Polypeptide and antibody containing same acting as light-chain

Abstract

Provided is a polypeptide, which is used as a light-chain or light-chain variable region of an antibody. The polypeptide is used to construct an antibody together with an antibody heavy-chain or antibody heavy-chain variable region having binding affinity to different targets (antigens), and the antibody retains binding affinity to targets (antigens) and biological activity. Further provided is an antibody containing the polypeptide.

Description

A polypeptide and an antibody comprising the same as a light chain

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This patent application claims the priority benefit of Chinese invention patent application No. CN202310116909.2 filed on February 15, 2023, the entire contents of which are hereby incorporated by reference. Technical Field

[0003] The present invention relates to the field of biomedicine, and in particular, to a peptide and its use as an antibody light chain, as well as a monoclonal antibody or multispecific antibody comprising the peptide as a common light chain. Background Art

[0004] Antibodies typically exist as one or more Y-shaped monomers, each composed of four polypeptide chains: two heavy chains and two light chains. The two heavy chains and two light chains of an antibody can be identical, in which case the antibody is called a "homodimer," which has binding affinity and specificity for one target, such as an antigen; or the two heavy chains and two light chains can be different, in which case the antibody is called a "heterodimer," which has binding affinity and specificity for two targets, such as antigens. Additional target-binding domains can also be constructed on the Y-shaped monomer structure.

[0005] It is generally believed that the above-mentioned binding affinity and specificity of an antibody to a target, such as an antigen, are jointly determined by at least six complementarity-determining regions (CDRs) in the paired heavy and light chains; however, some have proposed that a polypeptide can be provided that can be paired with any heavy chain that has binding affinity and specificity for a certain target to construct an antibody (homodimer); on this basis, the polypeptide can also be paired with two or more antibody heavy chains as a universal light chain to construct bispecific or even multispecific antibodies (heterodimers, heteromultimers) with affinity and binding specificity for different targets.

[0006] Furthermore, current conventional methods for preparing bispecific antibodies often require the simultaneous transfection of four plasmids, each expressing two different heavy chains and two different light chains. However, when these four polypeptide chains are assembled into an antibody, there is a risk of mispairing between the heavy and light chains. Providing the aforementioned polypeptide as a common light chain to pair with the two different heavy chains would avoid this problem.

[0007] Summary of the Invention

[0008] In response to the above problems, the present invention aims to provide a polypeptide that, as an antibody light chain variable region, can be combined with an antibody heavy chain or antibody heavy chain variable region specific for a target (antigen), or with two or more antibody heavy chains or antibody heavy chain variable regions specific for different targets (antigens), to construct an antibody. Another object of the present invention is to provide an antibody comprising the polypeptide as a light chain variable region, for example, an antibody in the form of a homodimer or heterodimer.

[0009] The technical solutions of the present invention are as follows.

[0010] In a first aspect, the present invention provides a polypeptide, wherein the amino acid sequence of the polypeptide comprises:

[0011] (1) the amino acid sequence shown in SEQ ID NO. 25; the amino acid sequence shown in SEQ ID NO. 26; and the amino acid sequence shown in SEQ ID NO. 32;

[0012] (2) the amino acid sequence shown in SEQ ID NO.31; the amino acid sequence shown in SEQ ID NO.33; and the amino acid sequence shown in SEQ ID NO.32; or

[0013] (3) The amino acid sequence shown in SEQ ID NO.52; the amino acid sequence shown in SEQ ID NO.26; and the amino acid sequence shown in SEQ ID NO.53.

[0014] Furthermore, the polypeptide comprises the amino acid sequence shown in SEQ ID NO.2, SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.16 or SEQ ID NO.41.

[0015] SEQ ID NO.2:

[0016] SEQ ID NO.13:

[0017] SEQ ID NO.15:

[0018] SEQ ID NO.16:

[0019] SEQ ID NO.41:

[0020] Furthermore, the polypeptide comprises the amino acid sequence shown in SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.37, SEQ ID NO.38 or SEQ ID NO.43.

[0021] SEQ ID NO.35:

[0022] SEQ ID NO.36:

[0023] SEQ ID NO.37:

[0024] SEQ ID NO.38:

[0025] SEQ ID NO.43:

[0026] The polypeptide provided by the present invention is used as an antibody light chain or light chain variable region, and can be used to construct an antibody with binding affinity to different targets (antigens) with an antibody heavy chain or antibody heavy chain variable region. For example, the polypeptide is used as an antibody light chain or light chain variable region, and is used to construct an antibody with binding affinity to a target (antigen) with an antibody heavy chain or antibody heavy chain variable region. The antibody is a homodimer having two identical heavy chains and two identical light chains (a monospecific antibody). Alternatively, for example, the polypeptide is used as an antibody light chain or light chain variable region, and is used to construct an antibody with binding affinity to two targets (antigens) with two antibody heavy chains or antibody heavy chain variable regions, respectively. The antibody is a heterodimer having two different heavy chains and two identical light chains (a bispecific antibody).

[0027] In a second aspect, the present invention provides an antibody or an antigen-binding fragment thereof, wherein the antibody or the antigen-binding fragment thereof comprises the polypeptide provided in the first aspect of the present invention as an antibody light chain or light chain variable region.

[0028] In the context of the present invention, the antigen-binding fragment is any functional fragment of an antibody that can specifically bind to a target. In the context of the present invention, "target" and "antigen" are used interchangeably.

[0029] The antibody or antigen-binding fragment thereof provided by the present invention may be an IgG-like antibody. In the present invention, "IgG-like antibody" refers to an antibody or antigen-binding fragment thereof having at least two Fab arms and an optional Fc region, and being a traditional monoclonal antibody (mAb) structure or a similar structure. Therefore, the antibody or antigen-binding fragment thereof provided by the present invention comprises, in at least one of its Fab arms, an amino acid sequence defined in any one of (1) to (3) provided by the first aspect of the present invention as light chain CDRs; or comprises an amino acid sequence shown in SEQ ID NO.2, SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.16 or SEQ ID NO.41 as a light chain variable region (VL). Alternatively, the antibody or antigen-binding fragment thereof provided by the present invention comprises an amino acid sequence shown in SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.37, SEQ ID NO.38 or SEQ ID NO.43 as a light chain.

[0030] Furthermore, the antibody or antigen-binding fragment thereof further comprises a heavy chain variable region (VH) in at least one Fab arm thereof, wherein the heavy chain variable region and the light chain variable region form a binding domain for a target. According to a specific embodiment of the present invention, the target may be programmed cell death 1 (PD-1), lymphocyte activation gene 3 (LAG-3), programmed cell death 1 ligand 1 (PDL1) or epidermal growth factor receptor (EGFR).

[0031] According to a specific embodiment of the present invention, the antibody or antigen-binding fragment thereof comprises in at least one Fab arm thereof the following heavy chain CDRs (HCDR1, HCDR2 and HCDR3) and light chain CDRs (LCDR1, LCDR2 and LCDR3), respectively:

[0032] (1) HCDR1 comprising the amino acid sequence of SEQ ID NO. 28, HCDR2 comprising the amino acid sequence of SEQ ID NO. 29, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 30; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 25, LCDR2 comprising the amino acid sequence of SEQ ID NO. 26, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 32;

[0033] (2) HCDR1 comprising the amino acid sequence of SEQ ID NO. 22, HCDR2 comprising the amino acid sequence of SEQ ID NO. 23, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 24; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 25, LCDR2 comprising the amino acid sequence of SEQ ID NO. 26, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 32;

[0034] (3) HCDR1 comprising the amino acid sequence of SEQ ID NO. 28, HCDR2 comprising the amino acid sequence of SEQ ID NO. 29, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 30; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 31, LCDR2 comprising the amino acid sequence of SEQ ID NO. 33, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 32;

[0035] (4) HCDR1 comprising the amino acid sequence of SEQ ID NO. 22, HCDR2 comprising the amino acid sequence of SEQ ID NO. 23, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 24; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 31, LCDR2 comprising the amino acid sequence of SEQ ID NO. 33, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 32;

[0036] (5) HCDR1 comprising the amino acid sequence of SEQ ID NO. 22, HCDR2 comprising the amino acid sequence of SEQ ID NO. 34, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 24; and LCDR1 comprising the amino acid sequence of SEQ ID NO. 31, LCDR2 comprising the amino acid sequence of SEQ ID NO. 33, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 32;

[0037] (6) HCDR1 comprising the amino acid sequence of SEQ ID NO. 22, HCDR2 comprising the amino acid sequence of SEQ ID NO. 34, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 24; and LCDR1 comprising the amino acid sequence of SEQ ID NO. 25, LCDR2 comprising the amino acid sequence of SEQ ID NO. 26, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 32;

[0038] (7) HCDR1 comprising the amino acid sequence of SEQ ID NO.48, HCDR2 comprising the amino acid sequence of SEQ ID NO.49, and HCDR3 comprising the amino acid sequence of SEQ ID NO.50; and LCDR1 comprising the amino acid sequence of SEQ ID NO.25, LCDR2 comprising the amino acid sequence of SEQ ID NO.26, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32;

[0039] (8) HCDR1 comprising the amino acid sequence of SEQ ID NO.48, HCDR2 comprising the amino acid sequence of SEQ ID NO.51, and HCDR3 comprising the amino acid sequence of SEQ ID NO.50; and LCDR1 comprising the amino acid sequence of SEQ ID NO.52, LCDR2 comprising the amino acid sequence of SEQ ID NO.26, and LCDR3 comprising the amino acid sequence of SEQ ID NO.53;

[0040] (9) HCDR1 comprising the amino acid sequence of SEQ ID NO.54, HCDR2 comprising the amino acid sequence of SEQ ID NO.55, and HCDR3 comprising the amino acid sequence of SEQ ID NO.56; and LCDR1 comprising the amino acid sequence of SEQ ID NO.31, LCDR2 comprising the amino acid sequence of SEQ ID NO.33, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32;

[0041] (10) a HCDR1 comprising the amino acid sequence of SEQ ID NO.48, a HCDR2 comprising the amino acid sequence of SEQ ID NO.51, and a HCDR3 comprising the amino acid sequence of SEQ ID NO.50; and a LCDR1 comprising the amino acid sequence of SEQ ID NO.31, a LCDR2 comprising the amino acid sequence of SEQ ID NO.33, and a LCDR3 comprising the amino acid sequence of SEQ ID NO.32; or

[0042] (11) HCDR1 comprising the amino acid sequence shown in SEQ ID NO.54, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.55, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.56; and LCDR1 comprising the amino acid sequence shown in SEQ ID NO.52, LCDR2 comprising the amino acid sequence shown in SEQ ID NO.26, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.53.

[0043] Furthermore, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region in at least one Fab arm thereof, wherein the heavy chain variable region and the light chain variable region respectively comprise:

[0044] (1) the amino acid sequence shown in SEQ ID NO. 12; and the amino acid sequence shown in SEQ ID NO. 2;

[0045] (2) the amino acid sequence shown in SEQ ID NO.10; and the amino acid sequence shown in SEQ ID NO.2;

[0046] (3) the amino acid sequence shown in SEQ ID NO.12; and the amino acid sequence shown in SEQ ID NO.13;

[0047] (4) the amino acid sequence shown in SEQ ID NO.10; and the amino acid sequence shown in SEQ ID NO.13;

[0048] (5) the amino acid sequence shown in SEQ ID NO. 14; and the amino acid sequence shown in SEQ ID NO. 15;

[0049] (6) the amino acid sequence shown in SEQ ID NO. 19; and the amino acid sequence shown in SEQ ID NO. 15;

[0050] (7) the amino acid sequence shown in SEQ ID NO. 14; and the amino acid sequence shown in SEQ ID NO. 16;

[0051] (8) the amino acid sequence shown in SEQ ID NO. 19; and the amino acid sequence shown in SEQ ID NO. 16;

[0052] (9) the amino acid sequence shown in SEQ ID NO. 39; and the amino acid sequence shown in SEQ ID NO. 2;

[0053] (10) the amino acid sequence shown in SEQ ID NO.40; and the amino acid sequence shown in SEQ ID NO.41;

[0054] (11) the amino acid sequence shown in SEQ ID NO.44; and the amino acid sequence shown in SEQ ID NO.13;

[0055] (12) the amino acid sequence shown in SEQ ID NO.45; and the amino acid sequence shown in SEQ ID NO.15;

[0056] (13) the amino acid sequence shown in SEQ ID NO.40; and the amino acid sequence shown in SEQ ID NO.15;

[0057] (14) The amino acid sequence shown in SEQ ID NO.45; and the amino acid sequence shown in SEQ ID NO.41.

[0058] The antibody or antigen-binding fragment thereof may be a murine antibody, a chimeric antibody, or a humanized antibody; and may further comprise a heavy chain constant region and a light chain constant region. According to a specific embodiment of the present invention, the heavy chain constant region may be an IgG1 or IgG4 heavy chain constant region; and the light chain constant region may be a kappa or lambda light chain constant region. For example, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.17 (hIgG4) or SEQ ID NO.42 (hIgG1); and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.18 (hkappa). Alternatively, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.20 (hIgG4; Knob) or SEQ ID NO.21 (hIgG4; Hole); and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.18. Alternatively, the heavy chain constant region of the antibody comprises the amino acid sequence shown in SEQ ID NO.46 (hIgG1; Knob) or SEQ ID NO.47 (hIgG1; Hole); and the light chain constant region of the antibody comprises the amino acid sequence shown in SEQ ID NO.18.

[0059] At least two Fab arms of the antibody or antigen-binding fragment thereof provided by the present invention may be identical, thereby binding to the same target (antigen). In this case, the antibody or antigen-binding fragment thereof comprises the same amino acid sequence combination of HCDR1 to HCDR3 and LCDR1 to LCDR3 selected from the group consisting of (1) to (11) above, or comprises the same amino acid sequence combination of the heavy chain and light chain variable regions selected from the group consisting of (1) to (14) above. The antibody or antigen-binding fragment thereof further comprises a heavy chain constant region and a light chain constant region. For example, as described above, the heavy chain constant region comprises the amino acid sequence shown in SEQ ID NO.17 or SEQ ID NO.42; the light chain constant region comprises the amino acid sequence shown in SEQ ID NO.18. Furthermore, the antibody or antigen-binding fragment thereof has a heavy chain and a light chain, such as a monoclonal antibody having two identical heavy chains and two identical light chains.

[0060] Alternatively, the at least two Fab arms of the antibody or antigen-binding fragment thereof provided by the present invention may be different, thereby binding to different targets (antigens). In this case, the antibody comprises in its at least two Fab arms different combinations of amino acid sequences selected from HCDR1 to HCDR3 and LCDR1 to LCDR3 provided above (1) to (11), or comprises different combinations of amino acid sequences selected from the heavy chain and light chain variable regions provided above (1) to (14). In this case, preferably, the at least two Fab arms of the antibody or antigen-binding fragment thereof comprise the same combination of light chain CDRs sequences, or comprise the same light chain VL sequence. For example, the at least two Fab arms each comprise: (1) LCDR1 comprising the amino acid sequence shown in SEQ ID NO.25; LCDR2 comprising the amino acid sequence shown in SEQ ID NO.26; and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; (2) LCDR1 comprising the amino acid sequence shown in SEQ ID NO.31; LCDR2 comprising the amino acid sequence shown in SEQ ID NO.33; and LCDR3 comprising SEQ ID NO.32; or (3) LCDR1 comprising the amino acid sequence shown in SEQ ID NO.52; LCDR2 comprising the amino acid sequence shown in SEQ ID NO.26; and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.53. Furthermore, the two Fab arms each comprise: (1) a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.2; (2) a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.13; (3) a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.15; (4) a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.16; or (5) a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.41.

[0061] According to a specific embodiment of the present invention, the antibody or antigen-binding fragment thereof comprises:

[0062] (1) In one Fab arm, a HCDR1 comprising the amino acid sequence of SEQ ID NO. 28, a HCDR2 comprising the amino acid sequence of SEQ ID NO. 29, and a HCDR3 comprising the amino acid sequence of SEQ ID NO. 30; and a LCDR1 comprising the amino acid sequence of SEQ ID NO. 31, a LCDR2 comprising the amino acid sequence of SEQ ID NO. 33, and a LCDR3 comprising SEQ ID NO. 32;

[0063] In the other Fab arm, HCDR1 comprises the amino acid sequence of SEQ ID NO. 22, HCDR2 comprises the amino acid sequence of SEQ ID NO. 34, and HCDR3 comprises the amino acid sequence of SEQ ID NO. 24; and LCDR1 comprises the amino acid sequence of SEQ ID NO. 31, LCDR2 comprises the amino acid sequence of SEQ ID NO. 33, and LCDR3 comprises SEQ ID NO. 32;

[0064] (2) in one Fab arm, comprising HCDR1 comprising the amino acid sequence of SEQ ID NO.28; HCDR2 comprising the amino acid sequence of SEQ ID NO.29; and HCDR3 comprising the amino acid sequence of SEQ ID NO.30; and, LCDR1 comprising the amino acid sequence of SEQ ID NO.25; LCDR2 comprising the amino acid sequence of SEQ ID NO.26; and LCDR3 comprising the amino acid sequence of SEQ ID NO.32;

[0065] In the other Fab arm, HCDR1 comprises the amino acid sequence of SEQ ID NO. 22, HCDR2 comprises the amino acid sequence of SEQ ID NO. 34, and HCDR3 comprises the amino acid sequence of SEQ ID NO. 24; and, LCDR1 comprises the amino acid sequence of SEQ ID NO. 25; LCDR2 comprises the amino acid sequence of SEQ ID NO. 26; and LCDR3 comprises the amino acid sequence of SEQ ID NO. 32;

[0066] (3) In one Fab arm, the HCDR1 comprises the amino acid sequence of SEQ ID NO.54; the HCDR2 comprises the amino acid sequence of SEQ ID NO.55; and the HCDR3 comprises the amino acid sequence of SEQ ID NO.56; and, the LCDR1 comprises the amino acid sequence of SEQ ID NO.31; the LCDR2 comprises the amino acid sequence of SEQ ID NO.33; and the LCDR3 comprises the amino acid sequence of SEQ ID NO.32;

[0067] In the other Fab arm, HCDR1 comprises the amino acid sequence shown in SEQ ID NO.48, HCDR2 comprises the amino acid sequence shown in SEQ ID NO.51, and HCDR3 comprises the amino acid sequence shown in SEQ ID NO.50; and, LCDR1 comprises the amino acid sequence shown in SEQ ID NO.31; LCDR2 comprises the amino acid sequence shown in SEQ ID NO.33; and LCDR3 comprises the amino acid sequence shown in SEQ ID NO.32; or

[0068] (4) in one Fab arm, comprising HCDR1 comprising the amino acid sequence of SEQ ID NO.54; HCDR2 comprising the amino acid sequence of SEQ ID NO.55; and HCDR3 comprising the amino acid sequence of SEQ ID NO.56; and, LCDR1 comprising the amino acid sequence of SEQ ID NO.52; LCDR2 comprising the amino acid sequence of SEQ ID NO.26; and LCDR3 comprising the amino acid sequence of SEQ ID NO.53;

[0069] In the other Fab arm, it comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO.48, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.51, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.50; and, LCDR1 comprising the amino acid sequence shown in SEQ ID NO.52; LCDR2 comprising the amino acid sequence shown in SEQ ID NO.26; and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.53.

[0070] According to a specific embodiment of the present invention, further, the antibody or antigen-binding fragment thereof comprises:

[0071] (1) In one Fab arm, the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO. 14, and the light chain variable region comprises the amino acid sequence shown in SEQ ID NO. 15;

[0072] In the other Fab arm, the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO. 19, and the light chain variable region comprises the amino acid sequence shown in SEQ ID NO. 15;

[0073] (2) in one Fab arm, comprising a heavy chain variable region having the amino acid sequence shown in SEQ ID NO. 14 and a light chain variable region having the amino acid sequence shown in SEQ ID NO. 16;

[0074] In the other Fab arm, the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO. 19, and the light chain variable region comprises the amino acid sequence shown in SEQ ID NO. 16;

[0075] (3) in one Fab arm, comprising a heavy chain variable region having the amino acid sequence shown in SEQ ID NO. 45 and a light chain variable region having the amino acid sequence shown in SEQ ID NO. 15;

[0076] In the other Fab arm, the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO.40, and the light chain variable region comprises the amino acid sequence shown in SEQ ID NO.15; or

[0077] (4) in one Fab arm, comprising a heavy chain variable region having the amino acid sequence shown in SEQ ID NO. 45 and a light chain variable region having the amino acid sequence shown in SEQ ID NO. 41;

[0078] In the other Fab arm, the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO.40, and the light chain variable region comprises the amino acid sequence shown in SEQ ID NO.41.

[0079] In this case, the antibody or antigen-binding fragment thereof further comprises a heavy chain constant region and a light chain constant region. For example, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO. 20 or SEQ ID NO. 21; and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO. 18. Alternatively, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO. 46 (hIgG1; Knob) or SEQ ID NO. 47 (hIgG1; Hole); and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO. 18.

[0080] Furthermore, the antibody is a bispecific antibody having two different heavy chains but containing two identical light chains. According to a specific embodiment of the present invention, the bispecific antibody may comprise the amino acid sequence shown in SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38 or SEQ ID NO. 43 as a light chain.

[0081] According to the specific embodiments of the present invention, the bispecific antibodies provided by the present invention are shown in Table 9 and Table 36 in the "Specific Embodiments".

[0082] The bispecific antibodies in Table 9 include the following domains:

[0083] The bispecific antibodies KA-1835 H28G27V4×H107D1210-hIgG4M and KA-1836 H107D1210×H28G27V4-hIgG4M each contain two Fab arms targeting PD1 and LAG3, respectively. One Fab arm contains a heavy chain variable region (SEQ ID NO. 14) and a light chain variable region (SEQ ID NO. 15) targeting PD1, while the other Fab arm contains a heavy chain variable region (SEQ ID NO. 19) and a light chain variable region (SEQ ID NO. 15) targeting LAG3. The bispecific antibodies contain two identical light chains (SEQ ID NO. 37).

[0084] The bispecific antibody KA-1793 H28G27V4×H107D1210-hIgG4M comprises two Fab arms targeting PD1 and LAG3, respectively. One Fab arm comprises a heavy chain variable region (SEQ ID NO.14) and a light chain variable region (SEQ ID NO.16) targeting PD1, and the other Fab arm comprises a heavy chain variable region (SEQ ID NO.19) and a light chain variable region (SEQ ID NO.16) targeting LAG3. The bispecific antibody comprises two identical light chains (SEQ ID NO.38).

[0085] The bispecific antibodies in Table 36 include the following domains:

[0086] The bispecific antibody KA-2072 H22A12x58E3-CLC01 comprises two Fab arms targeting EGFR and PDL1, respectively. One Fab arm comprises a heavy chain variable region (SEQ ID NO. 45) and a light chain variable region (SEQ ID NO. 15) targeting EGFR, and the other Fab arm comprises a heavy chain variable region (SEQ ID NO. 40) and a light chain variable region (SEQ ID NO. 15) targeting PDL1. This bispecific antibody contains two identical light chains (SEQ ID NO. 37).

[0087] The bispecific antibody KA-2073 H22A12x58E3-CLC02 comprises two Fab arms targeting EGFR and PDL1, respectively. One Fab arm comprises a heavy chain variable region (SEQ ID NO. 45) and a light chain variable region (SEQ ID NO. 41) targeting EGFR, and the other Fab arm comprises a heavy chain variable region (SEQ ID NO. 40) and a light chain variable region (SEQ ID NO. 41) targeting PDL1. The bispecific antibody also comprises two identical light chains (SEQ ID NO. 43).

[0088] The present invention provides a polypeptide. Experiments have shown that, as an antibody light chain or light chain variable region, the polypeptide can be combined with an antibody heavy chain or antibody heavy chain variable region having binding affinity for different targets (antigens) to construct an antibody, wherein the antibody retains the binding affinity for the target (antigen) and the biological activity.

[0089] In a third aspect, the present invention provides the use of the polypeptide described in the first aspect in constructing an antibody. As described above, the antibody can be a homodimer having two identical heavy chains and two identical light chains, or a heterodimer having two different heavy chains and two identical light chains. The polypeptide can serve as the light chain or light chain variable region of the antibody.

[0090] In a fourth aspect, the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding the polypeptide of the first aspect. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:

[0092] Figure 1: Binding detection results of hybridoma cell culture supernatant containing anti-LAG3 antibody to LAG3-expressing cells.

[0093] Figure 2: Detection results of the blocking effect of hybridoma cell culture supernatant containing anti-LAG3 antibodies on the binding of LAG3 to tumor cells.

[0094] Figure 3: Detection results of the binding of hybridoma cell culture supernatant containing anti-PD1 antibodies to PD1-expressing cells.

[0095] Figure 4: Detection results of the blocking effect of hybridoma cell culture supernatant containing anti-PD1 antibody on the binding of PD1 to PDL1-expressing cells.

[0096] Figure 5: Detection results of binding of anti-PD1 humanized antibodies and chimeric antibodies to PD1-expressing cells.

[0097] Figure 6: Detection results of blocking the binding of PD1 to PDL1-expressing cells by anti-PD1 humanized antibodies and chimeric antibodies.

[0098] Figure 7: Detection results of binding of anti-LAG3 humanized antibodies and chimeric antibodies to LAG3-expressing cells.

[0099] Figure 8: Detection results of anti-LAG3 humanized antibodies and chimeric antibodies blocking the binding of LAG3 to tumor cells.

[0100] Figure 9: Detection results of PD1×LAG3 bispecific antibody binding to PD1-expressing cells.

[0101] Figure 10: Detection results of PD1×LAG3 bispecific antibody binding to LAG3-expressing cells.

[0102] Figure 11: Detection results of the blocking effect of the PD1×LAG3 bispecific antibody on the binding of PD1 to PDL1-expressing cells.

[0103] Figure 12: Detection results of the blocking effect of PD1×LAG3 bispecific antibody on the binding of LAG3 to tumor cells.

[0104] Figure 13: Detection results of PD1×LAG3 bispecific antibody binding to PD1-expressing cells.

[0105] Figure 14: Detection results of PD1×LAG3 bispecific antibody binding to LAG3-expressing cells.

[0106] Figure 15: Detection results of the blocking effect of the PD1×LAG3 bispecific antibody on the binding of PD1 to PDL1-expressing cells.

[0107] FIG16 : Detection results of the blocking effect of PD1×LAG3 bispecific antibody on the binding of LAG3 to tumor cells.

[0108] Figure 17: Detection results of the binding of hybridoma cell culture supernatant containing anti-PDL1 antibody to PDL1-expressing cells; 17A: positive control antibody; 17B: hybridoma cell culture supernatant.

[0109] Figure 18: Detection results of the blocking effect of hybridoma cell culture supernatant containing anti-PDL1 antibody on the binding of PDL1 to PD1-expressing cells; 18A: positive control antibody; 18B: hybridoma cell culture supernatant.

[0110] FIG19 : Detection results of the blocking effect of anti-PDL1 mouse antibody on PDL1 / PD1 signaling.

[0111] FIG20 : Detection results of binding of anti-PDL1 humanized antibody to PDL1-expressing cells.

[0112] FIG21 : Detection results of blocking the binding of PDL1 to PD1-expressing cells by anti-PDL1 humanized antibodies.

[0113] Figure 22: Detection results of blocking PDL1 / PD1 signaling by anti-PDL1 humanized antibodies

[0114] Figure 23: Detection results of the binding of hybridoma cell culture supernatant containing anti-EGFR antibody to EGFR-expressing cells; 23A: positive control antibody; 23B: hybridoma cell culture supernatant.

[0115] Figure 24: Detection results of the blocking effect of anti-EGFR mouse antibody on the binding of EGFR-Fc protein to EGF; 24A: positive control antibody; 24B: anti-EGFR mouse antibody.

[0116] FIG25 : Detection results of the blocking effect of anti-EGFR mouse antibody on EGFR signal transduction.

[0117] FIG26 : Detection results of binding of anti-EGFR humanized antibodies to EGFR-expressing cells.

[0118] FIG27 : Detection results of blocking the binding of EGFR-Fc protein to EGF by anti-EGFR humanized antibodies.

[0119] Figure 28: Detection results of blocking EGFR signaling by anti-EGFR humanized antibodies

[0120] Figure 29: Detection results of EGFR×PDL1 bispecific antibody binding to PDL1-expressing cells.

[0121] FIG30 : Detection results of the blocking effect of EGFR×PDL1 bispecific antibody on the binding of PDL1 to PD1-expressing cells.

[0122] Figure 31: Detection results of EGFR×PDL1 bispecific antibody blocking PDL1 / PD1 signaling

[0123] FIG32 : Detection results of EGFR×PDL1 bispecific antibody binding to EGFR-expressing cells.

[0124] FIG33 : Detection results of the blocking effect of the EGFR×PDL1 bispecific antibody on the binding of EGF to EGFR-expressing cells.

[0125] FIG34 : Detection results of the blocking effect of EGFR×PDL1 bispecific antibody on EGFR signaling.

[0126] Best Mode for Carrying Out the Invention

[0127] The present invention is described below with reference to specific examples. Those skilled in the art will appreciate that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0128] The experimental methods in the following examples are conventional methods unless otherwise specified. The raw materials, reagents, etc. used in the following examples are commercially available products unless otherwise specified.

[0129] Example 1 Screening of common light chains

[0130] Analysis of existing technologies revealed that germline sequences similar to KV4 are more frequently expressed in mice and pair with mouse heavy chains at a higher frequency. Therefore, we selected this type of germline sequence, and among them, we selected the following mouse germline sequence, KV4-59, for its ease of humanization, good solubility, low immunogenicity, and lack of potential modification sites.

[0131] >KV4-59 (SEQ ID NO. 1):

[0132] The above sequences were modified. Since the CDR3 of the light chain (underlined) plays an important role in the affinity of antibody binding to antigen, amino acids were added after CDR3 to improve the affinity with potential antigens. The following three sequences were obtained:

[0133] >KV4-59-1 (SEQ ID NO. 2):

[0134] >KV4-59-2 (SEQ ID NO. 3):

[0135] >KV4-59-3 (SEQ ID NO. 4):

[0136] The above three sequences were used as antibody light chain variable region sequences, and chimeric antibodies were constructed with the following mouse anti-hen egg lysozyme antibody heavy chain variable region sequence and human heavy chain and light chain constant regions.

[0137] > Heavy chain variable region sequence of mouse anti-hen egg lysozyme antibody (SEQ ID NO.5):

[0138] By testing the expression level, thermal stability, solubility, freeze-thaw stability and other properties of the three chimeric antibodies, it was confirmed that when KV4-59-1 (SEQ ID NO. 2) was used as the antibody light chain variable region sequence, the constructed antibody had better properties.

[0139] Example 2 Construction of transgenic mice

[0140] Based on the C57 mouse antibody lambda light chain gene sequence, sgRNAs were designed from either end of the gene cluster. The Cas9-gRNA Target Efficiency Detection Kit (Weishanglide, Cat: VK007-30T) was used for in vitro verification, and the sgRNA sequences TGAATGCCATGTACTTATGG (SEQ ID NO. 6) and AAGTTCAGCTCCTAAAATGG (SEQ ID NO. 7) with high cleavage efficiency were selected. This sgRNA sequence was synthesized and microinjected into fertilized mouse eggs along with the spCas91.1 protein. The sgRNA directs the Cas9 protein to cleave both ends of the target gene fragment to be deleted, resulting in double-strand breaks (DSBs). DNA repair occurs at both ends of the genome via non-homologous end joining (NHEJ), deleting the target fragment in the middle and achieving knockout of the target gene. Two weeks after birth, the mice were genotyped to confirm that the lambda gene had been knocked out.

[0141] Based on the mouse antibody kappa light chain sequence, sgRNAs were designed and validated in vitro using a Cas9-gRNA Target Efficiency Detection Kit (Weishanglide, Cat: VK007-30T). The sgRNA sequences with high cleavage efficiency, IGK-L1: GTGAATGCCATGTACTTATGG (SEQ ID NO. 8); and IGK-R1: CAAGTTCAGCTCCTAAAATGG (SEQ ID NO. 9), were selected. These sgRNA sequences were synthesized and microinjected into fertilized mouse eggs along with the spCas91.1 protein. The sgRNA-mediated Cas9 protein cleavage of the DNA at the target site created a nick. Using a donor DNA fragment carrying homology arms and the target fragment KV4-59-1 (SEQ ID NO. 2), the DNA fragment was knocked in at the target site via homologous recombination. Two weeks after birth, the mice were genotyped to confirm knock-in of the common light chain gene.

[0142] Heterozygous mice with lambda gene knockout were selected for mating and breeding with heterozygous mice with common light chain knockin. Genotyping of each offspring was performed 2 weeks after birth to detect common light chain gene knockin and lambda knockout, until mice with common light chain gene knockin of all alleles and knockout of both lambda and kappa were obtained.

[0143] Example 3 Preparation of Hybridoma Cells Secreting Anti-LAG3 Antibodies

[0144] Mice constructed in Example 2 were immunized with a fusion protein (abbreviated as "LAG3-mFc") consisting of the extracellular region of human LAG3 (NCBI Reference Sequence: NP_002277.4) and mouse IgG2a-Fc (Genbank Accession No. AAH31470.1) as the immunogen. Mice with high titers were selected, and serum was collected. After dissection, spleens were removed and splenocytes isolated. These splenocytes were fused with cultured myeloma cells to generate hybridomas.

[0145] An ELISA plate was coated with a fusion protein of the extracellular region of human LAG3 and human IgG1-FC (Genbank accession number CAC20454.1) (abbreviated as "LAG3-hFc"), and the binding activity of hybridoma cell supernatants to the fusion protein was detected by ELISA to obtain multiple positive hybridoma cell lines that secreted anti-LAG3 antibodies.

[0146] Example 4 Detection of Binding of Hybridoma Cell Culture Supernatant Containing Anti-LAG3 Antibodies to LAG3-Expressing Cells

[0147] The gene sequence encoding human LAG3 (NCBI Reference Sequence: NM_002286.6) was constructed into a PLVX viral packaging vector (Clontech, virus package mix, Cat No.: 631275) and transfected into 293T cells. A drug-resistant cell line, 293T cells stably expressing human LAG3 (abbreviated as "293T-LAG3 cells"; Kyinno Biotechnology Co. Ltd. (abbreviated as "Kyinno"), Cat No.: KC-0214), was obtained by selection with puromycin. The 293T-LAG3 cells were then cultured in PBS containing 2% FBS to a concentration of 1 × 10 cells / mL. 7 cells / ml of cell suspension.

[0148] Place 50 μl of cell suspension into each flow tube (sample tube), then add 50 μl of the culture supernatant of the hybridoma cells to be tested or the control antibody 28F6-7, and incubate at 4°C for 60 minutes. Then, add 1 ml of flow buffer to each flow tube, centrifuge at 1200 rpm for 5 minutes, discard the supernatant, and repeat the wash three times. At the same time, set up control tube 1 (no culture supernatant and the secondary antibody below are added, only the cell suspension is added) and control tube 2 (no culture supernatant is added, only the cell suspension and the secondary antibody below are added).

[0149] 100 μl of flow cytometry buffer was added to each flow cytometry tube for resuspending. Then, 5 μl of PE-conjugated anti-mouse Fc tag secondary antibody (PE anti-mouse IgG Fc; Biolegend, Cat No. 409304) was added. The cells were incubated at 4°C in the dark for 30 minutes. Then, 1 ml of flow cytometry buffer was added and the cells were centrifuged at 1200 rpm for 5 minutes at room temperature. The supernatant was discarded and the wash cycle repeated three times. 250 μl of flow cytometry buffer was added to each flow cytometry tube again, and the cells were resuspended and mixed before detection. The results are shown in Table 1 and Figure 1.

[0150] Table 1. Detection results of the binding of hybridoma cell culture supernatant containing anti-LAG3 antibodies to LAG3-expressing cells

[0151] Among them, the control antibody 28F6-7 is a verified anti-LAG3 hybridoma antibody.

[0152] Example 5 Detection of the Blockade of LAG3 Binding to Tumor Cells by Hybridoma Cell Culture Supernatant Containing Anti-LAG3 Antibodies

[0153] Daudi cells (Kyinno, Cat No.: KC-0271) were collected, washed once with FACS buffer, and cultured at 2-5×10 5 Cells were plated into 96-well plates at 400 μl per well. A premix of 50 μl of hybridoma supernatant or control antibody 28F6-7 (starting at 20 μg / ml, 3.16-fold serial dilutions) and 500 ng of the LAG3-hFc fusion protein was added to each well and incubated for 2 hours. Each well was washed twice with 400 μl of FACS buffer. A secondary antibody conjugated with PE anti-human Fc tag (PE anti-human IgG Fc; SouthernBiotech, Cat. No. 2010-09) was added and incubated for 1 hour. Each well was then washed twice with 400 μl of FACS buffer before detection. Results are shown in Table 2 and Figure 2.

[0154] Table 2. Results of the test on the blocking effect of hybridoma cell culture supernatant containing anti-LAG3 antibody on the binding of LAG3 to tumor cells

[0155] A mouse antibody was obtained from the hybridoma cell KD-0019 28G2-7, named 28G2, and its variable region sequence is as follows (wherein the heavy chain and light chain CDRs are underlined and obtained according to the KABAT definition method, the same below):

[0156] > Heavy chain variable region of anti-LAG3 murine anti-28G2 (SEQ ID NO. 10; HCDRs: SEQ ID NOs. 22 / 23 / 24):

[0157] >Light chain variable region of anti-LAG3 murine anti-28G2 (SEQ ID NO. 11; LCDRs: SEQ ID NOs. 25 / 26 / 27):

[0158] Example 6 Preparation of Hybridoma Cells Secreting Anti-PD1 Antibodies

[0159] Mice constructed in Example 2 were immunized with a fusion protein consisting of the extracellular domain of human PD-1 (NCBI Reference Sequence: NP_005009.2) and mouse IgG2a-FC (Genbank Accession No. AAH31470.1) (abbreviated as "PD-1-mFC") as the immunogen. Mice with high titers were selected, and serum was collected. After dissection, spleens were removed and splenocytes isolated. These splenocytes were fused with cultured myeloma cells to generate hybridomas.

[0160] An ELISA plate was coated with a fusion protein of the extracellular region of human PD1 and human IgG1-FC (Genbank accession number CAC20454.1) (abbreviated as "PD1-hFC"), and the binding activity of the hybridoma cell supernatant with the fusion protein was detected by ELISA to obtain multiple positive hybridoma cell lines that secreted anti-PD1 antibodies.

[0161] Example 7 Detection of Binding of Hybridoma Cell Culture Supernatant Containing Anti-PD1 Antibodies to PD1-Expressing Cells

[0162] The gene sequence encoding human PD1 (NCBI Reference Sequence: NM_005018.3) was constructed into a PLVX viral packaging vector (Clontech, virus package mix, Cat No.: 631275) and transfected into 293T cells. A drug-resistant cell line, 293T cells stably expressing human PD1 (abbreviated as "293T-PD1 cells"; Kyinno, Cat No.: KC-0204), was selected with puromycin to obtain a drug-resistant cell line. 293T-PD1 cells were then prepared in PBS containing 2% FBS to a cell concentration of 1×10 7 cells / ml of cell suspension.

[0163] Place 50 μl of cell suspension into each flow tube (sample tube), then add 50 μl of the culture supernatant of the hybridoma cells to be tested and incubate at 4°C for 60 minutes. Then, add 1 ml of flow buffer to each flow tube, centrifuge at 1200 rpm for 5 minutes, discard the supernatant, and repeat the wash three times. At the same time, set up control tube 1 (no culture supernatant and the secondary antibody below are added, only the cell suspension is added) and control tube 2 (no culture supernatant is added, only the cell suspension and the secondary antibody below are added).

[0164] To each flow cytometry tube, 100 μl of flow cytometry buffer was added for resuspending. Then, 5 μl of PE-conjugated anti-mouse Fc tag secondary antibody (Biolegend, Cat. No. 409304) was added. The cells were incubated at 4°C in the dark for 30 minutes. Then, 1 ml of flow cytometry buffer was added and the cells were centrifuged at 1200 rpm for 5 minutes at room temperature. The supernatant was discarded and the wash cycle repeated three times. 250 μl of flow cytometry buffer was added to each flow cytometry tube again, and the cells were resuspended and mixed before detection. The results are shown in Table 3 and Figure 3.

[0165] Table 3. Detection results of the binding of hybridoma cell culture supernatant containing anti-PD1 antibodies to PD1-expressing cells

[0166] Example 8 Detection of the Blockade of PD1 Binding to PDL1-Expressing Cells by Hybridoma Cell Culture Supernatant Containing Anti-PD1 Antibodies

[0167] 293T cells overexpressing human PDL1 (abbreviated as “293T-PDL1 cells”; Kyinno, Cat No.: KC-0205) were collected, washed once with FACS buffer, and cultured at 2-5×10 5 Cells were plated into a 96-well plate at 400 μl per well. A premix of 50 μl of hybridoma supernatant and 500 ng of human PD1-hFc (NCBI Reference Sequence: NP_005009.2) was added to each well and incubated for 2 hours. Each well was washed twice with 400 μl of FACS buffer. A secondary PE anti-human IgG Fc antibody (SouthernBiotech, Cat No.: 2010-09) was added and incubated for 1 hour. Each well was then washed twice with 400 μl of FACS buffer before detection. Results are shown in Table 4 and Figure 4.

[0168] Table 4. Detection results of the blocking effect of hybridoma cell culture supernatant containing anti-PD1 antibody on the binding of PD1 to PDL1 expressing cells

[0169] A mouse antibody was obtained from the hybridoma cell KD-22-0054 107D12-10, named 107D12-10, and its variable region sequence is as follows (wherein the heavy chain and light chain CDRs are underlined):

[0170] >Heavy chain variable region of anti-PD-1 mouse antibody 107D12-10 (SEQ ID NO. 12; HCDRs: SEQ ID NOs. 28 / 29 / 30):

[0171] >Light chain variable region of anti-PD-1 mouse antibody 107D12-10 (SEQ ID NO. 13; LCDRs: SEQ ID NOs. 31 / 33 / 32):

[0172] Example 9 Construction of humanized and chimeric antibodies against PD1

[0173] The heavy and light chain variable regions of the anti-PD-1 mouse antibody 107D12-10 were humanized to obtain a humanized antibody sequence. The coding sequence of the humanized antibody sequence was ligated to the coding sequence of the heavy chain constant region of human IgG4 (SEQ ID NO.17) and the light chain constant region of human kappa (SEQ ID NO.18), respectively. The resulting coding gene was cloned into a eukaryotic expression vector and expressed to obtain a humanized anti-PD-1 antibody named KA-1807 H107D12-10V4-hIgG4M. Its variable region sequences (SEQ ID NO.14; SEQ ID NO.15) and full-length light chain (SEQ ID NO.37) are as follows (heavy and light chain CDRs are underlined).

[0174] In addition, two chimeric antibodies were constructed based on mouse anti-107D12-10. One chimeric antibody was constructed as follows: the coding sequence of the heavy chain variable region of mouse anti-107D12-10 (SEQ ID NO. 12) was linked to the coding sequence of the heavy chain constant region of human IgG4, and the coding sequence of the light chain variable region of mouse anti-107D12-10 (SEQ ID NO. 13) was linked to the coding sequence of the light chain constant region of human kappa. The resulting coding genes were cloned into a eukaryotic expression vector, expressed, and obtained into a chimeric anti-PD-1 antibody named KA-1773 M107D12-10CLC1-hIgG4M. Its variable region sequences (SEQ ID NO. 12; SEQ ID NO. 13) and full-length light chain sequence (SEQ ID NO. 36) are shown below. Another chimeric antibody was constructed as follows: the coding sequence of the heavy chain variable region of mouse anti-107D12-10 (SEQ ID NO.12) was linked to the coding sequence of the heavy chain constant region of human IgG4, and the coding sequence of the light chain variable region shown in SEQ ID NO.2 (KV4-59-1) was linked to the coding sequence of the light chain constant region of human kappa. The obtained coding genes were cloned into a eukaryotic expression vector, expressed and obtained as a chimeric anti-PD-1 antibody, named KA-1774 M107D12-10CLC2-hIgG4M, whose variable region sequence (SEQ ID NO.12; SEQ ID NO.2) and full-length light chain sequence (SEQ ID NO.35) are shown below.

[0175] >Heavy chain variable region of anti-PD-1 humanized antibody KA-1807 H107D12-10V4-hIgG4M (SEQ ID NO. 14; HCDRs: SEQ ID NOs. 28 / 29 / 30):

[0176] >Light chain variable region of anti-PD-1 humanized antibody KA-1807 H107D12-10V4-hIgG4M (SEQ ID NO. 15; LCDRs: SEQ ID NOs. 31 / 33 / 32):

[0177] >Heavy chain variable region of anti-PD-1 mouse antibody 107D12-10 (SEQ ID NO. 12; HCDRs: SEQ ID NOs. 28 / 29 / 30):

[0178] >Light chain variable region of anti-PD-1 mouse antibody 107D12-10 (SEQ ID NO. 13; LCDRs: SEQ ID NOs. 31 / 33 / 32):

[0179] >KV4-59-1 (SEQ ID NO.2; LCDRs: SEQ ID NOs.25 / 26 / 32):

[0180] >Human heavy chain CH1 and FC sequence (SEQ ID NO.17):

[0181] hIgG4-S228P

[0182] >Human light chain CL sequence (SEQ ID NO.18):

[0183] hkappa

[0184] >Light chain (SEQ ID NO. 35):

[0185] >Light chain (SEQ ID NO. 36):

[0186] >Light chain (SEQ ID NO. 37):

[0187] Example 10 Detection of Binding of Anti-PD1 Humanized Antibodies and Chimeric Antibodies to PD1-Expressing Cells

[0188] Flow cytometry (FACS) was used to detect the binding of the humanized and chimeric antibodies to PD1-expressing cells. The experimental procedure was similar to that of Example 7. Nivolumab and pembrolizumab were used as positive control antibodies, and Goat anti-human IgG-PE (Southern Biotech, September 2010) was used as the secondary antibody. The results are shown in Table 5 and Figure 5.

[0189] Table 5. Detection results of binding of anti-PD1 humanized antibodies and chimeric antibodies to PD1-expressing cells

[0190] Example 11 Detection of the Blocking Effect of Anti-PD1 Humanized Antibodies and Chimeric Antibodies on the Binding of PD1 to PDL1-Expressing Cells

[0191] 293T-PDL1 cells were collected, washed once with FACS buffer, and diluted to 2-5 × 10 5Cells were plated in 96-well plates. 50 μl of a premix of the test antibodies (anti-PD-1 chimeric antibodies KA-1773 M107D12-10CLC1-hIgG4M and KA-1774 M107D12-10CLC2-hIgG4M, humanized antibody KA-1807 H107D12-10V4-hIgG4M, and control antibodies nivolumab and pembrolizumab) and 30 ng of the fusion protein PD-1-mFc were added to each well and incubated for 2 hours. Each well was washed twice with 400 μl of FACS buffer, and a secondary PE anti-mouse IgG Fc antibody was added for 1 hour. Each well was then washed twice with 400 μl of FACS buffer before detection. The results are shown in Table 6 and Figure 6.

[0192] Table 6. Detection results of blocking the binding of PD1 to PDL1 expressing cells by anti-PD1 antibodies

[0193] Example 12 Construction of humanized and chimeric antibodies against LAG3

[0194] The heavy chain variable region of the anti-LAG3 murine antibody 28G2 was humanized to generate a humanized antibody sequence (SEQ ID NO. 19). Furthermore, the light chain variable region of the humanized PD1 antibody (SEQ ID NO. 15) provided in Example 9 was used as the light chain variable region of the humanized anti-LAG3 antibody. The coding sequence of the humanized antibody sequence was ligated with the coding sequences of the human IgG4 heavy chain constant region (SEQ ID NO. 17) and the human kappa light chain constant region (SEQ ID NO. 18), respectively. The resulting coding genes were cloned into a eukaryotic expression vector and expressed to generate humanized anti-LAG3 antibodies designated KA-1780 H28G2-7V2-hIgG4M and KA-1782 H28G2-7V4-hIgG4M. The variable region sequence (SEQ ID NO. 19; SEQ ID NO. 15) and full-length light chain sequence (SEQ ID NO. 37) of the latter are shown below.

[0195] In addition, two chimeric antibodies were constructed based on murine anti-28G2 and murine anti-107D12-10. One chimeric antibody was constructed by ligating the coding sequence of the heavy chain variable region of murine anti-28G2 (SEQ ID NO. 10) to the coding sequence of the heavy chain constant region of human IgG4, and ligating the coding sequence of the light chain variable region of murine anti-107D12-10 (SEQ ID NO. 13) to the coding sequence of the light chain constant region of human kappa. The resulting coding genes were cloned into a eukaryotic expression vector and expressed to obtain a chimeric anti-LAG3 antibody named KA-1728 M28G2-7CLC1-hIgG4M. Its variable region sequences (SEQ ID NO. 10; SEQ ID NO. 13) and full-length light chain sequence (SEQ ID NO. 36) are shown below. Another chimeric antibody was constructed as follows: the coding sequence of the heavy chain variable region of mouse anti-28G2 (SEQ ID NO.10) was linked to the coding sequence of the heavy chain constant region of human IgG4, and the coding sequence of the light chain variable region shown in SEQ ID NO.2 (KV4-59-1) was linked to the coding sequence of the light chain constant region of human kappa. The resulting coding genes were cloned into a eukaryotic expression vector, expressed, and a chimeric anti-LAG3 antibody was obtained, designated KA-1733 M28G2-7CLC2-hIgG4M. Its variable region sequences (SEQ ID NO.10; SEQ ID NO.2) and full-length light chain sequence (SEQ ID NO.35) are shown below.

[0196] >Heavy chain variable region of anti-LAG3 humanized antibody KA-1782 H28G2-7V4-hIgG4M (SEQ ID NO. 19; HCDRs: SEQ ID NOs. 22 / 34 / 24):

[0197] >Light chain variable region of anti-LAG3 humanized antibody KA-1782 H28G2-7V4-hIgG4M (light chain variable region of anti-PD1 humanized antibody KA-1807 H107D12-10V4-hIgG4M; SEQ ID NO. 15; LCDRs: SEQ ID NOs. 31 / 33 / 32):

[0198] > Heavy chain variable region of anti-LAG3 murine anti-28G2 (SEQ ID NO. 10; HCDRs: SEQ ID NOs. 22 / 23 / 24):

[0199] >Light chain variable region of anti-PD-1 mouse antibody 107D12-10 (SEQ ID NO. 13; LCDRs: SEQ ID NOs. 31 / 33 / 32):

[0200] >KV4-59-1 (SEQ ID NO.2; LCDRs: SEQ ID NOs.25 / 26 / 32):

[0201] >Human heavy chain CH1 and FC sequence (SEQ ID NO.17):

[0202] hIgG4-S228P

[0203] >Human light chain CL sequence (SEQ ID NO.18):

[0204] hkappa

[0205] >Light chain (SEQ ID NO. 35):

[0206] >Light chain (SEQ ID NO. 36):

[0207] >Light chain (SEQ ID NO. 37):

[0208] Example 13 Detection of Binding of Anti-LAG3 Humanized Antibodies and Chimeric Antibodies to LAG3-Expressing Cells

[0209] Flow cytometry (FACS) was used to detect the binding of the humanized and chimeric antibodies of Example 12 to LAG3-expressing cells. The experimental procedure was similar to that of Example 4. Relatlimab was used as a positive control antibody, and Goat anti-human IgG-PE (Southern Biotech, September 2010) was used as a secondary antibody. The results are shown in Table 7 and Figure 7.

[0210] Table 7. Detection results of binding of anti-LAG3 humanized antibodies and chimeric antibodies to LAG3-expressing cells

[0211] Example 14 Detection of Blockade of LAG3 Binding to Tumor Cells by Anti-LAG3 Humanized Antibodies and Chimeric Antibodies

[0212] Daudi cells were collected, washed once with FACS buffer, and diluted to 2-5 × 10 5Cells were plated in a 96-well plate. 50 μl of a premix of test antibodies (chimeric antibodies KA-1728 M28G2-7CLC1-hIgG4M and KA-1733 M28G2-7CLC2-hIgG4M, humanized antibodies KA-1780 H28G2-7V2-hIgG4M and KA-1782 H28G2-7V4-hIgG4M, and control antibody Relatlimab) and 500 ng of human LAG3-mFc were added to each well and incubated for 2 hours. The cells were washed twice with 400 μl of FACS buffer per well, and then a PE anti-mouse IgG Fc secondary antibody was added and incubated for 1 hour. The cells were then washed twice with 400 μl of FACS buffer per well. The results are shown in Table 8 and Figure 8.

[0213] Table 8. Detection results of anti-LAG3 humanized antibodies and chimeric antibodies blocking the binding of LAG3 to tumor cells

[0214] Example 15 Construction of PD1×LAG3 bispecific antibody

[0215] The coding sequence of the amino acid sequence shown in SEQ ID NO.15 or SEQ ID NO.16 below (the sequence obtained by humanizing KV4-59-1) is linked to the coding sequence of the light chain constant region of human kappa (SEQ ID NO.18) to obtain the common light chain 1 (SEQ ID NO.37) or common light chain 2 (SEQ ID NO.38) of the bispecific antibody.

[0216] The PD1 humanized antibody heavy chain variable region coding sequence was linked to the coding sequences of the following human heavy chain Knob CH1 and FC sequences; the LAG3 humanized antibody heavy chain variable region coding sequence was linked to the coding sequences of the following human heavy chain Hole CH1 and FC sequences. Alternatively, the LAG3 humanized antibody heavy chain variable region coding sequence was linked to the coding sequences of the following human heavy chain Knob CH1 and FC sequences; the PD1 humanized antibody heavy chain variable region coding sequence was linked to the coding sequences of the following human heavy chain Hole CH1 and FC sequences.

[0217] The obtained coding sequences were cloned into eukaryotic expression vectors to obtain three recombinant expression plasmids (encoding common light chain 1 or 2, encoding heavy chain targeting PD1, and encoding heavy chain targeting LAG3). The three plasmids were transiently co-transfected using the HEK293F expression system to produce the PD1×LAG3 bispecific antibody. Briefly, for a 1L shake flask, HEK293F cells were cultured at a rate of 1×10 6The cells were inoculated into 250 mL of culture medium at a density of 10 / mL and incubated at 110 rpm and 5% CO2. The next day, the three expression vectors prepared in advance were mixed with the transfection reagent in a certain proportion and the cells were inoculated at a density of 2×10 6 The transfection complex was added to the cells at a cell density of 100 μg / mL. Nutrients and DNA inhibitors were added 24 hours later. After 5-7 days of cell culture, the expression supernatant was collected, centrifuged, filtered, and purified using a MabSelectSure affinity chromatography column (GE Healthcare). The purified antibodies were tested for purity by SDS-PAGE electrophoresis and antibody concentration was detected using Nanodrop.

[0218] The domains contained in the obtained PD1×LAG3 bispecific antibody are shown in Table 9.

[0219] Table 9. Bispecific antibodies containing a common light chain

[0220] >Heavy chain variable region of anti-PD-1 humanized antibody KA-1807 H107D12-10V4-hIgG4M (SEQ ID NO. 14; HCDRs: SEQ ID NOs. 28 / 29 / 30):

[0221] >Heavy chain variable region of anti-LAG3 humanized antibody KA-1782 H28G2-7V4-hIgG4M (SEQ ID NO. 19; HCDRs: SEQ ID NOs. 22 / 34 / 24):

[0222] >Light chain variable region of anti-PD-1 humanized antibody KA-1807 H107D12-10V4-hIgG4M (SEQ ID NO. 15; LCDRs: SEQ ID NOs. 31 / 33 / 32):

[0223] > Humanized sequence of KV4-59-1 (SEQ ID NO. 16; LCDRs: SEQ ID NOs. 25 / 26 / 32):

[0224] >Human heavy chain Knob CH1 and FC sequence (hIgG4; SEQ ID NO.20):

[0225] >Human heavy chain Hole CH1 and FC sequence (hIgG4; SEQ ID NO.21):

[0226] >Human light chain CL sequence (SEQ ID NO.18):

[0227] hkappa

[0228] >Light chain (SEQ ID NO. 37):

[0229] >Light chain (SEQ ID NO. 38):

[0230] Example 16 Detection of Binding of PD1×LAG3 Bispecific Antibody with Common Light Chain 1 to PD1-Expressing Cells and LAG3-Expressing Cells

[0231] As described in Examples 4 and 7, flow cytometry (FACS) was used to detect the binding of the PD1×LAG3 bispecific antibody to PD1-expressing cells (293T-PD1 cells) and LAG3-expressing cells (293T-LAG3 cells), respectively. The results are shown in Table 10 and Figure 9 (for PD1 targeting), and in Table 11 and Figure 10 (for LAG3 targeting).

[0232] Table 10. Detection results of PD1×LAG3 bispecific antibody binding to PD1-expressing cells

[0233] Table 11. Detection results of PD1×LAG3 bispecific antibody binding to LAG3-expressing cells

[0234] Example 17 Detection of the Blockade of PD1 Binding to PDL1-Expressing Cells and LAG3 Binding to Tumor Cells by a PD1×LAG3 Bispecific Antibody with Common Light Chain 1

[0235] As described in Examples 5 and 8, flow cytometry (FACS) was used to examine the blocking effect of the PD1×LAG3 bispecific antibody on the binding of PD1 to PDL1-expressing cells and LAG3 to tumor cells, respectively. The results are shown in Table 12 and Figure 11 (for PD1 targeting), and in Table 13 and Figure 12 (for LAG3 targeting).

[0236] Table 12. Results of the test on the blocking effect of PD1×LAG3 bispecific antibody on the binding of PD1 to PDL1-expressing cells

[0237] Table 13. Results of the test on the blocking effect of PD1×LAG3 bispecific antibody on the binding of LAG3 to tumor cells

[0238] Example 18 Affinity Detection of PD1×LAG3 Bispecific Antibody with Common Light Chain 1 to PD1 and LAG3

[0239] The ForteBio Octet assay tested the affinity of the PD1×LAG3 bispecific antibody for PD1 and LAG3. The mobile phases used were PD1-His (Kyinno, Cat. No.: KP-1023) diluted to 400 nM, 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, and 3.12 nM, and LAG3-His (ACRO, Cat. No.: LA3-H5222) diluted to 200, 100, 50, 25, 12.5, 6.25, and 3.12 nM, respectively. The results are shown in Tables 13 and 14.

[0240] Table 13. Affinity of PD1×LAG3 bispecific antibodies to PD1

[0241] Table 14. Affinity of PD1×LAG3 bispecific antibodies to LAG3

[0242] Example 19 Detection of Binding of PD1×LAG3 Bispecific Antibody with Common Light Chain 2 to PD1-Expressing Cells and LAG3-Expressing Cells

[0243] As described in Examples 4 and 7, flow cytometry (FACS) was used to detect the binding of the PD1×LAG3 bispecific antibody to PD1-expressing cells (293T-PD1 cells) and LAG3-expressing cells (293T-LAG3 cells), respectively. The results are shown in Table 16 and Figure 13 (for PD1 targeting), and in Table 17 and Figure 14 (for LAG3 targeting).

[0244] Table 16. Detection results of PD1×LAG3 bispecific antibody binding to PD1-expressing cells

[0245] Table 17. Detection results of PD1×LAG3 bispecific antibody binding to LAG3-expressing cells

[0246] Example 20 Detection of the Blockade of PD1 Binding to PDL1-Expressing Cells and LAG3 Binding to Tumor Cells by a PD1×LAG3 Bispecific Antibody with Common Light Chain 2

[0247] As described in Examples 5 and 8, flow cytometry (FACS) was used to examine the blocking effect of the PD1×LAG3 bispecific antibody on the binding of PD1 to PDL1-expressing cells and LAG3 to tumor cells, respectively. The results are shown in Table 18 and Figure 15 (for PD1 targeting), and in Table 19 and Figure 16 (for LAG3 targeting).

[0248] Table 18. Results of the test on the blocking effect of PD1×LAG3 bispecific antibody on the binding of PD1 to PDL1-expressing cells

[0249] Table 19. Results of the test on the blocking effect of PD1×LAG3 bispecific antibody on the binding of LAG3 to tumor cells

[0250] Example 21 Affinity Detection of PD1×LAG3 Bispecific Antibody with Common Light Chain 2 to PD1 and LAG3

[0251] The ForteBio Octet assay tested the affinity of the PD1×LAG3 bispecific antibody for PD1 and LAG3. The mobile phases used were PD1-His (Kyinno, Cat. No.: KP-1023) diluted to 400 nM, 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, and 3.12 nM, and LAG3-His (ACRO, Cat. No.: LA3-H5222) diluted to 200, 100, 50, 25, 12.5, 6.25, and 3.12 nM, respectively. The results are shown in Tables 20 and 21.

[0252] Table 20. Affinity of PD1×LAG3 bispecific antibodies to PD1

[0253] Table 21. Affinity of PD1×LAG3 bispecific antibodies to LAG3

[0254] Example 22 Preparation of hybridoma cells secreting anti-PDL1 antibodies

[0255] As described in Example 3, mice constructed in Example 2 were immunized with a fusion protein of the extracellular region of human PDL1 and mouse Fc fragment (abbreviated as "PDL1-mFc," Kyinno, Cat No. KP-1008). Mice with high titers were selected, and serum was collected. After dissection, spleens were removed and splenocytes isolated. These splenocytes were fused with cultured myeloma cells to generate hybridomas.

[0256] An ELISA plate was coated with PDL1-his, and the binding activity of hybridoma cell supernatant with PDL1-his was detected by ELISA to obtain multiple positive hybridoma cell lines secreting anti-PDL1 antibodies.

[0257] Example 23 Detection of Binding of Hybridoma Cell Culture Supernatant Containing Anti-PDL1 Antibodies to PDL1-Expressing Cells

[0258] 293T-PDL1 cells (Kyinno, Cat No.: KC-0205) overexpressing human PDL1 were cultured in PBS containing 2% FBS to a cell concentration of 1×10 7 cells / ml of cell suspension.

[0259] Flow cytometry was then used to detect the binding of hybridoma cell culture supernatants containing anti-PDL1 antibodies to 293T-PDL1 cells, as described in Example 4. The difference was that the positive control antibody was atezolizumab (Kyinno, Cat No.: KA-1303-02), and 5 μl of a PE-labeled anti-mouse Fc tag secondary antibody was added to detect binding of the hybridoma supernatant, while a secondary anti-human antibody, Goat anti-human IgG-PE (Southern Biotech, 2010-09), was added to detect binding of the positive control antibody atezolizumab. The results are shown in Table 22 and Figure 17.

[0260] Table 22. Detection results of the binding of hybridoma cell culture supernatant containing anti-PDL1 antibodies to PDL1-expressing cells

[0261] Example 24 Detection of the Blocking Effect of Hybridoma Cell Culture Supernatant Containing Anti-PDL1 Antibodies on the Binding of PDL1-mFc Protein to PD1-Expressing Cells

[0262] 293T cells overexpressing human PD1 (abbreviated as “293T-PD1 cells”; Kyinno, Cat No.: KC-0204) were washed once with FACS buffer and plated at 2-5×10 5Cells were plated into 96-well plates. 50 μl of hybridoma supernatant or a premix of the positive control antibody atezolizumab and 500 ng of human PDL1-mFc (Kyinno, Cat No.: KP-1008) or PDL1-hFc (Kyinno, Cat No.: KP-1009) (NCBI Reference Sequence: NP_054862.1) was added to each well and incubated for 2 hours. Each well was washed twice with 400 μl of FACS buffer and then co-incubated with either the anti-human secondary antibody Goat anti-human IgG-PE (Southern Biotech, 2010-09) or the anti-mouse secondary antibody PE anti-mouse IgG Fc (Biolegend, 405307) for 1 hour. Each well was washed twice with 400 μl of FACS buffer before detection. Results are shown in Table 23 and Figure 18.

[0263] Table 23. Detection results of the blocking effect of hybridoma cell culture supernatant containing anti-PDL1 antibody on the binding of PDL1 to PD1-expressing cells

[0264] A mouse antibody was obtained from the hybridoma cell KD-22-0227 58E3-2, named 58E3-2, and its variable region sequence is as follows (wherein the heavy chain and light chain CDRs are underlined and obtained according to the KABAT definition method):

[0265] >Heavy chain variable region of anti-PDL1 murine antibody 58E3-2 (SEQ ID NO. 39; HCDRs: SEQ ID NOs. 48 / 49 / 50):

[0266] >Light chain variable region of anti-PDL1 mouse antibody 58E3-2 (KV4-59-1; SEQ ID NO. 2; LCDRs: SEQ ID NOs. 25 / 26 / 32):

[0267] Example 25 Detection of Blockade of PDL1 / PD1 Signaling by Anti-PDL1 Mouse Antibody

[0268] Jurkat NFAT-PD1-luc cells (Kyinno, Cat No.: KC-1503, expressing luciferase after NFAT signaling activation) and 293T OS8-hPDL1 cells (Kyinno, Cat No.: KC-1148, expressing OKT3 antibody on the cell surface) were respectively adjusted to a cell density of 20,000 cells / 45 μL using RPMI-1640 + 10% FBS medium. Then, 45 μL of 293T OS8-hPDL1 cells and Jurkat NFAT-PD1-luc cells were added to each well of a 96-well culture plate, followed by 10 μL of serially diluted positive control antibody Atezolizumab or anti-PDL1 mouse antibody. After mixed culture for 6 hours, 50 μL of Bright-Lite solution (Vazyme, Cat No.: 500) was added to each well. No.: DD1204) and detected the activated luciferase signal. Background activation was determined for incubation without antibody. A correlation curve was plotted between the fold increase in activation intensity after adding antibody and the antibody concentration, and the IC50 of the PDL1 antibody was calculated. The test results are shown in Table 24 and Figure 19.

[0269] Table 24. Detection results of anti-PDL1 mouse antibody blocking PDL1 / PD1 signaling

[0270] Example 26 Affinity Detection of Anti-PDL1 Mouse Antibody and PDL1

[0271] The affinity of the anti-PDL1 mouse antibody for PDL1 was determined using the ForteBio Octet. The mobile phase used was PDL1-His (Kyinno, Cat. No.: KP-1002) at concentrations of 200 nM, 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, and 3.12 nM. The results are shown in Table 25.

[0272] Table 25. Affinity of anti-PDL1 mouse antibodies to PDL1

[0273] Example 27 Construction of humanized anti-PDL1 antibody

[0274] The heavy and light chain variable regions of the anti-PDL1 murine antibody 58E3-2 were humanized to generate humanized antibody sequences (SEQ ID NO. 40; SEQ ID NO. 41). The coding sequences of the humanized antibody sequences were ligated to the coding sequences of the heavy chain constant region of human IgG1 (SEQ ID NO. 42) and the light chain constant region of human kappa (SEQ ID NO. 18), respectively. The resulting coding genes were cloned into a eukaryotic expression vector and expressed to obtain a humanized anti-PDL1 antibody named KA-2016 H58E3-2V4-2-hIgG1. The variable region sequences (SEQ ID NO. 40; SEQ ID NO. 41) and full-length light chain (SEQ ID NO. 43) are shown below (heavy and light chain CDRs are underlined).

[0275] >Heavy chain variable region of anti-PDL1 humanized antibody KA-2016 H58E3-2V4-2-hIgG1 (SEQ ID NO. 40; HCDRs: SEQ ID NOs. 48 / 51 / 50):

[0276] Light chain variable region of anti-PDL1 humanized antibody KA-2016 H58E3-2V4-2-hIgG1 (SEQ ID NO. 41; HCDRs: SEQ ID NOs. 52 / 26 / 53):

[0277] >Human heavy chain CH1 and FC sequence (SEQ ID NO.42):

[0278] hIgG1

[0279] >Human light chain CL sequence (SEQ ID NO.18):

[0280] hkappa

[0281] >Light chain (SEQ ID NO. 43):

[0282] Example 28 Detection of Binding of Anti-PDL1 Humanized Antibodies to PDL1-Expressing Cells

[0283] 293T-PDL1 cells were prepared in PBS containing 2% FBS to a cell concentration of 1×10 7 cells / ml of cell suspension.

[0284] Then, flow cytometry was used to detect the binding of the anti-PDL1 humanized antibody KA-2016 H58E3-2V4-2-hIgG1 or the positive control antibody Atezolizumab to 293T-PDL1 cells, as described in Example 23. The detection results are shown in Table 26 and Figure 20.

[0285] Table 26. Detection results of binding of anti-PDL1 humanized antibodies to PDL1 expressing cells

[0286] Example 29 Detection of the Blocking Effect of Anti-PDL1 Humanized Antibodies on the Binding of PDL1-mFc Protein to PD1-Expressing Cells

[0287] As described in Example 24, the ability of humanized anti-PDL1 antibodies to block the binding of PDL1-mFc protein to PD1-expressing cells was tested. 50 μl of a premix of serially diluted humanized antibody KA-2016 H58E3-2V4-2-hIgG1 or the positive control antibody atezolizumab and 500 ng of human PDL1-mFc was added, followed by incubation with the secondary anti-mouse antibody PE anti-mouse IgG Fc. The results are shown in Table 27 and Figure 21.

[0288] Table 27. Detection results of blocking the binding of PDL1 to PD1-expressing cells by anti-PDL1 humanized antibodies

[0289] Example 30 Detection of Blockade of PDL1 / PD1 Signaling by Anti-PDL1 Humanized Antibodies

[0290] The blocking effect of anti-PDL1 humanized antibodies on PDL1 / PD1 signaling was tested as described in Example 25. The test results are shown in Table 28 and Figure 22.

[0291] Table 28. Detection results of blocking PDL1 / PD1 signaling by anti-PDL1 humanized antibodies

[0292] Example 31 Preparation of Hybridoma Cells Secreting Anti-EGFR Antibodies

[0293] As described in Example 3, mice constructed in Example 2 were immunized with a fusion protein of the extracellular region of human EGFR (NCBI Reference Sequence: BC118665.1) and mouse Fc (abbreviated as "EGFR-mFc," Kyinno, Cat No.: KP-1148). Mice with high titers were selected, and serum was collected. After dissection, spleens were removed and splenocytes isolated. These splenocytes were fused with cultured myeloma cells to generate hybridomas.

[0294] ELISA plates were coated with EGFR-his (Kyinno, Cat No.: KP-1341), and the binding activity of hybridoma cell supernatants to EGFR-his was detected by ELISA to obtain multiple positive hybridoma cell lines secreting anti-EGFR antibodies.

[0295] Example 32 Detection of Binding of Hybridoma Cell Culture Supernatant Containing Anti-EGFR Antibodies to EGFR-Expressing Cells

[0296] The gene sequence encoding human EGFR (NCBI Reference Sequence: BC118665.1) was constructed into a PLVX viral packaging vector (Clontech, virus package mix, Cat No.: 631275) and transfected into CT26 cells. A drug-resistant cell line, CT26 cells stably expressing human EGFR (abbreviated as "CT26-EGFR cells"; Kyinno, Cat No.: KC-1451), was selected with puromycin to obtain a drug-resistant cell line. CT26-EGFR cells were then cultured in PBS containing 2% FBS to a cell concentration of 10 7 cells / ml of cell suspension.

[0297] Flow cytometry was then used to detect the binding of hybridoma cell culture supernatants containing anti-EGFR antibodies to CT26-EGFR cells, as described in Example 4. The difference was that the positive control antibody was cetuximab (Kyinno, Cat No.: KA-1398), and 5 μl of a PE-labeled anti-mouse Fc tag secondary antibody was added to detect binding of the hybridoma supernatant, while 5 μl of a Goat anti-human IgG-PE secondary antibody (Southern Biotech, 2010-09) was added to detect binding of the positive control antibody cetuximab. The results are shown in Table 29 and Figure 23.

[0298] Table 29. Detection results of the binding of hybridoma cell culture supernatant containing anti-EGFR antibodies to EGFR-expressing cells

[0299] A mouse antibody was obtained from the hybridoma cell KD-22-0198 22A12-2, named 22A12-2, and its variable region sequence is as follows (heavy chain and light chain CDRs are underlined and obtained according to the KABAT definition method):

[0300] >Heavy chain variable region of anti-EGFR mouse antibody 22A12-2 (SEQ ID NO.44; HCDRs: SEQ ID NOs.54 / 55 / 56):

[0301] >Light chain variable region of anti-EGFR mouse antibody 22A12-2 (SEQ ID NO.13; HCDRs: SEQ ID NOs.31 / 33 / 32):

[0302] Example 33 Detection of the Blockade of EGFR-Fc Protein Binding to EGF by Anti-EGFR Mouse Antibody

[0303] ELISA plates were coated with EGF-His (2 μg / ml, Acro, EGF-H52H3) dissolved in PBS overnight at 4°C and blocked the next day with blocking buffer (PBS containing 1% bovine serum albumin) for 1 hour at room temperature. Cetuximab, a control antibody, or hybridoma antibodies were serially diluted and incubated with 0.4 μg / ml of EGFR-mFc (Kyinno, Cat No.: KP-1148) or EGFR-hFc (Kyinno, Cat No.: KP-1149), followed by incubation with the EGF-His-coated ELISA plates for 1 hour at room temperature. After washing with PBS containing 0.5% Tween-20, the cells were incubated with either HRP anti-mouse IgG (1:10,000 dilution) or HRP anti-human IgG (1:10,000 dilution) secondary antibodies. After washing with PBS containing 0.5% Tween-20, HRP substrate was added for color development, and binding signals were detected and IC50 values ​​were calculated. The results are shown in Table 30 and Figure 24.

[0304] Table 30. Detection results of the blocking effect of anti-EGFR mouse antibody on the binding of EGFR to EGF

[0305] Example 34 Detection of Blockade of EGFR Signaling by Anti-EGFR Mouse Antibodies

[0306] 293T-NFAT-Luc2-EGFR cells (Kyinno, Cat No.: KC-2952; luciferase expression upon EGFR signaling activation) were cultured at a density of 20,000 cells / 80 μL using RPMI-1640 medium supplemented with 10% FBS. 10 μL of serially diluted positive control antibody cetuximab or anti-EGFR mouse antibody was then added and incubated for 30 minutes. 10 μL of EGF-His (final concentration 20 ng / mL, Acro, EGF-H52H3) was then added and incubated overnight. 50 μL of Bright-Lite solution (Vazyme, Cat No.: DD1204) was then added to each well to detect activated luciferase signal. Incubation without EGF was considered background activation. Correlation curves were plotted between the fold increase in activation intensity after EGF addition and antibody concentration, and the IC50 of the EGFR antibody was calculated. The results are shown in Table 31 and Figure 25.

[0307] Table 31. Detection results of anti-EGFR mouse antibody blocking EGFR signal transduction

[0308] Example 35 Affinity Detection of Anti-EGFR Mouse Antibody to EGFR

[0309] The affinity of the anti-EGFR mouse antibody for EGFR was determined using the ForteBio Octet assay. The mobile phase used EGFR-His (Kyinno, Cat. No. KP-1150) at concentrations of 200 nM, 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, and 3.12 nM. The results are shown in Table 32.

[0310] Table 32. Affinity of anti-EGFR mouse antibody to EGFR

[0311] Example 36 Construction of humanized anti-EGFR antibodies

[0312] The heavy chain variable region of the anti-EGFR murine antibody 22A12-2 was humanized to generate a humanized antibody sequence (SEQ ID NO. 45). Furthermore, the light chain variable region of the humanized PD1 antibody (SEQ ID NO. 15) provided in Example 9 was used as the light chain variable region of the humanized anti-EGFR antibody. The coding sequence of the humanized antibody sequence was ligated with the coding sequences of the heavy chain constant region of human IgG1 (SEQ ID NO. 42) and the light chain constant region of human kappa (SEQ ID NO. 18), respectively. The resulting coding genes were cloned into a eukaryotic expression vector and expressed to generate a humanized anti-EGFR antibody named KA-1063 H22A12-2V1-hIgG1. The variable region sequences (SEQ ID NO. 45; SEQ ID NO. 15) and full-length light chain (SEQ ID NO. 37) are shown below (heavy and light chain CDRs are underlined).

[0313] >Heavy chain variable region of anti-EGFR humanized antibody KA-1063 H22A12-2V1-hIgG1 (SEQ ID NO.45; HCDRs: SEQ ID NOs.54 / 55 / 56):

[0314] >Light chain variable region of anti-EGFR humanized antibody KA-1063 H22A12-2V1-hIgG1 (light chain variable region of anti-PD1 humanized antibody KA-1807 H107D12-10V4-hIgG4M; SEQ ID NO. 15; LCDRs: SEQ ID NOs. 31 / 33 / 32):

[0315] >Human heavy chain CH1 and FC sequence (SEQ ID NO.42):

[0316] hIgG1

[0317] >Human light chain CL sequence (SEQ ID NO.18):

[0318] hkappa

[0319] >Light chain (SEQ ID NO. 37):

[0320] Example 37 Detection of Binding of Anti-EGFR Humanized Antibodies to EGFR-Expressing Cells

[0321] CT26-EGFR cells were cultured in PBS containing 2% FBS to a cell concentration of 1 × 10 7cells / ml of cell suspension.

[0322] Then, the binding of the humanized EGFR antibody to CT26-EGFR cells was detected by flow cytometry, as described in Example 32. The detection results are shown in Table 33 and Figure 26.

[0323] Table 33. Detection results of binding of anti-EGFR humanized antibodies to EGFR-expressing cells

[0324] Example 38 Detection of the Blocking Effect of Humanized Anti-EGFR Antibodies on the Binding of EGFR-Fc Protein to EGF

[0325] Referring to Example 33, the blocking effect of humanized EGFR antibodies on EGFR-EGF binding was tested. Cetuximab, a control antibody, or KA-1063 H22A12-2V1-hIgG1, a humanized antibody, was serially diluted and incubated with 0.4 μg / ml of EGFR-mFc (Kyinno, Cat. No. KP-1148). Finally, the cells were incubated with a secondary anti-mouse antibody (HRP anti-mouse IgG). The results are shown in Table 34 and Figure 27.

[0326] Table 34. Detection results of blocking the binding of EGFR to EGF by anti-EGFR humanized antibodies

[0327] Example 39 Detection of Blockade of EGFR Signaling by Humanized Anti-EGFR Antibodies

[0328] The blocking effect of anti-EGFR humanized antibodies on EGFR signaling was tested with reference to Example 34. The test results are shown in Table 35 and Figure 28.

[0329] Table 35. Detection results of blocking EGFR signaling by anti-EGFR humanized antibodies

[0330] Example 40 Construction of EGFR×PDL1 bispecific antibody

[0331] The coding sequence of the amino acid sequence shown in SEQ ID NO. 15 or SEQ ID NO. 41 was linked to the coding sequence of the human kappa light chain constant region (SEQ ID NO. 18) to obtain the common light chain 1 (SEQ ID NO. 37) or common light chain 3 (SEQ ID NO. 43) of the bispecific antibody.

[0332] The EGFR humanized antibody heavy chain variable region coding sequence was connected to the coding sequences of the following human heavy chain Knob CH1 and FC sequences; the PDL1 humanized antibody heavy chain variable region coding sequence was connected to the coding sequences of the following human heavy chain Hole CH1 and FC sequences.

[0333] Referring to Example 15, an EGFR×PDL1 bispecific antibody was obtained, and the domains included are shown in Table 36.

[0334] Table 36. Bispecific antibodies with common light chain 1 or 3

[0335] >Heavy chain variable region of anti-EGFR humanized antibody KA-1063 H22A12-2V1-hIgG1 (SEQ ID NO.45; HCDRs: SEQ ID NOs.54 / 55 / 56):

[0336] >Human heavy chain Knob CH1 and FC sequence (hIgG1; SEQ ID NO.46):

[0337] >Heavy chain variable region of anti-PDL1 humanized antibody KA-2016 H58E3-2V4-2-hIgG1 (SEQ ID NO. 40; HCDRs: SEQ ID NOs. 48 / 51 / 50):

[0338] >Human heavy chain Hole CH1 and FC sequence (hIgG1; SEQ ID NO.47):

[0339] >Light chain variable region of anti-EGFR humanized antibody KA-1063 H22A12-2V1-hIgG1 (light chain variable region of anti-PD1 humanized antibody KA-1807 H107D12-10V4-hIgG4M; SEQ ID NO. 15; LCDRs: SEQ ID NOs. 31 / 33 / 32):

[0340] >Light chain (SEQ ID NO. 37):

[0341] Light chain variable region of anti-PDL1 humanized antibody KA-2016 H58E3-2V4-2-hIgG1 (SEQ ID NO. 41; HCDRs: SEQ ID NOs. 52 / 26 / 53):

[0342] >Light chain (SEQ ID NO. 43):

[0343] Example 41 Detection of Binding of EGFR×PDL1 Bispecific Antibodies Having Common Light Chain 1 or 3 to PDL1-Expressing Cells

[0344] Flow cytometry was used to detect the binding of the EGFR×PDL1 bispecific antibody to PDL1-expressing cells, as described in Example 28. The detection results are shown in Table 37 and Figure 29.

[0345] Table 37. Results of binding of EGFR×PDL1 bispecific antibodies with common light chain 1 or 3 to PDL1-expressing cells

[0346] Example 42 Detection of Blockade of PDL1-mFc Protein Binding to PD1-Expressing Cells by EGFR×PDL1 Bispecific Antibodies Having Common Light Chain 1 or 3

[0347] As described in Example 29, the blocking effect of EGFR×PDL1 bispecific antibodies on the binding of PDL1-mFc protein to PD1-expressing cells was tested. 50 μl of a premix of serially diluted EGFR×PDL1 bispecific antibodies KA-2072 H22A12x58E3-CLC01, KA-2073-H22A12x58E3-CLC0, or the positive control antibody atezolizumab and 1.2 μg / ml human PDL1-mFc was added, followed by incubation with the secondary anti-mouse antibody PE anti-mouse IgG Fc. The test results are shown in Table 38 and Figure 30.

[0348] Table 38. Results of the test on the blocking effect of EGFR×PDL1 bispecific antibodies with common light chain 1 or 3 on the binding of PDL1 to PD1-expressing cells

[0349] Example 43 Detection of Blockade of PDL1 / PD1 Signaling by EGFR×PDL1 Bispecific Antibodies Having Common Light Chain 1 or 3

[0350] The blocking effect of the EGFR×PDL1 bispecific antibody on PDL1 / PD1 signaling was tested as described in Example 30. The test results are shown in Table 39 and Figure 31.

[0351] Table 39. Results of testing the blocking of PDL1 / PD1 signaling by EGFR×PDL1 bispecific antibodies with common light chain 1 or 3

[0352] Example 44 Detection of Binding of EGFR×PDL1 Bispecific Antibodies Having Common Light Chain 1 or 3 to EGFR-Expressing Cells

[0353] As described in Example 32, flow cytometry was used to detect the binding of the EGFR×PDL1 bispecific antibody to CT26-EGFR cells; the difference was that the secondary antibody was 5 μl Goat anti-human IgG-PE (Southern Biotech, 2010-09). The detection results are shown in Table 40 and Figure 32.

[0354] Table 40. Results of binding of EGFR×PDL1 bispecific antibodies with common light chain 1 or 3 to EGFR-expressing cells

[0355] Example 45 Detection of the Blockade of EGF-mFc Protein Binding to EGFR-Expressing Cells by EGFR×PDL1 Bispecific Antibodies Having Common Light Chain 1 or 3

[0356] CT26 cells overexpressing human EGFR ("CT26-EGFR cells") were collected. EGFR×PDL1 bispecific antibodies KA-2072 H22A12x58E3-CLC01 and KA-2073-H22A12x58E3-CLC0, or the positive control antibody cetuximab, were serially diluted and incubated with CT26-EGFR cells. The cells were then incubated with 0.05 μg / ml of EGF-mFc (Acro, EGF-H525b), and finally with the secondary anti-mouse antibody PE anti-mouse IgG Fc (Biolegend, 405307). Flow cytometry was used to detect EGF-mFc binding to the cells. The results are shown in Table 41 and Figure 33.

[0357] Table 41. Results of the test on the blocking effect of EGFR×PDL1 bispecific antibodies with common light chain 1 or 3 on the binding of EGF to EGFR-expressing cells

[0358] Example 46 Detection of Blockade of EGFR Signaling by EGFR×PDL1 Bispecific Antibodies Having Common Light Chain 1 or 3

[0359] The blocking effect of the EGFR×PDL1 bispecific antibody on EGFR signaling was tested as described in Example 34. The test results are shown in Table 42 and Figure 34.

[0360] Table 42. Results of testing the blocking of EGFR signaling by EGFR×PDL1 bispecific antibodies with common light chain 1 or 3

[0361] Example 47 Affinity Detection of EGFR×PDL1 Bispecific Antibodies with Common Light Chain 1 or 3 to EGFR and PDL1

[0362] The EGFR×PDL1 bispecific antibody was tested for binding to EGFR and PDL1 as described in Examples 26 and 35. The results are shown in Table 43.

[0363] Table 43. Affinity of EGFR×PDL1 bispecific antibodies with common light chain 1 or 3 to EGFR and PDL1

[0364] The above description of the specific embodiments of the present invention does not limit the present invention. Those skilled in the art can make various changes or modifications based on the present invention. As long as they do not depart from the spirit of the present invention, they should fall within the scope of the claims attached to the present invention.

Claims

1. A polypeptide, the amino acid sequence of which comprises: (1) the amino acid sequence shown in SEQ ID NO.25; the amino acid sequence shown in SEQ ID NO.26; and the amino acid sequence shown in SEQ ID NO.32; or (2) the amino acid sequence shown in SEQ ID NO.31; the amino acid sequence shown in SEQ ID NO.33; and the amino acid sequence shown in SEQ ID NO.32; or (3) the amino acid sequence shown by SEQ ID NO.52; the amino acid sequence shown by SEQ ID NO.26; and the amino acid sequence shown by SEQ ID NO.

53.

2. The polypeptide according to claim 1, characterized in that The polypeptide comprises the amino acid sequence shown in SEQ ID NO.2, SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.16 or SEQ ID NO.

41.

3. The polypeptide according to claim 1 or 2, characterized in that The polypeptide comprises the amino acid sequence shown in SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.37, SEQ ID NO.38 or SEQ ID NO.

43.

4. An antibody or an antigen-binding fragment thereof, comprising the polypeptide according to any one of claims 1 to 3 as an antibody light chain or light chain variable region; Preferably, the antibody or antigen-binding fragment thereof is an IgG-like antibody having at least two Fab arms and optionally an Fc region.

5. The antibody or antigen-binding fragment thereof according to claim 4, characterized in that: The antibody or antigen-binding fragment thereof comprises, in at least one Fab arm thereof, an amino acid sequence as defined in any one of (1) to (3) of claim 1 as light chain CDRs; or comprising the amino acid sequence shown in SEQ ID NO.2, SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.16 or SEQ ID NO.41 as a light chain variable region; or, The antibody or antigen-binding fragment thereof comprises the amino acid sequence shown in SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.37, SEQ ID NO.38 or SEQ ID NO.43 as a light chain.

6. The antibody or antigen-binding fragment thereof according to claim 4 or 5, characterized in that: The antibody or antigen-binding fragment thereof comprises in at least one Fab arm thereof the heavy chain CDRs (HCDR1, HCDR2 and HCDR3) and the light chain CDRs (LCDR1, LCDR2 and LCDR3) as shown below, respectively: (1) HCDR1 comprising the amino acid sequence of SEQ ID NO.28, HCDR2 comprising the amino acid sequence of SEQ ID NO.29, and HCDR3 comprising the amino acid sequence of SEQ ID NO.30; and, LCDR1 comprising the amino acid sequence of SEQ ID NO.25, LCDR2 comprising the amino acid sequence of SEQ ID NO.26, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32; (2) HCDR1 comprising the amino acid sequence of SEQ ID NO.22, HCDR2 comprising the amino acid sequence of SEQ ID NO.23, and HCDR3 comprising the amino acid sequence of SEQ ID NO.24; and, LCDR1 comprising the amino acid sequence of SEQ ID NO.25, LCDR2 comprising the amino acid sequence of SEQ ID NO.26, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32; (3) HCDR1 comprising the amino acid sequence of SEQ ID NO.28, HCDR2 comprising the amino acid sequence of SEQ ID NO.29, HCDR3 comprising the amino acid sequence of SEQ ID NO.30; and, LCDR1 comprising the amino acid sequence of SEQ ID NO.31, LCDR2 comprising the amino acid sequence of SEQ ID NO.33, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32; (4) HCDR1 comprising the amino acid sequence of SEQ ID NO.22, HCDR2 comprising the amino acid sequence of SEQ ID NO.23, and HCDR3 comprising the amino acid sequence of SEQ ID NO.24; and, LCDR1 comprising the amino acid sequence of SEQ ID NO.31, LCDR2 comprising the amino acid sequence of SEQ ID NO.33, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32; (5) HCDR1 comprising the amino acid sequence of SEQ ID NO.22, HCDR2 comprising the amino acid sequence of SEQ ID NO.34, and HCDR3 comprising the amino acid sequence of SEQ ID NO.24; and LCDR1 comprising the amino acid sequence of SEQ ID NO.31, LCDR2 comprising the amino acid sequence of SEQ ID NO.33, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32; (6) HCDR1 comprising the amino acid sequence of SEQ ID NO.22, HCDR2 comprising the amino acid sequence of SEQ ID NO.34, HCDR3 comprising the amino acid sequence of SEQ ID NO.24; and LCDR1 comprising the amino acid sequence of SEQ ID NO.25, LCDR2 comprising the amino acid sequence of SEQ ID NO.26 LCDR2 comprising the amino acid sequence shown in SEQ ID NO.31, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; (7) HCDR1 comprising the amino acid sequence of SEQ ID NO.48, HCDR2 comprising the amino acid sequence of SEQ ID NO.49, HCDR3 comprising the amino acid sequence of SEQ ID NO.50; and, LCDR1 comprising the amino acid sequence of SEQ ID NO.25, LCDR2 comprising the amino acid sequence of SEQ ID NO.26, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32; (8) HCDR1 comprising the amino acid sequence of SEQ ID NO.48, HCDR2 comprising the amino acid sequence of SEQ ID NO.51, HCDR3 comprising the amino acid sequence of SEQ ID NO.50; and, LCDR1 comprising the amino acid sequence of SEQ ID NO.52, LCDR2 comprising the amino acid sequence of SEQ ID NO.26, and LCDR3 comprising the amino acid sequence of SEQ ID NO.53; (9) HCDR1 comprising the amino acid sequence of SEQ ID NO.54, HCDR2 comprising the amino acid sequence of SEQ ID NO.55, and HCDR3 comprising the amino acid sequence of SEQ ID NO.56; and LCDR1 comprising the amino acid sequence of SEQ ID NO.31, LCDR2 comprising the amino acid sequence of SEQ ID NO.33, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32; (10) HCDR1 comprising the amino acid sequence of SEQ ID NO.48, HCDR2 comprising the amino acid sequence of SEQ ID NO.51, and HCDR3 comprising the amino acid sequence of SEQ ID NO.50; and LCDR1 comprising the amino acid sequence of SEQ ID NO.31, LCDR2 comprising the amino acid sequence of SEQ ID NO.33, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32; or (11) HCDR1 comprising the amino acid sequence shown in SEQ ID NO.54, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.55, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.56; and, LCDR1 comprising the amino acid sequence shown in SEQ ID NO.52, LCDR2 comprising the amino acid sequence shown in SEQ ID NO.26, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.

53.

7. The antibody or antigen-binding fragment thereof according to any one of claims 4 to 6, characterized in that The antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region in at least one Fab arm, wherein the heavy chain variable region and the light chain variable region respectively comprise: (1) the amino acid sequence shown in SEQ ID NO.12; and the amino acid sequence shown in SEQ ID NO.2 sequence; (2) the amino acid sequence shown in SEQ ID NO.10; and the amino acid sequence shown in SEQ ID NO.2; (3) the amino acid sequence shown in SEQ ID NO.12; and the amino acid sequence shown in SEQ ID NO.13; (4) the amino acid sequence shown in SEQ ID NO.10; and the amino acid sequence shown in SEQ ID NO.13; (5) the amino acid sequence shown in SEQ ID NO.14; and the amino acid sequence shown in SEQ ID NO.15; (6) the amino acid sequence shown in SEQ ID NO.19; and the amino acid sequence shown in SEQ ID NO.15; (7) the amino acid sequence shown in SEQ ID NO.14; and the amino acid sequence shown in SEQ ID NO.16; (8) the amino acid sequence shown in SEQ ID NO.19; and the amino acid sequence shown in SEQ ID NO.16; (9) the amino acid sequence shown in SEQ ID NO.39; and the amino acid sequence shown in SEQ ID NO.2; (10) the amino acid sequence shown in SEQ ID NO.40; and the amino acid sequence shown in SEQ ID NO.41; (11) the amino acid sequence shown in SEQ ID NO.44; and the amino acid sequence shown in SEQ ID NO.13; (12) the amino acid sequence shown in SEQ ID NO.45; and the amino acid sequence shown in SEQ ID NO.15; (13) the amino acid sequence shown in SEQ ID NO.40; and the amino acid sequence shown in SEQ ID NO.15; (14) The amino acid sequence shown in SEQ ID NO.45; and the amino acid sequence shown in SEQ ID NO.

41.

8. The antibody or antigen-binding fragment thereof according to any one of claims 4 to 7, characterized in that: At least two Fab arms of the antibody or antigen-binding fragment thereof are identical or different; wherein the at least two Fab arms are identical and comprise the same amino acid sequence combination selected from any one of (1) to (11) of claim 6; or, comprise the same amino acid sequence combination selected from any one of (1) to (11) of claim 7; A combination of amino acid sequences defined in any one of (1) to (14).

9. The antibody or antigen-binding fragment thereof according to any one of claims 4 to 8, characterized in that The at least two Fab arms are different and contain different combinations of amino acid sequences selected from any one of (1) to (11) of claim 6; or, contain different combinations of amino acid sequences selected from any one of (1) to (14) of claim 7; Preferably, the at least two Fab arms of the antibody or antigen-binding fragment thereof comprise the same combination of light chain CDRs sequences, or comprise the same light chain VL sequence.

10. The antibody or antigen-binding fragment thereof according to any one of claims 4 to 9, characterized in that The antibody or antigen-binding fragment thereof comprises: (1) In one Fab arm, a HCDR1 comprising the amino acid sequence of SEQ ID NO.28, a HCDR2 comprising the amino acid sequence of SEQ ID NO.29, and a HCDR3 comprising the amino acid sequence of SEQ ID NO.30; and a LCDR1 comprising the amino acid sequence of SEQ ID NO.31, a LCDR2 comprising the amino acid sequence of SEQ ID NO.33, and a LCDR3 comprising SEQ ID NO.32; In another Fab arm, HCDR1 comprising the amino acid sequence shown in SEQ ID NO.22, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.34, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.24; and, LCDR1 comprising the amino acid sequence shown in SEQ ID NO.31, L CDR2 comprising the amino acid sequence shown in SEQ ID NO.33, and LCDR3 comprising SEQ ID NO.32; (2) in one Fab arm, comprising HCDR1 comprising the amino acid sequence of SEQ ID NO.28, HCDR2 comprising the amino acid sequence of SEQ ID NO.29, and HCDR3 comprising the amino acid sequence of SEQ ID NO.30; and, comprising LCDR1 comprising the amino acid sequence of SEQ ID NO.25, LCDR2 comprising the amino acid sequence of SEQ ID NO.26, and LCDR3 comprising the amino acid sequence of SEQ ID NO.32; In another Fab arm, HCDR1 comprising the amino acid sequence shown in SEQ ID NO.22, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.34, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.24; and, LCDR1 comprising the amino acid sequence shown in SEQ ID NO.25, LCDR2 comprising the amino acid sequence shown in SEQ ID NO.26, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; (3) in one Fab arm, comprising HCDR1 of the amino acid sequence shown in SEQ ID NO.54; HCDR2 comprising the amino acid sequence shown in SEQ ID NO.55; and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.56; and, LCDR1 comprising the amino acid sequence shown in SEQ ID NO.31; LCDR2 comprising the amino acid sequence shown in SEQ ID NO.33; and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; In another Fab arm, HCDR1 comprising the amino acid sequence shown in SEQ ID NO.48, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.51, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.50; and, LCDR1 comprising the amino acid sequence shown in SEQ ID NO.31; LCDR2 comprising the amino acid sequence shown in SEQ ID NO.33; and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; or (4) in one Fab arm, comprising HCDR1 of the amino acid sequence shown in SEQ ID NO.54; HCDR2 of the amino acid sequence shown in SEQ ID NO.55; and HCDR3 of the amino acid sequence shown in SEQ ID NO.56; and, LCDR1 of the amino acid sequence shown in SEQ ID NO.52; LCDR2 of the amino acid sequence shown in SEQ ID NO.26; and LCDR3 of the amino acid sequence shown in SEQ ID NO.53; In another Fab arm, HCDR1 comprises the amino acid sequence shown in SEQ ID NO.48, HCDR2 comprises the amino acid sequence shown in SEQ ID NO.51, and HCDR3 comprises the amino acid sequence shown in SEQ ID NO.50; and, LCDR1 comprises the amino acid sequence shown in SEQ ID NO.52; LCDR2 comprises the amino acid sequence shown in SEQ ID NO.26; and LCDR3 comprises the amino acid sequence shown in SEQ ID NO.

53.

11. The antibody or antigen-binding fragment thereof according to any one of claims 4 to 10, characterized in that: The antibody or antigen-binding fragment thereof comprises: (1) In one Fab arm, a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO.14 and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.15; In the other Fab arm, a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO.19 and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.15; (2) in one Fab arm, comprising a heavy chain variable region of the amino acid sequence shown in SEQ ID NO.14 and a light chain variable region of the amino acid sequence shown in SEQ ID NO.16; In the other Fab arm, a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO.19 and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.16; (3) in one Fab arm, comprising a heavy chain variable region of the amino acid sequence shown in SEQ ID NO.45 and a light chain variable region of the amino acid sequence shown in SEQ ID NO.15; In the other Fab arm, the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO.40, and the light chain variable region comprises the amino acid sequence shown in SEQ ID NO.15; or (4) in one Fab arm, comprising a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO.45 and a light chain variable region having an amino acid sequence as shown in SEQ ID NO.41; In the other Fab arm, the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO.40, and the light chain variable region comprises the amino acid sequence shown in SEQ ID NO.

41.

12. Use of the polypeptide according to any one of claims 1 to 3 in constructing antibodies.

13. A nucleic acid molecule comprising a nucleotide sequence encoding the polypeptide of any one of claims 1 to 3.