A set of primers and taqman probes for detecting DNA of the causative agent salmonellosis in biological material by real-time PCR

Abstract

The utility model relates to the field of biotechnology, medical and molecular genetics, namely to the use of species-specific primers and a fluorescent TaqMan probe in real-time polymerase chain reaction for the detection of bacteria of the genus Salmonella spp. The technical result provided by the utility model is expressed in the development of oligonucleotides, the construction of positive controls and the detection of DNA of Salmonella enterica bacteria using the PCR method with real-time detection of results. A set of primers and TaqMan probes for detection of DNA of the causative agent of salmonellosis in biological material by the PCR method in real time, containing the following nucleotide sequences: hilA-F - (forward primer) - TAACATCATCACGCTGCATT; hilA-R - (reverse primer) - CTGTATCAAAAAGCCAACC; hilA-Probe - FAM-GTCACGTCAACCACCAGTABHQ1. hilA-plasmid TAACATCATCACGCTGCATTGTGCGTATGAGCT GCGTTTCGGGCGTCACGTCAACCACCAGTACGC GGTTGGCTTTTTGATACAG