GENETIC MODIFICATION OF CROPS BASED ON GENOMIC EDITING AND PRODUCTION OF BRACHYTIC PLANTS

MX433995BActive Publication Date: 2026-05-19MONSANTO TECHNOLOGY LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
MX2022014145
Authority / Receiving Office
MX · MX
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-12-22
Filing Date
2019-06-21
Publication Date
2026-05-19
Estimated Expiration
2037-12-21
Patent Text Reader

Abstract

The present invention relates to a maize plant, characterized in that it comprises at least one non-natural brachytic mutation, wherein the maize plant exhibits a semi-dwarf phenotype compared to a control maize plant that does not comprise the at least one non-natural brachytic mutation when grown under comparable conditions.
Need to check novelty before this filing date? Find Prior Art

Description

This application claims the benefit under 35 U.S.C. 119(e) of U.S. patent application no. 62 / 438,370, filed on December 22, 2016, which is incorporated herein in its entirety by this reference. The sequence listing contained in the file named “62248-0000-WO ST25”, which is 32,079 bytes in size (measured on the MS-Windows operating system) and was created on December 21, 2017, is filed with this application and incorporated herein by this reference. BACKGROUND OF THE INVENTION Field This description refers to compositions and methods for producing a modified plant that exhibits a semi-dwarf phenotype. Related technique In recent decades, a sustained increase in crop yields has been achieved, for example, in wheat and rice. This increase is partly attributed to the use of fertilizers and pesticides, as well as to the introduction of semi-dominant dwarf mutations that reduce plant height. Taller plants are more likely to bend in response to torrential rains or wind, and the heavier inflorescences of selected high-yielding varieties also make them more susceptible to bending. Conversely, shorter crops are more resistant to bending. Dwarf or semi-dwarf traits can also allow for higher planting densities and help improve crop yields and nitrogen response. The introduction of dwarf varieties of wheat and rice served as a cornerstone of the so-called "plant revolution" of the late 20th century. Corn (Zea mays L.), a member of the Poaceae family, produces cylindrical stalks similar to those of other grasses. Corn stalks are thick and spongy inside and are divided into sections called internodes and nodes. The number of nodes varies between 8 and 40 depending on the variety and growing conditions. Commercial hybrid corn typically grows to a height of over 2 meters, meaning each plant usually produces one or two ears. The ear typically grows about one-third of the way up the plant, or about three feet from the ground. Consequently, while a corn plant provides a large ear in addition to substantial leaf and stalk structure, it can have a significant mechanical stability problem. Reducing the height of a corn plant can improve its mechanical stability. More than 40 monogenic dwarf mutants have been described in maize. Most of these mutants lead to large reductions in grain yield and, consequently, have not been used to improve grain production in germplasm that is susceptible to bending. Therefore, an important but difficult goal in maize breeding is the identification and use of dwarf or semi-dwarf mutations that confer short stature without severely affecting other organs, especially reproductive organs (e.g., ears). In maize, brachytic mutants exhibit short stature due to a shortening of internode length without a corresponding reduction in the number of internodes or the quantity and size of other organs, including leaves, ears, and tassels. See Kempton J. Hered., 11:111-115 (1920); Pilu et al., Molecular Breeding, 20:8391 (2007). BR genes are plant hormones that regulate a number of key processes in plant development and growth. Three brachytic br mutants have been isolated in maize to date: brachyticl (br1), brachytic2 (br2), and brachytic3 (br3). The br1 and br3 mutations both result in reduced maize plant height, which is considered very serious for commercial production due to the potential impact on yield.Conversely, the br2 mutant has particular agronomic potential due to the shortening of the lower stem internodes without evident reductions in other plant organs. Furthermore, br2 lines exhibit unusual stem tolerance and resistance to wind bending, while the leaves are generally darker and remain actively green longer than those of wild-type plants. The br2 phenotype does not respond to treatment with gibberellins, auxins, brassinosteroids, and cytokinins, suggesting that the biosynthesis of these hormones is not altered by the br2 mutation. Multani et al. identified a genomic sequence of the Br2 gene and deposited it with GenBank accession number AY366085. See Science, 302(5642)81-84 (2003). Br2 was thought to encode a putative protein similar to the adenosine triphosphate (ATP)-binding cassette transporters of the multidrug-resistant (MDR) class of P-glycoproteins (PGPs). The predicted BR2 protein consists of two similar halves, each containing six putative transmembrane domains and one intracellular ATP nucleotide-binding domain. The br2 gene is 7139 bp long with a coding sequence of 4185 bp. Pilu et al. They reported an allele br2-23 that has an 8 bp deletion at the 3' end of the Br2 gene and claimed a direct relationship between this deletion and the brachytic phenotype in their br2-23 plants. See Pilu et al., Molecular Breeding, 20:83-91 (2007).However, the use of brachytic mutations in maize has not been commercially exploited, partly due to the rigidity of the available brachytic mutant alleles. There is a need in maize research to genetically modify maize plants to provide novel and commercially relevant brachytic mutant alleles, for example, those that confer a semi-dwarf phenotype and maintain or improve grain production. BRIEF DESCRIPTION OF THE FIGURES Figure 1 schematically illustrates the structure of the BR2 gene. Figure 2 schematically illustrates the structure of a naturally occurring BR2 mutant allele, br2-MX, as well as its polymorphisms and mutations. Figure 3 shows a reduced (semi-dwarf) plant height of a genome-edited R1 maize plant at a V6 growth stage expressing a truncated BR2 protein due to a single T insertion in Exon 5, compared to wild-type control plants. Figure 4 shows a reduced (semi-dwarf) plant height of a gene-edited BR2 01DKD2 maize plant expressing a truncated BR2 protein due to a single T insertion in Exon 5, compared to a wild-type control. Figure 5A shows a reduced (semi-dwarf) plant height of a gene-edited BR2 maize plant expressing a truncated BR2 protein due to a single T insertion in Exon 5 (“br2-GE’,” hereafter), compared to a natural br2-MX mutant and a wild-type control. Figure 5B shows a reduced plant height of a BR2 homozygous genome-edited plant expressing a truncated BR2 protein due to a single T insertion in Exon 5, compared to a BR2 heterozygous genome-edited plant, a negative segregation BR2 genome-edited plant, and a wild-type control. Figure 6 shows shorter internodes of a gene-edited BR2 maize plant expressing a truncated BR2 protein due to single T insertion in Exon 5, compared to a wild-type BR2 natural control. BRIEF DESCRIPTION OF THE INVENTION The present descriptive report provides a maize plant comprising at least one unnatural brachytic mutation, wherein the maize plant exhibits a semidwarf phenotype compared to a control maize plant not comprising at least one unnatural brachytic mutation when grown under comparable conditions. This descriptive report also provides a brachytic maize plant comprising at least one non-natural brachytic mutation. Also provided in this descriptive memorandum is a brachytic maize plant comprising at least one non-naturally occurring brachytic mutating allele. This descriptive report also provides a maize plant comprising at least one unnatural brachytic mutation exhibiting a semi-dwarf phenotype. In one respect, the present descriptive report provides a maize plant comprising at least one unnatural brachytic mutant allele exhibiting a semi-dwarf phenotype. In another aspect, the present descriptive report provides a modified maize plant comprising a non-naturally occurring mutation in a BR gene that reduces BR gene activity, wherein the mutation is not introduced by a transposon. In yet another aspect, the present descriptive memorandum provides a modified maize plant comprising a modified BR2 gene with reduced activity, wherein the modified maize plant does not comprise a brachytic allele br2-23 or SNP5259. In yet another aspect, the present descriptive memorandum provides a non-transgenic maize plant comprising a synthetic mutation in a BR gene that reduces the activity of the BR gene. In another aspect, the present descriptive report provides a modified maize plant comprising a non-transgene- and non-transposon-mediated mutation in a BR gene that reduces BR gene activity. In another aspect, the present descriptive report provides a brachytic maize plant comprising a dominant non-transgenic BR mutant allele. This descriptive memorandum also provides a method for producing a semi-dwarf maize plant, wherein the method comprises: (a) providing a guide RNA that recognizes a target site in a BR gene in a maize cell, wherein the guide RNA acts in conjunction with an RNA-guided nuclease that creates a chain break at the target site, (b) generating a maize plant from the maize cell, and (c) selecting the maize plant that exhibits the semi-dwarf phenotype. In another aspect, the present descriptive memorandum includes a CRISPR-based genome editing system comprising Cas9 and a guide RNA, wherein the CRISPR-based genome editing system reduces the activity of a BR gene. This descriptive memorandum further provides a method for cleaving a BR gene in a maize cell, comprising providing a guide RNA and an RNA-guided nuclease in the maize cell, wherein the guide RNA acts together with the RNA-guided nuclease to create a chain break at a target site. DETAILED DESCRIPTION OF INVENTION Definitions Unless otherwise indicated herein, terms are to be understood according to the conventional usage given by those skilled in the relevant art. Examples of resources describing many of the molecular biology-related terms used herein can be found in Alberts et al., Molecular Biology of the Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, Genes IX, Oxford University Press: New York, 2007. DNA base nomenclature is used as set forth in 37 CFR 1822. This reference incorporates in its entirety all references mentioned herein, including, for example, all patents, published patent applications and non-patent publications. When used in a list of two or more items, the term “and / or” means that any of the listed items may be used on its own or in conjunction with any one or more of the listed items. For example, the expression “A and / or B” is intended to mean one or both of A and B—that is, A alone, B alone, or A and B together. The expression “A, B and / or C” is intended to mean A alone, B alone, C alone, A and B together, A and C together, B and C together, or A, B, and C together. As used herein, singular terms and singular forms such as “a,” “one,” and “the” include plural referents unless the context clearly indicates otherwise. Therefore, for example, the reference to “plant,” “the plant,” or IVIA / a / ZUZZ / UI 41 40 “a plant” also includes multiple plants; in addition, depending on the context, the use of the term “plant” may also include the genetically similar or identical progeny of that plant; the use of the expression “a nucleic acid” optionally includes, as a practical matter, many copies of that nucleic acid molecule; similarly, the term “probe” optionally (and typically) includes many similar or identical probe molecules. As used herein, the expression “around” is intended to qualify the numerical values ​​it modifies, thus denoting that value as variable within a margin of error. When no particular margin of error is stated, such as a standard deviation from an average value, the expression “around” should be understood to mean the interval that would encompass the stated value and also the interval that would be included by rounding the figure up or down, taking into account significant figures. As used herein, “plant” refers to a whole plant or any part thereof, or a cell or tissue culture derived from a plant, comprising any of: whole plants, plant components or organs (e.g., leaves, stems, roots, etc.), plant tissues, seeds, plant cells, and / or plant progeny. A plant cell is a biological cell of a plant, taken from a plant, or derived by culturing a cell taken from a plant.As used herein, a “part of a plant” may refer to any intact organ or tissue of a plant, such as the meristem, shoot structure / organ (e.g., leaf, stem, or node), root, flower or flower structure / organ (e.g., bract, sepal, petal, stamen, carpel, anther, and ovule), seed (e.g., embryo, endosperm, and seed coat), fruit (e.g., mature ovary), propagule, or other plant tissues (e.g., vascular tissue, dermal tissue, supporting tissue, and the like), or any part thereof. The parts of a plant of the present invention may be viable, non-viable, regenerable, and / or non-regenerable. A “propagule” may include any part of the plant that can grow into a complete plant. As used herein, a “corn plant” refers to a plant of the species Zea mays L and includes all varieties of plants that can be cultivated with corn, including wild corn species. As used herein, a “dwarf” plant refers to an unusually small plant. Generally, a “dwarf” plant has a height or stature that is approximately 30, 35, 40, 45, 50, 55, 60% or more smaller than that of a control wild-type plant (e.g., a twin plant that possesses all other traits except for the dwarf trait). As used herein, a “semi-dwarf plant” refers to a plant that is approximately 5, 10, 15, 20, 25, 30 percent or less shorter than a control wild-type plant. Generally, but not exclusively, such a dwarf plant is characterized by a reduced trunk, stem, or trunk length when compared to the control wild-type plant under comparable growing conditions. In one respect, the trunk, stem, or trunk length of a modified maize plant comprising a non-naturally occurring mutation in a BR gene of the present description is about 5, 6, 1%, 8, 9, 10, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29%, or 30%, compared to that of a control plant not possessing the non-naturally occurring mutation in the BR gene under comparable growing conditions.As used herein, a “brachytic plant” refers to a plant that exhibits short stature due to a shortening of the internode length without a corresponding reduction in the number of internodes or the quantity and size of other organs, including, but not limited to, leaves, ears, and tassels. “Extremely brachytic” refers to an abnormal variation in plants characterized by shortened internodes without corresponding reductions in other plant parts. A “brachytic mutation” refers to a mutation in a BR gene that produces a brachytic plant. As used herein, a “BR gene” refers to any brachytic gene in a plant, where mutation of this gene produces a brachytic plant. In one respect, the BR gene is a BR1 gene. In another respect, the BR gene is a BR2 gene. In yet another respect, the BR gene is a BR3 gene. As used herein, “germplasm” refers to living sources of genetic material. Germplasm may be part of an organism or cell, or it may be separate from the organism or cell. In general, germplasm provides genetic material with a specific molecular constitution that provides a physical basis for some or all of the heritable qualities of an organism or cell culture. As used herein, germplasm includes cells, seeds, or tissues from which new plants can be grown, or parts of plants, such as leaves, stems, pollen, or cells that can be cultured to form a whole plant. As used herein, a “transgenic plant” refers to a plant whose genome has been altered by the integration or insertion of a recombinant DNA construct, sequence, or molecule. A transgenic plant includes a Ro plant developed or regenerated from one or more originally genetically modified plant cells. IVIA / a / ZUZZ / UI 41 40 transformed, as well as transgenic progeny plants in plant breeding or later generations of the transgenic plant Ro. As used herein, a “mutation” refers to the permanent alteration of the nucleotide sequence of an organism’s genome, extrachromosomal DNA, or other genetic elements. As used herein, the expression “substitution mutation” refers to an exchange of a single nucleotide for another. As used herein, the term “insertion” refers to the addition of one or more extra nucleotides into DNA. Insertions in the coding region of a gene can disrupt the splicing of mRNA (splicing site mutation) or cause a frameshift, and both can significantly alter the gene product. As used herein, the term “deletion” refers to the removal of one or more nucleotides from DNA. Like insertions, these mutations can alter the reading frame of the gene. As used herein, the term “inversion” refers to the reversal of the orientation of a chromosomal segment. As used herein, the term “duplication” refers to the creation of multiple copies of chromosomal regions, thereby increasing the dosage of genes located within them. As used herein, the expressions “percent identity” or “percent identical”, as referring to two or more protein or nucleotide sequences, are calculated by (i) comparing two optimally aligned sequences (of nucleotides or proteins) over a comparison window, (ii) determining the number of positions at which the identical nucleic acid base (for nucleotide sequences) or amino acid residue (for proteins) occurs in both sequences to provide the number of matching positions, (iii) dividing the number of matching positions by the total number of positions in the comparison window, and then (iv) multiplying this quotient by 100% to provide the percent identity.If the “percentage of identity” is calculated with respect to a reference sequence without specifying a particular comparison window, the percentage of identity is determined by dividing the number of matching positions in the alignment region by the total length of the reference sequence. Therefore, for the purposes of this description, when two sequences (query and subject) are optimally aligned (with room for gaps in their alignment), the “percentage of identity” for the query sequence is equal to the number of identical positions between the two sequences divided by the total number of positions in the query sequence that are longer than its length (or a comparison window), which is then multiplied by 100%. As used herein, “anterior” refers to a nucleic acid sequence that is placed before the 5’ end of a linked nucleic acid sequence. As used herein, “posterior” refers to a nucleic acid sequence that is placed after the 3’ end of a linked nucleic acid sequence. As used herein, “5’” refers to the start of a coding DNA sequence or the start of an RNA molecule. As used herein, “3’” refers to the end of a coding DNA sequence or the end of an RNA molecule. It should be noted that an “inversion” refers to the reversal of the orientation of a given polynucleotide sequence. For optimal sequence alignment to calculate their percentage identity, various programs and algorithms for aligning multiple sequences or pairs of sequences are known in the art, such as ClustalW, etc., which can be used to compare the sequence similarity or identity between two or more nucleotide or protein sequences. Although other comparison and alignment methods are known in the art, the alignment and percentage identity between two sequences (including the percentage identity ranges described above) can be determined by the ClustalW algorithm. See, for example, Chenna R.et al., “Multiple sequence alignment with the Clustal series of programs,” Nucleic Acids Research 31: 3497-3500 (2003); Thompson JD et al., “Clustal W: Improving the sensitivity of Progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice,” Nucleic Acids Research 22: 4673-4680 (1994); and Larkin MA et al., “Clustal W and Clustal X version 2.0,” Bioinformatics 23: 2947-48 (2007), whose content and description are incorporated herein by this reference. As commonly understood in the field, the term “promoter” can refer, in general terms, to a DNA sequence containing an RNA polymerase binding site, transcription start site, and / or TATA box, and which assists or promotes the transcription and expression of a gene (or transgene) and / or associated polynucleotide sequence amenable to transcription. A promoter may be synthetically produced, modified, or derived from a naturally occurring promoter sequence or another promoter sequence. A promoter may also include a chimeric promoter comprising a combination of two or more heterologous sequences. Therefore, a promoter described herein may include variants of promoter sequences that are similar in composition, but not identical, to other known promoter sequences or those provided herein. A promoter can be classified according to a variety of criteria related to the expression pattern of a gene (including a transgene) or associated coding or transcriptional sequence operatively bound to the promoter, such as constitutive, developmental, tissue-specific, inducible, etc. Promoters that drive expression in all or most plant tissues are called “constitutive” promoters. Promoters that drive expression during specific periods or stages of development are called “developmental” promoters. Promoters that drive enhanced expression in certain plant tissues compared to other plant tissues are called “tissue-enhanced” or “tissue-preferred” promoters.Therefore, a “tissue-preferred” promoter elicits relatively higher or preferential expression in one or more specific plant tissues, but lower levels of expression in other plant tissues. Promoters that are expressed within one or more specific plant tissues, with little or no expression in other plant tissues, are called “tissue-specific” promoters. An “inducible” promoter is one that initiates transcription in response to an environmental stimulus, such as cold, drought, or light, or other stimuli, such as wounding or the application of chemicals. A promoter can also be classified according to its origin, such as heterologous, homologous, chimeric, synthetic, etc. A “heterologous” promoter is a promoter sequence that has a different origin from its associated transcript, coding sequence, or gene (or transgene) and / or is not naturally occurring in the plant species being transformed.The expression “plant expressible promoter” refers to a promoter that can initiate, assist, affect, cause and / or promote the transcription and expression of its associated transcriptional DNA sequence, coding sequence or gene in a plant tissue or cell. The term “heterologous,” with respect to a promoter, refers to a promoter sequence that has a different origin from its associated transcript DNA sequence, coding sequence, or gene (or transgene) and / or is not naturally occurring in the plant species being transformed. More broadly, the term “heterologous” can refer to a combination of two or more DNA sequences or molecules, such as a promoter and an associated transcript DNA sequence, coding sequence, or gene, when this combination is artificial and not normally found in nature. The term “recombinant”, with respect to a polynucleotide molecule (DNA or RNA), protein, construct, vector, etc., refers to an artificial protein or polynucleotide sequence or molecule that is not normally found in nature, and / or is present in a context in which it is not normally found in nature, including a polynucleotide molecule (DNA or RNA), protein, construct, etc., comprising a IVIA / a / ZUZZ / UI 41 40 A combination of protein or polynucleotide sequences that would not normally be found contiguous or close together in nature without human intervention, and / or a polynucleotide molecule, protein, construct, etc., comprising at least two protein or polynucleotide sequences that are heterologous to each other. A recombinant construct, protein molecule, or polynucleotide, etc., may comprise one or more protein or polynucleotide sequences that (i) are separated from one or more protein or polynucleotide sequences that are close together in nature, and / or (ii) are adjacent to (or contiguous with) other protein or polynucleotide sequences that are not naturally close together. Such a recombinant polynucleotide molecule, protein, construct, etc., may also refer to a protein or polynucleotide sequence or molecule that has been genetically modified and / or constructed outside of a cell.For example, a recombinant DNA molecule may comprise any suitable vector, plasmid, etc., and may include a circular or linear DNA molecule. Such plasmids, vectors, etc., may contain various maintenance elements, including a prokaryotic origin of replication and a selectable marker, as well as one or more transgenes or expression cassettes, perhaps in addition to a selectable plant marker gene, etc. The term recombinant may also refer to an organism possessing recombinant material; for example, a plant comprising recombinant nucleic acid is considered a recombinant plant. As used herein, “allele” refers to an alternative nucleic acid sequence at a particular locus; the length of an allele can be as small as one nucleotide base, but is typically longer. For example, a first allele may occur on one chromosome, while a second allele occurs on a second homologous chromosome, as is the case for different chromosomes in a heterozygous individual or between different homozygous or heterozygous individuals in a population. A favorable allele is the allele at a particular locus that confers, or contributes to, an agronomically desirable phenotype or, alternatively, is an allele that allows for the identification of susceptible plants that may be removed from a plant breeding or planting program.A favorable marker allele is a marker allele that segregates with the favorable phenotype or, alternatively, segregates with the susceptible plant phenotype, thus providing the benefit of identifying plants prone to a disease. A favorable allelic form of a chromosomal interval is a chromosomal interval that includes a nucleotide sequence that contributes to superior agronomic performance at one or more genetic loci physically located within the chromosomal interval. IVIA / a / ZUZZ / UI 41 40 As used herein, “crossing” or “cross” means producing offspring by fertilization (e.g., cells, seeds, or plants) and includes crosses between plants (sexual) and self-fertilization (self-fertilization). As used herein, “backcrossing” and “backcrossing” refer to the process by which a progeny plant is repeatedly crossed back with one of its parents. In a backcross scheme, the “donor” parent refers to the original plant with the desired gene or locus to be introgressed. The “recipient” parent (used one or more times) or “recurrent” parent (used one or more times) refers to the original plant into which the gene or locus is introgressed. The initial cross gives rise to the Fi generation. The term “BC1” refers to the second use of the recurrent parent, “BC2” refers to the third use of the recurrent parent, and so on. In one aspect, a repeated backcross is performed, where a progeny individual from each successive backcross generation is backcrossed with the same original phenotype. As used herein, “genotype” is the genetic makeup of an individual (or group of individuals) at one or more gene loci, as opposed to the observable trait (the phenotype). The genotype is defined by the allele(s) at one or more known loci that the individual inherited from the parent group. The term genotype can be used to refer to an individual’s genetic makeup at a single locus, at multiple loci, or, more generally, to an individual’s genetic makeup for all the genes in their genome. A “haplotype” is an individual’s genotype at multiple gene loci. Typically, the gene loci described by a haplotype are physically and genetically linked, that is, located at the same chromosomal interval. As used herein, “locus” is a chromosomal region where a polymorphic, trait-determining nucleic acid, gene, or marker is located. The loci described herein comprise one or more polymorphisms in a population; for example, alternative alleles are present in some individuals. As used herein, “allele” refers to an alternative nucleic acid sequence at a particular locus. The length of an allele can be as small as one nucleotide base, but is typically longer. For example, a first allele may occur on one chromosome, while a second allele occurs on a second homologous chromosome, as occurs for different chromosomes in a heterozygous individual or between different homozygous or heterozygous individuals in a population.As used herein, a chromosome in a diploid plant is “hemizygous” when only one copy of a locus is present. For example, an inserted transgene is hemizygous when it is inserted into only one sister chromosome (i.e., the second sister chromosome does not contain the inserted transgene). The terms “phenotype,” “phenotypic trait,” or “trait” refer to one or more characteristics of an organism. A phenotype can be observed with the naked eye or through any other known method of assessment, such as microscopy, biochemical analysis, genomic analysis, or a test for tolerance to a particular disease. In some cases, a phenotype is directly controlled by a single gene or genetic locus—that is, a “single-gene trait.” In other cases, a phenotype results from the interaction of several genes. “Operationally linked” refers to the association of two or more nucleic acid elements in a recombinant DNA construct, such as when a promoter is operationally linked to DNA that is transcribed into RNA, either to express or suppress a protein. Recombinant DNA constructs can be designed to express a protein, which may be an endogenous protein, an exogenous homolog of an endogenous protein, or an exogenous protein with no natural homolog. Alternatively, recombinant DNA constructs can be designed to suppress the level of an endogenous protein, for example, by deleting the natural gene.Gene suppression can be effectively achieved through RNA interference (RNAi) mechanisms, where recombinant DNA comprises sense and antisense DNA linked to the target gene. The recombinant DNA is transcribed into RNA that can double-strand to initiate the RNAi mechanism. Gene suppression can also be carried out using recombinant DNA comprising antisense DNA linked to the target gene. Alternatively, it can be performed using recombinant DNA that is transcribed into microRNA linked to the target gene. “Polymorphism” refers to the presence of one or more variations within a population. A polymorphism can manifest as a variation in the nucleotide sequence of a nucleic acid or as a variation in the amino acid sequence of a protein. Polymorphisms include the presence of one or more variations of a nucleic acid sequence or nucleic acid element at one or more loci within a population of one or more individuals. The variation may include, but is not limited to, one or more nucleotide base changes, the insertion of one or more nucleotides, or the deletion of one or more nucleotides. A polymorphism can arise from random processes in nucleic acid replication, through mutagenesis, as a result of mobile genomic elements, from copy number variation, and during meiosis, such as during unequal crossing over, genome duplication, and chromosomal breaks and fusions.Variation may be common or occur at a low frequency within a population; in the former case, it is more useful in general plant breeding, and in the latter, it may be associated with unusual but important phenotypic variation. Useful polymorphisms may include single nucleotide polymorphisms (SNPs), insertions or deletions in DNA sequences (Indels), single DNA sequence repeats (SSRs), a restriction fragment length polymorphism, and a tag SNP. They may also encompass polymorphisms of a genetic marker, a gene, a DNA-derived sequence, an RNA-derived sequence, a promoter, a 5' untranslated region of a gene, a 3' untranslated region of a gene, microRNAs, siRNAs, a tolerance locus, a satellite marker, a transgene, an mRNA, an mRNA of, a transcription profile, and a methylation pattern.Furthermore, the presence, absence, or variation in the number of copies of the above may include polymorphisms. As used herein, a “vector,” “expression cassette,” or “cassette” is a polynucleotide or other molecule that transfers nucleic acids between cells. Vectors are often derived from plasmids, bacteriophages, or viruses and optionally comprise parts that mediate vector maintenance and facilitate their intended use. A “cloning vector,” “carrier vector,” or “subcloning vector” contains operationally linked parts that facilitate subcloning steps (e.g., a multiple cloning site containing multiple restriction endonuclease sites). As used herein, the term “expression vector” refers to a vector comprising operationally linked polynucleotide sequences that facilitate the expression of a coding sequence in a particular host organism (e.g., a bacterial expression vector or a plant expression vector). As used herein, “yield” is the culmination of all agronomic traits, as determined by the productivity per unit area of ​​a particular commercially valuable plant product. “Agronomic traits” include the underlying genetic elements of a given plant variety that contribute to yield over the course of the growing season. As used herein, the expression “comparable growing conditions” refers to similar environmental conditions and / or agronomic practices for growing and making meaningful comparisons between two or more plant genotypes, such that neither the environmental conditions nor the agronomic practices would contribute to or explain any observed differences between the two or more plant genotypes. Environmental conditions include, for example, light, temperature, water, humidity, and nutrition (e.g., nitrogen and phosphorus). Agronomic practices include, for example, sowing, pruning, cutting, transplanting, covering, and suckering. See Chapters 4B and 4C of Tobacco, Production, Chemistry and Technology, Davis & Nielsen, eds., Blackwell Publishing, Oxford (1999), pp. 70–103. As used herein, “select” or “selection”, in the context of plant breeding, refers to the act of choosing or selecting desired individuals, usually from a population, based on certain predetermined criteria. The use of the term “polynucleotide” is not intended to limit the present description to polynucleotides comprising DNA. Those skilled in the art will recognize that polynucleotides and nucleic acid molecules may comprise ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The polynucleotides described herein also comprise all forms of sequences, including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, and the like. As used herein, the term “polypeptide” refers to a chain of at least two amino acids covalently linked together. Description BR2 gene and semi-dwarf phenotype Brachytic mutants of maize exhibit short stature due to a shortening of internode length without a corresponding reduction in the number of internodes or the quantity and size of other organs, including leaves, ears, and tassels. See Pilu et al., Molecular Breeding, 20:83-91 (2007). Three brachytic mutants were isolated: brachyticl (br1), brachytic2 (br2), and brachytic3 (br3). One brachytic mutant of maize with particular agronomic potential is the recessive mutation br2, which results in shortened internodes of the lower stalk without an apparent reduction in other plant organs. Furthermore, br2 lines exhibit unusual stalk tolerance and resistance to wind bending, while the leaves are generally darker and remain green longer than those of wild-type plants.The br2 phenotype does not respond to treatment with GA, auxins, brassinosteroids, and cytokinins, suggesting that the biosynthesis of these hormones is not altered by the br2 mutation. Multan et al. identified the genomic sequence of the Br2 gene and deposited it in GenBank accession number AY366085. See Science, 302(5642)81-84 (2003). Br2 was reported to encode a putative protein similar to the adenosine triphosphate (ATP)-binding cassette transporters of the multidrug-resistant (MDR) class of P-glycoproteins (PGPs). As shown in Figure 1, the BR2 gene contains 5 exons and 4 introns: Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, and Intron 4. The present description provides a maize plant comprising at least one unnatural BR mutation, wherein the maize plant exhibits a semidwarf phenotype compared to a control maize plant not comprising the unnatural BR mutation when grown under comparable conditions. Mutations in the naturally occurring BR gene have been found to contribute to the semidwarf or brachytic phenotype in maize plants. The present description provides a modified maize plant comprising a non-naturally occurring mutation in a BR gene, including the BR2 gene. As used herein, a “natural mutation,” a “naturally occurring mutation,” or a “natural” mutation refers to a mutation that occurs spontaneously in nature without any intervention from experimental or laboratory procedures or through exposure to mutagens. Not limited to scientific theory, a naturally occurring mutation can arise from a variety of sources, including errors in DNA replication, spontaneous injury, and transposable elements (or transposons). The expression “unnatural mutation” or “mutation that is not of natural origin” refers to a mutation that does not occur naturally in nature, but as a result of experimental or laboratory procedures, or through exposure to mutagens. The present description provides a modified maize plant comprising a non-naturally occurring mutation in a BR gene that reduces BR gene activity, wherein the mutation is not introduced by a transposon. As used herein, “modified,” in the context of plants, seeds, plant components, and plant genomes, refers to a state that contains changes or variations from its natural state. Modified seeds or plants contain molecular changes in their genetic material, including genetic or epigenetic modifications. Typically, modified seeds or plants, or a parent or original line thereof, have undergone mutagenesis, genome editing (e.g., but not limited to, methods using site-specific nucleases), genetic transformation (e.g., but not limited to, methods using Agrobacterium transformation or microprojectile bombardment), or a combination thereof. As used herein, “transposon” refers to sequences of DNA that can change position within a genome, creating or reversing mutations and altering the size of the cell's genome. In one respect, the modified maize plant provided herein does not comprise a brachytic br2-23 mutation. As used herein, the term “brachytic br2-23 mutation” refers to a naturally occurring recessive mutation carrying an eight-nucleotide deletion in the coding region of the maize br2 gene that corresponds to the brachytic phenotype, as reported in Pilu et al., Molecular Breeding, 20: 83-91 (2007) and Cassani et al., Plant Growth Regul., 64: 185-192 (2011). These references are incorporated herein in their entirety by this reference. In one respect, the modified maize plant described herein does not comprise SNP5259. As used herein, the term “SNP5259” refers to a naturally occurring single nucleotide polymorphism (SNP) at a maize plant height quantitative trait locus (QTL), qph1, which has been validated as the causative mutation that reduces plant height and increases maize yield potential. This was reported in Xing et al., J. Exp. Bot., 66: 3791-802 (2015). This reference is incorporated herein by reference in its entirety. In one aspect, the modified maize plant of the present description does not comprise alleles of the br2 brachytic polymorphism identified by the use of marker-assisted selection in maize, as reported in U.S. patent publication no. s2016 / 0319375, which is incorporated herein by this reference in its entirety, together with U.S. provisional applications no. s62 / 180,430 and 62 / 153,831. In one respect, the modified maize plant of the present description does not comprise any maize plant containing naturally occurring BR2 mutant alleles. In one respect, the modified maize plant of the present description does not comprise a maize plant containing the naturally occurring br2-MX mutant alleles, as described in Example 1 and shown in Figures 2 and 5A of the present description. In another respect, the modified maize plant of the present description does not comprise a brachytic mutation br2-23, SNP5259, multiple alleles of brachytic polymorphisms of br2, mutant alleles of br2-MX, or any other naturally occurring mutation in a BR gene. In one respect, the BR gene is a Br1 gene. In another respect, the BR gene is a Br2 gene. In yet another respect, the BR gene is a Br3 gene. In one aspect, a plant described herein comprises a br2 mutation introduced by targeted genome editing to mimic a naturally occurring mutant br2 allele. In another aspect, a method described herein comprises targeted genome editing of a brachytic gene (e.g., BR2) in a desired inbred background to introduce a naturally occurring mutant br2 allele. In one respect, the present description provides a non-transgenic maize plant comprising a synthetic mutation in a BR gene that reduces the activity of the BR gene. As used herein, the term “synthetic mutation” refers to a non-spontaneous mutation and occurs as a result of exposure to mutagens. In another aspect, the present description provides a modified maize plant comprising a non-transgene- and non-transposon-mediated mutation in a BR gene that reduces the activity of the BR gene. As used herein, the term “transgene” refers to a recombinant DNA molecule, construct, or sequence integrated or inserted into a genome, thereby altering the genome. In one aspect, the modified maize plant comprises a non-naturally occurring substitution mutation in a BR gene. In another aspect, the modified maize plant comprises a non-naturally occurring insertion in a BR gene. In another aspect, the modified maize plant comprises a non-naturally occurring inversion in a BR gene. In yet another aspect, the modified maize plant comprises a non-naturally occurring deletion in a BR gene. In yet another aspect, the modified maize plant comprises a non-naturally occurring duplication in a BR gene. The present description further provides a modified maize plant comprising a non-naturally occurring insertion into a BR2 gene, wherein the insertion results in truncation of the BR2 protein encoded by the BR2 gene. In one aspect, the insertion occurs within Exon 1 of the BR2 gene, where the insertion introduces a premature stop codon. In another aspect, the insertion occurs within Exon 2 of the BR2 gene, where the insertion introduces a premature stop codon. In another aspect, the insertion occurs within Exon 3 of the BR2 gene, where the insertion introduces a premature stop codon. In another aspect, the insertion occurs within Exon 4 of the BR2 gene, where the insertion introduces a premature stop codon. In another aspect, the insertion occurs within Exon 5 of the BR2 gene, where the insertion introduces a premature stop codon. In yet another aspect, the insertion occurs within the 3' UTR of the BR2 gene.In yet another aspect, the insertion occurs within the 5' UTR of the BR2 gene. In one respect, at least one non-natural mutation of BR or BR2 is at least one insertion. In another respect, the at least one insertion is a single nucleobase insertion. In one respect, the single nucleobase is guanine. In another respect, the single nucleobase is cytosine. In another respect, the single nucleobase is adenine. In another respect, the single nucleobase is thymine. In another respect, the single nucleobase is uracil. In yet another respect, a thymine is inserted between nucleotides 5420 and 5421 according to the open reading frame of BR2 to create a premature stop codon. In one respect, the single nucleobase insertion occurs within Exon 1 of the BR2 gene. In another respect, the single nucleobase insertion occurs within Exon 2 of the BR2 gene. In yet another respect, the single nucleobase insertion occurs within Exon 3 of the BR2 gene. In another aspect, the single nucleobase insertion occurs within Exon 4 of the BR2 gene.In another aspect, the insertion of a simple nucleobase occurs within Exon 5 of the BR2 gene. In another aspect, the insertion of a simple nucleobase occurs within UTR 3' of the BR2 gene. In another aspect, the insertion of a simple nucleobase occurs within UTR 5' of the BR2 gene. In another aspect, the insertion of a simple nucleobase occurs within a promoter of the BR2 gene. In another aspect, the insertion of a simple nucleobase occurs within Intron 1 of the BR2 gene. In another aspect, the insertion of a simple nucleobase occurs within Intron 2 of the BR2 gene. In another aspect, the insertion of a simple nucleobase occurs within Intron 3 of the BR2 gene. En otro aspectos, la inserción de nucleobase simple se produce dentro del Intrón 4 del gen BR2. In another aspect, the at least one insertion occurs within Exon 1 of the BR2 gene, where the at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the at least one insertion occurs within Exon 2 of the BR2 gene, where the at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the at least one insertion occurs within Exon 3 of the BR2 gene, where the at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the at least one insertion occurs within Exon 4 of the BR2 gene, where the at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the at least one insertion occurs within Exon 5 of the BR2 gene, where the at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, at least one insertion occurs within the 3' UTR of the BR2 gene, where at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, at least one insertion occurs within the 5' UTR of the BR2 gene, where at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, at least one insertion occurs within a BR2 gene promoter, where at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, at least one insertion occurs within Intron 1 of the BR2 gene, where at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, at least one insertion occurs within Intron 2 of the BR2 gene, where at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, at least one insertion occurs within Intron 3 of the BR2 gene, where at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, at least one insertion occurs within Intron 4 of the BR2 gene, where at least one insertion comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In one respect, at least one unnatural mutation of BR or BR2 is at least one substitution. In another respect, at least one substitution occurs within Exon 1 of the BR2 gene. In another respect, at least one substitution occurs within Exon 2 of the BR2 gene. In another respect, at least one substitution occurs within Exon 3 of the BR2 gene. In another respect, at least one substitution occurs within Exon 4 of the BR2 gene. In another respect, at least one substitution occurs within Exon 5 of the BR2 gene. In another respect, at least one substitution occurs within the 3' UTR of the BR2 gene. In aspect 140, at least one substitution occurs within the 5' UTR of the BR2 gene. In another aspect, at least one substitution occurs within a promoter of the gene. BR2. In another 140 aspect, at least one substitution occurs within the Gene intron BR2. In another aspect, at least one substitution occurs within the Gene intron BR2. In another aspect, at least one substitution occurs within the Gene intron BR2. In another aspect, at least one substitution occurs within Intron 4 of the BR2 gene. In one respect, at least one unnatural mutation of BR or BR2 is at least one deletion. In another respect, at least one deletion occurs within Exon 1 of the BR2 gene. In another respect, at least one deletion occurs within Exon 2 of the BR2 gene. In another respect, at least one deletion occurs within Exon 3 of the BR2 gene. In another respect, at least one deletion occurs within Exon 4 of the BR2 gene. In another respect, at least one deletion occurs within Exon 5 of the BR2 gene. In another respect, at least one deletion occurs within the 3' UTR of the BR2 gene. In another respect, at least one deletion occurs within the 5' UTR of the BR2 gene. In another respect, at least one deletion occurs within a promoter of the BR2 gene. In another respect, at least one deletion occurs within Intron 1 of the BR2 gene. In another aspect, at least one deletion occurs within Intron 2 of the BR2 gene.In another aspect, at least one deletion occurs within Intron 3 of the BR2 gene. In another aspect, at least one deletion occurs within Intron 4 of the BR2 gene. In one respect, at least one unnatural mutation of BR or BR2 is at least one duplication. In another respect, at least one duplication occurs within Exon 1 of the BR2 gene. In yet another respect, at least one duplication occurs within Exon 2 of the BR2 gene. In another aspect, at least one duplication occurs within Exon 3 of the BR2 gene. In another aspect, at least one duplication occurs within Exon 4 of the BR2 gene. In another aspect, at least one duplication occurs within Exon 5 of the BR2 gene. In another aspect, at least one duplication occurs within the 3' UTR of the BR2 gene. In another aspect, at least one duplication occurs within the 5' UTR of the BR2 gene. In another aspect, at least one duplication occurs within a promoter of the BR2 gene. In another aspect, at least one duplication occurs within the promoter of the BR2 gene. Intron Intron Intron of the gene of the gene gene BR2. BR2. BR2. In In In another aspect, at least one duplication occurs within Intron 4 of the BR2 gene. Genome editing Because the suppression of BR genes in maize produces plants that have a shorter height, a larger stem diameter, and greater resistance to bending, the inventors of the present further propose that the expression of BR genes can be reduced or eliminated by genome editing to provide these favorable traits to maize or other cereal or monocotyledonous plants. As used herein, a “targeted editing technique” refers to any method, protocol, or technique that allows for the targeted and / or precise editing of a specific location in a genome (e.g., the editing is not random). While not exhaustive, the use of a site-specific nuclease is an example of a targeted editing technique. As used herein, “editing” or “genomic editing” refers to the targeted mutagenesis, insertion, deletion, or substitution of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 1000, at least 2500, at least 5000, at least 10,000, or at least 25,000 nucleotides from a nucleic acid sequence of a plant's endogenous genome. Genome editing, or targeted editing, can be performed using one or more site-specific nucleases. Site-specific nucleases can induce a double-strand break (DSB) at a target site in a genomic sequence, which is then repaired by the natural processes of homologous recombination (HR) or non-homologous end joining (NHEJ). Sequence modifications, such as insertions and deletions, can be made at DSB locations through NHEJ repair. HR can be used to integrate a donor nucleic acid sequence into a target site. If two DSBs flank a target region, the breaks can be repaired by NHEJ by reversing the orientation of the targeted DNA (also called "inversion"). In one aspect, a vector or construct provided herein comprises polynucleotides encoding at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 site-specific nucleases. In another aspect, a cell provided herein already comprises a site-specific nuclease. In one aspect, a polynucleotide encoding a site-specific nuclease provided herein is stably transformed into a cell. In another aspect, a polynucleotide encoding a site-specific nuclease provided herein is transiently transformed into a cell. In another aspect, a polynucleotide encoding a site-specific nuclease is under the control of a tunable promoter, a constitutive promoter, a tissue-specific promoter, or any promoter useful for the 140 site-specific nuclease expression. In one aspect, a vector comprises in cis a cassette encoding a site-specific nuclease and a donor molecule, such that upon contact with the genome of a cell, the site-specific nuclease enables site-specific integration of the donor molecule. In another aspect, a first vector comprises a cassette encoding a site-specific nuclease and a second vector comprises a donor molecule, such that upon contact with the genome of a cell, the site-specific nuclease provided in trans enables site-specific integration of the donor molecule. The site-specific nucleases provided herein may be used as part of a targeted editing technique. Non-exhaustive examples of site-specific nucleases used in the methods and / or compositions provided herein include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), nucleases guided by (e.g., Cas9 and Cpf1), a recombinase (e.g., but not limited to, a serine recombinase coupled to a DNA recognition motif, a tyrosine recombinase coupled to a DNA recognition motif), a transposase (e.g., but not limited to, a DNA transposase coupled to a DNA-binding domain), or any combination thereof.In one aspect, a method provided herein comprises the use of one or more, two or more, three or more, four or more, or five or more site-specific nucleases to induce one, two, three, four, five or more than five DSBs at one, two, three, four, five or more than five target sites. In one aspect, a genome editing system provided herein (for example, a meganuclease, a ZFN, a TALEN, a CRISPR / Cas9 system, a CRISPR / Cpf1 system, a recombinase, a transposase) or a combination of genome editing systems provided herein, is used in a method to introduce one or more insertions, deletions, substitutions or inversions at a locus in a cell to introduce a mutation, or to generate a dominant negative allele or a dominant positive allele. Site-specific nucleases, such as meganucleases, ZFNs, TALENs, Argonaut proteins (non-exhaustive examples of Argonaut proteins include Argonaut Thermus thermophilus (TtAgo), Argonaut Pyrococcus furiosus (PfAgo), Argonaut Natronobacterium gregoryi (NgAgo), homologs of these, or modified versions thereof), Cas9 nucleases (non-exhaustive examples of RNA-guided nucleases include Casi, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Casio, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, ML / a / ZUZZ / U 14 140 Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, homologs of these, or modified versions thereof, induce a double-strand break in DNA at the target site of a genomic sequence, which is then repaired by natural hypersensitivity (HR) or natural hypersensitivity (NHEJ) processes. Sequence modifications then occur at the excised sites, which may include inversions, deletions, or insertions, resulting in gene alteration in the case of NHEJ, or the integration of nucleic acid sequences via HR. In one respect, a site-specific nuclease provided herein is selected from the group consisting of a zinc finger nuclease, a meganuclease, an RNA-guided nuclease, a TALE nuclease, a recombinase, a transposase, or any combination thereof. In another respect, a site-specific nuclease provided herein is selected from the group consisting of a Cas9 or a Cpf1.In another respect, a site-specific nuclease provided herein is selected from the group consisting of a Casi, a Casi B, a Cas2, a Cas3, a Cas4, a Cas5, a Cas6, a Cas7, a Cas8, a Cas9, a Casio, a Csy1, a Csy2, a Csy3, a Cse1, a Cse2, a Csc1, a Csc2, a Csa5, a Csn2, a Csm2, a Csm3, a Csm4, a Csm5, a Csm6, a Cmr1, a Cmr3, a Cmr4, a Cmr5, a Cmr6, a Csb1, a Csb2, a Csb3, a Csx17, a Csx14, a Csx10, a Csx16, a CsaX, a Csx3, a Csx1, a Csx15, a Csf1, a Csf2, a Csf3, a Csf4, a Cpf1, a homolog of these, or a modified version of these. In another respect, an RNA-guided nuclease provided herein is selected from the group consisting of a Cas9 or a Cpf1.In another respect, an RNA-guided nuclease provided herein is selected from the group consisting of a Casi, a Cas1B, a Cas2, a Cas3, a Cas4, a Cas5, a Cas6, a Cas7, a Cas8, a Cas9, a Casio, a Csy1, a Csy2, a Csy3, a Cse1, a Cse2, a Csc1, a Csc2, a Csa5, a Csn2, a Csm2, a Csm3, a Csm4, a Csm5, a Csm6, a Cmr1, a Cmr3, a Cmr4, a Cmr5, a Cmr6, a Csb1, a Csb2, a Csb3, a Csx17, a Csx14, a Csx10, a Csx16, a CsaX, a Csx3, a Csx1, a Csx15, a Csf1, a Csf2, a Csf3, a Csf4, a Cpf1, a homologue of these, or a modified version thereof. In another respect, a method and / or composition provided herein comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten site-specific nucleases.In yet another aspect, a method and / or composition provided herein comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine or at least ten polynucleotides encoding at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine or at least ten site-specific nucleases. IVIA / a / ZUZZ / UI 4 140 Recombinases In one aspect, a tyrosine recombinase coupled to a DNA recognition motif provided herein is selected from the group consisting of a Cre recombinase, a Gin recombinase, an Flp recombinase, and a Tnp1 recombinase. In one aspect, either a Cre recombinase or a Gin recombinase provided herein is linked to a zinc-finger DNA-binding domain. The Flp-FRT-targeted recombination system is derived from the 2μ plasmid of the baker's yeast Saccharomyces cerevisiae. In this system, the Flp recombinase (flippase) recombines sequences between flippase recognition target (FRT) sites. The FRT sites comprise 34 nucleotides. Flp binds to the "arms" of the FRT sites (one arm is in reverse orientation) and cleaves the FRT site at either end of an intervening nucleic acid sequence. Following excision, Flp recombines nucleic acid sequences between two FRT sites.Cre-lox is a site-directed recombination system derived from bacteriophage P1 that is similar to the Flp-FRT recombination system. Cre-lox can be used to invert, delete, or translocate a nucleic acid sequence. In this system, the Cre recombinase recombinates a pair of lox nucleic acid sequences. The lox sites comprise 34 nucleotides, with the first and last 13 nucleotides (arms) being palindromic. During recombination, the Cre recombinase protein binds to two lox sites on different nucleic acids and cleaves at those sites. The cleaved nucleic acids are then cut and spliced ​​together (translocated reciprocally), completing the recombination process. In another respect, a lox site provided herein is a loxP, lox 2272, loxN, lox 511, lox 5171, Iox71, Iox66, M2, M3, M7 or M11 site. In another aspect, a serine recombinase coupled to a DNA recognition motif provided herein is selected from the group consisting of a PhiC31 integrase, an R4 integrase, and a TP-901 integrase. In another aspect, a DNA transposase coupled to a DNA-binding domain provided herein is selected from the group consisting of a TALE-piggyBac and a TALE-Mutator. ZFN ZFNs are synthetic proteins consisting of a modified zinc-finger DNA-binding domain fused to the cleavage domain of the Fokl restriction nuclease. ZFNs can be engineered to cleave almost any long stretch of double-stranded DNA for modification of the zinc-finger DNA-binding domain. ZFNs form dimers from monomers composed of a non-Fokl nuclease-specific DNA-cleavage domain fused to a set of zinc fingers modified to bind to a target DNA sequence. The DNA-binding domain of a ZFN is typically composed of 3–4 sets of zinc fingers. The amino acids at positions -1, +2, +3, and +6 relative to the start of the zinc fingers helix, which contribute to site-specific binding to the target DNA, can be changed and customized to fit specific target sequences. The other amino acids form the consensus backbone for generating ZFNs with different sequence specificities. The rules for selecting target sequences for ZFNs are known in the technique. The Fokl nuclease domain requires dimerization to cleave DNA; therefore, two ZFNs with their C-terminus regions are necessary to join opposite DNA strands at the cleavage site (separated by 5–7 bp). The ZFN monomer can cleave the target site if the two ZFN-binding sites are palindromic. As used herein, the term ZFN is broad and includes a ZFN that can cleave double-stranded DNA without the assistance of another ZFN. The term ZFN is also used to denote one or both members of a ZFN pair that are modified to function together to cleave DNA at the same site. Without being limited to any one scientific theory, because the DNA-binding specificities of zinc finger domains can, in principle, be modified again using various methods, modified ZFNs can theoretically be constructed to target almost any gene sequence. Publicly available methods for modifying zinc finger domains include context-dependent assembly (CoDA), oligomerized cluster modification (OPEN), and modular assembly. In one aspect, a method and / or composition provided herein comprises one or more, two or more, three or more, four or more, or five or more ZFNs. In another aspect, a ZFN provided herein is capable of generating a targeted DSB. In one aspect, vectors comprising polynucleotides encoding one or more, two or more, three or more, four or more, or five or more ZFNs are delivered to a cell via transformation methods known in the art (e.g., non-exhaustively, viral transfection, particle bombardment, PEG-mediated protoplast transfection, or Agrobacterium-mediated transformation). Meganucleases Meganucleases, often identified in microbes, are unique enzymes with high activity and long recognition sequences (>14 bp) that produce site-specific digestion of target DNA. Modified versions of naturally occurring meganucleases typically possess extended DNA recognition sequences (e.g., 14 to 40 bp). Modifying meganucleases can be more challenging than modifying ZFNs and TALENs because the DNA cleavage and recognition functions of meganucleases are intertwined within a single domain. Specialized mutagenesis and high-throughput screening methods have been used to create novel meganuclease variants that recognize unique sequences and possess increased nuclease activity. In one aspect, a method and / or composition provided herein comprises one or more, two or more, three or more, four or more, or five or more meganucleases. In another aspect, a meganuclease provided herein is capable of generating a targeted DSB. In one aspect, vectors comprising polynucleotides encoding one or more, two or more, three or more, four or more, or five or more meganucleases are delivered to a cell via transformation methods known in the art (e.g., but not limited to, viral transfection, particle bombardment, PEG-mediated protoplast transfection, or Agrobacterium-mediated transformation). TALENT TALENs are artificial restriction enzymes generated by fusing the DNA-binding domain of a transcription activator-like effector (TALE) to a Fokl nuclease domain. When each member of a TALEN pair binds to DNA sites flanking a target site, the Fokl monomers dimerize and cause double-strand DNA breaks at the target site. In addition to the wild-type Fokl cleavage domain, variants of the Fokl cleavage domain with mutations were engineered to improve cleavage specificity and activity. The Fokl domain functions as a dimer, requiring two constructs with unique DNA-binding domains to target sites in the genome with appropriate orientation and spacing.Both the number of amino acid residues between the DNA-binding domain of TALEN and the Fokl cleavage domain and the number of bases between the two individual TALEN binding sites are parameters for achieving high levels of activity. TALENs are artificial restriction enzymes generated by fusing the DNA-binding domain of a transcription activator-like effector (TALE) to a nuclease domain. The nuclease is selected from a group consisting of Pvull, MutH, Tevly, Fokl, Alwl, Mlyl, Sbfl, Sdal, Stsl, CleDORF, Clo051, and Pept071. When each member of a TALEN pair binds to DNA sites flanking a target site, the Fokl monomers dimerize, causing a double-strand break in the DNA at the target site. As used herein, the term TALEN is broad and includes a monomeric TALEN that can cleave double-stranded DNA without the assistance of another TALEN. The term TALEN is also used to denote one or both members of a TALEN pair that work together to cleave DNA at the same site. Transcription activator-like effectors (TALE) can be modified to bind to virtually any DNA sequence. TALE proteins are DNA-binding domains derived from various plant pathogens of the genus Xanthomonas. X pathogens secrete TALE into the host plant cell during infection. TALE translocates to the nucleus, where it recognizes and binds to a specific DNA sequence in the promoter region of a specific gene in the host genome. TALE has a core DNA-binding domain composed of 13–28 repeating monomers of 33–34 amino acids. The amino acids in each monomer are highly conserved, except for hypervariable amino acid residues at positions 12 and 13. These two variable amino acids are called repeat variable residues (RVDs).The amino acid pairs NI, NG, HD, and NN of RVDs preferentially recognize adenine, thymine, cytosine, and guanine / adenine, respectively, and RVD modulation can recognize consecutive DNA bases. This simple relationship between amino acid sequence and DNA recognition allows for the modification of specific DNA-binding domains by selecting a combination of repeat segments containing the appropriate RVDs. In addition to the wild-type Fokl cleavage domain, variants of the Fokl cleavage domain with mutations were engineered to improve cleavage specificity and activity. The Fokl domain functions as a dimer, requiring two constructs with unique DNA-binding domains for target genome sites with appropriate orientation and spacing. Both the number of amino acid residues between the TALEN DNA-binding domain and the Fokl cleavage domain, and the number of bases between the two individual TALEN binding sites, are parameters for achieving high levels of activity. The PvulI, MutH, and Tevl cleavage domains are useful alternatives to Fokl and Fokl variants for use with TALEs. PvulI functions as a highly specific cleavage domain when coupled to a TALE (see Yank et al. 2013. PLoS One. 8: e82539). MutH is capable of introducing specific nicks to the strands in DNA (see Gabsalilow et al. 2013. Nucleic Acids Research).41: e83). Tevl introduces double-strand breaks in DNA at target sites (see Beurdeley et al., 2013. Nature Communications. 4:1762). The relationship between the amino acid sequence and the DNA recognition of the TALE-binding domain allows for the design of proteins. Software programs such as DNAWorks can be used to design TALE constructs. Those skilled in the technique are familiar with other methods for designing TALE constructs. See Doyle et al., Nucleic Acids Research (2012) 40: W117-122; Cermak et al., Nucleic Acids Research (2011) 39:e82; and tale-nt.cac.cornell.edu / about. In one aspect, a method and / or composition provided herein comprises one or more, two or more, three or more, four or more, or five or more TALENs. In another aspect, a TALEN provided herein is capable of generating a targeted DSB. In one aspect, vectors comprising polynucleotides encoding one or more, two or more, three or more, four or more, or five or more TALENs are delivered to a cell via transformation methods known in the art (e.g., but not limited to, viral transfection, particle bombardment, PEG-mediated protoplast transfection, or Agrobacterium-mediated transformation). CRISPR / Cas9 A CRISPR / Cas9 system or a CRISPR / Cpf1 system are alternatives to Fokl-based ZFN and TALEN methods. In one respect, a genome editing system provided herein comprises a CRISPR system. CRISPR systems are based on modified RNA-guided nucleases (RGNs) that use complementary base pairing to recognize DNA sequences at target sites. In one respect, a vector provided herein may comprise any combination of a nucleic acid sequence encoding an RNA-guided nuclease. Without being limited to any particular scientific theory, CRISPR / Cas nucleases are part of the adaptive immune system of bacteria and archaea, protecting them against invading nucleic acids such as viruses by cleaving target DNA in a sequence-dependent manner. Immunity is acquired through the integration of short fragments of the invading DNA, known as spacers, between ~20-nucleotide CRISPR repeats at the proximal end of a CRISPR locus (a CRISPR array). One described Cas protein is the Cas9 nuclease (also known as Csn1), which is part of the Class 2, Type II CRISPR / Cas system in Streptococcus pyogenes. See Makarova et al. Nature Reviews Microbiology (2015) doi: 10.1038 / nrmicro3569. Cas9 comprises a RuvC-like nuclease domain at its amino terminus and an HNH-like nuclease domain located in the middle of the protein.Cas9 proteins also contain a PAM-interacting domain (Pl), a recognition lobe (REC), and a BH domain. The Cpf1 nuclease, another type II system, acts similarly to Cas9, but Cpf1 does not require a tracrRNA. See Gong et al., Science (2013) 339: 819–823; Zetsche et al., Cell (2015) doi: 10.1016 / j.cell.2O15.09.038; U.S. Patent Publication No. s2014 / 0068797; U.S. Patent Publication No. a2014 / 0273235; U.S. Patent Publication No. s2015 / 0067922; U.S. Patent No. s8,697,359; U.S. Patent No. s8,771,945. US patent no. s8,795,965; US patent no. s8,865,406; US patent no. s8,871,445; US patent no. s8,889,356; US patent no. 28,889,418; US patent no. e8,895,308; and US patent no. B8,906,616, each of which is incorporated herein by reference in its entirety. When Cas9 or Cpf1 cleave targeted DNA, endogenous double-strand break (DSB) repair mechanisms are activated. DSBs can be repaired by non-homologous end joining, which can incorporate insertions or deletions (indels) at the targeted locus. If two DSBs flanking a target region are created, the breaks can be repaired by reversing the orientation of the targeted DNA. Alternatively, if a donor polynucleotide homologous to the target DNA sequence is provided, the DSB can be repaired by homology-directed repair. This repair mechanism allows for the precise integration of a donor polynucleotide into the targeted DNA sequence. While not limited to any particular scientific theory, in Class 2, Type II CRISPR / Cas systems, CRISPR arrays, including spacers, are transcribed during encounters with recognized invasive DNA and processed into small interfering CRISPR RNAs (crRNAs), which are approximately 40 nucleotides long. The crRNAs hybridize to transactivating crRNAs (tracrRNAs) to activate the Cas9 nuclease and guide it to a target site. The nucleic acid molecules provided herein can combine a crRNA and a tracrRNA into a single nucleic acid molecule, referred to herein as a “single-stranded guide RNA (sgRNA).” A prerequisite for target site cleavage is the presence of a conserved protospacer-adjacent motif (PAM) at a posterior position of the target DNA, which usually has the sequence 5-NGG-3 and, less frequently, NAG.Specificity is provided by the so-called "seed sequence," located approximately 12 bases upstream of the PAM, which must match between the RNA and the target DNA. Cpf1 acts similarly to Cas9, but Cpf1 does not require a tracrRNA. Therefore, in one aspect that utilizes Cpf1, a sgRNA can be replaced with a crRNA. In one aspect, a method and / or composition provided herein comprises one or more, two or more, three or more, four or more, or five or more Cas9 nucleases. In one aspect, a method and / or composition provided herein comprises one or more polynucleotides encoding one or more, two or more, three or more, four or more, or five or more Cas9 nucleases. In another aspect, a Cas9 nuclease provided herein is capable of generating a targeted DSB. In one aspect, a method and / or composition provided herein comprises one or more, two or more, three or more, four or more, or five or more Cpf1 nucleases. In one aspect, a method and / or composition provided herein comprises one or more polynucleotides encoding one or more, two or more, three or more, four or more, or five or more Cpf1 nucleases. In another aspect, a Cpf1 nuclease provided herein 140 present is capable of generating a directed DSB. In one aspect, vectors comprising polynucleotides encoding a site-specific nuclease and, optionally, one or more, two or more, three or more, or four or more sgRNAs are delivered to a plant cell via transformation methods known in the art (e.g., but not limited to, particle bombardment, PEG-mediated protoplast transfection, or Agrobacterium-mediated transformation). In one aspect, vectors comprising polynucleotides encoding a Cas9 nuclease and, optionally, one or more, two or more, three or more, or four or more sgRNAs are delivered to a plant cell via transformation methods known in the art (e.g., but not limited to, particle bombardment, PEG-mediated protoplast transfection, or Agrobacterium-mediated transformation).In another aspect, vectors comprising polynucleotides encoding a Cpf1 and, optionally, one or more, two or more, three or more, or four or more crRNAs, are provided to a cell through transformation methods known in the art (e.g., non-exhaustively, viral transfection, particle bombardment, PEG-mediated protoplast transfection, or Agrobacterium-mediated transformation). In one respect, an RNA-guided nuclease provided herein is selected from the group consisting of Casi, Casi B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, homologs of these or modified versions thereof, an Argonaut (non-exhaustive examples of Argonaut proteins include Thermus thermophilus Argonaut (TtAgo), Pyrococcus furiosus Argonaut (PfAgo), Natronobacterium gregoryi Argonaut (NgAgo), homologs of these, and modified versions thereof), a DNA guide for an Argonaut protein, and any combination thereof. In another respect, an RNA-guided nuclease provided herein is selected from the group consisting of Cas9 and Cpf1.In another respect, an RNA-guided nuclease provided herein comprises Cas9. In one respect, an RNA-guided nuclease provided herein is selected from the group consisting of Casi, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, homologs of these, or modified versions of these. In one respect, a site-specific nuclease is selected from the group consisting of Casi, Casi B, Cas2, Cas3, Cas4, Cas5, Cas6. IVIA / a / ZUZZ / U 14140 Cas7, Cas8, Cas9, Casio, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx1O, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, TtAgo, PfAgo and NgAgo. In another aspect, an RNA-guided nuclease is selected from the group consisting of Casi, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, TtAgo, PfAgo and NgAgo. Transformation According to aspects of this description, methods are provided for transforming a cell, tissue, or explant with a recombinant DNA construct or molecule comprising a transgene or transcriptable DNA sequence operatively linked to a promoter to induce a transgenic or genome-edited cell. According to other aspects of this description, methods are provided for transforming a plant cell, tissue, or explant with a recombinant DNA construct or molecule comprising a transgene or transcriptable DNA sequence operatively linked to a plant expression promoter to induce a transgenic or genome-edited plant or plant cell. Numerous methods are known in the art for transforming chromosomes or plastids in a plant cell with a recombinant DNA construct or molecule, which can be used according to the methods described herein to produce a transgenic plant and plant cell. Any procedure or method known in the art for transforming a plant cell, in accordance with the methods described herein, may be used. Effective methods for plant transformation include bacterially mediated transformation, such as Agrobacterium-mediated or Rhizhobium-mediated transformation, and microprojectile-mediated transformation. A variety of methods are known in the art for transforming explants with a transformation vector by bacterially mediated transformation or microprojectile-mediated transformation and then culturing, etc., such explants to regenerate or develop transgenic plants.Other methods for plant transformation are also known in the field, such as microinjection, electroporation, vacuum infiltration, pressure, sonication, silicon carbide fiber agitation, PEG-mediated transformation, etc. Transgenic plants produced by these transformation methods can be chimeric or non-chimeric for the transformation event depending on the methods and explants used. Those skilled in the art are familiar with methods for transforming plant cells. For example, specific instructions for transforming plant cells by bombarding microprojectiles with recombinant DNA-coated particles are found in U.S. patents Nos. 5,550,318; 5,538,880; 6,160,208; 6,399,861; and 6,153,812, and Agrobacterium-mediated transformation is described in U.S. patents Nos. 5,159,135; 5,824,877; 5,591,616; 6,384,301; 5,750,871; 5,463,174; and 5,188,958; all of which are incorporated herein by reference. Additional methods for plant transformation can be found, for example, in Compendium of Transgenic Crop Planning (2009) Blackwell Publishing. Any method familiar to those skilled in the art may be used for the transformation of a plant cell with any of the nucleic acid molecules provided herein. Alternatively, the nucleotide sequences described herein can be introduced into an organism and allowed to recombine with homologous regions of the organism's genome. Those skilled in the technique are familiar with such homologous recombination approaches, and these can be used to stably incorporate the sequences described herein into an organism. Furthermore, these strategies can be used to introduce inactivation mutations into a specific gene of an organism that shares substantial homology with the sequences described herein. An inactivation mutation is any mutation in a gene sequence that eliminates or substantially reduces the function or level of the gene's encoded product. Methods involving transformation of an organism followed by homologous recombination to stably integrate the sequences described herein into the organism's genome are contemplated herein.The description is specifically directed at methods that use the sequences described to alter the growth of an organism. Such methods include using the sequences described to interfere with the function or synthesis of a P-glycoprotein that controls the growth of an organism. The transformed cells can be cultured into plants using conventional methods. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants can then be grown and pollinated with the same transformed strain or with different strains, and the resulting hybrid possessing the constitutive expression of the desired phenotypic trait can be identified. Two or more generations can be grown to ensure that the constitutive expression of the desired phenotypic trait is stably maintained and inherited, and then the seeds can be harvested to confirm that the constitutive expression of the desired phenotypic trait has been achieved. The targets of explants or recipient cells for transformation may include, but are not limited to, a seed cell, a fruit cell, a leaf cell, a cotyledon cell, a hypocotyl cell, a meristem cell, an embryo cell, an endosperm cell, a root cell, a shoot cell, a stem cell, a sheath cell, a flower cell, an inflorescence cell, a trunk cell, a peduncle cell, a style cell, a stigma cell, a receptacle cell, a petal cell, a sepal cell, a pollen cell, an anther cell, a filament cell, an ovary cell, an ovule cell, a pericarp cell, a phloem cell, a bud cell, or a vascular tissue cell. In another respect, the present description provides a plant chloroplast.In one aspect, the present description provides an epidermal cell, a stomatal cell, a trichome cell, a capillary root cell, a storage root cell, or a tubule cell. In another aspect, the present description provides a protoplast. In yet another aspect, the present description provides a plant callus cell. It is considered that any cell from which a fertile plant can be regenerated is a useful recipient cell for the implementation of the present description. Calluses can be initiated from various tissue sources, including, but not limited to, immature embryos or embryonic parts, seedling apical meristems, microspores, and the like. Such cells that can proliferate as calluses can serve as recipient cells for transformation.The materials and practical transformation methods for producing the transgenic plants described herein (e.g., various media and recipient target cells, transformation of immature embryos, and subsequent regeneration of fertile transgenic plants) are described, for example, in U.S. Patents 6,194,636 and 6,232,526 and U.S. Patent Application Publication 2004 / 0216189, which are incorporated herein by reference. As is known in the art, the transformed tissues, cells, or explants may be subjected to further culture steps, such as callus induction, selection, regeneration, etc. The transformed tissues, cells, or explants containing a recombinant DNA insertion may be cultured, grown, or regenerated into transgenic plants in culture, seedlings, or soil according to methods known in the art.In one respect, the present description provides plant cells that are not reproductive material and do not mediate the natural reproduction of the plant. In another respect, the present description provides plant cells that are reproductive material and mediate the natural reproduction of the plant. In another respect, the present description provides plant cells that cannot maintain themselves through photosynthesis. In another respect, the present description provides somatic plant cells. Somatic cells, as opposed to germline cells, do not mediate plant reproduction. IVIA / a / ZUZZ / UI 4 140 Transgenic plants can be crossed with each other or with other plants to produce transgenic progeny and seeds. A transgenic plant can also be prepared by crossing a first plant containing the recombinant DNA sequence or transformation event with a second plant lacking the insertion. For example, a recombinant DNA sequence or construct can be introduced into a first plant line that is susceptible to transformation and then crossed with a second plant line to introgress the recombinant DNA sequence or construct into the second plant line. The progeny from these crosses can then be further backcrossed into the most desirable line multiple times, such as through 6 to 8 generations or backcrosses, to produce a progeny plant with substantially the same genotype as the original parent line, except for the introduction of the recombinant DNA sequence or construct. A plant, plant cell, or explant provided herein may be from an elite variety or an elite line. An elite variety or an elite line refers to any variety produced through breeding and selection for superior agronomic performance. A plant, plant cell, or explant provided herein may be a hybrid plant, cell, or explant. As used herein, a “hybrid” is created by crossing two plants of different varieties, lines, or species, such that the offspring comprise genetic material from each parent. Those skilled in the art will recognize that higher-order hybrids can also be generated. For example, a first hybrid can be produced by crossing Variety C with Variety D to create a C x D hybrid, and a second hybrid can be produced by crossing Variety E with Variety F to create an E x F hybrid.The first and second hybrids can be further crossed to create the higher order hybrid (C x D) x (E x F) comprising genetic information from all four parent varieties. A recombinant DNA construct or molecule described herein may comprise or be included within a DNA transformation vector for use in the transformation of a target plant explant, tissue, or cell. Such a transformation vector described herein may generally comprise sequences or elements necessary or favorable for efficient transformation, in addition to at least one selectable marker gene, at least one expression cassette and / or transcript DNA sequence encoding one or more site-specific nucleases, and optionally one or more sgRNAs or crRNAs.For Agrobacterium-mediated transformation, the transformation vector may comprise a modified region or segment of transfer DNA (or T-DNA) with two border sequences, a left border (LB) and a right border (RB), flanking at least one transgene or transcript DNA sequence, such that insertion of the T-DNA into the plant genome creates a transformation event for the transcript DNA sequence, transgene, or expression cassette.In other words, the transgene, a transcript DNA sequence, transgene, or expression cassette encoding the site-specific nuclease(s) and / or sgRNAs or crRNAs would be located between the right and left edges of the T-DNA, perhaps along with one or more additional transgenes or expression cassettes, such as a plant marker transgene and / or other genes of agronomic interest that can confer an agronomically important trait or phenotype to a plant. According to alternative interpretations, the transcript DNA sequence, transgene, or expression cassette encoding at least one site-specific nuclease, any necessary sgRNAs or crRNAs, and the plant marker transgene (or other gene of agronomic interest) may be present in separate T-DNA segments on the same recombinant DNA molecule or on different molecules, such as for co-transformation.A transformation construct or vector may also comprise prokaryotic maintenance elements, which for Agrobacterium-mediated transformation may be located in the main structure of the vector outside of the T-DNA region(s). A selectable plant marker transgene in a transformation vector or construct of the present description can be used to contribute to the selection of transformed tissue or cells due to the presence of a selection agent, such as an antibiotic or herbicide, where the selectable plant marker transgene provides tolerance or resistance to the selection agent. Therefore, the selection agent can affect or promote the survival, development, growth, proliferation, etc., of transformed cells expressing the selectable plant marker gene, such as to increase the proportion of transformed tissue or cells in the plant.Commonly used selectable plant marker genes include, for example, those that confer tolerance or resistance to antibiotics, such as kanamycin and paromomycin (nptll), hygromycin B (aph IV), streptomycin or spectinomycin (aadA), and gentamicin (aac3 and aacC4), or those that confer tolerance or resistance to herbicides, such as glufosinate (baro pat), dicamide (DMO), and glyphosate (aroA or Cp4-EPSPS). Detectable plant marker genes, which provide the ability to visually detect transformants, such as luciferase or green fluorescent protein (GFP), or a gene expressing beta-glucuronidase or uidA gene (GUS), for which various chromogenic substrates are known, can also be used.In one aspect, a vector or polynucleotide provided herein comprises at least one marker gene selected from the group consisting of nptll, aph IV, aadA, aac3, aacC4, bar, pat, DMO, EPSPS, aroA, GFP, and short (hsRNA), trans-acting siRNA (ta-sRNA), or microRNA (miRNA). In addition, sense and / or antisense RNA molecules may be used to target non-coding genomic regions or sequences within or near a gene to induce gene silencing. Accordingly, any of these methods may be used for the tissue-specific or tissue-preferred suppression of one or more endogenous BR genes. See, for example, US patent application publications n.s2009 / 0070898, 2011 / 0296555 and 2011 / 0035839, the content and descriptions of which are incorporated herein by reference. As used herein, the term “suppression” refers to a decrease, reduction, or elimination of the expression level of a target mRNA and / or protein encoded by a target gene in a plant, plant cell, or plant tissue at a specified stage of plant development, compared to the expression level of that mRNA and / or protein in a wild-type or control plant, cell, or tissue at the same stage of plant development. According to aspects of this description, a transgenic or modified plant provided herein comprises a BR expression level that is reduced by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or 100% compared to a control plant.According to aspects of the present description, a transgenic or modified plant provided herein comprises a BR expression level that is reduced by at least 5%-20%, 5%-25%, 5%-30%, 5%-40%, 5%-50%, 5%-60%, 5%-70%, 5%-75%, 5%-70%, 5%-70%, 5%-70%, 5%-70%, 5%-90%, 5%-70%, 7%-100%, 5%-100%, 5%-90%, 5%-75%, 2%-75%, 3%-80%, or 1%-75% compared to a control plant. Method for producing a semi-dwarf corn plant Also provided herein is a method for producing a semidwarf maize plant comprising providing a guide RNA that recognizes a target site in a BR gene in a maize cell, wherein the guide RNA acts in conjunction with an RNA-guided nuclease that creates a chain break at the target site; generating a maize plant from the maize cell; and selecting the maize plant that exhibits the semidwarf phenotype. As used herein, the term “guide RNA” or “gRNA” is a short RNA sequence comprising (1) a structural RNA sequence required for binding to an RNA-guided nuclease and (2) an RNA sequence complementary to a target sequence or target site. In one respect, the structural RNA sequence is that set out in SEQ ID NO: 5. In another respect, the target sequences for the BR2 gene are those set out in SEQ ID NO: 7-17. In one aspect, the gRNA comprises a sequence that is set out in SEQ ID NO: 6. In one aspect, the gRNA comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleotide sequence set out in SEQ ID NO: 6. As used herein, an “RNA-guided nuclease” refers to an RNA-guided DNA endonuclease associated with the CRISPR system. Non-exhaustive examples of RNA-guided nucleases include Casi, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Casio, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, homologs thereof, or modified versions thereof. In one respect, the RNA-guided nuclease is Cas9. In one respect, the RNA-guided nuclease comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleotide sequence set forth in SEQ ID NO: 1.In another aspect, the RNA-guided nuclease comprises an amino acid sequence with a sequence identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% with respect to a polypeptide sequence set forth in SEQ ID NO: 2. In one aspect, the RNA-guided nuclease comprises the N- and C-terminus nuclear localization sequences (NLSs). In one aspect, the N-terminus NLS is located at nucleotide positions 4 to 33 of SEQ ID NO: 1, and the C-terminus NLS is located at nucleotide positions 3586 to 3615 of SEQ ID NO: 1. As used herein, the term “target site” or “target sequence” refers to a location on a polynucleotide sequence that binds to a site-specific nuclease, which introduces a strand break into the nucleic acid backbone and cleaves it. In one respect, the strand break is a double-strand break. The target site is located immediately upstream of a 2–6 base-pair DNA sequence, also known as a protospacer-adjacent motif (PAM). In another respect, a target site comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 29, or at least 30 consecutive nucleotides. 140 In one aspect, a target site provided herein has at least 10, at least 20, at least 30, at least 40, at least 50, at least 75, at least 100, at least 125, at least 150, at least 200, at least 250, at least 300, at least 400, or at least 500 nucleotides. In one aspect, a site-specific nuclease binds to a target site. In another aspect, a site-specific nuclease binds to a target site via a guide non-coding RNA (i.e., such as, but not limited to, a CRISPR RNA or a simple guide RNA (both of which are described in more detail below)). In one aspect, a non-coding RNA provided herein is complementary to a target site.It is important to note that perfect complementarity is not required for a non-coding RNA to bind to a target site; at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 mismatches between a target site and a non-coding RNA may be tolerated. As used herein, a “target region” or “targeted region” refers to a polynucleotide sequence flanked by two or more target sites. In some respects, a target region may be subject to deletion or inversion. As used herein, “flanked,” when used to describe a target region, refers to two or more target sites physically surrounding the target region, with one target site on each side. A target site can be located within a polynucleotide sequence that encodes a leader, enhancer, transcription start site, promoter, 5' UTR, exon, intron, 3' UTR, polyadenylation site, or termination sequence. It can also be observed that a target site can be located upstream of a sequence that encodes a leader, enhancer, transcription start site, promoter, 5' UTR, exon, intron, 3' UTR, polyadenylation site, or termination sequence. In one aspect, a target site is placed at less than 10, less than 20, less than 30, less than 40, less than 50, less than 75, less than 100, less than 125, less than 150, less than 200, less than 250, less than 300, less than 400, less than 500, less than 600, less than 700, less than 800, less than 900, less than 1000, less than 1250, less than 1500, less than 2000, less than 2500, less than 5000, less than 10.000 or less than 25,000 nucleotides of a polynucleotide that encodes a leader, enhancer, transcriptional start site, promoter, 5' UTR, exon, intron, 3' UTR, polyadenylation site, gene, or termination sequence. In one aspect, the target site is a BR2 gene. In another aspect, the target site is located within Exon 1 of the BR2 gene. In another aspect, the target site is located within Exon 2 of the BR2 gene. In another aspect, the target site is located within Exon 3 of the BR2 gene. In another aspect, the target site is located within Exon 4 of the BR2 gene. In another In one aspect, the target site is located within Exon 5 of the BR2 gene. In another aspect, the target site is located within the 3' UTR of the BR2 gene. In another aspect, the target site is located within the 5' UTR of the BR2 gene. In another aspect, the target site is located within the promoter of the BR2 gene. In another aspect, the target site is located within Intron 1 of the BR2 gene. In another aspect, the target site is located within Intron 2 of the BR2 gene. In another aspect, the target site is located within Intron 3 of the BR2 gene. In another aspect, the target site is located within Intron 4 of the BR2 gene. In one aspect, the target site comprises a nucleotide sequence established at SEQ ID NO: 7. In another aspect, the target site comprises a nucleotide sequence established at SEQ ID NO: 8. In another aspect, the target site comprises a nucleotide sequence established at SEQ ID NO: 9. In another aspect, the target site comprises a nucleotide sequence established at SEQ ID NO: 10. In another aspect, the target site comprises a nucleotide sequence established at SEQ ID NO: 11. In another aspect, the target site comprises a nucleotide sequence established at SEQ ID NO: 12. In another aspect, the target site comprises a nucleotide sequence established at SEQ ID NO: 13. In another aspect, the target site comprises a nucleotide sequence established at SEQ ID NO: 14.In another aspect, the target site comprises a nucleotide sequence that is established in SEQ ID NO: 15. In another aspect, the target site comprises a nucleotide sequence that is established in SEQ ID NO: 16. In another aspect, the target site comprises a nucleotide sequence that is established in SEQ ID NO: 17. As used herein, “donor molecule” is defined as a nucleic acid sequence selected for site-directed insertion into a genome. In one respect, a targeted editing technique provided herein comprises the use of one or more, two or more, three or more, four or more, or five or more donor molecules. A donor molecule provided herein may be of any length. For example, a donor molecule provided herein has a length of 2 to 50,000, 2 to 10,000, 2 to 5,000, 2 to 1,000, 2 to 500, 2 to 250, 2 to 100, 2 to 50, 2 to 30, 15 to 50, 15 to 100, 15 to 500, 15 to 1,000, 15 to 5,000, 18 to 30, 18 to 26, 20 to 26, 20 to 50, 20 to 100, 20 to 250, 20 to 500, 20 to 1,000, 20 to 5,000, or 20 to 10,000 nucleotides. A donor molecule comprises one or more genes that encode actively transcribed and / or translated gene sequences.These transcribed sequences may encode a protein or a non-coding RNA. In some respects, the donor molecule may comprise a polynucleotide sequence that does not include a functional gene or a complete gene (i.e., the donor molecule may simply comprise regulatory sequences, such as a promoter) or may contain no identifiable gene expression elements or actively transcribed gene sequences. Furthermore, the donor molecule may be linear or circular, and may be single-stranded or double-stranded. It may be delivered to the cell as empty nucleic acid, as a complex with one or more delivery agents (e.g., liposomes, poloxamers, protein-encapsulated T-strand, etc.), or it may be contained within a bacterial or viral delivery vehicle, such as Agrobacterium tumefaciens or a geminivirus, respectively.In another aspect, a donor molecule provided herein binds operatively to a promoter. In another aspect, a donor molecule provided herein is transcribed into RNA. In another aspect, a donor molecule provided herein does not bind operatively to a promoter. In one aspect, a donor molecule provided herein may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten genes. In one aspect, a donor molecule provided herein does not comprise any genes. Not without limitation, a gene provided herein may include an insecticide resistance gene, a herbicide tolerance gene, a nitrogen use efficiency gene, a water use efficiency gene, a nutritional quality gene, a DNA-binding gene, a selectable marker gene, an RNA construct, a site-specific genomic modification enzyme gene, a single guide RNA of a CRISPR / Cas9 system, a geminivirus-based expression cassette, or a plant viral expression vector system. In one aspect, a donor molecule comprises a polynucleotide encoding a promoter.In another aspect, a donor molecule provided herein comprises a polynucleotide encoding a tissue-preferred or tissue-specific promoter. In yet another aspect, a donor molecule provided herein comprises a polynucleotide encoding a constitutive promoter. In another aspect, a donor molecule provided herein comprises a polynucleotide encoding an inducible promoter. In another aspect, a donor molecule comprises a polynucleotide encoding a structure selected from the group consisting of a leader, an enhancer, a transcriptional start site, a 5' UTR, an exon, an intron, a 3' UTR, a polyadenylation site, a transcriptional termination site, a promoter, a full-length gene, a partial gene, a gene, or a non-coding RNA. Any site or locus in a plant genome can be selected for site-directed integration of a donor sequence. For site-directed integration, a double-strand break (DSB) can first be made at a selected genomic locus using a site-specific nuclease, such as a zinc finger nuclease, a natural or modified meganuclease, a TALE endonuclease, or an RNA-guided endonuclease (e.g., Cas9 or Cpf1). Any known method in the technique for site-directed integration can be used.In the presence of a donor sequence, the cut or DSB can then be repaired by homologous recombination between one or more homology arms of the donor template and the plant genome, or by non-homologous end joining (NHEJ), resulting in site-directed integration of the donor sequence into the plant genome to create a targeted insertion event at the cut or DSB site. Therefore, site-specific integration or insertion of a transgene or construct can be achieved. In one aspect, a sequence can be inserted into a double-strand break created by a CRISPR-based genome editing system without a donor sequence. In another aspect, a single base insertion into a double-strand break created by a CRISPR-based genome editing system can be achieved by non-homologous end joining (NHEJ) without a donor sequence. In yet another aspect, a single base can be inserted into a BR2 gene using the CRISPR-based genome editing system described herein. In one aspect, a single base can be inserted into Exon 1 of the BR2 gene, thereby creating a premature stop codon. In another aspect, a single base can be inserted into Exon 2 of the BR2 gene, thereby creating a premature stop codon. In yet another aspect, a single base can be inserted into Exon 3 of the BR2 gene, thereby creating a premature stop codon.In yet another aspect, a single base can be inserted into Exon 4 of the BR2 gene, creating a premature stop codon. Similarly, a single base can be inserted into Exon 5 of the BR2 gene, creating a premature stop codon. In another aspect, a donor sequence can be inserted or integrated into a strand break created by the guide RNA in conjunction with RNA-guided nucleases. In one aspect, the strand break is a double-strand break (DSB). The donor sequence may comprise a transgene or construct, such as a non-coding RNA molecule that targets a BR gene. In one aspect, the donor sequence introduces a premature stop codon into a BR2 gene. In one aspect, the premature stop codon is inserted within Exon 1 of the BR2 gene. In another aspect, the premature stop codon is inserted within Exon 2 of the BR2 gene. In another aspect, the premature stop codon is inserted within Exon 3 of the BR2 gene. In another aspect, the premature stop codon is inserted within Exon 4 of the BR2 gene. In yet another aspect, the premature stop codon is inserted within Exon 5 of the BR2 gene. According to one aspect of the present description, the method for producing a IVIA / a / ZUZZ / UI 4 140 Semidwarf maize plant creates at least one non-natural BR or BR2 mutation that further comprises integrating a sequence into the chain break. In one aspect, the sequence is integrated into the BR or BR2 gene via non-homologous end joining (NHEJ). In one aspect, the sequence is a single guanine. In another aspect, the sequence is a single cytosine. In another aspect, the sequence is a single adenine. In another aspect, the sequence is a single thymine. In another aspect, the sequence is a single uracil. In another aspect, a thymine is inserted between nucleotides 5420 and 5421 according to the open reading frame of BR2 to create a premature stop codon. In one aspect, the single nucleotide integrates into Exon 1 of the BR2 gene. In another aspect, the single nucleotide integrates into Exon 2 of the BR2 gene. In another aspect, the single nucleotide integrates into Exon 3 of the BR2 gene. In another aspect, the single nucleotide integrates into Exon 4 of the BR2 gene. In another aspect, the single nucleotide integrates into Exon 5 of the BR2 gene. In another aspect, the single nucleotide integrates into the 3' UTR of the BR2 gene. In another aspect, the single nucleotide integrates into the 5' UTR of the BR2 gene. In another aspect, the single nucleotide integrates into a promoter of the BR2 gene. In another aspect, the single nucleotide integrates into Intron 1 of the BR2 gene. In another aspect, the single nucleotide integrates into Intron 2 of the BR2 gene. In another aspect, the single nucleotide integrates into Intron 3 of the BR2 gene. In another aspect, the single nucleotide integrates into Intron 4 of the BR2 gene. In one aspect, the sequence comprises at least 2 nucleotides. In another aspect, the sequence comprises at least 3 nucleotides. In another aspect, the sequence comprises at least 4 nucleotides. In another aspect, the sequence comprises at least 5 nucleotides. In another aspect, the sequence comprises at least 6 nucleotides. In another aspect, the sequence comprises at least 7 nucleotides. In another aspect, the sequence comprises at least 8 nucleotides. In another aspect, the sequence comprises at least 9 nucleotides. In another aspect, the sequence comprises at least 10 nucleotides. In one aspect, the sequence is integrated within Exon 1 of the BR2 gene. In another aspect, the sequence is integrated within Exon 2 of the BR2 gene. In another aspect, the sequence is integrated within Exon 3 of the BR2 gene. In another aspect, the sequence is integrated within Exon 4 of the BR2 gene. In another aspect, the sequence is integrated within Exon 5 of the BR2 gene.In another aspect, the sequence integrates into the 3' UTR of the BR2 gene. In another aspect, the sequence integrates into the 5' UTR of the BR2 gene. In another aspect, the sequence integrates into a promoter of the BR2 gene. In another aspect, the sequence integrates into Intron 1 of the BR2 gene. In another aspect, the sequence integrates into Intron 2 of the BR2 gene. In another aspect, the sequence integrates into Intron 3 of the BR2 gene. In another aspect, the sequence integrates into Intron 4 of the BR2 gene. In another aspect, the sequence integrates into the BR or BR2 gene through a IVIA / a / ZUZZ / UI 4 140 140 donor sequence by homologous recombination (HR). In one aspect, the sequence is a single nucleotide. In one aspect, the sequence is a single guanine. In another aspect, the sequence is a single cytosine. In another aspect, the sequence is a single adenine. In another aspect, the sequence is a single thymine. In another aspect, the sequence is a single uracil. In another aspect, a thymine is inserted between nucleotides 5420 and 5421 according to the open reading frame of BR2 to create a premature stop codon. In one aspect, the single nucleotide is integrated into Exon 1 of the BR2 gene. In another aspect, the single nucleotide is integrated into Exon 2 of the BR2 gene. In another aspect, the single nucleotide is integrated into Exon 3 of the BR2 gene. In another aspect, the single nucleotide is integrated into Exon 4 of the BR2 gene. In another aspect, the single nucleotide is integrated into Exon 5 of the BR2 gene.In another aspect, the single nucleotide integrates into the 3' UTR of the BR2 gene. In another aspect, the single nucleotide integrates into the 5' UTR of the BR2 gene. In another aspect, the single nucleotide integrates into a promoter of the BR2 gene. In another aspect, the single nucleotide integrates into Intron 1 of the BR2 gene. In another aspect, the single nucleotide integrates into Intron 2 of the BR2 gene. In another aspect, the single nucleotide integrates into Intron 3 of the BR2 gene. In another aspect, the single nucleotide integrates into Intron 4 of the BR2 gene. In one aspect, the sequence comprises at least 2 nucleotides and is integrated into the BR or BR2 gene by means of a donor sequence. In another aspect, the sequence is integrated within Exon 1 of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the sequence is integrated within Exon 2 of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the sequence is integrated within Exon 3 of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the sequence is integrated within Exon 4 of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the sequence is integrated within Exon 5 of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the sequence is integrated within the 3' UTR of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the sequence is integrated within the 5' UTR of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. 140 In another aspect, the sequence is integrated within a promoter of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the sequence is integrated within Intron 1 of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the sequence is integrated within Intron 2 of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the sequence is integrated within Intron 3 of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In another aspect, the sequence is integrated within Intron 4 of the BR2 gene, where the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides. In one respect, the method for producing a semi-dwarf corn plant also includes integrating into the chain-breaking at least one substitution, at least one inversion, at least one deletion, at least one duplication, or a combination thereof. 140 In another aspect, at least one substitution occurs within Exon 1 of the BR2 gene. In another aspect, at least one substitution occurs within Exon 2 of the BR2 gene. In another aspect, at least one substitution occurs within Exon 3 of the BR2 gene. In another aspect, at least one substitution occurs within Exon 1 of the BR2 gene. In another aspect, at least one substitution occurs within Exon 2 of the BR2 gene. 3' 5' of the gene gene gene gene BR2. BR2. A substitution occurs within a gene promoter. In In one another BR2. BR2. BR2. In In In another other other substitution substitution occurs occurs within within the of the of Intron Intron Intron of the gene of the gene gene BR2. BR2. BR2. In In In another aspect, at least one substitution occurs within Intron 4 of the BR2 gene. In another aspect, at least one deletion occurs within Exon 1 of the BR2 gene. In another aspect, at least one deletion occurs within Exon 2 of the BR2 gene. In another aspect, at least one deletion occurs within Exon 3 of the BR2 gene. In another aspect, at least one deletion occurs within Exon 4 of the BR2 gene. In another aspect, at least one deletion occurs within Exon 5 of the BR2 gene. In another aspect, a deletion occurs within the 3' UTR of the BR2 gene. In another aspect, at least one deletion occurs within the 5' UTR of the BR2 gene. In another aspect, at least one deletion occurs within a promoter of the BR2 gene. In another aspect, at least one deletion occurs within Intron 1 of the BR2 gene. In another aspect, at least one deletion occurs within Intron 2 of the BR2 gene. In another aspect, at least one deletion occurs within Intron 3 of the BR2 gene.In another aspect, at least one deletion occurs within Intron 4 of the BR2 gene. In another aspect, at least one duplication occurs within Exon 1 of the BR2 gene. In another aspect, at least one duplication occurs within Exon 2 of the BR2 gene. In another aspect, at least one duplication occurs within Exon 3 of the BR2 gene. In another aspect, at least one duplication occurs within Exon 4 of the gene. BR2. In another aspect, the duplication occurs within the exon of the gene. BR2. In another 3' 5' of the gene, a duplication occurs within a gene promoter BR2. BR2. BR2. In In In another aspect, the duplication occurs within the Intron Intron Intron of the gene of the gene gene BR2. BR2. BR2. In In In another aspect, at least one duplication occurs within Intron 4 of the BR2 gene. Semi-dwarf phenotype The brachytic, dwarf, or semidwarf maize described herein may have characteristics that make it suitable for grain and forage production, especially in fast-growing environments. In particular, limited heat units in fast-growing environments reduce grain yield and decrease the likelihood of the crop reaching physiological maturity in a given year. The brachytic, dwarf, or semidwarf maize plants described herein require fewer heat units (e.g., 10%) than conventional hybrids to reach anthesis and generally reach physiological maturity earlier than conventional cultivars. The semidwarf maize plants described herein are less prone to root and stalk bending due to their shorter stalks and lower ear position.The corn plants described herein also have the potential to produce high-quality forage due to their high cob-to-stubble ratio. Semi-dwarf or short-stature maize plants may also have one or more additional traits, including, but not limited to, larger stalk diameter, less green breakage, deeper roots, larger leaf area, earlier canopy cover, greater stomatal conductance, shorter ear height, higher leaf water content, better drought tolerance, greater nitrogen use efficiency, greater water use efficiency, reduced leaf area and anthocyanin content under normal stress conditions, or with reduced nitrogen or water, greater ear weight, greater number of kernels, greater kernel weight, higher yield, greater number of seeds, greater seed weight, greater proliferation capacity, and / or higher harvest index. According to the modalities of this description, modified maize or cereal plants are provided that possess at least one favorable agronomic trait and at least one ear or female reproductive organ that is substantially or completely lacking in distinct types. The favorable agronomic trait may include, but is not limited to, shorter plant height, shorter internode length at one or more internodes, larger stalk or trunk diameter (thickness), greater resistance to bending, improved drought tolerance, improved nitrogen use efficiency, improved water use efficiency, deeper roots, larger leaf area, earlier canopy cover, and / or higher harvestable yield. As used herein, “harvest index” refers to the mass of grain harvested divided by the total aboveground biomass of the plant in a harvested area. In one aspect, the height at maturity of the corn plant that exhibits a phenotype 140 semidwarf is reduced by about 10%, 20%, 30%, 40%, 60% or 70% compared to a control plant that is not provided with the guide RNA and RNA-guided nuclease grown under comparable conditions. In another aspect, the yield of the corn plant exhibiting a semi-dwarf phenotype is equal to or greater than the yield of a control plant that is not provided with the guide RNA and the RNA-guided nuclease grown under comparable conditions. In another aspect, the corn plant that exhibits a semi-dwarf phenotype requires about 5%, 10%, 15%, 20% or 25% fewer heat units than a control plant that is not provided with the guide RNA and RNA-guided nuclease to achieve anthesis. In yet another aspect, the corn plant exhibiting a semi-dwarf phenotype has a relative maturity of about 10%, 15%, 20%, 25%, 30%, 35%, 40% or 45% less in days than the relative maturity of a control plant that is not provided with the guide RNA and the RNA-guided nuclease grown under comparable conditions. According to one aspect of the present description, a modified maize plant provided herein comprises a height less than 1600 mm, less than 1550 mm, less than 1500 mm, less than 1450 mm, less than 1400 mm, less than 1350 mm, less than 1300 mm, less than 1250 mm, less than 1200 mm, less than 1150 mm, less than 1100 mm, less than 1050 mm or less than 1000 mm and an average stem diameter of at least 17.5 mm, at least 18 mm, at least 18.5 mm, at least 19 mm, at least 19.5 mm, at least 20 mm, at least 20.5 mm, at least 21 mm, at least 21.5 mm or at least 22 mm. According to another aspect, the modified corn plant also comprises at least one ear that substantially lacks mature male reproductive tissue. According to one aspect of the present description, a modified maize plant provided herein comprises a height of 1000 mm to 1600 mm, 1000 mm to 1500 mm, 1050 mm to 1500 mm, 1100 mm to 1500 mm, 1150 mm to 1500 mm, 1200 mm to 1500 mm, 1250 mm to 1500 mm, 1300 mm to 1500 mm, 1350 mm to 1500 mm, 1400 mm to 1500 mm, 1450 mm to 1500 mm, 1000 mm to 1600 mm, 1100 mm to 1600 mm, 1200 mm to 1600 mm, 1300 mm to 1600 mm or from 1000 mm to 1300 mm, and an average stem diameter of 17.5 mm to 22 mm, 18 mm to 22 mm, 18.5 mm to 22 mm, 19 mm to 22 mm, 19.5 mm to 22 mm, 20 mm to 22 mm, 20.5 mm to 22 mm, 21 mm to 22 mm, 21.5 mm to 22 mm, 17.5 mm to 21 mm, 17.5 mm to 20 mm, 17.5 mm to 19 mm, 17.5 mm to 18 mm, 18 mm to 21 mm, 18 mm to 20 mm, or 18 mm to 19 mm. According to another aspect, the modified maize plant further comprises at least one ear that substantially lacks mature male reproductive tissue. 140 140 According to one aspect of the present description, a modified maize plant provided herein comprises a height that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% less than the height of an unmodified control plant and a stem diameter that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% larger than the stem diameter of the unmodified control plant.According to another aspect of the present description, a modified maize plant provided herein comprises a height that is 5% to 75%, 5% to 70%, 5% to 65%, 5% to 60%, 5% to 55%, 5% to 50%, 5% to 45%, 5% to 40%, 5% to 35%, 5% to 30%, 5% to 25%, 5% to 20%, 5% to 15%, 5% to 10%, 10% to 75%, 25% to 75%, 10% to 50%, or 50% to 75% less than the height of an unmodified control plant and a stem diameter that is 5% to 100%, 5% to 95%, 5% to 90%, 5% to 85%, from 5% to 80%, from 5% to 75%, from 5% to 70%, from 5% to 65%, from 5% to 60%, from 5% to 55%, from 5% to 50%, from 5% to 45%, from 5% to 40%, from 5% to 35%, from 5% to 30%, from 5% to 25%, from 5% to 20%, from 5% to 15%, from 5% to 10%, from 10% to 100%, from 10% to 75%, from 10% to 50%, from 25% to 75%, from 25% to 50% or from 50% to 75% greater than the stem diameter of the unmodified control plant. According to one aspect of the present description, a modified maize plant provided herein comprises a fresh ear weight that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% greater than the fresh ear weight of an unmodified control plant.According to another aspect of the present description, a modified maize plant provided herein comprises a fresh ear weight that is 5% to 100%, 5% to 95%, 5% to 90%, 5% to 85%, 5% to 80%, 5% to 75%, 5% to 70%, 5% to 65%, 5% to 60%, 5% to 55%, 5% to 50%, 5% to 45%, 5% to 40%, 5% to 35%, 5% to 30%, 5% to 25%, 5% to 20%, 5% to 15%, 5% to 10%, 10% to 100%, 10% to 75%, 10% to 50%, 25% to 75%, 25% to 75% % to 50% or 50% to 75% greater than the fresh ear weight of an unmodified control plant. According to one aspect of the present description, a modified maize plant provided herein comprises a harvest index of at least 0.57, at least 0.58, at least 0.59, at least 0.60, at least 0.61, at least 0.62, at least 0.63, at least 0.64, or at least 0.65. According to another aspect of the present description, a modified maize plant provided herein comprises a harvest index of 0.57 to 0.65, 0.57 to 0.64, 0.57 to 0.63, 0.57 to 0.62, 0.57 to 0.61, 0.57 to 0.60, 0.57 to 0.59, 0.57 to 0.58, 0.58 to 0.65, 0.59 to 0.65, or 0.60 to 0.65.According to yet another aspect of the present description, a modified corn plant provided herein comprises a harvest index that is at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 45%, or at least 50% higher compared to an unmodified control plant.According to yet another aspect of the present description, a modified corn plant provided herein comprises a harvest index that is 1% to 45%, 1% to 40%, 1% to 35%, 1% to 30%, 1% to 25%, 1% to 20%, 1% to 15%, 1% to 14%, 1% to 13%, 1% to 12%, 1% to 11%, 1% to 10%, 1% to 9%, 1% to 8%, 1% to 7%, 1% to 6%, 1% to 5%, 1% to 4%, 1% to 3%, 1% to 2%, 5% to 15%, 5% to 20%, 5% to 30%, or 5% to 40% higher compared to a non-modified control plant modified. According to one aspect of the present description, a population of modified maize plants provided herein comprises a bending frequency that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% lower compared to a population of unmodified control plants.According to another aspect of the present description, a population of modified maize plants provided herein comprises a bending frequency that is 5% to 100%, 5% to 95%, 5% to 90%, 5% to 80%, 5% to 75%, 5% to 70%, 5% to 65%, 5% to 60%, 5% to 45%, 5% to 40%, 5% to 35%, 5% to 30%, 5% to 20%, 5% to 15%, 5% to 10%, 10% to 100%, 10% to 75%, 10% to 50%, 25% to 75%, 25% to 50%, and 10% to 10%, respectively. % or 50% to 75% lower compared to a population of unmodified control plants. According to one aspect, the present description provides a population of modified maize plants, where the population of modified maize plants shares 140 parents with a single modified maize plant, wherein the modified maize plant population comprises an average height of 1500 mm or less, where the modified maize plant population comprises an average stem diameter of 18 mm or more, where less than 5%, less than 10%, less than 15%, less than 20%, or less than 25% of the modified maize plant population comprises a height greater than 1500 mm, and where less than 5%, less than 10%, less than 15%, less than 20%, or less than 25% of the modified maize plant population comprises at least one ear comprising male reproductive tissue. In another respect, the modified maize plant population comprises an average height of 1200 mm or less. According to one aspect, the present description provides a population of modified maize plants, where the modified maize plant population shares parents with a single modified maize plant, where the modified maize plant population comprises an average height of 1500 mm or less, where less than 5%, less than 10%, less than 15%, less than 20%, or less than 25% of the modified maize plant population comprises a height greater than 1500 mm, and where the modified maize plant population comprises a bending frequency that is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% lower compared to a population of unmodified control maize plants. According to one aspect, the present description comprises a modified maize plant comprising a height of 1500 mm or less, wherein the modified maize plant further comprises a stem diameter of 18 mm or more, and wherein at least one ear of the modified maize plant substantially lacks mature male reproductive tissue. According to one aspect, the present description comprises a modified maize plant comprising a height of 1500 mm or less, wherein the modified maize plant further comprises a harvest index of at least 0.58, and wherein the modified maize plant further comprises at least one ear that substantially lacks mature male reproductive tissue. Example modalities The following are examples of the modalities of this descriptive report. Mode 1. A maize plant comprising at least one unnatural brachytic mutation, wherein the maize plant exhibits a semidwarf phenotype compared to a control maize plant not comprising at least one unnatural brachytic mutation when grown under comparable conditions. Option 2. A brachytic maize plant comprising at least one non-natural brachytic mutation. Option 3. A brachytic maize plant comprising at least one non-naturally occurring brachytic mutating allele. Category 4. A maize plant comprising at least one unnatural brachytic mutation exhibiting a semi-dwarf phenotype. Option 5. A maize plant comprising at least one unnatural brachytic mutant allele exhibiting a semi-dwarf phenotype. Modality 6. A modified maize plant comprising a non-naturally occurring mutation in a BR gene that reduces BR gene activity, wherein the mutation is not introduced by transposon, and wherein the modified maize plant does not comprise a brachytic br2-23 allele or SNP5259. Mode 7. A modified maize plant comprising a modified BR2 gene with reduced activity, wherein the modified maize plant does not comprise a brachytic allele br2-23 or SNP5259. Modality 8. A non-transgenic maize plant comprising a synthetic mutation in a BR gene that reduces BR gene activity. Modality 9. A modified maize plant comprising a non-transgene- and non-transposon-mediated mutation in a BR gene that reduces BR gene activity. Modality 10. A brachytic maize plant comprising a dominant non-transgenic mutant BR allele. Modality 11. The corn plant of modality 1, where the BR gene is a BR2 gene. Mode 12. The maize plant of mode 1 or 11, wherein at least one unnatural BR mutation is selected from the group consisting of a substitution, an insertion, an inversion, a deletion, a duplication, and a combination thereof. Mode 13. The maize plant of mode 12, wherein at least one non-natural BR mutation is at least one insertion. Mode 14. The maize plant of mode 13, wherein at least one insertion occurs within a polynucleotide sequence of the BR2 gene that is selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5' and a combination thereof. Mode 15. The maize plant of mode 14, where at least one insertion occurs within Exon 5 of the BR2 gene. Option 16. The corn plant of any of options 13 to 15, where the 140 140 at least one insertion comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides or at least 20 nucleotides. Mode 17. The maize plant of mode 15, wherein at least one insertion is an individual nucleobase selected from the group consisting of guanine, cytosine, adenine, thymine, or uracil. Modality 18. The maize plant of modality 17, where the individual nucleobase is thymine. Mode 19. The modified maize plant of mode 18, wherein the single insertion of thymine (T) occurs between nucleotides 5420 and 5421 according to the open reading frame of BR2. Modality 20. The corn plant of modality 12, where at least one unnatural mutation is at least one substitution. Mode 21. The maize plant of mode 20, wherein at least one substitution occurs within a polynucleotide sequence of a BR2 gene selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5', and a combination thereof. Modality 22. The maize plant of modality 12, where at least one unnatural mutation is at least one deletion. Mode 23. The maize plant of mode 22, wherein at least one deletion occurs within a polynucleotide sequence of a BR2 gene that is selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5', and a combination thereof. Modality 24. The corn plant of modality 12, where at least one unnatural mutation is at least one duplication. Mode 25. The maize plant of mode 24, wherein at least one duplication occurs within a polynucleotide sequence of a BR2 gene selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5', and a combination thereof. Modality 26. The modified maize plant of any of modalities 1 to 25, where the presence of the mutation that is not of natural origin in the BR gene does not have a negative impact on the agronomic or quality properties of the maize plant. Modality 27. The modified corn plant of modality 26, wherein the height at maturity of the modified corn plant exhibiting the semidwarf phenotype is reduced by about 10%, 20%, 30%, 40%, 60% or 70% compared to a control corn plant. Modality 28. The modified corn plant of modality 26, where the yield of the modified corn plant is equal to or greater than the yield of a control corn plant. Mode 29. The modified corn plant of mode 26, wherein the corn plant requires about 5%, 10%, 15%, 20% or 25% fewer heat units than a control plant. Modality 30. The modified corn plant of modality 26, wherein the modified corn plant has a relative maturity in days about 10%, 15%, 20%, 25%, 30%, 35%, 40% or 45% less than the relative maturity of a control corn plant. Modality 31. The maize plant modified from any of modalities 1 to 30, wherein at least one non-natural BR mutation is transferred in a dominant manner. Mode 32. The modified corn plant of mode 31, wherein the modified corn plant can generate an antisense BR2 transcript. Modality 33. The maize plant of any of modalities 1 to 30, wherein the maize plant is homozygous for at least one unnatural brachytic mutation. Mode 34. The maize plant of mode 33, wherein at least one unnatural brachytic mutation is selected from the group consisting of a substitution, an insertion, an inversion, a deletion, a duplication, and a combination thereof. Mode 35. The maize plant of mode 34, wherein at least one unnatural brachytic mutation is at least one insertion. Mode 36. The maize plant of mode 35, wherein at least one insertion occurs within a polynucleotide sequence of the BR2 gene that is selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5' and a combination thereof. Mode 37. The maize plant of mode 36, where at least one insertion occurs within Exon 5 of the BR2 gene. Mode 38. The maize plant of mode 37, wherein at least one insertion is an individual nucleobase selected from the group consisting of guanine, cytosine, adenine, thymine, or uracil. Modality 39. The maize plant of modality 38, where the individual nucleobase 140 is thymine. Mode 40. The maize plant of mode 39, where the single insertion of thymine (T) occurs between nucleotides 5420 and 5421 according to the open reading frame of BR2. Modality 41. The maize plant of any of modalities 1 to 30, wherein the maize plant is heterozygous for at least one unnatural brachytic mutation. Modality 42. The maize plant of modality 41, wherein the maize plant comprises a wild-type BR2 allele. Mode 43. The maize plant of mode 41, wherein the maize plant comprises a mutating allele of natural BR2. Modality 44. The maize plant of modality 43, where the naturally occurring mutant allele BR2 is br2-MX. Modality 45. The maize plant of modality 44, wherein the naturally occurring mutant allele BR2 comprises an insertion of a 4.7 kb transposon in Exon 5 of the BR2 gene. Modality 46. The maize plant of any of modalities 43 to 45, wherein the maize plant comprises at least one unnatural brachytic mutation selected from the group consisting of a substitution, an insertion, an inversion, a deletion, a duplication, and a combination thereof. Mode 47. The maize plant of mode 46, wherein at least one unnatural brachytic mutation is at least one insertion. Mode 48. The maize plant of mode 47, wherein at least one insertion occurs within a polynucleotide sequence of the BR2 gene that is selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', L)TR 5' and a combination thereof. Mode 49. The maize plant of mode 48, where at least one insertion occurs within Exon 5 of the BR2 gene. Modality 50. The maize plant of modality 49, wherein at least one insertion is an individual nucleobase selected from the group consisting of guanine, cytosine, adenine, thymine, or uracil. Modality 51. The maize plant of modality 50, where the individual nucleobase is thymine. Mode 52. The maize plant of mode 51, where the single insertion of thymine (T) occurs between nucleotides 5420 and 5421 according to the open reading frame of BR2. Modality 53. A method for producing a semi-dwarf maize plant, wherein the method comprises (a) providing a guide RNA that recognizes a target site in a BR gene IVIA / a / ZUZZ / UI 41 40 in a maize cell, where the guide RNA acts together with an RNA-guided nuclease that creates a chain break at the target site, (b) generating a maize plant from the maize cell and (c) selecting the maize plant that exhibits the semidwarf phenotype. Modality 54. The method of modality 53, which further comprises integrating into the chain break a sequence, where the chain break is a double chain break. Modality 55. The method of modality 54, wherein the sequence is an individual nucleobase selected from the group consisting of guanine, cytosine, adenine, thymine, or uracil. Modality 56. The modality 55 method, where the individual nucleobase is thymine. Mode 57. The method of mode 56, wherein thymine is inserted between nucleotides 5420 and 5421 according to the open reading frame of BR2. Mode 58. The method of mode 54, wherein the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, or at least 10 nucleotides. Modality 59. The method of any of modalities 54, 55, 56 and 58, where the sequence is integrated into a BR2 gene. Modality 60. The method of modality 59, wherein the sequence is integrated within a polynucleotide sequence of the BR2 gene that is selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5' and a combination of these. Modality 61. The modality 54 method, in which the sequence is introduced by means of a donor sequence. Modality 62. The method of modality 61, wherein the sequence is an individual nucleobase selected from the group consisting of guanine, cytosine, adenine, thymine, or uracil. Modality 63. The method of modality 62, where the individual nucleobase is thymine. Mode 64. The method of mode 63, wherein thymine is inserted between nucleotides 5420 and 5421 according to an open reading frame of BR2. Mode 65. The method of mode 61, wherein the sequence comprises at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, to 140 less 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides or at least 20 nucleotides. Modality 66. The method of any of modalities 61, 62, 63 and 65, where the sequence is integrated into a BR2 gene. Modality 67. The method of modality 66, wherein the sequence is integrated within a polynucleotide sequence of the BR2 gene that is selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5' and a combination of these. Modality 68. The method of modality 53 or 54, which further comprises integrating into the chain breaking at least one substitution, at least one inversion, at least one deletion, at least one duplication, or a combination thereof. Mode 69. The method of mode 68, wherein at least one substitution occurs within a polynucleotide sequence of a BR2 gene selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5' and a combination thereof. Modality 70. The method of modality 68, wherein at least one deletion occurs within a polynucleotide sequence of a BR2 gene that is selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5' and a combination thereof. Modality 71. The method of modality 68, wherein at least one duplication occurs within a polynucleotide sequence of a BR2 gene that is selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5' and a combination thereof. Modality 72. The method of any of modalities 53-71, wherein the RNA-guided nuclease is selected from the group consisting of Casi, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Casio, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, their counterparts or modified versions thereof. Modality 73. The method of modality 72, wherein the RNA-guided nuclease is Cas9 comprising a nucleic acid sequence that is established in SEQ ID NO: 1. 140 Mode 74. The method of mode 72 or 73, where the nuclease is guided by RNA comprises an N-terminus nuclear localization sequence, a C-terminus nuclear localization sequence, or both. Modality 75. The method of modality 73, where Cas9 is encoded by a nucleotide sequence at least 85% identical to SEQ ID NO: 1. Modality 76. The method of modality 72, wherein the target site is located within a polynucleotide sequence of the BR2 gene that is selected from the group consisting of a BR2 promoter, Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Intron 1, Intron 2, Intron 3, Intron 4, UTR 3', UTR 5' and a combination of these. Modality 77. The method of modality 76, where the target site is located within Exon 5. Mode 78. The method of mode 77, wherein the target site comprises a nucleotide sequence that is selected from the group consisting of SEQ ID NO. Ί17. Modality 79. The method of modality 77, where the target site comprises a sequence that is established in SEQ ID NO: 15. Modality 80. The modality 79 method, where the guide RNA comprises a sequence that is established in SEQ ID NO: 6. Modality 81. The method of modality 53 to 80, where the plant exhibiting a semi-dwarf phenotype is homozygous, hemizygous, or heterozygous for the BR gene. Modality 82. The method of modality 81, where the plant that exhibits a semi-dwarf phenotype is homozygous for the BR gene. Modality 83. The method of modality 82, wherein the plant exhibiting the semi-dwarf phenotype comprises at least one unnatural brachytic mutation that is selected from the group consisting of a substitution, an insertion, an inversion, a deletion, a duplication, and a combination thereof. Modality 84. The method of modality 83, wherein at least one unnatural brachytic mutation is at least one insertion. Modality 85. The method of modality 84, where at least one insertion occurs within Exon 5 of the BR2 gene. Mode 86. The method of mode 85, wherein the at least one insertion is a single thymine (T) insertion occurring between nucleotides 5420 and 5421 according to the BR2 open reading frame. Modality 87. The method of modality 81, where the plant exhibiting a semi-dwarf phenotype is heterozygous for the BR gene. Modality 88. The method of modality 87, where the plant exhibiting a semi-dwarf phenotype comprises a wild-type BR2 allele. IVIA / a / ZUZZ / UI 4 140 Modality 89. The method of modality 87, where the plant exhibiting a semi-dwarf phenotype comprises a mutating allele of natural BR2. Modality 90. The method of modality 89, where the natural mutant allele BR2 is br2-MX. Modality 91. The method of modality 89, wherein the natural mutant BR2 allele comprises an insertion of a 4.7 kb transposon in Exon 5 of the BR2 gene. Modality 92. The method of any of modalities 89 to 91, wherein the plant exhibiting the semidwarf phenotype comprises at least one unnatural brachytic mutation that is selected from the group consisting of a substitution, an insertion, an inversion, a deletion, a duplication, and a combination thereof. Modality 93. The method of modality 92, wherein at least one unnatural brachytic mutation is at least one insertion. Modality 94. The method of modality 93, where at least one insertion occurs within Exon 5 of the BR2 gene. Mode 95. The method of mode 94, wherein the at least one insertion is a single thymine (T) insertion occurring between nucleotides 5420 and 5421 according to the BR2 open reading frame. Modality 96. The method of modality 53, wherein the height at maturity of the maize plant exhibiting a semidwarf phenotype is reduced by about 10%, 20%, 30%, 40%, 60% or 70% with respect to a control plant that is not provided with the guide RNA and RNA-guided nuclease grown under comparable conditions. Modality 97. The method of modality 53, wherein the yield of the maize plant exhibiting a semidwarf phenotype is equal to or greater than the yield of a control plant not provided with the guide RNA and RNA-guided nuclease grown under comparable conditions. Modality 98. The method of modality 53, where the corn plant exhibiting a semidwarf phenotype requires about 5%, 10%, 15%, 20% or 25% fewer heat units than a control plant that is not provided with guide RNA and RNA-guided nuclease to achieve anthesis. Modality 99. The method of modality 53, wherein the corn plant exhibiting a semidwarf phenotype has a relative maturity of about 10%, 15%, 20%, 25%, 30%, 35%, 40% or 45% less in days than the relative maturity of a control plant that is not provided with the guide RNA and RNA-guided nuclease grown under comparable conditions. Modality 100. A CRISPR-based genome editing system that 140 comprises Cas9 and a guide RNA, where the CRISPR-based genome editing system reduces the activity of a BR gene. Modality 101. The CRISPR-based genome editing system of modality 100, where the BR gene is a BR2 gene. Modality 102. The CRISPR-based genome editing system of modality 101, where Cas9 is encoded by a nucleotide sequence established in SEQ ID NO: 1. Modality 103. The CRISPR-based genome editing system of modality 100, where Cas9 is encoded by a nucleotide sequence at least 85% identical to SEQ ID NO: 1. Modality 104. The CRISPR-based genome editing system of modality 101, where the guide RNA comprises a sequence that is established in SEQ ID NO: 6. Modality 105. A method for cleaving a BR gene in a maize cell, comprising providing a guide RNA and an RNA-guided nuclease in the maize cell, wherein the guide RNA acts together with the RNA-guided nuclease to create a chain break at a target site. Mode 106. The method of mode 105, which further comprises integrating a nucleic acid sequence into the chain break. Modality 107. The method of modality 106, where the RNA-guided nuclease is Cas9. Modality 108. The method of modality 105, wherein the BR gene is a BR2 gene. Modality 109. The method of modality 105, where the target site comprises a sequence that is selected from the group consisting of SEQ ID NO. 7-17. Modality 110. The modality 105 method, where the guide RNA comprises a sequence that is established in SEQ ID NO: 6. Modality 111. The modality 105 method, wherein the RNA-guided nuclease comprises a sequence that is established in SEQ ID NO: 2. Modality 112. The method of any of modalities 105 to 111, wherein the maize cell expresses a truncated BR protein that produces a semi-dwarf phenotype. 140 EXAMPLES EXAMPLE 1 Generation of a corn plant that exhibits the semi-dwarf phenotype Creation of a construct that expresses a recombinant Cas9 An optimized maize version of the Streptococcus thermophilus LMD9 Cas9 protein is cloned into a vector along with the N- and C-terminus nuclear localization signal (NLS) and an internal intron (“recombinant Cas9”). The nucleotide sequence of recombinant Cas9 is established in SEQ ID NO: 1, and its amino acid sequence is established in SEQ ID NO: 2. The N- and C-terminus NLSs are located at nucleotide positions 4–33 and 3586–3615 of SEQ ID NO: 1, respectively, and the internal intron is located at nucleotide positions 507–695 of SEQ ID NO: 1. The recombinant Cas9 protein is expressed under the Dahlia mosaic virus (DaMV) promoter (SEQ ID NO: 3). The Cas9 protein is able to bind to a protospacer-adjacent motif (PAM) that has a DNA sequence of 5AGAA'3. The PAM AGAA sequence functions as a binding signal for Cas9, and the presence of this sequence is necessary for recombinant Cas9-mediated DNA cleavage. Search for BR2 gene target sites The BR2 gene sequence of maize is analyzed to detect potential PAM AGAA sequences with an N-20-NNAGAA configuration. This sequence functions as the binding site for recombinant Cas9. Therefore, 11 target guide RNA (gRNA) sequences adjacent to a PAM AGAA sequence are selected, as shown in the table below: TABLE 1 BR2 gene target sequence 140 gRNA SEQ ID NO Target gRNA sequence SEQ ID NO (sgRNA) Br2gRNA1 7 TACAGTCCGCCGATCATGAC 34 Br2gRNA2 8 TGGGCGGCTGCTCGGTCTCC 35 Br2gRNA3 9 TCCGCCGGCGCCAATGACAG 36 Br2gRNA4 10 GAGGCCCGCACGTCGGTGTC 37 Br2gRNA5 11 TTCCCGGCGGGCACGCTCAG 38 Br2gRNA6 12 ATCGCCTGGTTCGACGCGGA 39 Br2gRNA7 13 GACCGCATCTCCGTCATCGT 40 Br2gRNA8 14 GTCGTGGGCGCCACCGTGCT 41 Br2gRNA9 15 TGCGCGGCCTCCAGGTCCCC 6 Br2gRNAo1 16 ATGTCCGGCCGCGACGGGTA 42 Br2gRNAo2 17 CTGTTCGCGACGAGCATCAG 43 The target sequence of each of the preceding BR2 gRNAs operatively binds to a promoter sequence (SEQ ID NO: 4) at its 5' end and to a structural guide gRNA sequence at its 3' end (SEQ ID NO: 5). The resulting complete single guide RNA (sgRNA) sequences are those listed in the right-hand column of Table 1. One of the preceding target gRNA sequences, Br2gRNA9 as stated in SEQ ID NO: 15, is operationally linked to a promoter sequence (SEQ ID NO: 4) at its 5' end and to a structural guide gRNA sequence at its 3' end (SEQ ID NO: 5). The resulting sequence (SEQ ID NO: 6) is expressed via a vector in maize cells, as described below. Other gRNA sequences for the BR2 gene are those listed in SEQ ID NO: 24-26. The complete sequences, including a promoter (SEQ ID NO: 4) at the 5' end of each SEQ ID NO: 24-26, are listed in SEQ ID NO: 31-33, respectively. The sequences listed in SEQ ID NO: 20-23 are gRNA sequences capable of binding to a maize-optimized version of Streptococcus pyogenes Cas9 and targeting the BR2 gene for genome editing. The expression cassette sequences, including a promoter (SEQ ID NO: 4) at the 5' end of each SEQ ID NO: 20-23, are listed in SEQ ID NO: 27-30, respectively. Evaluation of the insertion of a double-stranded DNA fragment with blunt ends Functional rRNAs for the CRISPR / Cas9 system were evaluated to determine their targeting efficiency in inserting blunt-ended double-stranded DNA (dsDNA) into the BR2 gene cut site. If recombinant Cas9 possesses endonuclease activity and introduces a double-strand break (DSB) in the protospacer of the selected BR2 target site, the endogenous maize non-homologous end joining (NHEJ) DNA repair system inserts the blunt-ended dsDNA into the DSB. The 11 sgRNAs in Table I are selected and expressed in a vector using the promoter as described in SEQ ID NO: 4. Protoplast evaluations of Cas9 / gRNA efficiency are performed as follows: maize leaf protoplasts are transformed with (1) 0.8 pmol of a plasmid expressing recombinant Cas9 protein, (2) 1.6 pmol of gRNA plasmid, and (3) 50 pmol of previously hybridized blunt-ended cdDNA (SEQ ID NO: 18 and 19). To assess transformation efficiency, 2.5 µg of a construct encoding green fluorescent protein (GFP) is also included in the protoplast transformation. A standard PEG-mediated protocol is used to transform aliquots of maize leaf protoplast suspensions containing approximately 320,000 cells. Two days later, an aliquot of the transformed maize leaf protoplasts was collected to calculate the transfection frequency using the PE Operetta® imaging system (PerkinElmer, Waltham, MA), which calculates the ratio of GFP-positive cells to total cells. Omitting the recombinant Cas9 expression cassette during maize protoplast transformation served as a negative control. The protoplasts were harvested 48 hours post-transfection and analyzed for the insertion of the blunt-ended double-stranded DNA fragment at the target sites using POR with an oligospecific primer and a gene-specific primer. Two sequences were identified as capable of inserting blunt-ended cDNA into the corresponding target sites of the BR2 gene. The target sequence (SEQ ID NO: 15) with the fewest off-target effects for stable transformation was selected (the complete sequence for expression is the one established in SEQ ID NO: 6). Transformation and regeneration of corn plants Standard Agrobacterium tumefaciens-mediated transformation is used to transform an O1DKD2 maize plant with Cas9 and γRNA using a binary transfer DNA (T-DNA) vector system. Specifically, a binary vector containing the glyphosate resistance marker CP4 and sequences encoding recombinant Cas9 and γRNA (SEQ ID NO: 6) is created under the control of the cauliflower mosaic virus (CaMV) 35S promoter. A standard auxiliary vector is also created. Both vectors are immobilized on competent Agrobacterium tumefaciens strains. Through non-homologous end joining (NHEJ), a single nucleobase thymine (T) is added in Exon 5 of the BR2 gene between nucleotides number 5420 and 5421, according to the BR2 open reading frame (ORF), or between nucleotides number 2907 and 2908 of the ORF after intron removal, thereby creating a premature stop codon, leading to a truncated BR2 protein. The stem tips of transformed O1DKD2 maize plants inoculated with Agrobacterium tumefaciens strains for transgenic plants are selected using glyphosate-containing medium. The regenerated seedlings are then transferred to containers and planted in soil in the growth room. Selection of semi-dwarf corn plants The semidwarf trait associated with the BR2 gene in maize is transmitted via a recessive allele. Selection of transgenic maize plants with a semidwarf trait is carried out by breeding and self-crossing the first backcross generation to determine which plants carry the recessive alleles. Further evaluations of the progeny in subsequent backcross generations are performed to determine the presence of the locus of interest. The final backcross generation is typically self-crossed to provide purebred progeny for the truncated BR2 genes. A naturally occurring BR2 mutant exhibiting a semidwarf phenotype is used as a control. The naturally occurring BR2 mutant comprises a br2-MX allele. As shown in Figure 2, Intron 4 contains multiple insertions and deletions. A 4.7 kb insertion in Exon 5 introduces a premature stop codon. Semi-dwarf phenotype Genetically edited maize plants exhibit a semi-dwarf phenotype, as shown in Figures 3-6. Figure 3 shows a reduced (semi-dwarf) plant height of a genome-edited R1 maize plant at a V6 growth stage expressing a truncated BR2 protein due to single T insertion in Exon 5, compared to a wild-type control plant. Figure 4 shows a reduced (semi-dwarf) plant height of a gene-edited BR2 01DKD2 maize plant expressing a truncated BR2 protein due to single T insertion in Exon 5, compared to a wild-type control. Figure 5A shows the reduced (semi-dwarf) plant height of a gene-edited BR2 maize plant expressing a truncated BR2 protein due to the insertion of a single T in Exon 5, compared to the natural br2-MX mutant and a wild-type control. The reduction in plant height of the gene-edited plant is similar to that of the natural br2-MX mutant plant. Both plants show a significant reduction in height compared to the wild-type control. Figure 5B shows reduced plant height in a homozygous BR2 genome-edited plant expressing a truncated BR2 protein due to the insertion of a single T in Exon 5, compared to a heterozygous BR2 genome-edited plant, a negative-segregating BR2 genome-edited plant, and a wild-type control. Only the homozygous BR2 genome-edited plant exhibits the semi-dwarf phenotype, indicating that this trait is inherited recessively. Figure 6 shows shorter internodes of a gene-edited BR2 maize plant expressing a truncated BR2 protein due to single T insertion in Exon 5, compared to a wild-type BR2 natural control. EXAMPLE 2 Introduction of a brachytic allele BR2 to produce a new brachytic variety A maize plant comprising a brachytic allele described herein is crossed with another non-brachytic maize line comprising a desirable trait (e.g., improved performance under drought, cold, or heat stress conditions). The Fi progeny plants from this cross are analyzed for the insertion of a single thymine (T) in Exon 5 of the BR2 gene between nucleotides 5420 and 5421, according to the BR2 gene's open frequency reference (ORF). One plant from the selected Fi progeny is then backcrossed with the original non-brachytic maize line comprising the desired trait (recurrent parent). Plants from the BC1 generation are also genotyped for the single T insertion to select for the brachytic allele. After multiple rounds of backcrossing (e.g., 5–7 generations), a new brachytic maize line comprising the desirable trait is obtained in the elite recurrent parent line. EXAMPLE 3 Generation of hybrid maize plants br2 Through plant breeding, hybrid br2 maize plants are generated by crossing a non-br2 / wild type or a natural br2 mutant (br2-MX) with an edited mutant 140 br2 genomics (br2-GE). The hybrid maize plants grown and measured in field experiments described herein are summarized in Table 2 below: TABLE 2 Controlled br2y hybrid corn plants br2 hybrids (named by two inbred parents flanking u+” J Genotype at the BR2 locus 01DKD2-ZAB-R1+CV666824 br2-GE / br2-MX CV648265+CV666824 br2-MX / br2-MX 01DKD2-ZAB-R1+CV126318 br2-GE / \NT 01DKD2+CV126318 WT / WT CV648265+CV126318 br2-MX / WT 01DKD2+CV666824 WT / br2-MX It is worth noting that 01DKD2-ZAB-R1 denotes br2 with genome editing and a single T insertion in Exon 5 of the BR2 gene between nucleotides 5420 and 5421 of the BR2 ORE in maize (br2-GE). CV666824 and CV648265 denote the same br2 mutant from Mexico in which a 4.7 kb transposon is inserted into Exon 5 of the BR2 gene (br2-MX), resulting in a premature stop codon and a putative truncated BR2 protein of 1234 amino acid residues. 01DKD2 and CV126318 are non-brachytic (wild-type) inbred maize plants. EXAMPLE 4 Phenotype of hybrid maize plants br2 - field experiments The br2 hybrid corn plants are planted in a field under natural disease conditions using standard agronomic practices. Specifically, eight rows of corn plants are planted (30 inches between rows) with 12 corn plants per row. Plant height is measured to the top of the ligule leaf at the R3 stage (“PHTR3”), and ear height is measured to the ear node at the R3 stage (“EHTR3”). Stalk diameter is measured two leaves below the ear at the R3 stage (“STDIEM2R3”). Other traits related to flowering or yield components are also measured as follows: time in days between pollen dispersal and silking (female-male flowering interval or “ASI”); time in days to 50% pollen dispersal at stage R1 (“P50DR1”); time in days to 50% silking visibility at stage R1 (“S50DR1”); ear diameter measured by image capture at stage R6 (“EDR6”); ear area (one side measured by image capture) at stage R6 (“EAIMAR6”); ear automation volume at stage R6 (“EAVR6”); calculated ear volume at stage R6 (“ECVR6”); percentage of ear voids at stage R6 (“EVPCTR6”); ear tip voids at stage R6 (“ETVR6”); percentage of void in the tip of the cob (“ETVPCR6”);ear length measured by image capture at stage R6 (“ELENR6”); individual kernel weight at stage R6 (“SKWTR6”); kernels per unit area at stage R6 (“KARR6”); and ear void measured by image capture at stage R6 (“EVR6”).; TABLE 3 Reduction of the plant height in 01DKD2-ZAB-R1+CV666824 Trait Number of rows 01DKD2-ZABR1+ CV666824 (average) CV648265+ CV666824 (average) Average difference p-value Plant height traits EHTR3 8 21.9 26.7 4.8 0.00 PHTR3 8 48 54.2 6.2 0.00 Yield or flowering component traits ASI 8 36.6 30.5 -6.1 0.48 P50DR1 8 57.5 57.6 0.1 0.66 S50DR1 8 58.5 58.6 0.1 0.69 EDR6 14 1.9 1.8 -0.1 0.67 EAIMAR6 14 11.2 11.0 -0.2 0.60 EAVR6 14 14.7 14.4 -0.3 0.55 ECVR6 14 19.4 19.1 -0.3 0.63 As shown in Table 3 above, 01 DKD2-ZAB-R1+CV666824 (comprising one br2-GE allele and one br2-MX natural mutant allele) has an average ear height reduction (EHTR3) of 4.8 inches and an average plant height reduction (PHTR3) of 6.2 inches, compared to CV648265+CV666824 (comprising two of the br2-MX natural mutant alleles). Both the ear height reduction and the plant height reduction are statistically significant with a p-value < 0.01. On the other hand, no statistically significant differences were observed for the yield or flowering component traits, which include ASI, P50DR1, S50DR1, EDR6, EAIMAR6, EAVR6 and ECVR6. TABLE 4 Reduction in plant height and increase in stem diameter in 01DKD2-ZABR1+CV666824 Trait Number of rows 01DKD2-Z ABRI + CV666824 (average) 01DKD2+ CV666824 (average) Average difference P-value Plant height / diameter traits EHTR3 6 21.9 45.9 24.0 0.00 PHTR3 6 48.0 82.6 34.6 0.00 STDIEM2R3 6 1.3 1.0 -0.3 0.00 Yield or flowering component traits EDR6 10 1.9 1.8 -0.1 0.56 EVPCTR6 10 40.3 38.6 -1.7 0.35 EAIMAR6 10 11.2 10.7 -0.5 0.14 ETVR6 10 1.5 1.5 0.0 0.17 ETVPCR6 10 51.9 51.8 -0.1 0.99 EAVR6 10 14.7 14.0 -0.7 0.16 ELENR6 10 7.2 6.9 -0.3 0.13 EVR6 10 4.4 4.1 -0.3 0.07 ECVR6 10 19.4 18.7 -0.7 0.27 As shown in Table 4 above, 01DKD2-ZAB-R1+CV666824 (comprising a br2-GE allele and a naturally occurring mutant allele of br2-MX) has an average ear height reduction (EHTR3) of 24 inches and an average plant height reduction (PHTR3) of 34.6 inches, compared to 01DKD2+CV666824 (comprising a wild-type allele and a naturally occurring mutant allele of br2-MX). Furthermore, 01DKD2ZAB-R1+CV666824 has an average 0.3-inch increase in stem diameter (STDIEM2R3) compared to 01DKD2+CV666824. All of these measurements are statistically significant with a p-value < 0.01. On the other hand, no statistically significant differences were observed for the yield or flowering component traits, which include EDR6, EVPCTR6, EAIMAR6, ETVR6, ETVPCR6, EAVR6, ELENR6, EVR6 and ECVR6. TABLE 5 Reduction of the plant height in 01DKD2-ZAB-R1+CV126318 Trait Number of rows 01DKD2-ZAB- R1+ CV126318 (average) 01DKD2+ CV126318 (average) Average difference p-value Plant height traits EHTR3 8 43.6 45.6 2.0 0.04 PHTR3 8 83.5 85.7 2.2 0.02 Yield or flowering component traits ASI 8 11.3 18.9 7.6 0.32 P50DR1 8 59.3 59.0 -0.3 0.43 S50DR1 8 59.6 59.6 0.0 0.99 KPER6 9 473.4 468.0 -5.4 0.83 ETVPCR6 12 48.5 49.3 0.8 0.71 EAVR6 12 14.4 14.8 0.4 0.52 ELENR6 12 6.8 6.9 0.1 0.31 EDR6 12 1.9 1.9 0.0 0.88 EAIMAR6 12 10.7 11.0 0.3 0.40 SKWTR6 9 0.0 0.0 0.0 0.68 ETVR6 12 1.4 1.4 0.0 0.32 ECVR6 12 19.3 19.7 0.4 0.61 KARR6 9 337.5 312.4 -25.1 0.34 EVPCTR6 12 38.3 38.2 -0.1 0.97 EVR6 12 4.0 4.1 0.1 0.50 As shown in Table 5 above, 01DKD2-ZAB-R1+CV126318 (comprising a br2-GE allele and a wild-type BR2 allele) has an average ear height reduction (EHTR3) of 2.0 inches and an average plant height reduction (PHTR3) of 2.2 inches, compared to 01DKD2+CV126318 (comprising wild-type BR2 alleles). These measurements are statistically significant with a p-value < 0.04. On the other hand, no statistically significant differences were observed for the yield or flowering component traits, which include ASI, P50DR1, S50DR1, KPER6, ETVPCR6, EAVR6, ELENR6, EDR6, EAIMAR6, SKWTR6, ETVR6, ECVR6, KARR6, EVPCTR6 and EVR6.

Claims

1. A maize plant, characterized in that it comprises at least one unnatural brachytic mutation, wherein the maize plant exhibits a semidwarf phenotype compared to a control maize plant that does not comprise at least one unnatural brachytic mutation when grown under comparable conditions.

2. The maize plant according to claim 1, characterized in that at least one non-natural brachytic mutation occurs in a BR gene that reduces BR gene activity and is not introduced by a transposon, and wherein the maize plant does not comprise a brachytic allele br2-23o SNP5259.

3. The maize plant according to claim 2, characterized in that the BR gene is a BR2 gene.

4. The maize plant according to claim 3, characterized in that at least one unnatural brachytic mutation is selected from the group consisting of a substitution, an insertion, an inversion, a deletion, a duplication, and a combination thereof.

5. The maize plant according to claim 4, characterized in that the at least one unnatural brachytic mutation is an insertion of a single thymine (T) between nucleotides 5420 and 5421 according to the open reading frame of BR2.

6. The maize plant according to any of claims 1 to 5, characterized in that it is heterozygous for at least one unnatural brachytic mutation.

7. The maize plant according to claim 6, characterized in that it comprises a mutant allele of natural BR2.

8. The maize plant according to claim 7, characterized in that the mutant allele of natural BR2 is br2-MX.

9. The maize plant according to claim 8, characterized in that the natural BR2 mutant allele comprises an insertion of a 4.7 kb transposon in exon 5 of the BR2 gene.

10. The maize plant according to any of claims 7 to 9, characterized in that it comprises at least one non-natural brachytic mutation selected from the group consisting of a substitution, an insertion, an inversion, a deletion, a duplication, and a combination thereof.

11. The maize plant according to claim 10, characterized in that the at least one unnatural brachytic mutation is an insertion of a single thymine (T) between nucleotides 5420 and 5421 according to the open reading frame of BR2.

12. The maize plant according to any of claims 1 to 5, characterized in that it is homozygous for at least one unnatural brachytic mutation.