicol, or tetracycline resistance, preferably kanamycin resistance. Exemplary selectivity markers for the selection of plant transformants are the hyg gene encoding resistance to hygromycin B; neomycin phosphotransferase conferring resistance to kanamycin, paromomycin, and G418 ( nptII ) genes; glutathione-S-transferase genes from rat livers conferring resistance to glutathione-induced herbicides, for example as disclosed in European Patent No. EP 256223; glutamine synthase genes conferring resistance to glutamine synthase inhibitors such as phosphinothricin upon overexpression, for example as disclosed in International Patent No. WO 87 / 05327; acetyltransferase genes from Streptomyces viridochromogenes conferring resistance to the selective agonist phosphinothricin, for example as disclosed in European Patent No. EP 275957; genes encoding 5-enolschimate-3-phosphate synthase (EPSPS) conferring resistance to N-phosphonomethylglycine, for example as disclosed in the literature [Hinchee et al. (1988)]; For example, conferring resistance to vialaphos as disclosed in International Patent No. WO91 / 02071 barGenes; nitrilease genes such as bxn from Klebsiella ozanae conferring resistance to bromoxinyl (Stalker et al., 1988); dihydrofolate reductase (DHFR) genes conferring resistance to methotrexate (Thillet et al., 1988); mutant acetolactate synthase genes (ALS) conferring resistance to imidazolinone, sulfonylurea, or other ALS-inhibitory chemicals (European Patent No. EP 154,204); mutant anthranilate synthase genes conferring resistance to 5-methyl tryptophan; or dalafone dehalogenase genes conferring resistance to herbicides, including but not limited to these.

[0263] A desirable selectivity marker is one in which various chromogenic substrates encode the known β-glucuronidase (GUS) enzyme uidA Genes; β-galactosidase genes encoding known enzymes for chromogenic substrates; equorin genes that can be used for calcium-sensitive bioluminescence detection (Prasher et al., 1985); green fluorescent protein genes (Niedz et al., 1995) or derivatives thereof; or luciferase that allows for bioluminescence detection ( luc It includes the ) gene (Ow et al., 1986). A "reporter molecule" refers to a molecule that provides an analytically identifiable signal that facilitates the measurement of promoter activity based on protein products by its chemical nature.

[0264] Preferably, the nucleic acid composition is stably incorporated into, for example, the genome of a plant or cell of the present invention. Accordingly, the nucleic acid may contain a suitable element that enables the molecule to be incorporated into the genome, or the composition may be placed in a suitable cell in which it can be incorporated into the chromosomes of the plant cell.

[0265] One embodiment of the present invention comprises a recombinant vector, which comprises at least one nucleotide molecule of the present invention inserted into any vector capable of delivering a nucleic acid molecule into a host cell. Such a vector contains a heterogeneous nucleic acid sequence that is not originally found adjacent to the nucleic acid molecule of the present invention and, preferably, is a nucleic acid sequence derived from a species other than the species from which the nucleic acid molecule(s) originated. The vector may be RNA or DNA, eukaryote or prokaryote, and is typically a virus or plasmid.

[0266] A number of vectors suitable for the stable transfection of plant cells or the establishment of genetically modified plants are, for example, in the literature [Pouwels et al. . , Cloning Vectors: A Laboratory Manual, 1985, supp. 1987]; [Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989]; and [Gelvin et al. . This is described in the Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, a plant expression vector comprises one or more cloned plant genes and a dominant selector marker under transcriptional control, for example, of 5' and 3' regulatory sequences. Such plant expression vectors may also contain promoter regulatory regions (e.g., regulatory regions controlling inducible or constitutive, environmentally or developmentally regulated, or cell- or tissue-specific expression), transcription initiation sites, ribosome binding sites, RNA processing signals, transcription termination sites, and / or polyadenylation signals.

[0267] Levels of ROS1s polypeptides can be regulated by reducing the expression levels of proteins-encoding genes in rice plants, which can lead to increased aleurone thickness. Gene expression levels can be regulated, for example, by altering the number of copies per cell by introducing synthetic gene constructs containing a cow sequence and transcriptional control elements that are functional in the cell and operably linked thereto. Multiple transformants may be selected and screened for having specificity and / or desirable levels of transplant gene expression resulting from the influence of the endogenous sequence near the transplant gene integration site. Desired levels and patterns of transplant gene expression result in increased aleurone thickness. Alternatively, a population of mutant seeds or a population of plants from a breeding program may be screened for individual lines having increased aleurone thickness.

[0268] Recombinant cells

[0269] Another embodiment of the present invention comprises a recombinant cell comprising a host cell transformed with one or more recombinant molecules of the present invention, or a progeny cell thereof. Transformation of a nucleic acid molecule within a cell can be achieved by any method in which the nucleic acid molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. The recombinant cell may be maintained as a unicellular cell or may grow into a tissue, organ, or multicellular organism. The transformed nucleic acid molecule of the present invention may be maintained extrachromosomes or incorporated into one or more regions within the chromosomes of the transformed (i.e., recombinant) cell in such a manner that its expressive ability is retained. A preferred host cell is a plant cell, more preferably a rice cell.

[0270] Plants with genetic mutations

[0271] The term “plant” as used herein as a noun refers to the entire plant and any member of the plant kingdom, but as an adjective refers to any substance present in, obtained from, derived from, or related to a plant, such as, for example, plant organs (e.g., leaves, stems, roots, flowers), single cells (e.g., pollen), seeds, plant cells, etc. Roots, sprouted seedlings, and sprouted seeds are also included within the meaning of “plant”. The term “plant part” as used herein refers to one or more plant tissues or organs obtained from a plant and containing the genomic DNA of the plant. A plant part includes vegetative structures (e.g., leaves, stems), roots, flower organs / structures, seeds (embryos, cotyledons, and seed coats), plant tissues (e.g., vascular tissue, basal tissue, etc.), cells, and their offspring. The term “plant cell” refers to a cell obtained from or within a plant as used herein, and includes protoplasts or other cells derived from a plant, germ cell-producing cells, and cells that regenerate into a whole plant. Plant cells may be cells in a culture. “Plant tissue” means differentiated tissue obtained from or within a plant (“explant”), or undifferentiated tissue derived from various forms of plant cell aggregates in a culture, such as immature or mature embryos, seeds, roots, shoots, fruits, tubers, pollen, tumor tissues such as crown galls, and kali (scabra). Exemplary plant tissues in or from a seed are cotyledons, embryos, and embryo axis. The present invention thus comprises plants and plant parts and products comprising the same.

[0272] The terms “grain” and “seed” are used interchangeably herein. Depending on the context, “grain” may refer to a mature grain within a plant, a developing grain within a plant, a harvested grain, or a grain after processing, e.g., milling or polishing (wherein most of the grain is undamaged), or after infiltration or germination. A mature grain generally has a moisture content of about 18 to less than 20%. In an embodiment, the developing grain of the present invention is at least about 10 days after pollination (DAP). In an embodiment, the developing grain of the present invention comprises a grain between flowering and 7 days after flowering.

[0273] "Genetic transplanted plant" refers to a plant having one or more genetic variations as defined herein, as used herein, which contains nucleic acid compositions not found in wild-type plants of the same species, variety, or cultivated variety. That is, a genetic transplanted plant (transformed plant) contains genetic material (transplanted gene) that was not present prior to transformation. The transplanted gene may comprise a gene sequence obtained or derived from a plant cell or another plant cell or a non-plant source, or a synthetic sequence. Typically, the transplanted gene has been introduced into the plant by human manipulation, such as, for example, transformation, but any method recognized by a person skilled in the art may be used. The genetic material is preferably stably integrated into the plant genome. The introduced genetic material may include sequences that occur naturally in the same species, but may include rearranged sequences or elements, for example, different arrangements of antisense. Plants containing such sequences are included in the "genetic transplanted plant" herein.

[0274] "Non-genetically modified plants" are those that have not been genetically modified by the introduction of genetic material using recombinant DNA technology.

[0275] "Wild type" refers to a cell, tissue, grain, or plant that has not been modified according to the present invention, as used herein. A wild type cell, tissue, or plant may be used as a control group to compare the expression level of exogenous nucleic acids or the degree and nature of a cell, tissue, grain, or plant modified as described herein.

[0276] As used herein, the term “corresponding wild-type” rice plant or grain, or similar sphere, comprises at least 50%, more preferably at least 75%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, and more preferably 99.5% of the genotype of the rice plant or grain of the present invention, but in each plant or grain ROS1a Refers to a rice plant or grain that does not contain one or more genetic variants (e.g., introduced genetic variants) that reduce the activity of the gene and / or thickened aleurone. In embodiments, the rice grain or plant of the present invention is a homogeneous genotype relative to a wild-type rice grain or plant that is free of one or more genetic variants (e.g., introduced variants). Preferably, the corresponding wild-type plant or grain is a cultivated variety or cultivar identical to the ancestor of the plant / grain of the present invention, or a sibling plant strain, also referred to as a "segregant," that lacks one or more genetic variants and / or does not have thickened aleurone, and is derived therefrom. In embodiments, the rice plant or grain of the present invention has a genotype that is less than 50% identical to the genotype of the rice variety Zhonghua 11 (ZH11). ZH11 has been commercially available since 1986.

[0277] Genetically modified plants, as defined in the context of the present invention, comprise offspring of a genetically modified rice plant using recombinant technology, wherein the offspring comprises the transplanted gene of interest. Such offspring may be obtained by self-pollination of the primary genetically modified plant or by crossing such a plant with another rice plant. This is generally intended to regulate the production of at least one protein / enzyme defined herein within the target plant or plant organ. Genetically modified plant parts comprise all parts and cells of said plant containing the transplanted gene, such as cultured tissue, callus, and protoplast.

[0278] As used herein, the term "rice" refers to the genus Oryza Refers to any species of ) , It includes its ancestors as well as its offspring produced by crossbreeding with other species. The plants are commercially cultivated rice species, for example, for example, Oryza sativa ( Oryza sativa It is suitable for commercial products of strains, cultivated varieties, varieties, or grains.

[0279] As used herein, "brown rice" refers to the whole grain of rice containing the bran layer and the embryo (germ), rather than the hull typically removed during harvest. That is, brown rice is not polished to remove the aleurone and the embryo. "Brown" refers to the presence of brown or yellowish-brown pigments within the bran layer. Brown rice is considered to be a whole grain. As used herein, "white rice" (milled rice) refers to a rice grain from which the bran and germ have been removed, i.e., the starchy endosperm of essentially the entire rice grain. Both of these types of rice grains may be short, medium, or long grains. Compared to white rice, brown rice has a higher content of protein, minerals, and vitamins, and has a higher lysine content in its protein content.

[0280] As used herein, “colored rice” includes black rice and red rice, each of which contains a pigment, such as proanthocyanidin (tannin), within the aleurone layer. Colored rice has a higher riboflavin content than uncolored rice but has a similar thymine content. “Black rice” may turn a deep purple color when cooked due to anthocyanins. “Purple rice” (also known as “forbidden rice”) is a short-grain variant of black rice and is included in black rice as defined herein. It is purple when uncooked and dark brown when cooked. “Red rice” contains various anthocyanins, including cyanidin-3-glucoside (chrysanthemin) and peonidin-3-glucoside (oxycoxycyanin), which provide a red / brown color to the bran.

[0281] Each of these types of rice grains can be treated to prevent germination, for example, by cooking (boiling) or by dry heating. Brown and colored rice are typically cooked for 20 to 40 minutes depending on the desired texture, whereas white rice is typically cooked for 12 to 18 minutes. Cooking or heating reduces the levels of antitrophic factors, such as trypsin inhibitors, oryzacystatin, and hemagglutinin (lectins), in rice grains by the denaturation of these proteins, rather than by the phytate content. Rice grains may also be soaked in water before cooking or cooked slowly over a long period, as is known in the relevant art. Rice grains may also be split, blanched, or heat-stabilized. Rice bran may be stabilized, for example, by steaming at 100°C for about 6 minutes.

[0282] In an embodiment, the grain of the present invention has extended grain maturity compared to the corresponding wild-type grain. Extended maturity can be determined by using a seed setting rate (%) which involves calculating the percentage of florets in a seed-filled plant by the mature grain stage.

[0283] In an embodiment, the grain of the present invention has reduced germination ability compared to the corresponding wild-type grain. For example, when the grain is grown at 28°C under a 12h day / 12h night cycle without humidity control in a growth chamber, it has about 70% to about 80%, or about 75%, preferably 70% to 100% of the germination ability of the corresponding wild-type grain. The term “germination” is defined as when the radicle visually emerges through the seed coat, as used herein.

[0284] In an embodiment, the plant of the present invention is a wild-type parent variety (e.g., having the sequence of amino acids provided in SEQ ID NO. 2). ROS1a Compared to a homogeneous plant containing polypeptides, it has one or more or all of normal plant height, fertility (female and male), grain size, and weight per 1,000 grains. In an embodiment, the grain of the present invention can produce a rice plant having one or more or all of the following compared to a wild-type parent variety: normal plant height, fertility (female and male), grain size, and weight per 1,000 grains. As used herein, the term "normal" may be determined by measuring the same traits in a wild-type parent variety grown under the same conditions as the plant of the present invention. In an embodiment, the plant of the present invention is normal if it has a level / number of defined traits of + / - 10%, more preferably + / - 5%, more preferably + / - 2.5%, and even more preferably + / - 1% compared to a wild-type parent variety.

[0285] Genetically modified plants, as defined in the context of the present invention, include plants (as well as parts and cells of said plants) and their offspring that have been genetically modified using recombinant technology to induce the production of at least one polypeptide of the present invention in a desired plant or plant organ. Genetically modified plants may be produced using technology known in the relevant art, such as generally described in the literature [A. Slater et al., Plant Biotechnology - The Genetic Manipulation of Plants, Oxford University Press (2003)] and [P. Christou and H. Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004)].

[0286] In a preferred embodiment, the genetically modified plant is homozygous with respect to each and all genes and nucleic acid constructs introduced (transplant genes) so that its offspring are separated for the desired phenotype. The genetically modified plant may be heterozygous with respect to the introduced transplant gene(s) in, for example, F1 offspring grown from hybrid seeds. Such plants may provide advantages widely known in the art, such as hybrid vigor.

[0287] In an embodiment, the method for selecting a rice plant of the present invention comprises the step of analyzing a DNA sample from the plant for at least one “other genetic marker.” As used herein, the “other genetic marker” may be any molecule linked to a desired trait of the plant. Such markers are widely known to those skilled in the art and include molecular markers linked to genes that determine traits, such as disease resistance, yield, plant morphology, grain quality, back characteristics, grain color, gibberel acid content in seeds, plant height, flour color, etc. Examples of such genes determine semi-dwarf growth habit and consequent lodging resistance. Rht It is a gene.

[0288] Four common methods for directly delivering genes into cells are described: (1) chemical methods (Graham et al., 1973); (2) physical methods, e.g., microinjection (Capecchi, 1980); electroporation (e.g., see International Patent No. WO 87 / 06614, U.S. Patents No. US 5,472,869, No. 5,384,253, International Patents No. WO 92 / 09696 and No. WO 93 / 21335); and gene guns (e.g., see U.S. Patents No. US 4,945,050 and No. US 5,141,131); (3) viral vectors (Clapp, 1993; Lu et al., 1993; Eglitis et al., 1988); and (4) receptor-mediated mechanism (Curiel et al., 1992; Wagner et al., 1992).

[0289] Acceleration methods that can be used include, for example, microprojectile bombardment. Microprojectile bombardment is an example of a method for delivering transformed nucleic acid molecules to plant cells. This method is reviewed in the literature [Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994)]. Non-biological particles (microprojectiles) are coated with nucleic acids and can be delivered to cells by propulsion. Exemplary particles include those composed of tungsten, gold, platinum, etc. A specific advantage of microprojectiles is that, in addition to being an effective means of regeneratively transforming monocots, there is no need for the isolation of protoplasts or sensitivity to Agrobacterium infection. A particle delivery system suitable for use with the present invention is the helium-accelerated PDS-1000 / He gun available from Bio-Rad Laboratories. For shock, immature embryos or derived target cells, such as scutella or calli from immature embryos, can be arranged on a solid culture medium.

[0290] In another alternative embodiment, chloroplasts can be stably transformed. A method disclosed for the transformation of chloroplasts in higher plants comprises the total delivery of DNA particles containing a selective marker and targeting DNA to the chloroplast genome through homologous recombination (US Patents No. US 5,451,513, US 5,545,818, US 5,877,402, US 5,932,479, and International Patent No. WO 99 / 05265).

[0291] Agrobacterium-mediated transport is a widely available system for introducing genes into plant cells because DNA is introduced into the entire plant tissue, thereby bypassing the need for regeneration of an undamaged plant from the protoplast. The use of Agrobacterium-mediated plants incorporating vectors to introduce DNA into plant cells is widely known in the relevant art (see, for example, U.S. Patents No. 5,177,010, 5,104,310, 5,004,863, and 5,159,135). Additionally, the incorporation of T-DNA is a relatively precise process that induces a small number of rearrangements. The region of DNA to be transported is defined by a boundary sequence, and the intervening DNA is typically inserted into the plant genome.

[0292] Transplanted plants formed using the Agrobacterium transformation method typically contain a single gene locus on a single chromosome. Such transplanted plants may be referred to as being hemizygous with respect to the added gene. Transplanted plants that are homozygous with respect to the added structural gene, that is, plants containing two added genes, i.e., one gene at the same locus on each chromosome of a chromosome pair, are more preferred. Homozygous transplanted plants can be obtained by sexually crossing (selfing) independent isolates of transplanted plants containing a single added gene, germinating some of the produced seeds, and analyzing the plants produced for the gene of interest.

[0293] Other methods of cell transformation may also be used, which include, but are not limited to, introducing DNA into the plant by direct DNA transfer into the pollen, by directly injecting DNA into the reproductive organs of the plant, or by directly injecting DNA into the cells of an immature embryo and then rehydrating the dried embryo.

[0294] Regeneration, development, and cultivation from a single plant protoplast transformant or various transformed explants are widely known in the relevant technical field (Weissbach et al., Methods for Plant Molecular Biology, Academic Press, San Diego, (1988)). The regeneration and growth process typically involves the step of selecting transformed cells and the step of culturing these individualized cells through the conventional stages of embryonic development via a rooted seedling stage. Genetically modified embryos and seeds are regenerated in a similar manner. The resulting genetically modified rooted seedlings are then planted in a suitable plant growth medium, such as soil.

[0295] The development or regeneration of plants containing external, exogenous genes is widely known in the relevant art. Preferably, the regenerated plant is self-pollinated to provide a homozygous genetically modified plant. Alternatively, pollen obtained from the regenerated plant is crossbred with seed-grown plants of agronomically important lines. Conversely, the regenerated plant is pollinated using pollen from plants of these important lines. The genetically modified plant of the present invention containing the desired exogenous nucleic acid is cultivated using methods widely known to those skilled in the art.

[0296] To confirm the presence of the transplanted gene in genetically modified cells and plants, polymerase chain reaction (PCR) amplification or Southern blot analysis may be performed using methods known to those skilled in the art. Expression products of the transplanted gene may be detected by any of the various methods depending on the nature of the product, including Western blot and enzymatic assays. One particularly useful method for quantifying protein expression and detecting replication in different plant tissues is to use a reporter gene, such as GUS. After obtaining the genetically modified plant, it may be grown to produce plant tissues or parts having the desired phenotype. Plant tissues or parts may be harvested and / or seeds may be collected. Seeds may be provided as a source for growing additional plants having tissues or parts with the desired characteristics.

[0297] Marker secondary selection

[0298] Marker-assisted selection is a widely recognized method in traditional breeding programs for selecting heterozygous plants required for backcrossing with recurrent parents. In each backcross generation, the plant population will be heterozygous for the gene of interest, which is typically present in a 1:1 ratio within the backcross population, and molecular markers can be used to distinguish the two alleles of the gene. For example, by extracting DNA from young shoots and testing it with markers specific to the introgressed desired trait, initial selection of plants for further backcrossing is possible, allowing for concentration on plants with lower energy and resources. To accelerate the backcross program, embryos from immature seeds (25 days after flowering) can be excised and grown in a nutrient medium under sterile conditions that do not allow for full seed maturity. This process, referred to as "embryo rescue," used in combination with DNA extraction at the three-leaf stage, and ROS1a Analysis of at least one genetic variant that alters activity and imparts increased aleurone thickness to the plant allows for the rapid selection of plants possessing the desired traits that can be grown to maturity in a greenhouse or farmland for additional backcrossing on subsequent recurrent parents.

[0299] Any molecular biology technique known in the relevant art may be used in the method of the present invention. Such methods include, but are not limited to, the use of nucleic acid amplification, nucleic acid sequencing, nucleic acid hybridization with a suitably labeled probe, single-strand conformation analysis (SSCA), denaturation gradient gel electrophoresis (DGGE), heteroduplex analysis (HET), chemical cleavage analysis (CCM), catalytic nucleic acid cleavage, or combinations thereof (e.g., the literature [Lemieux, 2000]; [Langridge et al. . [Reference: , 2001]). The present invention also uses molecular marker technology ROS1aChanging activity and imparting increased aleurone thickness to plants (e.g.) ROS1a This includes detecting polymorphisms linked to alleles of a gene. Such methods include the detection or analysis of restriction fragment length polymorphisms (RFLP), RAPD, amplified fragment length polymorphisms (AFLP), and microsatellite (simple sequence repeat, SSR) polymorphisms. Closely linked markers can be easily obtained by methods widely known in the relevant art, such as bulked segregant analysis as reviewed in the aforementioned literature [Langridge et al. (2001)].

[0300] In an embodiment, the linked locus for marker auxiliary selection is within at least 1 cM or 0.5 cM or 0.1 cM or 0.01 cM from the gene encoding the polypeptide of the present invention.

[0301] "Polymerase Chain Reaction" ("PCR") is a reaction that prepares a target polynucleotide using a "pair of primers" or a "set of primers" consisting of "upstream" and "downstream" primers, a polymerization catalyst such as DNA polymerase, and typically a heat-stable polymerase. The PCR method is known in the relevant art and is taught, for example, in the literature ["PCR" (MJ McPherson and SG Moller (editors), BIOS Scientific Publishers Ltd, Oxford, (2000))]. PCR increases aleurone thickness in plants ROS1a It can be performed on cDNA obtained from reverse transcription mRNA isolated from plant cells expressing a gene or allele. However, it is generally easier to perform PCR on genomic DNA isolated from plants.

[0302] A primer is an oligonucleotide sequence that hybridizes to a target sequence in a sequence-specific manner and can be extended during PCR. An amplicon, PCR product, PCR fragment, or amplification product is a newly synthesized copy of the target sequence and the extension product containing the primer. A multiplex PCR system contains multiple sets of primers that induce the simultaneous production of more than one amplicon. A primer may perfectly match the target sequence, or it may contain internal mismatched bases that can trigger the introduction of restriction enzymes or catalytic nucleic acid recognition / cleavage sites at the specific target sequence. Primers may also contain additional sequences and / or modified or labeled nucleotides to facilitate the capture or detection of the amplicon. Repeated cycles of thermal denaturation of DNA, annealing of the primer against its complementary sequence, and extension of the annealed primer into the polymerase result in exponential amplification of the target sequence. The terms target, target sequence, or template refer to the amplified nucleic acid sequence.

[0303] Methods for directly sequencing nucleotide sequences are widely known to those skilled in the art, for example, the aforementioned literature [Ausubel et al.] and the aforementioned literature [Sambrook et al.] . It can be found in ]. Sequencing can be performed by any suitable method, e.g., dideoxy sequencing, chemical sequencing, or a modification thereof. Direct sequencing has the advantage of determining variations in any base pair of a specific sequence.

[0304] TILLING

[0305] The plants of the present invention may be produced using a known method of tilling (targeting-induced local lesions in genomes). In the first step, seeds (or pollen) are treated with a chemical mutagen, and then the plants are advanced to a generation in which the mutation is stably inherited, thereby inducing an introduced mutation, such as a novel single base pair change, in a plant population. DNA is extracted, and seeds are stored from all members of the population to create a resource that can be accessed repeatedly over time.

[0306] For tilling assays, PCR primers are designed to specifically amplify a single gene target of interest. Specificity is particularly important when the target is a member of a gene family or a part of a polyploid genome. Next, PCR products can be amplified from pooled DNA of multiple individuals using dye-labeled primers. These PCR products are denatured and re-annealed to allow for the formation of mismatched base pairs. Mismatches, or heteroduplexes, represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., some plants from a population may possess the same polymorphism) and induced SNPs (i.e., only a very small number of individual plants are likely to exhibit the mutation). After the formation of heteroduplexes, the use of endonucleases that recognize and cleave the mismatched DNA, such as Cel I, is key to discovering novel SNPs within the tilling population.

[0307] Using this approach, thousands of plant species can be screened to identify any individuals possessing single nucleotide changes, as well as small insertions or deletions (1 to 30 bp), in specific regions of any gene or genome. The genomic fragments to be screened can range in size from 0.3 to 1.6 kb. In 8-fold pooling, this combination of 1.4 kb fragments per test (ignoring the ends of fragments where SNP deletions are problematic due to noise) and 96 lanes allows up to one million base pairs of genomic DNA to be screened per single test, making tilling a high-throughput technology.

[0308] TILLING is further described in the literature [Slade and Knauf (2005)] and [Henikoff et al. (2004)].

[0309] In addition to allowing for the efficient detection of mutations, high-throughput tilling technology is ideal for the detection of natural polymorphisms. Thus, investigating unknown homologous DNA by heteroduplexing known sequences reveals the number and locations of polymorphic sites. Both nucleotide changes and small insertions and deletions are identified, including at least some repeat number polymorphisms. This has been referred to as ecotilling (Comai et al., 2004).

[0310] Each SNP is recorded at its appropriate site within several nucleotides. Therefore, each haplotype can be stored based on its mobility. Sequence data can be obtained with a relatively small incremental effort using a fraction of the same amplified DNA used for the mismatch-truncation test. Left or right sequencing primers for a single reaction are selected based on their proximity to the polymorphism. Sequencher software performs multiple alignments and detects base changes identified by gel bands in each case.

[0311] Ecotilling can be performed at a much lower cost than complete sequencing, which is the method currently used for most SNP discovery. Instead of a pool of DNA from mutant plants, plates containing aligned ecotype DNA can be selected. Since detection is performed on a gel that is uniform across the entire lane with nearly base pair resolution and background patterns, bands of the same size can be matched, and thus SNP discovery and genotyping can be performed in a single step. In this approach, the ultimate sequencing of SNPs is simple and efficient, which is made even simpler and more efficient by the fact that the same PCR fractions used for screening can be applied to DNA sequencing.

[0312] Grain processing

[0313] Due to the thickened aleurone, the rice grain of the present invention, and the flour and bran derived therefrom, have improved nutrient content. The isolated aleurone tissue will have low levels of starch and husk and represents the major portion of the physiologically beneficial substrate of the grain for human nutritional intake. For example, the grain of the present invention and / or the flour produced therefrom comprises one or more of the following, each by weight, when compared to the corresponding wild-type grain and / or the flour produced therefrom:

[0314] i) a higher mineral content, e.g., about 20% or at least about 25% higher (preferably the mineral content is the content of one or more or all of zinc (e.g., at least about 10% or at least about 15% higher), iron (e.g., at least about 10% or at least about 15% higher), potassium (e.g., at least about 20% or at least about 25% higher), magnesium (e.g., at least about 18% or at least about 22% higher), phosphorus (e.g., at least about 17% or at least about 21% higher), and sulfur (e.g., at least about 5% or at least about 8% higher),

[0315] ii) higher antioxidant content, e.g., at least about 25% or at least more than about 35% total phenolic compounds, and / or at least about 60% or at least more than about 70% hydrophilic antioxidants,

[0316] iii) Higher phytate content, e.g., at least about 10% or at least about 15% higher phytate content,

[0317] iv) A higher content of one or more or all of vitamins B3, B6, and B9,

[0318] v) Higher dietary fiber content and / or insoluble fiber content (e.g., at least about 150%, or at least about 180%, higher total fiber),

[0319] vi) Starch content of about 90% to about 100% by weight relative to the starch content of the corresponding wild-type grain;

[0320] vii) Higher sucrose content,

[0321] viii) Higher monosaccharide content (e.g., arabinose, xylose, galactose, glucose content) e.g., at least about 1.5 or at least about 2 times higher monosaccharide content,

[0322] ix) a higher fat content, e.g., at least about 20%, at least about 30% or at least about 50%, or about 50% higher fat content, and

[0323] x) Similar nitrogen levels.

[0324] Each of these nutrient components of the grain can be determined using routine techniques, such as those summarized in Examples 1 and 5.

[0325] In one embodiment, the rice grain of the present invention and / or the powder produced therefrom each comprise one or more or all of the following based on weight:

[0326] i) at least about 20%, at least about 30%, or at least about 50%, or more than about 50% of fat compared to the corresponding wild-type grain / flour,

[0327] ii) at least about 11 mg / g or at least about 12 mg / g of total phytate,

[0328] iii) A mineral content exceeding at least about 20% or at least about 25% in the powder obtained from the grain compared to the powder from the corresponding wild-type grain,

[0329] iv) at least about 14 mg / kg or at least about 15 mg / kg of total zinc,

[0330] v) at least about 13 mg / kg or at least about 13.5 mg / kg of total iron,

[0331] vi) Total fiber exceeding at least about 150%, or at least about 180%, compared to the corresponding wild-type grain / flour,

[0332] vii) Starch content of about 90% to about 100% by weight relative to the starch content of the corresponding wild-type grain / flour;

[0333] viii) at least about 1.5 or at least about 2 times higher monosaccharide content (e.g., arabinose, xylose, galactose, glucose content) compared to the corresponding wild-type grain / flour, and

[0334] ix) at least about 25%, or at least about 35%, of total phenolic compounds compared to the corresponding wild-type grain / flour, and / or at least about 60%, or at least about 70%, of hydrophilic antioxidants,

[0335] In an embodiment, the grain contains amylose in an increased proportion of its total starch content compared to the corresponding wild-type grain. Methods for producing such grains are described, for example, in International Patents No. WO 2002 / 037955, WO 2003 / 094600, WO 2005 / 040381, WO 2005 / 001098, WO 2011 / 011833 and WO 2012 / 103594.

[0336] In an embodiment, the grain of the present invention contains an increased proportion of oleic acid and / or a decreased proportion of palmitic acid compared to the corresponding wild-type grain in terms of its total fatty acid content. Methods for producing such grains are described, for example, in International Patents No. WO 2008 / 006171 and WO 2013 / 159149.

[0337] The grains / seeds of the present invention, or other plant parts of the present invention, can be processed using any technology known in the relevant art field to produce food ingredients, food, or non-food products.

[0338] As used herein, when provided as part of a food or beverage, the term “other food or beverage ingredient” refers to any substance suitable for consumption by animals, preferably any substance suitable for consumption by humans. Examples include, but are not limited to, grains from other plant species, sugar, etc., but exclude water.

[0339] In one embodiment, the product is whole grain flour, e.g., ultrafine-milled whole grain flour, or flour made from about 100% grains. The whole grain flour comprises a refined flour component (refined flour or refined flour) and a coarse fraction (ultrafine-milled coarse fraction).

[0340] The refined powder may be, for example, a powder produced by grinding and bolting washed grains. The particle size of the refined powder is described as a powder that passes through a fabric having an opening no larger than that of a woven wire fabric marked "212 micrometers (US Wire 70)" for more than 98% of the particles. The coarse fraction comprises at least one of the bran and the germ. For example, the germ is an embryo found within the kernel of the grain. The germ contains lipids, fibers, vitamins, proteins, minerals, and phytonutrients, such as flavonoids. The bran comprises several cell layers and contains significant amounts of lipids, fibers, vitamins, proteins, minerals, and phytonutrients, such as flavonoids. Additionally, the coarse fraction may comprise an aleurone layer containing lipids, fibers, vitamins, proteins, minerals, and phytonutrients, such as flavonoids. Although technically considered as part of the endosperm, the aleurone layer exhibits many of the same characteristics as the bran and is therefore typically removed along with the bran and germ during the milling process. The aleurone layer contains proteins, vitamins, and phytonutrients, such as ferulic acid.

[0341] Additionally, the coarse fraction can be blended with the refined powder component. The coarse fraction can be mixed with the refined powder component to form whole grain flour, thereby providing whole grain flour with increased nutritional value, fiber content, and antioxidant capacity compared to the refined powder. For example, the coarse fraction or whole grain flour can be used in varying amounts to replace refined or whole grain flour in baked goods, stacks, and food products. The whole grain flour of the present invention (i.e., ultrafine-refined whole grain flour) can also be marketed directly to consumers for use in home baked goods. In an exemplary embodiment, the granulation profile of the whole grain flour is such that 98% of the particles by weight of the whole grain flour are less than 212 micrometers.

[0342] In additional embodiments, to stabilize the whole grain flour and / or coarse fraction, enzymes found in the bran and germ of the whole grain flour and / or coarse fraction are inactivated. Stabilization is a method using steam, heat, radiation, or other treatments that inactivate enzymes found in the bran and germ layers. The stabilized flour retains its cooking characteristics and has a longer shelf life.

[0343] In additional embodiments, whole grain flour, coarse fraction, or refined flour may be a component (ingredient) of a food product and may be used to manufacture a food product. For example, groceries include bagels, biscuits, bread, buns, croissants, dumplings, English muffins, muffins, pita bread, quick bread, refrigerated / frozen dough products, dough, baked beans, burritos, chili, tacos, tamales, tortillas, pot pies, ready-to-eat grains, ready-to-eat meals, stuffing, microwaveable meals, brownies, cakes, cheesecakes, coffee cakes, cookies, desserts, pastries, sweet rolls, candy bars, pie crusts, pie fillings, baby food, baking mix, batter, breading, gravy mix, meat extenders, meat substitutes, seasoning mix, soup mix, gravy, roux, salad dressing, sauce, sour cream, noodles, pasta, ramen noodles, chow mein noodles, ro mein noodles, ice cream inclusions, ice cream bars, ice cream cones, ice cream sandwiches, crackers, croutons, donuts, It may be egg rolls, extruded snacks, fruit and grain bars, microwaveable snack products, nutrient bars, pancakes, semi-baked bakery products, pretzels, puddings, granola-based products, snack chips, snack foods, snack mixes, waffles, pizza crusts, animal food, or pet food.

[0344] In an alternative embodiment, whole grain flour, refined flour, or coarse fraction may be a component of a nutrient supplement. For example, the nutrient supplement may be a product added to food containing one or more additional ingredients, typically including vitamins, minerals, herbs, amino acids, enzymes, antioxidants, herbs, spices, probiotics, extracts, prebiotics, and fiber. The whole grain flour, refined flour, or coarse fraction of the present invention contains vitamins, minerals, amino acids, enzymes, and fiber. For example, the coarse fraction contains a concentrated amount of dietary fiber as well as other essential nutrients essential to human food, such as B vitamins, selenium, chromium, manganese, magnesium, and antioxidants. For example, 22 grams of the coarse fraction of the present invention delivers 33% of an individual's recommended daily intake of fiber. Nutrient supplements may contain any known nutrient components that aid in an individual's overall health, examples of which include, but are not limited to, vitamins, minerals, other fiber components, fatty acids, antioxidants, amino acids, peptides, proteins, lutein, ribose, omega-3 fatty acids, and / or other nutrient components. Supplements may be delivered in the following forms, but are not limited to: instant beverage mixes, ready-to-eat beverages, nutrient bars, wafers, cookies, crackers, gel shots, capsules, chewable tablets, and pills. One embodiment delivers the fiber supplement in the form of a flavored shake or malt-type beverage, and such an embodiment may be particularly attractive as a fiber supplement for children.

[0345] In additional embodiments, a milling process may be used to produce a mixed grain flour or a mixed grain coarse fraction. For example, the bran and germ from one type of grain may be ground and blended with the ground endosperm or whole grain flour of another type of grain. Alternatively, the bran and germ of one type of grain may be ground and blended with the endosperm or whole grain flour of another type of grain. The present invention is considered to include mixing any combination of one or more of the bran, germ, endosperm, and whole grain flour of one or more types of grains. Using this mixed grain approach, a customized flour may be produced, and a single flour may be produced by utilizing the quality and nutrient content of various types of grain kernels.

[0346] The whole grain flour, coarse fraction, and / or grain product of the present invention may be produced by any milling method known in the relevant art. An exemplary embodiment comprises grinding the grain as a single stream without separating the endosperm, bran, and germ of the grain into separate streams. Washed and tempered grain is transported to a first path grinder, such as a hammer mill, roller mill, pin mill, impact mill, disc mill, air attrition mill, gap mill, etc. After grinding, the grain is discharged and transported to a sifter. Additionally, it is considered that the whole grain flour, coarse fraction, and / or grain product of the present invention may be modified or improved by a number of other processes, such as fermentation, instantization, extrusion, encapsulation, toasting, roasting, etc.

[0347] Examples

[0348] Example 1. General material and method

[0349] Observation of white pigment by staining with Sudan Red solution

[0350] A staining solution was prepared by adding 1 g of Sudan Red IV to 50 ml of polyethylene glycol solution (average molecular weight 400, Sigma, Cat. No. 202398), incubating at 90°C for 1 hour, and mixing with an equal volume of 90% glycerol. After removing the pericarp (palea and lemma) of each grain, mature rice grains were incubated in distilled water for 5 hours and then cut transversely or longitudinally using a razor blade. The flakes were stained in the Sudan Red solution at room temperature for 24 to 72 hours. Subsequently, the flakes were counterstained with Lugol staining solution at room temperature for 20 minutes (Sigma, 32922) and observed under a dissecting microscope (Sreenivasulu, 2010).

[0351] Dyeing white pigment into Evans Blue

[0352] Evans Blue staining solution was prepared by dissolving 0.1 g of Evans Blue (Sigma, E2129) in 100 ml of distilled water. After removing the pericarp (inner glume and outer glume) of each grain, the mature rice grains were transversely sliced ​​using a razor blade. The flakes were incubated in distilled water at room temperature for 30 minutes, the stain was added, and the flakes were left at room temperature for 2 minutes. Subsequently, the staining solution was discarded, the flakes were washed twice with distilled water, and observed under a dissecting microscope.

[0353] Optical microscopic observation of rice endosperm

[0354] Rice grains were fixed in a formalin-acetic acid-alcohol (FAA) solution (60% ethanol, 5% glacial acetic acid, and 2% formaldehyde), degassed for 1 hour, rehydrated with a series of alcohol solutions containing 70%, 80%, 95%, and then 100% ethanol, infiltrated with LR white resin (Electron Microscopy Sciences, 14380), and polymerized at 60°C for 24 hours. Microtome sections were performed using a Leica UC7 microtome. Thin sections were stained in a 0.1% toluidine blue solution (Sigma, T3260) at room temperature for 2 minutes, followed by two washes with distilled water and observation under an optical microscope. Alternatively, the thin section was stained in a 0.01% Calcofluor white solution (Sigma, 18909) at room temperature for 2 minutes and observed under an optical microscope.

[0355] Staining with PAS and Commassie Blue

[0356] The fixed section on the slide was incubated in preheated 0.4% periodic acid (Sigma, 375810) at 57°C for 30 minutes, followed by rinsing three times with distilled water. Schiff reagent (Sigma, 3952016) was applied, and the slide was incubated at room temperature for 15 minutes, followed by rinsing three times with distilled water. The section was then incubated in 1% Coomassie blue ((R-250), ThermoScientific, 20278) at room temperature for 2 minutes, followed by rinsing three times with distilled water. Dehydration of the thin sections was achieved by using a series of alcohol solutions containing 30%, 50%, 60%, 75%, 85%, 95% to 100% ethanol for 2 minutes each, and then each slide was cleared in 50% xylene and 100% xylene solutions (Sigma, 534056) for 2 minutes each. Subsequently, a Eukitt (registered trademark) rapid-curing mounting medium (Fluka, 03989) was mounted on a coverslip, and the thin sections were observed under an optical microscope.

[0357] DNA extraction and PCR conditions

[0358] Two methods were used for DNA extraction from plant leaf samples: a rapid DNA extraction method to provide less pure DNA samples and a more intensive DNA extraction method for purer DNA (modified from the literature [Huang (2009)]). In the first method, four glass beads with a diameter of 2 mm (Sigma, 273627), 1 to 2 mg of rice leaf tissue, and 150 µl of extraction buffer (10 mM Tris, pH 9.5, 0.5 mM EDTA, 100 mM KCl) were added to each well of a 96-well PCR plate. The plate was sealed, and the mixture was homogenized for 1 minute using a Mini-Beadbeater-96 mixer (GlenMills, 1001). After centrifugation at 3000 rpm for 5 minutes, the extracted supernatant containing DNA was used in the PCR reaction.

[0359] In the second method, two glass beads with a diameter of 2 mm and 0.2 g of leaves were placed in 1.5 ml Eppendorf tubes and cooled in liquid nitrogen for 10 minutes. The samples were then homogenized in a Mini-BeadBitter-96 for 1 minute, followed by the addition of 600 µl of DNA extraction buffer (2% SDS, 0.4 M NaCl, 2 mM EDTA, 10 mM Tris-HCl, pH 8.0) to each tube, and the mixture was incubated at 65°C for 1 hour. After cooling the mixture, 450 µl of 6 M NaCl was added, mixed, and centrifuged at 12,000 rpm for 20 minutes. The supernatants from each were transferred to new tubes, and DNA was precipitated in an equal volume of 2-propanol at -20°C for 1 hour. DNA was recovered by centrifugation at 2400 rpm at 4°C for 20 minutes, and the pellet was washed twice with 75% ethanol. The pellet was air-dried at room temperature, resuspended in 600 µl of distilled water containing 10 ng / µl RNAse (Thermo Scientific, EN0201), and used in a PCR reaction.

[0360] The PCR reaction was performed using 5 µl of 2xPCR buffer containing Taq polymerase (ThermoScientific, K0171), 5' and 3' oligonucleotide primers, and 1 µl of DNA sample in a total volume of 10 µl. Amplification was performed using 35 cycles of 30 seconds at 94°C, 30 seconds at 55°C, and 30 seconds at 72°C. The amplification products were analyzed by gel electrophoresis using a 3% agarose gel. For the control PCR reaction, DNA preparations from homozygous Zhonghua11 (ZH11) (wild-type Japonica rice), homozygous NJ6 (wild-type Indica rice), and a mixture of ZH11 and NJ6 were used.

[0361] ta2For allele gene mapping, PCR amplification of the gene markers was performed using the following primer pairs (5' to 3' sequences): INDEL 127 (Chromosome I site 6,343,260), forward primer TGAGTAGTTGCGTTGTTCT (SEQ No. 15), reverse primer TCTTAGTGAGCCGTTTCT (SEQ No. 16); INDEL 129 (Chromosome I site 6,560,681), forward primer CCTTCTGTGCTATGGGTT (SEQ No. 17), reverse primer CATGCCAAGACACCACTT (SEQ No. 18); INDEL 128 (Chromosome I site 6,470,027), forward primer TGGCTTTGGAAACGGTAG (SEQ No. 19), reverse primer TTTAGAGGGATGTGCGTCA (SEQ No. 20); INDEL 149 (locus 6,427,144 on chromosome 1), forward primer AAACAACGATCCAGCAAA (SEQ No. 21), reverse primer TTGGCACCGTATTACTTTC (SEQ No. 22).

[0362] TILLING black

[0363] The primers used for the TTILLING assay had the following nucleotide sequences:

[0364] TA2-1F: ACGCATTCTTCATTGACTGTATGT(Sequence No. 23)

[0365] TA2-1R: GCCCTTTCAATACAATGACTAGGT(Sequence No. 24)

[0366] TA2-2F:GAACATTTGAATCATGTTCCTCAC(Sequence No. 25)

[0367] TA2-2R: ACTATCCTTTGATGCAAGTTCTCC(Sequence No. 26)

[0368] TA2-3F: GTTGGAAGAGCAGTTAAAGCAAAT(Sequence No. 27)

[0369] TA2-3R: CTTCGGCAGTGAAATTTAGTAACA(Sequence No. 28)

[0370] TA2-4F: TACAGAACTTCTACGAATGCAGGA(Sequence No. 29)

[0371] TA2-4R: GCAACATGAATTGCTAAAGATGAG(Sequence No. 30).

[0372] PCR amplification using ExTaq was performed using the following reaction conditions: 95°C for 2 minutes; 8 cycles for every 1kb amplicon length of 94°C for 20 seconds, 68°C for 30 seconds (decrease by 1°C per cycle), and 72°C for 60 seconds, followed by 35 cycles for every 1kb amplicon length of 94°C for 20 seconds, 60°C for 30 seconds, and 72°C for 60 seconds, and a final extension at 72°C for 5 minutes. PCR products from wild type and test samples were mixed and subjected to complete denaturation-slow annealing to form a heterogeneous duplex under the following conditions: 99°C for 10 minutes for denaturation, followed by 70 cycles of decay starting at 70°C, decreasing by 0.3°C per cycle for 20 seconds each, and then maintaining at 15°C to re-anneal the denatured PCR products to form a heterogeneous duplex. CelI digestion of the annealed PCR product was carried out for 15 minutes at 45°C in a 15 µl reaction mixture containing CelI buffer (10 mM HEPES, pH 7.5, 10 mM KCl, 10 mM MgSO4, 0.002% Triton X-100, and 0.2 µg / ml bovine serum albumin (BSA)), 4 µl of PCR product, and 1 unit of CelI (10 units / µl) (when the PCR product is polymerized by Ex Taq) or 20 units of CelI (when the PCR product is polymerized by KOD), and then 3 µl of 0.5 M EDTA (pH 8.0) was added to stop the reaction. Alternatively, digestion is performed at 60°C for 30 minutes in a 15-µl reaction mixture containing 4 µl of PCR product and 2 units of mung bean nuclease (MBN, 10 units / µl, Cat. No. M0250S; New England Biolabs, USA) in MBN buffer (20 mM BIS-Tris, pH 6.5, 10 mM MgSO4, 0.2 mM ZnSO4, 0.002% Triton X-100, and 0.2 µg / ml BSA), and then 2 µl of 0.The reaction was stopped by adding 2% SDS.

[0373] In a 96-well PCR plate Cel The 1-digested PCR product was diluted to 100 µL with deionized water, and capillary electrophoresis was performed on an AdvanCE (trademark) FS96 instrument (Advanced Analytical Technologies, USA) at 9 kV for 30 seconds before the procedure, 15 seconds during the injection of 1 ng / µL molecular weight marker 75, 45 seconds for the injection of 15 kb or 50 and 3 kb dsDNA samples (Fermentas, Canada), and 40 minutes for sample separation. Gel images were acquired and analyzed using PROSize software (Advanced Analytical Technologies, USA) for capillary electrophoresis.

[0374] DNA Glycosylase (DME) Enzyme Test

[0375] Demeter (DME) is a bifunctional DNA glycosylase / lyase active for 5-methylcytosine substrates. Plants possess 5-methylcytosine in the following three sequence contexts: CpG, CpNpG, and CpNpN; DME is active for 5-methylcytosine in each of these sequence contexts. In an in vitro enzyme assay, the cleavage of the phosphodiester linkage on the 5' side of the methylated cytosine was detected to yield a δ-elimination product. Treatment of the DNA reaction product with a strong base (NaOH) prior to gel electrophoresis confirmed the δ-elimination process at the predicted sites.

[0376] The synthetic oligonucleotide used as a substrate in the enzyme assay was synthesized as follows, along with the nucleotide modifications listed in parentheses as presented below:

[0377] MEA-1.6F, 5'-CTATACCTCCTCAACTCCGGTCACCGTCTCCGGCG(Sequence No. 31)

[0378] MEA-1.6F18meC, 5'-CTATACCTCCTCAACTC(5-meC)GGTCACCGTCTCCGGCG(Sequence No. 32)

[0379] MEA-1.6F17meC, 5'-CTATACCTCCTCAACT(5-meC)CGGTCACCGTCTCCGGCG(Sequence No. 33)

[0380] MEA-1.6F22meC, 5'-CTATACCTCCTCAACTCCGGT(5-meC)ACCGTCTCCGGCG(Sequence No. 34)

[0381] MEA-1.6F18AP, 5'-CTATACCTCCTCAACTC(Abisic)GGTCACCGTCTCCGGCG(Sequence No. 35)

[0382] MEA-1.6F17AP, 5'-CTATACCTCCTCAACT(Abisic)CGGTCACCGTCTCCGGCG(Sequence No. 36)

[0383] MEA-1.6F15AP, 5'-CTATACCTCCTCAA(Abisic)TCCGGTCACCGTCTCCGGCG(Sequence No. 37)

[0384] MEA-1;6F12AP, 5'-CTATACCTCCT(Abisic)AACTCCGGTCACCGTCTCCGGCG(Sequence No. 38)

[0385] MEA-1.6F18T, 5'-CTATACCTCCTCAACTCTGGTCACCGTCTCCGGCG(Sequence No. 39)

[0386] MEA-1.6R, 5'-CGCCGGAGACGGTGACCGGAGTTGAGGAGGTATAG(Sequence No. 40)

[0387] MEA-1.6R17meC, 5'-CGCCGGAGACGGTGAC(5-meC)GGAGTTGAGGAGGTATAG(Sequence No. 41).

[0388] Each 20 pmol oligonucleotide was end-labeled in a 50 µL reaction at 37°C for 1 hour in the presence of 30 μCi of (γ-32P)-ATP (6000 Ci / mol, Perkin Elmer Life Sciences) using 20 units of T4 polynucleotide kinase. Each labeled oligonucleotide was purified as described by the manufacturer using the Qiaquick nucleotide removal kit (Qiagen). The labeled oligonucleotides were annealed with appropriate complementary oligonucleotides in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 0.1 M NaCl. Each mixture was heated to 100°C for 10 minutes and then slowly cooled to room temperature overnight. Msp I or Hpa II. Restriction endonuclease digestion was followed by gel electrophoresis to determine the efficiency of annealing. Only substrates with more than 90% double strands were used in the glycosylase activity assay.

[0389] A 5'-labeled oligonucleotide substrate (13.3 nM) was incubated with DME protein (250 nM) in a 15 ml reaction mixture containing 40 mM HEPES-KOH (pH 8.0), 0.1 M KCl, 0.1 mM EDTA, 0.5 mM dithiothreitol, and 200 mg / ml BSA at 37°C for 1 hour. The reaction was stopped with 15 ml of 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol FF, and boiled for 5 minutes. To induce elimination, NaOH was added to a final concentration of 0.1 M, and the reaction was boiled for 7 minutes. The product was fractionated over 15% polyacrylamide containing 7.5 M urea and 1 x TBE. Electrophoresis was performed at 1000V for 4 hours using a Hoefer SQ3 gel apparatus. The gel was exposed to Kodak BioMax MR film at -80℃.

[0390] Analysis method

[0391] The source and other major components of grains, food ingredients, and food samples were determined by standard methods, for example, as described below.

[0392] The moisture content of the grains was measured according to the Association of Official Analytical Chemists (AOAC) method 925.10. Briefly, a grain sample (approx. 2 g) was dried to a constant weight in an oven at 130°C for approximately 1 hour.

[0393] Ash content was measured according to AOAC method 923.03. The samples used for moisture determination were burned in a muffle furnace at 520°C for 15 hours.

[0394] Protein content of grains, food ingredients, and food samples

[0395] Protein content was measured according to AOAC method 992.23. Briefly, total nitrogen was analyzed by the Dumas combustion method using an automated nitrogen analyzer (Elementar Rapid N cube, Elementar Analysensysteme GmbH, Hanau, Germany). The protein content (g / 100g) of the grain or food sample was predicted by multiplying the nitrogen content by 6.25.

[0396] Sugars, starches, and other polysaccharides

[0397] Total starch content was measured according to AOAC method 996.11, using the enzymatic method from the literature [McCleary et al. (1997)].

[0398] The amount of sugar was measured according to AOAC method 982.14. Briefly, monosaccharides were extracted using aqueous ethanol (80% ethanol), acetonitrile:water (75:25 v / v) as the mobile phase, and quantitatively analyzed by HPLC using a polyamine-linked polymer gel column with an evaporative light scattering detector.

[0399] Total neutral non-starch polysaccharides (NNSP) were measured by a slightly modified gas chromatography procedure from the literature [Theander et al. (1995)] (which included hydrolysis with 1 M sulfuric acid for 2 hours followed by centrifugation).

[0400] Fructan (fructo-oligosaccharide) was analyzed by the method described in AOAC Method 999.03. Briefly, fructo-oligosaccharide was extracted in water and then digested with a sucrase / maltase / invertase mixture. The resulting free sugar was then reduced with sodium borohydride and digested into fructose / glucose using fructanose. The released fructose / glucose was measured using p-hydroxybenzoic acid and hydrazine (PAHBAH).

[0401] Fiber content

[0402] Total dietary fiber (TDF) was measured according to AOAC Method 985.29, and soluble and insoluble fiber (SIF) was measured according to AOAC Method 991.43. Briefly, TDF was determined by the gravimetric technique of the literature [Prosky et al. (1985)] as described in AOAC Method 985.29, and SIF was determined by the gravimetric technique as described in AOAC 991.43.

[0403] Total geology

[0404] 5 g of powdered sample was incubated with 1% Clarase 40000 (Southern Biological, MC23.31) at 45°C for 1 hour. Lipids were extracted from the sample in chloroform / methanol by multiple extractions. After centrifugation to separate the phases, the chloroform / methanol fraction was removed, and the lipids were recovered by drying at 101°C for 30 minutes. The mass of the remaining residue represents the total lipids in the sample (AOAC Method 983.23).

[0405] Lipid fatty acid profile

[0406] Lipids were extracted from polished powder in chloroform according to AOAC Method 983.23. After adding a fraction of hepta-decanoic acid as an internal standard, a portion of the lipid-containing chloroform fraction was evaporated under a nitrogen stream. The residue was suspended in 1% sulfuric acid in anhydrous methanol, and the mixture was heated at 50°C for 16 hours. The mixture was diluted with water and extracted twice with hexane. The combined hexane solution was loaded onto a small Florisil column, the column was washed with hexane, and then fatty acid methyl esters were eluted with 10% ether in hexane. The eluent was evaporated to dry matter, and the residue was dissolved in iso-octane for injection into a GC. The fatty acid methyl esters were quantitatively analyzed against a mixture of standard fatty acids. GC conditions: Column SGE BPX70 30 m x 0.32 mm x 0.25 µm; injection 0.5 µl; Injector 250℃; 15:1 split; flow 1.723 ml / min constant flow; oven 150℃ for 0.5 min, up to 180℃ at 10℃ / min, up to 220℃ at 1.5℃ / min, up to 260℃ at 30℃ / min (total run time 33 min); detector FID at 280℃.

[0407] Antioxidant activity (ORAC-H)

[0408] Hydrophilic antioxidant activity (ORAC-H) was determined according to a modified version of the literature [Huang (2002a and 2002b)] as described in the literature [Wolbang et al. (2010)]. Samples were extracted for lipophilic antioxidants, followed by hydrophilic antioxidants, as follows: 100 mg of sample was weighed three times in a 2 mL microtube. Then, 1 mL of hexane:dichloromethane (50:50) was added, the mixture was vigorously mixed for 2 minutes, and centrifuged at 13,000 rpm for 2 minutes at 10°C. The supernatant was transferred to a glass vial, and the pellet was re-extracted with an additional 2 mL of the hexane:dichloromethane mixture. The mixing and centrifugation steps were repeated, and the supernatant was transferred to the same glass vial. The residual solvent from the pellet was evaporated under a weak nitrogen stream. Next, 1 mL of an acetone:water:acetic acid mixture (70:29.5:0.5) was added and mixed vigorously for 2 minutes. Subsequently, the mixture was centrifuged as before, and the supernatant was used for the ORAC-H plate calibration. If necessary, the sample was diluted with phosphate buffer. The area under the curve (AUC) was calculated and compared with the AUC value for the Trolox standard. The ORAC value is reported as uM Trolox equivalent / g sample.

[0409] phenolic substances

[0410] Slightly modified literature [Li et al. The results were determined by extraction according to the method described in

[2008] . Briefly, free phenolic substances were determined from a 100 mg sample after extraction in 2 mL of 80% methanol by sonication in a glass vial (8 mL volume) for 10 minutes. The supernatant was transferred to a second glass vial, and the extraction of the residue was repeated. The combined supernatant was evaporated into a dry state under nitrogen. 2 mL of acetic acid (2%) was added to adjust the pH to approximately 2, followed by the addition of 3 mL of ethyl acetate, and the phenolic substances were extracted by shaking for 2 minutes. The vial was centrifuged at 2000 xg for 5 minutes at 10°C. The supernatant was transferred to a clean glass vial, and the extraction was repeated two more times. The combined supernatant was evaporated under nitrogen at 37°C. The residue was dissolved in 2 mL of 80% methanol and frozen.

[0411] Samples of the conjugated phenolic compounds were processed in conjunction with the assay for free phenolic compounds for an initial 80% methanol extraction. At this time, 2.5 mL (2 M) sodium hydroxide and a magnetic rod were added to the evaporating supernatant in a glass vial, which was then filled with nitrogen and tightly closed. The vial was mixed and heated at 110°C for 1 hour while stirring. After cooling the sample on ice, it was extracted with 3 mL of ethyl acetate by shaking for 2 minutes. The vial was centrifuged at 2000 x g for 5 minutes at 10°C. The supernatant was discarded, and the pH was adjusted to approximately 2 with 12 M HCl. The phenolic compounds were extracted using 3 x 3 mL aliquots of ethyl acetate as described for free phenolic compounds. The supernatants were combined, evaporated as a dry product under nitrogen at 37°C, and the residue was taken in 2 mL of 80% methanol and frozen.

[0412] After methanol extraction of free phenolic compounds, bound phenolic compounds were measured from the residue. 2.5 mL (2 M) sodium hydroxide and a magnetic rod were added to the residue, then the vial was filled with nitrogen and the lid was tightly closed. The vial was mixed and heated at 110°C for 1 hour while stirring. After cooling the sample on ice, it was extracted with 3 mL of ethyl acetate by shaking for 2 minutes. The vial was centrifuged at 2000 x g for 5 minutes at 10°C. The supernatant was discarded, and the pH was adjusted to approximately 2 with 12 M HCl. Phenolic compounds were extracted using 3 x 3 mL aliquots of ethyl acetate as described for free phenolic compounds. The supernatants were combined, evaporated as a dry product under nitrogen at 37°C, and the residue was placed in 2 mL of 80% methanol and frozen.

[0413] Total phenolic compounds were determined using 100 mg of sample by adding 200 µL of 80% methanol prior to hydrolysis to wet the sample. 2.5 mL (2 M) sodium hydroxide and a magnetic rod were added, then the vial was filled with nitrogen and the lid was tightly closed. The vial was mixed and heated at 110°C for 1 hour while stirring. After cooling the sample on ice, it was extracted with 3 mL of ethyl acetate by shaking for 2 minutes. The vial was centrifuged at 2000 x g for 5 minutes at 10°C. The supernatant was discarded, and the pH was adjusted to approximately 2 with 12 M HCl. Phenolic compounds were extracted using 3 x 3 mL aliquots of ethyl acetate as described for free phenolic compounds. The supernatants were combined, evaporated as a dry product under nitrogen at 37°C, and the residue was taken in 4 mL of 80% methanol and frozen.

[0414] To determine phenolic compounds, the amount of phenol in the treated / extracted samples was measured using Folin Ciocalteu's assay. Standard curves were generated using gallic acid standards at 0, 1.56, 3.13, 6.25, 12.5, and 25 µg / ml. 1 ml of the standard was added to a 4 ml glass tube. For the test samples, a thoroughly mixed 100 ml sample aliquot was added to 900 ml of water in a 4 ml glass tube. Then, 100 ml of Folin Ciocalteu reagent was added to each tube and immediately vortexed. 700 ml of sodium bicarbonate solution (1 M) was added after 2 minutes and mixed by vortexing. Each solution was incubated in the dark at room temperature for 1 hour, and the absorbance was read at 765 nm. The results were expressed in µg gallic acid equivalents / g of sample.

[0415] Phytate

[0416] The phytate content of the powder sample was determined based on the method of Harland and Oberleas as described in the literature [AOAC Official Methods of Analysis (1990)]. Briefly, 0.5 g of the powder sample was weighed and extracted with 2.4% HCl at room temperature for 1 hour using a rotary wheel (30 rpm). The mixture was then centrifuged at 2000 xg for 10 minutes, the supernatant was extracted, and diluted 20-fold with milli-Q water. An anion exchange column (500 mg Agilent Technologies) was placed under vacuum and conditioned for use according to the manufacturer's instructions. The diluted supernatant was then loaded onto the column and non-phytate species were removed by washing with 0.05 M HCl. Phytates were then eluted with 2 M HCl. The collected eluent was digested using a heating block. The sample was cooled, and the volume was diluted to 10 mL with milli-Q water. Phosphorus levels were determined by spectrophotometry using the molybdate-sulfonic acid staining method, and absorbance was read at 640 nm. Phytate was calculated using the following formula:

[0417] Phytate (mg / g) = P concentration * V1 * V2 / (1000 * sample weight * 0.282)

[0418] In the formula, P concentration is the concentration of phosphorus (µg / ml) as determined by spectrophotometry, V1 is the volume of the final solution, V2 is the volume of the extracted phytate solution, and 0.282 is the phosphorus-to-phytate conversion factor.

[0419] Total mineral content prediction

[0420] The total mineral content of the samples was measured by re-testing using AOAC methods 923.03 and 930.22. Approximately 2 g of flour was heated at 540°C for 15 hours, and then the mass of the ash residue was weighed. 0.5 g of whole wheat flour samples were digested using a tube block digestion with 8 M nitric acid at 140°C for 8 hours. Subsequently, the zinc, iron, potassium, magnesium, phosphorus, and sulfur content were analyzed according to the literature [Zarcinas (1983a and 1983b)] using inductively coupled plasma atomic emission spectrometry (ICP-AES).

[0421] Minerals were analyzed at CSIRO (Abray, Adelaide, South Australia), Weight Analytical Services (University of Adelaide, Weight, South Australia), and Dairy Technical Services (DTS, North Melbourne, Victoria). Elements were determined by induced-coupled plasma-optical emission spectroscopy (ICP-OES) after digestion with nitric acid solution (CSIRO) or dilute nitric acid and hydrogen peroxide (DTS), or by induced-coupled plasma-atomic emission spectroscopy (ICP-AES) after digestion with nitric acid / perchloric acid solution.

[0422] vitamin

[0423] Vitamin B1 (niacin), B3 (pyridoxine), and total folate analyses were performed by DTS as well as the National Measurement Institute (NMI). Niacin was measured according to the literature [AOAC Methods 13th Ed (1980) 43.045] and [Lahey, et al. (1999)]. Pyridoxine was measured according to the literature [Mann et al. (2001)]. The method involved pre-column transformation to pyridoxine (pyridoxol), the phosphorylated free form of vitamin B6. Acid phosphatase hydrolysis was used for dephosphorization, followed by Fe 2+ Pyridoxamine was converted to pyridoxal by deamination with glyoxylate in the presence of. Subsequently, pyridoxal was reduced to pyridoxine by sodium borohydride.

[0424] Folic acid was measured using the VitaFast folic acid kit according to the manufacturer's instructions or according to the AOAC method 2004.05.

[0425] Example 2. Isolation and Characterization of Thick-Aleurone (ta) Mutant

[0426] Establishment and cultivation of mutant rice populations

[0427] Approximately 8,000 grains (designated as M0 grains) from the wild-type rice variety Zhonghua11 (ZH11) were mutagenic by treatment with 60 mM ethyl methanesulfonate (EMS) under standard conditions. The mutagenic grains were planted in a field, and the resulting plants were cultivated to produce M1 grains. The M1 grains were harvested and subsequently planted in a field to produce M1 plants. 8,925 panicles were harvested from 1,327 individual M1 plants. From these plants, 36,420 M2 grains were selected, each containing at least 4 grains from each panicle.

[0428] Mutant selection by staining half of the grains

[0429] The pericarp (pericarp and periglabra) of M2 rice grains was removed. Each of the 36,420 grains was transversely bisected. The embryo-containing halves were placed in 96-well plates for subsequent germination, and each embryo-free halve was stained with Evans Blue and observed under a dissecting microscope to detect mutant grains with thickened aleurone compared to the wild type. The staining was based on the principle that Evans Blue can only pass through and stain non-living cells, such as those in the starchy endosperm, and that no color change is observed in the living aleurone layer. From the initial Evans Blue staining and histological analysis, individual grains exhibiting a significant increase in aleurone thickness were observed, as well as grains showing a significant increase in thickness of the aleurone on the ventral side of the seed. The remaining grains showed an increase in aleurone thickness, but to a lesser extent. The unstained area of ​​the dorsal side of each seed was specifically investigated for the thickness of the aleurone layer. Variants with an increased aleurone layer thickness on the dorsal side of the grain were also observed. Only variants with a significant increase in aleurone layer thickness across the entire cross-section were selected for further analysis.

[0430] Compared to wild-type hemisphere grains, hemisphere grains having a thicker region not stained with Evans blue were selected. Of the 36,420 grains examined, 219 grains (0.60%) showing differences in aleurone thickness were identified and selected. These were obtained from 162 panicles from 140 individual M1 plants, and therefore most represented independent mutants. In particular, one mutant grain was identified and characterized as having a mutation labeled thick-aleurone 2 (ta2), as further described below. Therefore, the corresponding wild-type gene Ta2 It is denoted as such, and this notation is used in this specification.

[0431] To maintain a presumed mutant line, each corresponding developed half-grain was germinated on a medium containing half-concentration MS salt (Murashige and Skoog, 1962) solidified with 1% Bacto agar (Bacto, 214030) and grown at 25°C under light intensity of 1500 to 2000 lux in a 16-hour day / 8-hour night cycle. Seedlings were transplanted to soil at the 2 to 3 leaflet stage, and the resulting plants were grown to maturity. At the time of germination and cultivation of the corresponding developed half-grain, 115 seeds (52.5% survival) grew to produce mature and fruiting plants.

[0432] Candidate mutant plants were identified, selected, and further analyzed for exhibiting few or no defects in general agronomic characteristics—such as normal plant height, fertility (female and male reproductive capacity), grain size, and 1,000-grain weight compared to wild-type parent varieties—as well as stable inheritance of thickened aleurone characteristics. Among these, those exhibiting a more extreme multi-aleurone phenotype with 6 to 7 cell layers ta2 indicated as 'Ra' Mutants were selected and analyzed in detail. As expected, the wild-type grains exhibited a single cell layer of algae.

[0433] ta2 Histological analysis of mutant grains

[0434] Wild type ZH11 and ta2Developing grains from mutant plants were studied, and morphological changes were compared 1 to 30 days after pollination (DAP). The ripening stages of rice grains can be described as having three stages: the milk grain stage, the dough grain stage, and the mature grain stage. In the dough grain stage, the grains of the wild-type panicle began to change from green to yellow, and then the vesicular tissue connecting the stem and the caryopsis was gradually destroyed. ta2 The color change of the grains in the panicle was delayed. Microscopic observation of the cross-section of the rice grain also ta2 The mutant grains exhibited an increased degree of opacity. Subsequently, scanning electron microscopy (SEM) was used to study the structure of starch granule organization in the central part of the starchy endosperm. In wild-type grains, the starch granules were tightly packed and exhibited a smooth surface and regular shape, but ta2 In the grain , irregular-shaped starch granules Looser packing was observed. In summary, ta2 At least three of the following changes were observed in plants and grains with mutations: delayed grain maturation, increased grain whitening, and starch granule structure.

[0435] Developing mutants and wild-type grains at 6, 7, 8, 9, 10, 12, 15, 18, 21, 24, 27, and 30 DAP were stained with Evans blue, and the aleurone layer was observed using an optical microscope. Up to 10 DAP, wild-type grains and ta2 No significant changes were observed in the thickness of the developing aleurone layer between mutant grains. After 10 DAP, ta2 The aleurone layer of the mutant was thicker than that of the wild-type grain, and the difference reached a maximum of approximately 20 DAP. These results were consistent with those from Sudan Red staining.

[0436] Wild-type grains and ta2 Mutant grains (30DAP) were further investigated for histological differences by cutting (1 µm), staining, and using a light microscope. After staining with 0.1% toluidine blue, which stains nucleic acids blue and polysaccharides purple, a monolayer of large, regularly oriented rectangular cells was observed in the wild-type grains. In contrast, ta2 Flakes of the mutant grains had an aleurone layer consisting of 6 to 8 cell layers, and the cells had varying sizes and irregular orientations. These observations are ta2 It was indicated that the thickening of the aleurone in the grain was mainly caused by an increase in the number of cell layers, rather than an increase in individual aleurone cells.

[0437] Additional staining with 0.01% Calcoflour White, a fluorescent cell wall stain, on wild-type grains and ta2 There was no difference in cell wall thickness between mutant grains. The cell walls of aleurone cells were wild-type grains and ta2 In the case of both grains, the cell walls were thicker than those in the starchy endosperm.

[0438] ta2 Analysis of agronomic characteristics of mutant plants and grains

[0439] After producing the BC3F3 generation by backcrossing wild-type (ZH11) plants in farmland for three generations and thereby eliminating additional unrelated mutations that may arise from mutagenic treatment, ta2 Some agronomic traits of mutant plants were analyzed. ta2 The mutant plants and grains did not differ significantly from the wild-type plants and grains in plant height, 1,000-grain weight, grain size (length, width, and thickness), and morphology (Table 2). In contrast, the wild-type plants exhibited a fruit set rate of 98.9%, whereas, ta2The mutant plants showed a decrease in fruit set rate to 73.4%. The fruit set rate was calculated as the percentage of florets in seed-filled plants based on the grain maturity stage. Furthermore, ta2 When mutant grains were grown at 28°C under a 12h day / 12h night cycle without humidity control in a growth chamber, they exhibited a decrease in germination ability of 75.1% compared to wild-type grains of 97.3%. Germination was defined as the time when the radicle visually emerged through the seed coat.

[0440] Example 3. ta2 Genetic analysis of mutants

[0441] Based on aleurone and endosperm tissues in growing plants, two genetic experiments were performed to determine whether the thick aleurone phenotype was determined maternally. First, maternal ta2 Test crosses were performed between (mutant) plants and paternal wild-type plants, and F2 offspring grains were obtained. Among the F2 grains, 49.4% (n=634) exhibited the thickened aleurone phenotype, which deviated significantly from the 3:1 (wild-type:mutant) ratio predicted for the Mendelian inheritance of the dominant gene in the F2 population. Secondly, repulsion crosses ta2 The experiment was conducted between the plant and the wild-type plant. All F1 seeds (100%; n=589) exhibited a thickened aleurone phenotype, whereas in a reciprocal cross using the wild-type as the maternal plant, all F1 seeds (n=197) induced the wild-type phenotype. These crosses indicated that the aleurone phenotype was determined by the maternal plant genotype.

[0442]

[0443] In order to establish whether the maternal effect is determined by the gametophyte genotype or the sporophyte genotype, homozygous Ta2 / Ta2 homozygous ta2 / ta2 Heterozygous obtained from crossbreeding between plants Ta2 / ta2 person F1 plants ta2 Homozygosity ta2 / ta2 It was used in reciprocal crosses with ) or wild-type plants. In reciprocal crosses between maternal heterozygotes and paternal wild-types, 47.3% (n=188) of F1 grains exhibited the ta2 mutant phenotype, whereas maternal ta2 In repulsion crosses between plants and paternal heterozygotes, 99.3% (n=425) of F1 individuals ta2 The mutant phenotype was shown. From these results, TA2 It was concluded that genes conferred the phenotype through the gametophyte and maternal inheritance modes.

[0444] According to the above genetic analysis, ta2 It can be suggested that the genetic model follows the mode of maternal inheritance of the gametophyte. The genotype of the maternal gametophyte is ta2 In this case, the endosperm phenotype is mutant ta2 (thickened aleurone) and is independent of the paternal genotype. Therefore, since the thickened aleurone phenotype is determined solely by the maternal gametophyte genotype during the development of the triploid starchy endosperm and aleurone, the maternal heterozygote produced 50% of offspring with a thickened aleurone phenotype independent of the paternal genotype, and the maternal ta2 / ta2 The homozygous produced 100% of offspring with a thick aleurone phenotype. TA2 Whether the maternal effect of the gametophyte is caused by the presence of additional copies of the maternal gene in the triploid endosperm or the paternal A2 Further experiments are needed to test whether it is induced by the effect of gene imprinting by maternal gametes that suppress gene expression.

[0445] Example 4. By gene mapping and sequence analysis Ta2 Identification of genes

[0446] SSR and INDEL markers for gene mapping

[0447] For gene mapping, the F2 plant population is within the genetic background of ZH11 (Japonica varieties). ta2It was produced from genetic crosses between plants containing the mutation and plants of the Indica variety NJ6. To identify genetic markers that are polymorphic between ZH11 and NJ6 and can subsequently be used for genetic mapping, PCR experiments were performed on leaf DNA samples from homozygous ZH11 plants, homozygous NJ6 plants, and a 1:1 mixture of DNA. Analysis of the PCR products by gel electrophoresis enabled comparison of products from ZH11, NJ6, and the mixture to identify polymorphic markers. Primer pairs were selected for genetic mapping only if amplification using separate ZH11 and NJ6 DNAs resulted in distinct amplified products, and the mixed DNA represented a combination of both products. A total of 124 primer pairs were selected, including 54 insertion-deletion polymorphisms (INDELs) and 70 short sequence repeat (SSR) polymorphisms. These gene markers were distributed along the rice genome at intervals of approximately 3 to 4 Mbp and provided good coverage for gene mapping.

[0448] ta2 For allele genetic mapping, 143 plants from the F2 population were scored using 124 polymorphism markers. In the mapping population for aleurone phenotype, the homozygosity of individual F2 plants was carefully evaluated by the phenotype of F3 progeny grains obtained from each F2 plant. Leaf DNA was extracted as described in Example 1. PCR amplification was performed as described in Example 1, and the products were separated by gel electrophoresis through 3% agarose. From the results ta2 It was concluded that the locus is located between markers INDEL 127 and INDEL 129 on chromosome 1 from the rice genome sequence, corresponding to a physical distance of approximately 217 kb (Fig. 1, top line).

[0449] Another 5,000 F2 plants were selected using these marker pairs. 362 individuals were identified and selected, representing recombination between INDEL 127 and INDEL 129. When these recombinant plants were phenotyped, thereby ta2 The locus was mapped to a 42.8kb region between the INDEL 149 and INDEL 128 markers (Fig. 1, second line).

[0450] ta2 The nucleotide sequences of these regions are obtained from mutant plants, compared with the wild-type sequence, and thereby ta2 To identify the corresponding mutations, flanked primers were designed for the genomic region, and DNA sequencing was performed. Comparison of genomic DNA sequences identified two single-nucleotide polymorphisms (SNPs) in the sequenced region for both genes annotated as LOC_01g11900. The first was a single nucleotide G (wild type) versus A (ta2) polymorphism at nucleotide locus Chr1: 6451738, located within intron 14 between exons 14 and 15 within the gene LOC_01g11900 on chromosome 1, in relation to the genomic sequence of Japonica rice (asterisk in Fig. 1). The second polymorphism was a G (wild type) to A (ta2) substitution at position Chr1: 6452308, located within the intron region (intron 15) between exons 15 and 16 of the gene LOC_01g11900 on chromosome 1.

[0451] RNA extraction, ta2Upon reverse transcription and sequencing of the cDNA corresponding to the alleles, it was observed that the first G to A polymorphism in Chr1: 6451738 was associated with a 21 bp insertion between exons 14 and 15 (Fig. 2), corresponding to a 7-amino acid in-frame insertion in the predicted amino acid sequence (Fig. 3). In contrast, there were no changes in the cDNA sequence for the mutation between exons 15 and 16, corresponding to the second polymorphism in locus Chr1: 6452308. From these data, the first polymorphism within intron 14 is the causative change, that is, within that grain ta2 It was concluded that it was a mutation. This conclusion was confirmed in the following examples. Furthermore, this mutation is wild-type Ta2 Compared to genes ta2 It was concluded that this led to changes in the splicing pattern of the gene's RNA transcripts, thereby inducing the ta2 phenotype. From the ratio of the number of cDNAs with 21 nucleotide insertions to the number of cDNAs without insertions, ta2 It was predicted that approximately 80% of the RNA transcripts from the (mutant) gene were spliced ​​at the newly generated splice site. If the mutant polypeptide with a 7-amino acid insertion is considered inactive, the mutant ta2 It was concluded that the gene maintained about 20% of the activity compared to the wild type.

[0452] The gene at locus LOC_01g11900 on chromosome 1 of the rice genome is an Arabidopsis thaliana gene encoding a bifunctional DNA glycosylase / lyase. Demeter gene( AtDME Rice, a cognate of ) ROS1a gene( OsROS1a Annotated as ). Arabidopsis DME enzyme acts as a DNA demethylator, reducing the methylation of C residues in DNA. Therefore, Ta2 Genes OsROS1a Genes and Arabidopsis DME It is synonymous with gene homologs.

[0453] Rice, including a promoter and a protein-coding region from nucleotides 4,727 to 15,869, including a promoter and a 5-UTR (untranslated region) of 4,726 nucleotides, 16 introns, and a 3'UTR of 615 nucleotides. ROS1a The nucleotide sequence of the gene is presented at SEQ ID NO. 9. The nucleotide positions of the 16 introns are provided in the legend for SEQ ID NO. 9. SEQ ID NO. 9 is also at its 3' end OsROS1 It includes a downstream region of 401 nucleotides that is not considered part of the gene. Wild type OsROS1 The nucleotide sequence of the cDNA corresponding to the gene is provided at SEQ ID NO. 8, and the polypeptide encoding 1952 amino acids is provided at SEQ ID NO. 2.

[0454] Rice has four ROS1 genes encoding polypeptides labeled as OsROS1a, OsROS1b (LOC_Os02g29230), OsROS1c (LOC_Os05g3735), and OsROS1d (LOC_Os05g37410). Rice also has two other Demeter homologues thought to encode DNA glycosylase, namely Demeter-like-2 (DML2) and Demeter-like-3 (DML3).

[0455] Description of structural features in wild-type rice TA2 polypeptide

[0456] rice TA2 Genes OsROS1aAfter discovering that it was identical to, the amino acid sequence of the OsTA2(OsROS1) polypeptide was investigated. Several typical DNA glycosylase structural features were identified. The glycosylase domain of the ROS1 protein possesses at least three identified motifs that are recognizably sufficiently conserved to hold the [4Fe-4S] cluster in place: a helix-hairpin-helix (HhH) motif (e.g., expressed by amino acids 1491 to 1515 in OsTA2), a glycine / proline-rich motif followed by a conserved aspartic acid (GPD), and four conserved cysteine ​​residues (e.g., within the region of amino acids 1582 to 1598). A lysine-rich domain (e.g., expressed by amino acids 87 to 139 in OsTA2) is also present. Unlike other members of the HhH DNA glycosylase superfamily, ROS1a - Family members contain additional divalent conserved domains (domains A and B) flanked to the central glycosylase domain (Mok et al., 2010). In the rice TA2 polypeptide (SEQ No. 2), domain A occurs at amino acids 859 to 965, the glycosylase domain occurs at amino acids 1403 to 1616, and domain B occurs at amino acids 1659 to 1933. Domain A contains a repeating mixed-charge cluster at amino acids 882 to 892. At The conserved DNA glycosylase domain and flanked domains A and B of DME have been reported to be essential and sufficient for DNA glycosylase / lyase enzyme activity, as indicated by mutagenic analysis (Mok et al., 2010).

[0457] Example 5. ta2 Analysis of nutrient composition in mutant grains

[0458] In order to measure the composition of mutant grains, especially regarding nutritionally important components, ZH11 and ta2Plants were grown simultaneously in the farmland under identical conditions. Whole grain flour samples were prepared from the kernels harvested from the plants and used for compositional analysis. The results of the close analysis of the flour (average of two repeated measurements) are provided in Table 2.

[0459] [Table 2]

[0460]

[0461] Proximity analysis is ta2 The mutant powder showed an increase of approximately 50% in total fat content. Total nitrogen analysis was ta2 No significant changes were observed at the protein level between the mutant and wild-type grains. A re-test measuring the amount of material remaining after the combustion of dehydrated powder samples showed that, compared to the wild type, ta2 It demonstrated a 26% increase in grains. The total fiber level is ta2 It increased by approximately 200% in the grain. The starch content is ta2 It decreased by 8.6% compared to the wild type of grain. These data ta2 It was demonstrated that an increase in the thickness of the aleurone layer in mutants caused an increase in the levels of aleurone-rich nutrients, such as lipids, minerals, and fiber, without altering seed size. To understand these and other changes in more detail, an intensive analysis was performed as follows.

[0462] minerals

[0463] To measure mineral content, ICP-AES, a combination of inductively coupled plasma (ICP) and atomic emission spectroscopy (AES), was used. This is a standard method for measuring mineral content and provides sensitive, high-throughput quantitative analysis of a significant number of elements in a single analysis. Data obtained from the analysis indicated that mutant grains had zinc and iron levels increased by approximately 15% by weight compared to wild-type grains. Zinc levels increased from 13.9 mg / kg to 16.0 mg / kg, while iron increased from 12.4 mg / kg to 14.2 mg / kg.

[0464] Increases in potassium, magnesium, phosphorus, and sulfur were also observed, increasing by approximately 28%, 23%, 22%, and 9%, respectively. These results are based on measurements of most minerals, ta2 It coincided with an increase in ash content in the grains.

[0465] Antioxidants

[0466] Antioxidants are biomolecules that counteract the negative effects of oxidation in animal tissues and thus can prevent oxidative stress-related diseases, such as infections, cardiovascular diseases, cancer, and aging-related disorders (Huang, 2005).

[0467] taThe antioxidant capacity of the powder obtained from mutant grains and wild-type rice grains was measured by the Oxygen Radical Absorbance Capacity (ORAC) assay as described in Example 1. In the ORAC assay, antioxidant capacity is expressed by the competitive kinetics between endogenous biomolecule-capturing radicals and the oxidative molecular fluorescent probe fluorescein against synthetic free radicals generated by AAPH (2,2'-azabis(2-amidino-propane)dihydrochloride). This capacity was calculated by comparing the area under the velocity curve (AUC) representing the fluorescence cleavage kinetics of the molecular probe fluorescein for the grain with the AUC generated by the Trolox standard (Prior, 2005). An alternative approach for quantifying antioxidant capacity is through the use of the Foline-Siocalto reagent (FCR); This represents antioxidant capacity by measuring the reducing ability of total phenolic compounds in food samples. The FCR assay is relatively simple, convenient, and reproducible. However, the more time-consuming ORAC assay measures biologically more relevant activity. Since antioxidants include a wide variety of polyphenols, reducing agents, and nucleophiles, measurements by both FCR and ORAC can provide better coverage and a more comprehensive representation of total antioxidant capacity. As reported in the literature [Prior (2005)], the results of FCR assays and ORAC measurements are generally consistent.

[0468] Both FCR and ORAC tests were increased compared to wild-type, ZH11 whole grain flour ta2 The antioxidant capacity of the powder from mutant whole grain flour was demonstrated. FCR is ta2 An increase of approximately 35% in total phenolic compounds was demonstrated in the mutant. ta2 There was also an 83% increase in hydrophilic antioxidant content in the powder from the mutant.

[0469] Phytate

[0470] When grown under conditions with adequate phosphorus, approximately 70% of the total phosphorus content in rice grains is in the form of phytate or phytic acid (myo-inositol-1,2,3,4,5,6-hexakisphosphate). Dietary phytate may also play a beneficial role in health as a strong antioxidant (Schlemmer, 2009). Total phytate analysis compared to the wild type ta2 The phytate content showed an increase of about 19%, which was from about 10.8 mg / g to about 12.7 mg / g.

[0471] Vitamin B

[0472] ta2 The levels of vitamins B3, B6, and B9 in the powder were approximately 19%, 63%, and 58% higher, respectively, than in the wild-type powder. When the test was repeated on four replicates, the increase in mean values ​​was approximately 20%, 33%, and 38%, respectively. Since it is known that aleurone is richer in vitamins B3, B6, and B9 than endosperm (Calhoun, 1960), ta It was concluded that the increase in aleurone thickness in mutant grains is responsible for the increase in vitamin B3, B6, and B9 content.

[0473] Dietary fiber

[0474] As described in Example 1, the total dietary fiber measured was observed to have increased by about 70%. Insoluble fiber increased by about 55%.

[0475] carbohydrate

[0476] With a heavy feeling ta2 The starch content of the grains decreased by 9%. In contrast, sucrose levels increased 2.5-fold in mutant grains, and monosaccharides (arabinose, xylose, galactose, glucose) increased from 31% to 118% compared to the wild type.

[0477] conclusion

[0478] Nutrient analysis is farmland-grown ta2 It was indicated that in whole grain flour produced from grains, most aleurone-rich nutrients—including macronutrients such as lipids and fiber, micronutrients such as minerals (iron, zinc, potassium, magnesium, phosphorus, sulfur), B vitamins such as B3, B6, and B9, antioxidants, and aleurone-associated biomolecules such as phenolic compounds and phytates—were significantly increased compared to the wild type. Additionally, substantial increases in free sucrose and monosaccharides were present. Along with the increases in these nutrients and micronutrients, as a relative percentage ta2 Starch content was slightly reduced in the mutant.

[0479] Example 6. Ta2 Selection for additional mutant alleles in genes

[0480] A mutant population of rice plants in the ZH11 gene background (Example 2) was selected by the TILLING assay as described in Example 1 so that they could be tested for the thickened aleurone phenotype. Ta2 Additional polymorphisms were identified in the gene. The method utilized heterologous duplexing of labeled wild-type RNA and candidate mutant RNA, and is essentially an endonuclease as described in the literature [Jiang et al. (2013)]. Cel Digested by I. TA2 Although the 5' region of the gene was selected first for selection, any region of the gene can be selected.

[0481] Multiple single nucleotide polymorphisms by TILLING assay Ta2 It was identified in the 5' region of the gene. Grains from polymorphic plants were the first ta2Thickened aleurone, similar to the mutant, and other grain phenotypes were investigated. Some grains exhibited thickened aleurone. These grains exhibiting the mutant phenotype and the offspring plants obtained therefrom were selected. In each Ta2 The presence of mutations was confirmed by determining the nucleotide sequence of the gene. In each mutant Ta2 The altered nucleotide(s) in the gene were identified. Three other thickened glaucoma mutants were also sequenced. Other grains containing polymorphisms but not exhibiting thickened glaucoma were also identified and retained for comparison. The identified mutants and other polymorphic lines, and their glaucoma phenotypes, are summarized in Table 3. Mutants with thickened glaucoma are indicated as follows: ++, significantly thickened glaucoma; +, slightly thickened glaucoma; -, unchanged glaucoma phenotype. It was evident that a variety of mutations and generated phenotypes were obtained.

[0482] The aleurone in wild-type ZH11 grains exhibited a thickness of one cell layer. In contrast to the specific mutant, the aleurone in mutant grains containing the V441A mutation was thickened on the dorsal side and contained about 5 to 6 cell layers. The aleurone in mutant S1357F grains was about 4 to 5 cell layers thick and the grain shrank, whereas the grain of mutant R482K grains was 2 to 3 cell layers thick and the grain did not shrank. The aleurone in mutant S214F grains contained 2 to 4 cell layers and shrank like the grains from mutants S156F and S1413N. In contrast, the aleurone of the K501S grain had 2 to 3 cell layers, and the grain did not shrivel. Therefore, various mutants and phenotypes Ta2 It was easily obtained from genes.

[0483]

[0484] TA2 Among the 60 newly identified lines exhibiting genetic polymorphism, 19 had amino acid changes (substitutions) in the predicted polypeptide products. Of these, at least 7 exhibited a thickened egg-grain phenotype. The S1413N and D1425N mutations are located within the glycosylase domain; other identified mutations are located outside the glycosylase domain. Unlike the initial splice-site variant mutants, all identified mutations were amino acid substitutions. There were no deletions or stop codons, which the inventors OsROS1 In It led to the conclusion that the mutation could be fatal. In Arabidopsis, maternal dme It has been reported that mutations caused stunted seeds (Choi et al., 2002 and 2004). In rice, ros1a The presence of a maternal null allele caused failure of early endosperm development regardless of paternal genotype (Ono et al., 2012).

[0485] TA2 ( OsROS1a The recovery of 10 new independent mutant alleles in the ) gene (each of which possessed a thickened aleurone layer in the grain) indicated that mutations in this gene are decisive in inducing the thickened aleurone phenotype. Additionally, all of these new mutations were the first ta2 The mutations were located in different regions of the gene, indicating that the gene can be altered at various sites along the entire length to achieve a thickened phenotype.

[0486] from mutants exhibiting thick grain ta2Several genes were cloned, the encoded polypeptides were expressed, and DNA glycosylase / lyase activity was tested. This confirmed that these polypeptides have reduced DNA glycosylase / lyase activity compared to the wild-type polypeptide.

[0487] Example 7. Complementarity analysis of ta2 mutants

[0488] Ta2 ( OsROS1a To reinforce the conclusion that mutations in the ) gene are responsible for thickened egg whites and the associated phenotype, complementarity experiments were performed by introducing a wild-type copy of the gene into the mutant line via transformation. To construct the transformation plasmid for the complementarity experiment, Ta2 A 16,882-nucleotide DNA fragment containing the introduced gene (nucleotide sequence provided as Sequence No. 9) was isolated from the wild-type rice genome. This fragment consists of, in order, a 4726-bp upstream sequence (which is considered to contain the gene's promoter), the entire fragment including all introns. OsTA2 It contained a protein-coding region, a 615-nucleotide 3'-UTR, and a 401-bp downstream region. It was amplified from ZH11 genomic DNA using a series of oligonucleotide primers, assembled, and then Kpn I and Sal It was digested with I and ligated into the binary vector pCAMBIA1300. The vector also contained a hygromycin resistance gene as a selective marker gene. The transformation plasmid and the control plasmid (empty vector) were introduced into the Agrobacterium tumefaciens strain EHA105, respectively, and rice recipient cells were transformed using the method described in the literature [Nishimura et al. (2006)]. A total of 32 T0 gene-transplanted plants were produced as wild-type Ta2They were generated from transgenic plants containing the gene. These plants were transferred to soil and grown to maturity in a growth chamber. When testing for the presence of the hygromycin resistance gene using PCR, 20 transgenic lines possessing the hygromycin gene were identified and selected. These were grown to maturity, and grains (T1 seeds) were harvested from each plant. Each of these plants was wild-type, as confirmed by PCR testing. Ta2 It contained T-DNA from a vector containing a gene.

[0489] The aleurone phenotypes of grains harvested from these plants were investigated by staining with Evans Blue. At least three of the transgenic plants produced grains with normal aleurone similar to the wild type, which is due to the introduced gene and the resulting ta2 It showed positive expression of mutation complementarity. This Ta2 It was definitively proven that mutations in genes caused mutant phenotypes.

[0490] Ta2 The gene below ROS1a They are called genes; these terms are interchangeable.

[0491] Example 8. In vitro enzyme activity assay of recombinant TA2 and ta2 proteins

[0492] As described in Example 4 above, in rice Ta2 Genes OsROS1a It was identical to the gene, which is homologous to the Arabidopsis thaliane DNA demethylator / glycosylase named Demeter (DME; Gehring et al., 2006). DME destroys the phosphodiester linkage on the 3' side of a 5-methylcytosine residue in a hemimethylated DNA substrate.

[0493] Therefore, the enzymatic activity from recombinant rice Ta2 and ta2 proteins is tested by measuring its activity against a labeled semi-methylated DNA substrate, which generates end-labeled DNA that migrates on a denatured polyacrylamide gel at the predicted site for the removal product, as described in the literature [Gehring et al. (2006)].

[0494] To express and purify Ta2 and ta2 polypeptides recombinantly, the whole length from wild-type and mutant ta2 plants ROS1a cDNA oligonucleotides JH021(5'-TTAATCTAGAATGCAGAGCATTATGGACTCG-3'; SEQ ID NO. 42) and JH017(5'-CGGTCGACTTAGGTTTTGTTGTTCTTCAATTTGC-3'; SEQ ID NO. 43)(this Xba I and Sal I. Each restriction site is added to the end of the amplified DNA fragment) and used as a template in the PCR reaction. The PCR product Xba I and Sal digest with I, clone into the pMAL-c2x vector (NEB), and c2x- ROS1a Generates a genetic construct. Genetically engineered E. coli Rosetta Transform into cells (Novagen). To produce polypeptides, grow the transformed cells at 28°C in LB supplemented with 0.2% glucose, 100 µg / ml ampicillin, and 50 µg / ml chloramphenicol until they reach an OD600 of 0.4. ROS1a-Mal fusion protein expression is induced with 10 μM IPTG at 18°C ​​for 1 hour. The culture is centrifuged at 6,500 rpm for 15 minutes at 4°C, and the pellet is resuspended in 30 mL of column buffer (20 mM Tris-HCl, pH 7.4, 200 mM NaCl, 1 mM EDTA) at 4°C. Cells are sonicated on ice for 2 minutes using a Branson Sonifier 250 at power setting 4. The lysate is centrifuged at 9,000 rpm for 25 minutes at 4°C, the supernatant is collected, and applied to gravity column purification. ROS1a The -Mal fusion protein is purified via amylose resin according to the manufacturer's protocol (New England Biolabs). The eluted protein is dialyzed overnight at 4°C against 50% glycerol in a Slide-A-Lyzer dialysis cassette (10,000 MWCO; Pierce). Protein concentration is determined by the Bradford method using a protein assay kit (Bio-Rad Laboratories), and the protein is stored at -20°C until further use.

[0495] ROS1a The DNA glycosylase activity of the -Mal fusion protein against a half-methylated double-stranded DNA substrate is tested as described in Example 1 (Gehring et al., 2006).

[0496] As a control group, ROS1a When incubated with unmethylated DNA oligonucleotides or incubated with a semi-methylated DNA substrate without enzymes, lyase activity or covalent trapping is not detected.

[0497] Example 9. In rice ROS1a Genetic homologues

[0498] Plant genes encoding DNA glycosylases that mediate DNA demethylation have been primarily characterized in Arabidopsis thaliana (Chan et al., 2005; Law and Jacobsen, 2010; Zhu, 2009). This Demeter (DME, Choi et al., 2002; Gehring et al., 2006), ROS1 (Gong et al., 2002; Agius et al., 2006), Demeter-Similar 2 (D ML2 ) and Demeter-Similar 3 Gene (D ML3 Includes , Choi et al., 2002; Ortega-Galisteo et al., 2008). Among these genes (and encoded polypeptides), the largest DME It is most strongly expressed in the homoploid core cells of the female gametophyte prior to fertilization, which promotes maternal allele-specific total hypomethylation and the expression of imprinted genes contained in the endosperm. In contrast, ROS1 , DML2 and DML3 It is expressed in trophic tissues (Gong et al., 2002; Penterman et al., 2007). ROS1 Compared to, DML2 and DML3 The level of gene expression is low (Mathieu et al., 2007). Furthermore, ros1 , dml2 and dml3 Homozygous mutations in [location] did not yield a clear morphological phenotype, but maternal dme The mutations caused stunted seeds, i.e., embryo lethality, and were not transmitted to offspring (Choi et al., 2002 and 2004). Despite these low expression levels, ROS1, DML2, and DML3 polypeptides still function as DNA glycosylases / lyases (Gong et al., 2002; Morales-Ruiz et al., 2006; Penterman et al., 2007). From this data, ROS1 It was not expected that the mutation would cause a thickened eggshell phenotype.

[0499] Phylogenetic analysis shows that the rice genome has 6 putative DNA glycosylases for cytosine demethylation ( ROS1 ortholog OsROS1a , OsROS1b , OsROS1c , OsROS1d 4 that appear to be ), and 2 obvious DML3 It was shown that it encrypts (including orthologs) (Zemach et al., 2010). OsROS1a Null mutations were identified in, but were not transmitted from male or female plants containing the mutation, which is probably ROS1a This is because wild-type DNA glycosylase is essential for both male and female gametophyte development (Ono et al., 2012). The inventors OsROS1a No published reports of partial mutations in are recognized.

[0500] Three identified motifs in the DNA glycosylase domain, namely the helix-hairpin-helix (HhH) motif, the glycine / proline-rich motif, and the subsequently conserved aspartic acid (GPD), and four conserved cysteine ​​residues (Example 4) were present in each member of the Demeter family. Glycosylase domain structures were also found in human 8-oxo-guanine DNA glycosylase (hOGG1), E. coli adenine DNA glycosylase (MutY), and endonuclease III (Endo III) (Bruner et al. 2000; Guan et al. 1998; Mok et al., 2010). Unlike other members of the HhH DNA glycosylase superfamily, the DME-family members contained additional divalent conserved domains (domain A and domain B) flanked to the central glycosylase domain (Mok et al., 2010).

[0501] The nucleotide sequences of the protein-coding regions for homologous genes were aligned using ClustalW (www.ebi.ac.uk / Tools / msa / clustalw2 / ). Rice for the corresponding regions of homologous genes in other species ROS1a The degree of sequence identity of the protein-coding region is shown in Table 4.

[0502] The inventors found from these analyses that rice is a plurality ROS1 They have genetic homologues, but DME It was concluded that the gene is not like that. In rice, as in Arabidopsis, ROS1 is its congener in the same species in relation to the degree of sequence identity. DML2 and DML3 It was clearly distinguished from.

[0503]

[0504] Example 10. In rice ROS1a Gene expression

[0505] In different rice tissues, including parts of the developing grain TA2 Experiments were performed to analyze gene expression. In the first experiment, TA2 mRNA was detected by homohybridization in rice tissue sections as described in the literature [Brewer et al. (2006)]. Briefly, after vacuum infiltration, various rice tissues were fixed in FAA fixative at 4°C for 8 hours, dehydrated using a graded ethanol series followed by a xylene series, and embedded in a Paraplast Plus (Sigma-Aldrich). Microtome sections (8 µm) were mounted on Probe-On Plus microscope slides (Fisher).

[0506] From the hybridized signal, TA2 It was concluded that it was expressed in the pericarp, seed coat, and aleurone tissue, and in the starchy endosperm of rice, but not in the vascular bundles.

[0507] Relative expression levels in different plant tissues were evaluated using real-time reverse transcription polymerase chain reaction (RT-PCR). Surprisingly, these results showed the highest relative expression in pollen, followed by anthers, young panicles, and aleurone tissues (Fig. 6). In the anthers OsROS1a It has been considered that the specific expression of [it] may be involved in the repression of transposons in male gametes. In Arabidopsis tricellular pollen, active DNA demethylation is important for maintaining the basal expression of transposons in the nucleus of the vegetative cell to produce siRNA that enhances RNA-dependent DNA methylation (RdDM) of transposons in male gametes, i.e., two sperm cells (Zhu, 2009; Zhu et al., 2007).

[0508] In developing seeds ROS1aThe expression of increased until day 10 of flowering and then decreased thereafter. Strong expression was observed in both the starchy endosperm and aleurone tissues. The early expression pattern in seed development coincided with the formation of thickened aleurone prior to the cellization of the endosperm during seed development. The inventors [discussed] the period from the day of flowering to 7 days after flowering (pollination) (0 to 7 DAP). ROS1a It was concluded that reduced expression of is important for the formation of thick aleurone.

[0509] Example 11. Patterns of gene methylation in rice

[0510] Overall, wild type TA2 Compared to plants ta2 To determine the methylation patterns of all rice genes in mutant plants, DNA was isolated from the endosperm and embryo, treated with bisulfite reacting with unmethylated cytosine, and then sequenced using Illumina. The endosperm was at 10 DAP ta2 Separations were isolated from developing rice grains of plants and wild-type (ZH11) plants, and from embryos of wild-type plants at the same stage of grain development. For sequencing after bisulfite treatment, conventional Illumina adapters were synthesized in which cytosine was replaced by 5-methylcytosine so that the adapter could survive the bisulfite transition. Paired end (PE) adapters were synthesized, which allowed each molecule to be sequenced from both ends, thereby facilitating subsequent alignment to the genomic scaffold sequence. Approximately 0.5 to 1 µg of genomic DNA was obtained from wild-type plants and ta2DNA was isolated from excised endosperms of both the plant and the wild-type embryo. The isolated DNA preparations were sheared by sonication into fragments of 100 to 500 bp. Adapters were ligated to the sheared fragments according to the Illumina protocol. The DNA was then treated twice with sodium bisulfite, which converts unmethylated cytosine (C) to uridine (U), using the Qiagen EpiTect kit, and amplified by 18 cycles of PCR using PfuTurboCx DNA polymerase (Stratagene), a proofreading enzyme that tolerates uridine on the template strand. These PCR amplifications generated a library of DNA fragments with distinct adapters at each end, where 'forward' Illumina sequencing primers produced nucleotide sequences from the 'original' genomic DNA-derived strand (where C corresponded to methylated C, T corresponded to unmethylated C, where C occurred in the genomic sequence) and 'reverse' Illumina sequencing primers produced nucleotide sequences from the complementary strand (where G corresponded to methylated C on the opposite strand, A corresponded to unmethylated C, where C occurred in the genomic sequence).

[0511] ta2 The degree of CG and CHG methylation in DNA obtained from endosperm was higher than in DNA obtained from control ZH11 endosperm, which is TA2 of Mutation OsROS1a While ) reduced the demethylation process in rice endosperm, ta2 This indicates that the degree of CHH methylation in the endosperm was not significantly different from that in the wild-type ZH11 endosperm.

[0512] Example 12. ta2 Additional analysis of nutrient composition in mutant grains

[0513] Further analysis was performed to measure the nutrient composition of the mutant grains in comparison to the corresponding wild-type grains (ZH11) grown simultaneously in the farmland under identical conditions. Whole grain flour samples were prepared from the grains harvested from the plants and used for compositional analysis as described in Example 5. The results of the close analysis of the flour for the grains grown in Australia are provided in Table 5. The results for the grains grown in China are provided in Table 6.

[0514] Proximity analysis is ta2 The mutant powder showed an increase of approximately 50% in total lipid content. Total nitrogen analysis was performed in China, not Australia. ta2 Significant changes were observed at the protein level between mutant and wild-type grains, which may be due to different nitrogen fertilizer regimens. Total fiber levels were ta2 It increased by approximately 66% or 91% in the grain. The starch content is ta2 It decreased by 9% compared to the wild type. These data ta2 It was confirmed that an increase in aleurone thickness in mutants caused a significant increase in the levels of aleurone-rich nutrients, such as lipids, minerals, and fiber, without altering seed size. Although the absolute values ​​differed between the two growth environments, ta2 The relative increase in grains was reasonably consistent.

[0515]

[0516]

[0517] It will be recognized by those skilled in the art that numerous changes and / or variations may be made in the present invention as presented in specific embodiments without departing from the spirit or scope of the invention as broadly described. The embodiments are therefore to be regarded as illustrative in all respects but not limiting.

[0518] This application claims priority from Patent No. AU 2015904754 filed on November 18, 2015, the full text of which is incorporated herein by reference.

[0519] All publications discussed and / or referenced in this specification are incorporated herein in their entirety.

[0520] The discussion of documents, acts, materials, devices, articles, etc., included in this specification is merely for the purpose of providing content for the invention. Any or all of these matters should not be construed as an acknowledgment that they constitute part of the prior art basis or were ordinary general knowledge in the field related to the invention as existed prior to the priority date of each claim of this application.

[0521] References

[0522]

[0523]

[0524]

[0525]

Claims

Claim 1 As a grain of the rice plant, aleurone, starchy endosperm, and ROS1a (Repressor of Silencing 1a) encoding a polypeptide variant ROS1a Includes genes, ROS1a A rice grain, wherein the polypeptide variant comprises the amino acid sequence presented in SEQ ID NO. 1, or comprises one or more amino acid substitutions selected from the group consisting of S156F, S214F, S1413N, A441V, S1357F, K501S, and R482K based on SEQ ID NO. 2, and the egg white is thickened compared to the egg white from a wild-type grain. Claim 2 In paragraph 1, the grain of a rice plant, comprising 2 to 8 cell layers. Claim 3 In paragraph 1, ROS1a encoding polypeptide variants ROS1a A grain of a rice plant that is homozygous for the gene. Claim 4 In paragraph 1, the rice plant is a grain of a rice plant that is reproductive to both sexes. Claim 5 In paragraph 1, the rice plant grain is a rice plant grain that exhibits delayed grain maturation. Claim 6 The grain of a rice plant according to claim 1, further characterized by one or more of the following: (a) the grain comprises, on a weight basis, one or more of the following or all of the following when compared to the wild-type grain: i) a higher mineral content, ii) a higher antioxidant content, iii) a higher phytate content, iv) a higher content of one or more or all of vitamins B3, B6 and B9, v) a higher dietary fiber content, vi) a higher insoluble fiber content, vii) a starch content of 90% to 100% by weight relative to the starch content of the wild-type grain; viii) a higher sucrose content, ix) a higher monosaccharide content, and x) a lipid content of at least 90% or at least 100% compared to the lipid content of the wild-type grain; (b) the grain contains an embryo; (c) the grain is a whole grain or a cracked grain; (d) the grain is processed so that it does not sprout further; (e) the grain has a germination rate of 70% to 100% compared to the germination rate of the wild-type grain; and (f) the grain contains an increased proportion of oleic acid, a decreased proportion of palmitic acid, or both in its total fatty acid content compared to the wild-type grain. Claim 7 A rice plant that produces grains according to any one of paragraphs 1 through 6. Claim 8 A method for producing the rice plant of paragraph 7 or grains therefrom, comprising: i) endogenous within the rice cell ROS1a By introducing a mutation in the gene, the above-mentioned mutated ROS1a A gene comprising the amino acid sequence presented in SEQ ID NO. 1, or one or more amino acid substitutions selected from the group consisting of S156F, S214F, S1413N, A441V, S1357F, K501S, and R482K based on SEQ ID NO. 2 ROS1a A step of encoding a polypeptide variant, and ii) a step of obtaining a rice plant from the cell obtained from step i), wherein the rice plant is the endogenous ROS1a A method comprising a step including a mutation of a gene. Claim 9 A method for selecting a rice plant that produces grains according to any one of claims 1 to 6, comprising: i) a step of selecting a population of rice plants or grains obtained from ancestral rice cells, grains, or mutagenic treatments of plants for the production of grains according to any one of claims 1 to 6, and ii) a step of selecting a rice plant that produces grains according to any one of claims 1 to 6 from the population of step (i), thereby selecting said rice plant or grain. Claim 10 A method for identifying a rice plant producing rice grains according to any one of claims 1 to 6, comprising the following steps: i) obtaining a nucleic acid sample from a rice plant, and ii) ROS1a encoding polypeptide variants ROS1a A step of screening the sample for the presence or absence of a gene. Claim 11 A grain according to any one of claims 1 to 6, a rice plant producing said grain, or a product produced from said grain or a part of a rice plant, wherein said product ROS1a polypeptide variant, ROS1a A product comprising a gene encoding a polypeptide variant, or both, wherein the product is a food ingredient, a beverage ingredient, a food or beverage product. Claim 12 In paragraph 11, i) the food ingredient or beverage ingredient is selected from the group consisting of whole wheat, flour, bran, starch, malt, and oil; ii) the food product is selected from the group consisting of fermented or unfermented bread, pasta, noodles, animal feed, breakfast cereals, snack foods, cakes, pastries, and foods containing powdered sauces; or iii) the beverage product is a packaged beverage or a beverage containing ethanol. Claim 13 A method for producing a food or beverage component from a grain according to any one of claims 1 to 6, a rice plant producing said grain, or a part of said grain or rice plant, comprising: A) a step of producing said food or beverage component by processing the grain according to any one of claims 1 to 6 or bran, flour, whole wheat, malt, starch, or oil from said grain; or B) a step of mixing the grain according to any one of claims 1 to 6 or bran, flour, whole wheat, malt, starch, or oil from said grain with another food or beverage component. Claim 14 delete Claim 15 delete Claim 16 delete Claim 17 delete Claim 18 delete Claim 19 delete Claim 20 delete Claim 21 delete Claim 22 delete Claim 23 delete Claim 24 delete Claim 25 delete Claim 26 delete Claim 27 delete Claim 28 delete Claim 29 delete Claim 30 delete Claim 31 delete Claim 32 delete Claim 33 delete Claim 34 delete Claim 35 delete Claim 36 delete Claim 37 delete Claim 38 delete Claim 39 delete Claim 40 delete Claim 41 delete Claim 42 delete Claim 43 delete Claim 44 delete Claim 45 delete Claim 46 delete Claim 47 delete Claim 48 delete Claim 49 delete Claim 50 delete

Images