COMPOSITIONS AND METHODS FOR THE IDENTIFICATION OF ANTIGEN-SPECIFIC T CELLS
Patent Information
- Application Number
- MX2021009640
- Authority / Receiving Office
- MX · MX
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-07-19
- Filing Date
- 2021-08-11
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2040-02-12
AI Technical Summary
Current methods for producing peptide-MHC multimers are laborious, yield low quantities of properly folded complexes, have poor exchange efficiency, and are not robust for high-throughput isolation of patient-specific neoepitope-targeted TCRs, especially for diverse MHC haplotypes.
A method using distinct sets of particles with unique antigen peptides and barcodes to identify and isolate T cell receptors, allowing for high-throughput identification of antigen specificity by calculating ratios of bound barcodes.
Enables efficient and robust identification of antigen-specific T cells, facilitating personalized TCR gene therapies by improving the production and specificity of peptide-MHC multimers for diverse MHC haplotypes.
Abstract
Description
COMPOSITIONS AND METHODS FOR THE IDENTIFICATION OF ANTIGEN-SPECIFIC T CELLS Cross Reference to Related Applications
[001] This Application claims priority to United States of America Provisional Application No.: 62 / 804,649, filed on February 12, 2019, United States of America Provisional Application No.: 62 / 826,823, filed on February 29, 2019. United States of America Provisional Request No.: 62 / 876,380, filed on July 19, 2019, and United States of America Provisional Request No.: 62 / 867,165, filed on June 26, 2019, the contents of which are incorporated by reference in their entirety, and to which priority is claimed.
[002] This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. This ASCII copy, created on January 21, 2020, is called 087520_0125_SL.txt and is 292,725 bytes in size. Background of the Invention
[003] T cells are the primary mediators of adaptive immunity. Directed by the specificity of each T cell's unique T cell receptor (TCR), T cells regulate autoimmunity, help activate B cells and innate effectors, and directly kill infected and cancer cells in a precisely targeted manner. Each TCR recognizes a ligand presented by a major histocompatibility complex (MHC) molecule on target cells. The identification of relevant peptide-MHC complex ligands plays a role in understanding immune responses to tumors and pathogens. MHC complex ligands are also valuable in understanding responses to self and dietary antigens. This understanding allows for clinically beneficial immunotherapies (eg, TCR gene transfer and vaccines) that initiate, amplify, or attenuate immune responses to target antigens.
[004] Mutated neoepitopes are important targets of endogenous and modified immune responses to cancer. Neoepitope-reactive tumor-infiltrating leukocytes (TILs) are present in the endogenous repertoire and tumors regress after adoptive transfer. Similarly, tumor mutational burden predicts the clinical effectiveness of CTLA-4 or PD-1 blockade, suggesting that these checkpoint inhibition strategies affect tumor regression by releasing neoepitope-reactive T cells. Because neoepitopes result from somatic mutations in tumor cells, they are generally not presented by thymic epithelial cells to induce central tolerance. Consequently, T cell responses directed to these neoepitopes are tumor-specific, likely high-affinity, and patient-specific (ie, private). Clinically, this presents both an opportunity and a challenge: neoepitopes are excellent targets for immunotherapy, but TCR isolation methods must be sufficiently high-throughput to allow therapeutic application on a clinically useful scale.
[005] There is an unmet need for fast and robust TCR ligand discovery technologies for both basic and translational research. Peptide-MHC multimers allow sorting of T cells of 7Π7 / 3 / ΥΙΛΙ according to the antigenic specificity of their TCRs, an important step in the isolation of tumor-specific TCRs for gene therapy. A current standard peptide-MHC production protocol begins with the solid phase synthesis of the peptide ligands of interest. In parallel, the universal microglobul I i na β2 and the relevant MHC class I molecules are heterologically expressed in E. coli, producing misfolded inclusion bodies. Each peptide is added to a refolding reaction containing β2-microglobulin and the relevant MHC class I molecule. Finally, the correctly refolded portion of the ternary complex can be purified and formulated for use in the production of peptide-MHC multimers. To facilitate the parallel production of a particular MHC molecule with many different peptide ligands, Schumacher and colleagues devised a photoscleavable peptide that binds to a particular MHC molecule as a conditional ligand. A single refolding reaction is performed to generate that MHC molecule bound to its conditional ligand. After exposure to UV light, the conditional ligand is cleaved and exchanged for a desired peptide present in excess. Many of these exchange reactions can be performed in parallel, allowing the construction of a library of pMHC for that particular MHC allele. Even so, this cutting-edge technology has challenging limitations. First, the production, purification, and refolding of MHC molecules expressed in E. coli inclusion bodies is laborious and produces low yields of properly folded peptide-MHC complex. Second, the turnaround time (weeks) for synthesis of commercial peptides is at odds with optimal time scales in the context of on-demand personalized TCR gene therapies targeting patient-specific neoepitopes. Third, many predicted ligands cannot be used to screen T cells via this approach because the biophysical properties (eg, hydrophobicity) of the peptide preclude its synthesis or exchange. Fourth, the exchange efficiency is generally poor (<50% exchange efficiency for most predicted HLA-binding peptides). The resulting mixture of correctly folded MHC swapped and misfolded unligated MHC results in low signal to noise multimer staining, an issue that is exacerbated when T cells are examined with a multiplexed set of peptide-MHC reagents. Fifth, the design and validation of conditional ligands for each new MHC allele is a laborious and not robust undertaking. As the MHC locus is the most multi-allelic locus in the human genome, this is a major obstacle to implementing neoepitope-targeted gene therapies across patients of diverse MHC haplotypes. Taken together, these limitations underscore the need for novel technologies in this field. Various compositions and processes for producing peptide-MHC multimers that address these limitations are described herein. Brief Description of the Invention
[006] The present disclosure provides compositions and methods for identifying neoepitopes, identifying and isolating T cell receptors, engineering primary cells to express specific T cell receptors, expanding modified T cells, and for the treatment of disorders using cell therapy. In various embodiments, the present invention provides improved cell therapy compositions and methods for identifying neoepitopes, identifying and isolating T cell receptors, engineering primary cells to express specific T cell receptors, expanding modified T cells, and for the treatment of diseases, disorders , and proliferative conditions.
[007] In one aspect, there is provided herein a method of identifying the antigen specificity of a T cell, comprising providing two or more distinct sets of particles, each distinct set of particles comprising a unique antigen peptide, and at least one defined barcode operatively associated with the identity of the antigen peptide, and each set comprises a first particle comprising a first identification mark and a second particle comprising a second identification mark other than the first identification mark; providing a sample known or suspected to comprise one or more T cells; contacting the sample with the two or more sets of particles, wherein the contacting comprises providing conditions sufficient for an individual T cell to bind to the single antigen of at least one set of particles; isolating one or more T cells that bind to the set of particles by their associated first and second identification marks; performing an assay to identify one or more barcodes bound to the set of particles that bind to the isolated T cell; determining a ratio of the barcodes bound to the isolated T cell wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a distinct barcode and dividing the first number copy by second copy number; and identifying the antigen specificity of the T cell based on the relationship.
[008] In one aspect, provided herein is a method of identifying the antigen specificity of a T cell, comprising: obtaining or having obtained at least one antigen-specific T cell bound to two or more distinct sets of particles, each distinct set of particles comprising a unique antigen peptide and at least one defined barcode operatively associated with the identity of the antigen peptide, wherein each set comprises a first particle comprising a first identification mark and a second particle containing it comprises a second identification mark different from the first identification mark; performing or having performed at least one assay to identify one or more barcodes detectably bound to the set of particles that binds to the T cell; and determining or having determined a ratio of the barcodes bound to the T cell that identifies the antigen specificity of the T cell, wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a different barcode and divide the first copy number by the second number.
[009] In one aspect, there is provided herein a method of identifying the antigen specificity of a T cell, comprising: obtaining or having obtained a data set comprising data associated with one or more interlinked barcodes detectable to the set of particles that binds, directly or indirectly, to the T cell, wherein the one or more barcodes are each operatively associated with a unique antigen peptide; and determining or having determined a ratio of the barcodes bound to the T cell that identifies the antigen specificity of the T cell, wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a different barcode and by dividing the first copy number by the second copy number.
[0010] In some embodiments, the data set comprises the one or more barcodes and the one or more barcode copy numbers. 7Π7 / 3 / ΥΙΛΙ
[0011] In some embodiments, the unique antigen peptide is the same for each different set of particles.
[0012] In some embodiments, the first particle comprises a first barcode and the second particle comprises a second barcode distinct from the first barcode, wherein the first and second barcodes are associated with antigen identity.
[0013] In some embodiments, the ratio of the barcodes corresponds to the antigen specificity of the isolated T cell.
[0014] In some embodiments, the isolated T cell is identified as an antigen-specific T cell if the barcode ratio is above a threshold.
[0015] In some embodiments, the threshold is at least or greater than 2.
[0016] In some embodiments, the threshold is at least or greater than 5.
[0017] In some embodiments, the threshold is at least or greater than 10.
[0018] In some embodiments, the threshold is between 2 and 5.
[0019] In some embodiments, the threshold is between 5 and 10.
[0020] In some embodiments, the threshold is at least or greater than 2,3, 4, 5, 6, 7, 8, 9,10, 2-5, 3-6, 4-7, 5-8, 5 -10, 7-10, or greater than 10.
[0021] In some embodiments, the assay is a nucleotide-based assay.
[0022] In some embodiments, the nucleotide-based assay is a POR assay, an RT-PCR assay, a sequencing assay, or a hybridization assay.
[0023] In some embodiments, the assay determines the sequences of the one or more barcodes.
[0024] In some embodiments, the assay determines the sequences and copy numbers of the one or more barcodes.
[0025] In some embodiments, the method further comprises obtaining the T cell receptor (TCR) CDR sequences.
[0026] In some embodiments, the method further comprises obtaining the alpha and beta TCR chain sequences.
[0027] In some embodiments, the T cell antigen specificity each comprises (a) the antigen peptide sequence and (b) the bound T cell TCR sequences.
[0028] In some embodiments, the first identification mark of each first particle is the same in each set.
[0029] In some embodiments, the second identification mark of every second particle is the same in every set.
[0030] In some embodiments, the first identification mark of each first particle is the same in each set, and wherein the second identification mark of each second particle is the same in each set.
[0031] In some embodiments, the first and second identification labels are fluorophores.
[0032] In some embodiments, the first fluorophore is allophycocyanin (APC).
[0033] In some embodiments, the second fluorophore is phycoerythrin (PE). ΖηΖ / 3 / ΥΙΛΙ
[0034] In some embodiments, the set of particles comprises a third particle comprising a third barcode distinct from the first and second barcodes, wherein the first, second, and third barcodes are associated with the identity of the antigen .
[0035] In some embodiments, the single antigen peptide is selected from the group consisting of: a tumor antigen peptide, a neoantigen peptide, a tumor neoantigen peptide, a viral antigen peptide, a bacterial antigen peptide , a phosphoantigen peptide, and a microbial antigen peptide.
[0036] In some embodiments, the single antigen peptide is a neoantigen peptide.
[0037] In some embodiments, where the neoantigen is derived from a subject's tumor sequencing data used to identify one or more somatic mutations present in the data relative to wild type.
[0038] In some embodiments, an in silico predictive algorithm is used to determine the neoantigen.
[0039] In some embodiments, the predictive algorithm further comprises an MHC binding algorithm to predict binding between the neoantigen and an MHC peptide.
[0040] In some embodiments, the sample is selected from a blood sample, a bone marrow sample, a tissue sample, a tumor sample, or a peripheral blood mononuclear cell (PBMC) sample.
[0041] In some embodiments, the sample is a PBMC sample.
[0042] In some embodiments, the sample is a tumor sample.
[0043] In some embodiments, the sample is a bone marrow sample.
[0044] In some embodiments, the T cell is a human T cell.
[0045] In some embodiments, the T cell is a CD8+ T cell.
[0046] In some embodiments, the CD8+ T cell is a human CD8+ T cell.
[0047] In some embodiments, the method comprises a library of distinct particle sets.
[0048] In some embodiments, the library comprises 2 to 500 distinct particle sets.
[0049] In some embodiments, the library comprises at least 60 distinct particle sets.
[0050] In some embodiments, each particle comprises an MHC peptide.
[0051] In some embodiments, the MHC peptide is a mammalian MHC peptide.
[0052] In some embodiments, the MHC peptide is a human MHC peptide.
[0053] In some embodiments, the MHC peptide is an HLA class I peptide.
[0054] In some embodiments, the HLA peptide comprises an HLA-A, HLA-B, or HLA-C peptide.
[0055] In some embodiments, the HLA peptide comprises HLA-A*01:01, HLA-A*02:01, HLA-A*03:01, HLA-A*24:02, HLA-A*30: 02, HLA-A*31:01, HLA-A*32:01, HLA-A*33:01, HLA-A*68:01, HLA-A*11:01, HLA-A*23:01, HLA-A*30:01, HLAA*33:03, HLA-A*25:01, HLA-A*26:01, HLA-A*29:02, HLA-A*68:02, HLA-B* 07:02, HLA-B*14:02, HLA-B*18:01, HLAB*27:02, HLA-B*39:01, HLA-B*40:01, HLA-B*44:02, HLA-B*46:01, HLA-B*50:01, HLA-B*57:01, HLA-B*58:01, HLAB*08:01, HLA-B*15:01, HLA-B* 15:03, HLA-B*35:01, HLA-B*40:02, HLA-B*42:01, HLA-B*44:03, HLA-B*51:01, HLAB*53:01, HLA-B*13:02, HLA-B*15:07, HLA-B*27:05, HLA-B*35:03, HLA-B*37:01, HLA-B*38:01, HLA- B*41:02, HLAB*44:05, HLA-B*49:01, HLA-B*52:01, HLA-B*55:01, HLA-C*02:02, HLA-C*03: 04, HLA-C*05:01, HLA-C*07:01, HLA C*01:02, HLA-C*04:01, HLA-C*06:02, HLA-C*07:02, HLA-C*16:01, HLA-C*03:03, HLA-C* 07:04, HLA-C*08:01, HLAC*08:02, HLA-C*12:02, HLA-C*12:03, HLA-C*14:02, HLA-C*15:02, or HLA-C*17:01.
[0056] In some embodiments, the HLA peptide comprises a Y84A mutation or a Y84C mutation.
[0057] In some embodiments, each particle comprises an HLA I peptide and a β2Μ peptide.
[0058] In some embodiments, the β2Μ peptide is a mammalian β2Μ peptide.
[0059] In some embodiments, the β2Μ peptide is a human β2Μ peptide.
[0060] In some embodiments, the β2Μ peptide comprises a mutation to allow or increase binding to thiol dyes.
[0061] In some embodiments, the mutation is S88C.
[0062] In some embodiments, each particle comprises a polypeptide comprising, in an amino to carboxyl terminus orientation, (i) the antigen peptide, (ii) a β2Μ peptide, and (iii) an MHC peptide.
[0063] In some embodiments, the polypeptide further comprises a first universal target peptide before the antigen peptide, and a second universal target peptide that is distinct from the first universal target peptide between the antigen peptide and the β2Μ peptide.
[0064] In some embodiments, each particle comprises a polypeptide comprising, in an amino to carboxyl terminus orientation, (i) a first universal target peptide, (ii) the antigen peptide, (ii) a second peptide universal target that is other than the first universal target peptide, (iv) a β2Μ peptide, and (v) an MHC peptide.
[0065] In some embodiments, the antigen peptide is 7-15 amino acids, 7-10, 8-9, 7, 8,9,10,11,12,13,14, or 15 amino acids in length.
[0066] In some embodiments, the polypeptide comprising the single antigen peptide is biotinylated.
[0067] In some embodiments, each particle in a distinct set of particles comprises a streptavidin core and at least one copy of the single antigen peptide.
[0068] In some embodiments, the particle comprises one, two, three, or four copies of the single antigen peptide.
[0069] In one aspect, provided herein is a library comprising two or more distinct sets of particles each comprising a unique antigen peptide and a defined barcode operatively associated with the identity of the antigen peptide, wherein each set comprises a first particle comprising a first identification mark and a second particle comprising a second identification mark distinct from the first identification mark.
[0070] In some embodiments, the identification tag is a fluorophore.
[0071] In some embodiments, the fluorophore is APC or PE.
[0072] In one aspect, provided herein is a particle comprising a tetrameric solid support attached to a single barcode and three or fewer attached polypeptide molecules, the comprising polypeptide molecules in an amino to carboxyl terminus orientation. , (i) an antigenic peptide, (ii) a β2Μ peptide, and (iii) an MHC peptide, wherein the barcode is operatively associated with the identity of the antigen peptide.
[0073] In some embodiments, the polypeptide further comprises a first universal target peptide before the target peptide. ΖηΖ / 3 / ΥΙΛΙ antigen, and a second universal target peptide that is distinct from the first universal target peptide between the antigen peptide and the β2Μ peptide.
[0074] In some embodiments, the solid support is a streptavidin core.
[0075] In some embodiments, the polypeptide molecules are biotinylated.
[0076] In some embodiments, the polypeptide molecules are attached to the streptavidin core via a biotin-streptavidin interaction.
[0077] In some embodiments, the particle further comprises an identification mark.
[0078] In some embodiments, the identification tag is a fluorophore.
[0079] In some embodiments, the fluorophore is APC or PE.
[0080] In one aspect, provided herein is a library comprising the particles, wherein the library comprises two or more distinct particles, wherein each distinct particle comprises a single antigen peptide.
[0081] In one aspect, there is provided herein a method of monitoring an immune repertoire in a subject, comprising: providing two or more distinct sets of particles, each distinct set of particles comprising a unique antigen peptide and at least a defined barcode operatively associated with the identity of the antigen peptide, and each set comprises a first particle comprising a first identification mark and a second particle comprising a second identification mark other than the first identification mark; providing a sample known or suspected to comprise one or more T cells, wherein the sample is obtained from a subject over time; contacting the sample with the two or more sets of particles, wherein the contacting comprises providing conditions sufficient for an individual T cell to bind to the single antigen of at least one set of particles; isolating one or more T cells associated with the first and second identification marks; performing an assay to identify one or more barcodes bound to the isolated T cell; determining a ratio of the barcodes bound to the isolated T cell wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a barcode other than step (e) and dividing the first copy number by the second copy number; identifying the antigen specificity of the T cell based on the ratio; and monitoring changes in the antigen-specific T cells identified by the method in the subject.
[0082] In some embodiments, the first and second identification labels are fluorophores.
[0083] In some embodiments, the fluorophore is APC or PE.
[0084] In one aspect, a method of monitoring an immune repertoire in a subject is provided herein, comprising obtaining or having obtained a data set comprising data associated with one or more detectably linked barcodes, directly or indirectly, to the T cell, wherein the one or more barcodes are each operatively associated with a unique antigen peptide; determining or having determined a ratio of the barcodes bound to the T cell that identifies the antigen specificity of the T cell, wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a barcode other than step (a) and divide the first copy number by the second number copy 7f\7.nrVW; identifying a unique antigen peptide sequence bound to an antigen-specific T cell; and monitoring changes in the antigen-specific T cells identified by the method in the subject.
[0085] In some embodiments, the data set comprises the one or more barcodes and the one or more barcode copy numbers.
[0086] In some embodiments, the unique antigen peptide is the same for each different set of particles.
[0087] In some embodiments, monitoring changes in T cells comprises administering to the subject a soluble labeled antigen-specific TCR.
[0088] In some embodiments, the subject is administered immunotherapy based on changes in the identified antigen-specific T cells.
[0089] In some modalities, immunotherapy is a checkpoint inhibitor.
[0090] In some embodiments, the checkpoint inhibitor is an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the anti-PD-1 antibody is selected from the group consisting of pembrolizumab, nivolumab, and cemiplimab. In some embodiments, the anti-PD-LI antibody is selected from the group consisting of atezolizumab, avelumab, and durvalumab. In some embodiments, the anti-CTLA4 antibody is iplimumab. In some embodiments, the checkpoint inhibitor is an anti-TIGIT antibody. In some embodiments, the anti-TIGIT antibody is selected from the group consisting of AB154 (Arcus), tiragolumab (Genentech), BMS-986297 (BMS), MK7684 (Merck), and etigilimab (OncoMed).
[0091] In one aspect, a method of identifying an antigen is provided herein, comprising providing two or more distinct sets of particles, each distinct set of particles comprising a unique antigen peptide and at least one associated defined barcode operatively with the identity of the antigen peptide, and each set comprises a first particle comprising a first identification mark and a second particle comprising a second identification mark other than the first identification mark; providing a sample known or suspected to comprise one or more T cells; contacting the sample with the two or more sets of particles, wherein the contacting comprises providing conditions sufficient for an individual T cell to bind to the single antigen of at least one set of particles; isolating one or more T cells associated with the first and second identification marks; performing an assay to identify one or more barcodes bound to the isolated T cell; determining a ratio of the barcodes bound to the isolated T cell wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a barcode other than step (e) and divide the first number by the second copy number; and identifying a unique antigen peptide sequence bound to an antigen-specific T cell.
[0092] In some embodiments, the first and second identification labels are fluorophores.
[0093] In some embodiments, the fluorophore is APC or PE.
[0094] In one aspect, there is provided herein a method of identifying an antigen, comprising
[0095] obtaining or having obtained a data set comprising data associated with one or more barcodes detectably linked, directly or indirectly, to the T cell, wherein the one or more barcodes are each operatively associated with a single antigen peptide; determining or having determined a ratio of the barcodes attached to the T-cell, wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a distinct barcode from step (a) and divide the first copy number by the second copy number; and identifying a unique antigen peptide sequence bound to an antigen-specific T cell.
[0096] In some embodiments, step (a) comprises obtaining a T cell-based sample and evaluating it to obtain the data set.
[0097] In some embodiments, the data set comprises the one or more barcodes and the one or more barcode copy numbers.
[0098] In some embodiments, the unique antigen peptide is the same for each different set of particles.
[0099] In one aspect, there is provided herein a method of identifying an HLA-peptide complex, comprising providing two or more distinct sets of particles, each distinct set of particles comprising a unique antigen peptide and at least one code of defined bars operatively associated with the identity of the antigen peptide, and each set comprises a first particle comprising a first identification mark and a second particle comprising a second identification mark other than the first identification mark; providing a sample known or suspected to comprise one or more T cells; contacting the sample with the two or more sets of particles, wherein the contacting comprises providing conditions sufficient for an individual T cell to bind to the single antigen of at least one set of particles; isolating one or more T cells associated with the first and second identification marks; performing an assay to identify one or more barcodes bound to the isolated T cell; determining a ratio of the barcodes bound to the isolated T cell wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a barcode other than step (e) and divide the first number by the second copy number; and identifying the HLA-peptide complex bound to an antigen-specific T cell.
[00100] In some embodiments, the first and second identification labels are fluorophores.
[00101] In some embodiments, the fluorophore is APC or PE.
[00102] In one aspect, there is provided herein a method of identifying an HLA-peptide complex, comprising obtaining or having obtained a data set comprising data associated with one or more detectably linked barcodes, directly or indirectly, to the T cell, wherein the one or more barcodes are each operatively associated with a unique antigen peptide; determining or having determined a ratio of the barcodes attached to the T-cell, wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a distinct barcode from step (a) and divide the first copy number by the second copy number; and identifying the HLA-peptide complex bound to an antigen-specific T cell.
[00103] In some embodiments, step (a) comprises obtaining a T cell-based sample and evaluating it to obtain the data set. ΖηΖ / 3 / ΥΙΛΙ
[00104] In some embodiments, the data set comprises the one or more barcodes and the one or more barcode copy numbers.
[00105] In some embodiments, the unique antigen peptide is the same for each different set of particles.
[00106] In one aspect, there is provided herein a method of identifying a subject for treatment with an immunotherapy, comprising providing two or more distinct sets of particles, each distinct set of particles comprising a unique antigen peptide and at least a defined barcode operatively associated with the identity of the antigen peptide, and each set comprises a first particle comprising a first identification mark and a second particle comprising a second identification mark other than the first identification mark; providing a sample known or suspected to comprise one or more T cells; contacting the sample with the two or more sets of particles, wherein the contacting comprises providing conditions sufficient for an individual T cell to bind to the single antigen of at least one set of particles; isolating one or more T cells associated with the first and second identification marks; performing an assay to identify one or more barcodes bound to the isolated T cell; determining a ratio of the barcodes bound to the isolated T cell wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a barcode other than step (e) and divide the first number by the second copy number.
[00107] In some embodiments, the first and second identification tags are fluorophores.
[00108] In some embodiments, the fluorophore is APC or PE.
[00109] In one aspect, there is provided herein a method of identifying a subject for treatment with an immunotherapy, comprising obtaining or having obtained a data set comprising data associated with one or more detectably linked barcodes, of directly or indirectly, to the T cell, wherein the one or more barcodes are each operatively associated with a unique antigen peptide; and determining or having determined a ratio of the barcodes attached to the T-cell, wherein the ratio is calculated by identifying a first predominant barcode copy number and a second barcode copy number other than step (a) and divide the first copy number by the second copy number.
[00110] In some embodiments, step (a) comprises obtaining a T-cell-based sample and evaluating it to obtain the data set.
[00111] In some embodiments, the data set comprises the one or more barcodes and the one or more barcode copy numbers.
[00112] In some embodiments, the unique antigen peptide is the same for each different set of particles.
[00113] In some embodiments, the immunotherapy comprises a T cell vaccine, a dendritic cell vaccine, a nucleic acid vaccine, a peptide vaccine, a viral vaccine, a soluble TCR, a TCR-drug conjugate, an antibody , or an antibody-drug conjugate.
[0114] In some embodiments, the antibody comprises a monoclonal antibody.
[00115] In one aspect, a method of identifying a unique TCR sequence is provided herein, comprising providing two or more distinct sets of particles, each distinct set of particles comprising a ΖηΖ / 3 / ΥΙΛΙ unique antigen peptide and at least one defined barcode operatively associated with the identity of the antigen peptide, each set comprising a first particle comprising a first identification mark and a second particle comprising a second mark of identification other than the first identification mark; providing a sample known or suspected to comprise one or more T cells; contacting the sample with the two or more sets of particles, wherein the contacting comprises providing conditions sufficient for an individual T cell to bind to the single antigen of at least one set of particles; isolating one or more T cells associated with the first and second identification marks; performing an assay to identify one or more barcodes bound to the isolated T cell; determining a ratio of the barcodes bound to the isolated T cell wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a barcode other than step (e) and divide the first number by the second copy number; and identifying the unique TCR sequence.
[00116] In some embodiments, the first and second identification labels are fluorophores.
[00117] In some embodiments, the fluorophore is APC or PE.
[00118] In one aspect, there is provided herein a method of identifying a unique TCR sequence, comprising obtaining or having obtained a data set comprising data associated with one or more detectably linked barcodes, directly or indirectly, to the T cell, wherein the one or more barcodes are each operatively associated with a unique antigen peptide; determining or having determined a ratio of the barcodes attached to the T-cell, wherein the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a distinct barcode from step (a) and divide the first copy number by the second copy number; and identifying the unique TCR sequence.
[00119] In some embodiments, step (a) comprises obtaining a T cell-based sample and evaluating it to obtain the data set.
[00120] In some embodiments, the data set comprises the one or more barcode sequences and the one or more barcode copy numbers.
[00121] In some embodiments, the unique antigen peptide is the same for each different set of particles.
[00122] In some embodiments, the method further comprises making a soluble TCR polypeptide comprising the identified unique TCR sequence.
[00123] In some embodiments, the soluble TCR polypeptide is linked to a label or drug.
[00124] In some embodiments, the method is iterated to identify at least two unique TCR sequences.
[00125] In some embodiments, the method further comprises making a library comprising the at least two unique TCR sequences.
[00126] In one aspect, there is provided herein a method of treating cancer in a subject, comprising obtaining or having obtained a data set comprising data associated with one or more detectably linked barcodes, in a manner directly or indirectly, to a T cell, wherein the one or more barcodes are each operatively associated with a unique antigen peptide; determine or have determined a relationship of the 7Π7 / 3 / ΥΙΛΙ T cell-bound barcodes that identify the antigen specificity of the T cell, where the ratio is calculated by identifying a first copy number of a predominant barcode and a second copy number of a barcode other than step (a) and dividing the first copy number by the second copy number; identifying at least one or both of the TCR sequences of the T cell and creating a modified T cell comprising at least one or both of the TCR sequences; and administering the modified T cell to the subject.
[00127] In some embodiments, the method further comprises administering an immunotherapy.
[00128] In some modalities, immunotherapy is a checkpoint inhibitor.
[00129] In some embodiments, the checkpoint inhibitor is an anti-PD-1 antibody, an anti-PD-1 antibody, L1, or an anti-CTLA-4 antibody.
[00130] In some embodiments, the T cell is autologous.
[00131] In some embodiments, the modified T cell is autologous.
[0132] In some embodiments, the single antigen peptide is presented by HLA class I on the cell surface of the subject's cancer.
[00133] In certain embodiments, the presently disclosed subject matter provides methods for processing T cells. In certain embodiments, the methods comprise: (a) contacting a sample with a plurality of distinct particle assemblies; (b) isolating one or more T cells bound to a particle; (c) identifying the barcode of the particle bound to the isolated T cell; and (d) determining a ratio of each barcode. In certain embodiments, each particle comprises a unique antigen peptide, an operatively associated barcode, and at least one identification mark. In certain embodiments, the sample comprises T cells. In certain embodiments, contacting comprises providing suitable conditions for an individual T cell to bind to a unique antigen peptide from at least one set of particles.
[00134] In certain embodiments, the ratio is calculated by identifying a copy number of a first barcode and a copy number of a second barcode and dividing the copy number of the first barcode by the number of copy of the second barcode. In certain embodiments, the unique antigen peptide is the same for each set of different particles. In certain embodiments, each distinct set of particles comprises at least one or more barcodes, where each barcode is associated with the identity of the antigen peptide. In certain embodiments, the ratio of each barcode corresponds to the antigen specificity of the isolated T cell. In certain embodiments, the isolated T cell is identified as an antigen-specific T cell if the ratio of the first barcode is above a threshold. In certain modalities, the threshold is at least or greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 2-5, 3-6, 4-7, 5-8, 5-10, 7-10, or greater than 10.
[0135] In certain embodiments, barcode identification comprises a nucleotide-based assay. In certain embodiments, the nucleotide-based assay is a PCR, RT-PCR, sequencing, or hybridization assay. In certain embodiments, the nucleotide-based assay determines a sequence of each barcode. In certain embodiments, the nucleotide-based assay determines a copy number of each barcode. In certain embodiments, the nucleotide-based assay determines (a) a sequence of each barcode and / or (b) a ZnZ / 3 / ΥΙΛΙ number of copies of each barcode.
[00136] In certain embodiments, the methods further comprise obtaining a T cell receptor (TCR) CDR sequence. In certain embodiments, the methods further comprise obtaining a TCR gene sequence. In certain embodiments, the TCR gene sequence is a TCR beta or TCR alpha chain sequence.
[0137] In certain embodiments, the methods comprise identifying the antigen specificity of a T cell. In certain embodiments, the T cell antigen specificity comprises the antigen peptide sequence and the bound T cell TCR sequences.
[00138] In certain embodiments, the at least one identification mark is the same in each different set of particles. In certain embodiments, the methods comprise at least two different identification marks. In certain embodiments, the at least one identification mark is a fluorophore. In certain embodiments, the fluorophore is selected from the group consisting of allophycocyanin (APC) and phycoerythrin (PE). In certain embodiments, the at least two different identification labels are fluorophores, where the fluorophores are selected from the group consisting of allophycocyanin (APC) and phycoerythrin (PE).
[0139] In certain embodiments, the antigen peptide is selected from the group consisting of a tumor antigen, a neoantigen, a tumor neoantigen, a viral antigen, a bacterial antigen, a phosphoantigen, and a microbial antigen. In certain embodiments, the neoantigen is identified from a subject's tumor sequencing data. In certain embodiments, an in silico predictive algorithm is used to determine the neoantigen. In certain embodiments, the predictive algorithm further comprises an MHC binding algorithm for predicting binding between the neoantigen and an MHC peptide.
[00140] In certain embodiments, the sample is selected from a blood sample, a bone marrow sample, a tissue sample, a tumor sample, or a peripheral blood mononuclear cell (PBMC) sample. In certain embodiments, wherein the T cell is a human T cell. In certain embodiments, the T cell is a CD8+ T cell.
[00141] In certain embodiments, the methods comprise a library of distinct particle sets. In certain embodiments, the library comprises 2 to 500 distinct particle sets. In certain embodiments, each particle comprises an MHC peptide. In certain embodiments, the MHC peptide is a human MHC peptide. In certain embodiments, the MHC peptide is an HLA class I peptide. In certain embodiments, the HLA peptide comprises an HLA-A, HLA-B, or HLA-C peptide. In certain embodiments, the HLA peptide comprises HLA-A*01:01, HLA-A*02:01, HLA-A*03:01, HLA-A*24:02, HLA-A*30:02, HLA -A*31:01, HLA-A*32:01, HLA-A*33:01, HLA-A*68:01, HLAΑΊ1Ό1, HLA-A*23:01, HLA-A*30:01, HLA -A*33:03, HLA-A*25:01, HLA-A*26:01, HLA-A*29:02, HLA-A*68:02, HLAB*07:02, HLA-B*14 :02, HLA-B*18:01, HLA-B*27:02, HLA-B*39:01, HLA-B*40:01, HLA-B*44:02, HLA-B*46:01 , HLAB*50:01, HLA-B*57:01, HLA-B*58:01, HLA-B*08:01, HLA-B*15:01, HLA-B*15:03, HLA-B *35:01, HLA-B*40:02, HLAB*42:01, HLA-B*44:03, HLA-B*51:01, HLA-B*53:01, HLA-B*13:02 , HLA-B*15:07, HLA-B*27:05, HLA-B*35:03, HLAB*37:01, HLA-B*38:01, HLA-B*41:02, HLA-B *44:05, HLA-B*49:01, HLA-B*52:01, HLA-B*55:01, HLA-C*02:02, HLAC*03:04, HLA-C*05:01 , HLA-C*07:01, HLA-C*01:02, HLA-C*04:01, HLA-C*06:02, HLA-C*07:02, HLA-C*16:01, HLA7Π7 / 3 / ΥΙΛΙ C*03:03, HLA-C*07:04, HLA-C*08:01, HLA-C*08:02, HLA-C*12:02, HLA-C*12:03, HLA-C* 14:02, HLA-C*15:02, or HLAC*17:01.
[00142] In certain embodiments, each particle comprises an HLA peptide and a β2Μ peptide. In certain embodiments, the β2Μ peptide is a human β2Μ peptide. In certain embodiments, the β2Μ peptide comprises a mutation. In certain embodiments, the mutation is S88C.
[00143] In certain embodiments, each particle comprises a polypeptide comprising, in an amino to carboxyl terminus orientation, (i) the antigen peptide, (¡i) a β2Μ peptide, and (i¡¡) a β2Μ peptide. MHC. In certain embodiments, the antigen peptide is 7-15 amino acids, 7-10, 8-9, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids in length. In certain embodiments, the polypeptide is biotinylated. In certain embodiments, the particles are selected from the group consisting of magnetic beads, agarose beads, styrene polymer particles, and dextran polymer particles. In certain embodiments, where the particles are coated with streptavidin.
[00144] In certain embodiments, the presently disclosed subject matter provides methods for monitoring an immune repertoire in a subject. In certain embodiments, the methods comprise monitoring changes in antigen-specific T cells in the subject. In certain embodiments, the methods comprise administering an immunotherapy to the subject. In certain modalities, the immunotherapy is a foster cell transfer or checkpoint inhibitor. In certain embodiments, any of the methods described herein are used to monitor an immune repertoire in a subject.
[0145] In certain embodiments, the presently disclosed subject matter provides methods for identifying at least one TCR sequence. In certain embodiments, the at least one TCR sequence is a TCR alpha sequence, a TCR beta sequence, or a combination thereof. In certain embodiments, the methods further comprise making a soluble TCR polypeptide. In certain embodiments, any of the methods described herein are used to identify at least one TCR sequence.
[00146] In certain embodiments, the presently disclosed subject matter provides libraries of particles. In certain embodiments, the library comprises at least two sets of particles. In certain embodiments, each set of particles comprises an antigen peptide, a barcode operatively associated with the identity of the antigen peptide, and at least one identification mark. In certain embodiments, the at least one identification mark is the same in each set of particles. In certain embodiments, at least two different identification marks on each different set of particles. In certain embodiments, the at least one identification mark is a fluorophore. In certain embodiments, the fluorophore is selected from the group consisting of allophycocyanin (APC) and phycoerythrin (PE). In certain embodiments, the at least two different identification labels are fluorophores, where the fluorophores are selected from the group consisting of allophycocyanin (APC) and phycoerythrin (PE).
[00147] In certain embodiments, the presently disclosed subject matter additionally provides particles. In certain embodiments, a particle comprises at least one polypeptide, a barcode, and an identification tag. In certain embodiments, the polypeptide comprises an antigen peptide, a β2Μ peptide, and an MHC peptide. In certain embodiments, the barcode is operatively associated with the identity of the antigen peptide. In certain embodiments, the particle is selected from the group consisting of magnetic beads, agarose beads, styrene polymer particles, and dextran polymer particles. In certain embodiments, the identification tag is a fluorophore. In certain embodiments, the particle is coated with streptavidin. In certain embodiments, the polypeptide is labeled.
[00148] In certain embodiments, the presently disclosed subject matter further describes methods of treating cancer in a subject. In certain embodiments, the methods comprise: (a) preparing a plurality of particles each comprising a plurality of labeled polypeptides; (b) contacting the plurality of particles with a plurality of T cells of the subject under conditions suitable for antigen-specific binding of a T cell to the particle; (c) isolating the T cells bound to the particle and identifying the TCR gene sequence of the isolated T cell; (d) preparing a polynucleotide comprising homology arms and at least one TCR gene sequence; (e) recombining the polynucleotide at an endogenous locus of the subject's T cell; (f) culturing the modified T cell to produce a population of T¡ cells and (g) administering a therapeutically effective amount of the modified T cells to the subject to thereby treat the cancer. In certain embodiments, the polypeptides comprise an antigen peptide, a β2Μ sequence, an HLA sequence, and a detectable label. In certain embodiments, the TCR gene sequence is patient-specific. In certain embodiments, the TCR gene sequence falls between the homology groups.
[00149] In certain embodiments, the presently disclosed subject matter further describes methods for modifying a cell. In certain embodiments, the methods comprise: (a) introducing into the cell a homologous recombination (HR) template nucleic acid sequence; and (b) recombining the HR template nucleic acid at an endogenous locus of the cell. In certain embodiments, the HR template nucleic acid comprises: (a) first and second homology arms homologous to the first and second sequences endogenous to the cell; (b) a T cell receptor (TCR) gene sequence obtained by any of the methods described herein; and (c) a first 2A coding sequence located downstream of the TCR gene sequence and a second 2A coding sequence located downstream of the TCR gene sequence, wherein the first and second 2A coding sequences code for the same amino acid sequence that diverge in codons from each other. In certain embodiments, the first and second endogenous sequences are homologous to the first and second homology groups of the HR template nucleic acid. In certain embodiments, the TCR gene sequence is located between the first and second HR arms. In certain embodiments, the 2A coding sequence is a P2A coding sequence. In certain embodiments, the HR template further comprises a sequence encoding a flexible linker. In certain embodiments, the flexible linker coding sequence is placed immediately upstream of the 2A coding sequences. In certain embodiments, the flexible linker has a Gly Ser Gly amino acid sequence. In certain embodiments, the HR template further comprises a sequence encoding a protease cleavage sequence. In certain embodiments, the protease cleavage sequence is a Furin sequence. In certain embodiments, the protease cleavage sequence is a TEV sequence. In certain embodiments, the protease cleavage sequence is upstream of the second 2A coding sequence.
[00150] In certain embodiments, the presently disclosed subject matter further describes compositions comprising modified cells. In certain embodiments, the modified cell comprises an exogenous nucleic acid sequence integrated into an endogenous locus. In certain embodiments, the exogenous nucleic acid sequence comprises: (a) a TCR gene sequence; and (b) a first 2A coding sequence located downstream of the TCR gene sequence and a second 2A coding sequence located downstream of the TCR gene sequence. In certain embodiments, the TCR gene sequence is identified by any of the methods described herein. In certain embodiments, the first and second 2A coding sequences code for the same amino acid sequence that diverge in codons from each other. In certain embodiments, the 2A coding sequence is a P2A coding sequence. In certain embodiments, the exogenous nucleic acid sequence further comprises a sequence encoding a flexible linker. In certain embodiments, the flexible linker coding sequence is placed immediately upstream of the 2A coding sequences. In certain embodiments, the flexible linker has a Gly Ser Gly amino acid sequence. In certain embodiments, the exogenous nucleic acid further comprises a sequence encoding a protease cleavage sequence. In certain embodiments, the protease cleavage sequence is a Furin sequence. In certain embodiments, the protease cleavage sequence is a TEV sequence. In certain embodiments, the protease cleavage sequence is upstream of the second 2A coding sequence. Brief Description of the Figures
[00151] These and other features, aspects, and advantages of the described compositions and methods will become better understood with respect to the following description, and accompanying figures, where:
[0152] Figure 1 shows the design of an example comPACT mini-gene. SS refers to the optional signal sequence; US1 refers to the first universal target site; NeoE refers to Neoepitope, the antigenic peptide sequence site; US2 refers to the second universal target site; L1 refers to the first optional linker sequence; Beta2m refers to the β-2-microglobulin domain sequence; L2 refers to the second optional linker sequence; MHC heavy chain refers to the heavy chain allele of MHC; L3 refers to the optional third linker sequence; and "purification pool" refers to the optional purification pool with a biotinylation sequence, a protease cleavage site, and an affinity tag sequence. While Figure 1 shows a His6 (SEQ ID NO: 34) (6-His tag (SEQ ID NO: 34)) as the affinity tag, any other appropriate affinity tag could be used including but not limited to tags histidine tags of different lengths (poly-His tags), HAT tags, FLAG tags (or FLAG epitopes), epitopes that are specific for any antibody used for purification, galactose binding protein tags, fluorescent tags, GST tags, HA tags, HaloTag, MBP tags, Myc tags, poly-Asp tag, poly-Phe tag, Protein C, Streptavidin / Biotin tags, Strep tags, G-protein, or any other tag protein purification agent that is capable of purifying a polypeptide from comPACT.
[00153] Furthermore, while Figure 1 shows that a nickel resin (see, ''Ni” in the figure) was used to purify the His6-tagged comPACT polypeptide (SEQ ID NO: 34), other resins of affinity with His6 (SEQ ID NO: 34) have been used. Specifically, zinc resin has been used to successfully purify a His6-tagged comPACT polypeptide (SEQ ID NO: 34) from solution. Cobalt and calcium resins are two other exemplary His6 affinity resins (SEQ ID NO: 34) that could be used.
[00154] Figure 2 shows a diagram of an exemplary modular platform available for rapidly assembling libraries of antigenic peptide ligands complexed with a chosen MHC allele. Figure 2 describes SEQ ID NO: 9, 11 and 13, respectively, in order of appearance.
[0155] Figure 3 is a diagram of an exemplary restriction digest cloning reaction to replace the dummy insert in the MHC template with a chosen neoepitope sequence. The dummy insert (underlined, bold; upper set of sequences in the figure) contains four stop codons in different frames and a unique restriction site for uncut or re-ligated template destruction. Restriction sites on each side of the insert are shown in boxes. The bottom set of sequences shows the neoE insert after the dummy insert has been cut and ligated with the correct neoE sequence. Figure 3 describes SEQ ID NO: 270-274, respectively, in order of appearance.
[0156] Figure 4 is a diagram of an exemplary restriction digest cloning reaction to insert a chosen neoepitope sequence into the MHC template. The neoepitope sequence (underlined, bold) is synthesized as a primer flanked by two different restriction sites (boxed). A universal primer with the reverse complement sequence e of the 3' restriction site is used in a PCR reaction to form a double stranded primer dimer of the neoepitope sequence. Restriction digest of both the neoepitope and the MHC template vector allows for a ligation reaction to insert the chosen neoepitope sequence into the MHC template sequence. Ligation reactions are transformed into E. coli and plasmids prepared from transformed E. coli are used in mammalian producer cell transfection reactions. Figure 4 describes SEQ ID NOs 275-276, 271-274 and 277, respectively, in order of appearance.
[00157] Figure 5 is a diagram of an exemplary alternative form of a restriction digest cloning reaction to insert a chosen neoepitope sequence into the MHC template. Two complementary NeoE-encoding primers are synthesized with a portion of the 5' and 3' restriction sites. These primers anneal to and mimic restriction digest overhangs. A pre-cleaved vector (critically retaining 5' phosphates at its overhanging ends) was then ligated with the annealed NeoE insert and the ligation product transformed into E. coli for plasmid production. Figure 5 describes SEQ ID NOs 278-279, 271-274 and 277, respectively, in order of appearance.
[00158] Figure 6 is a diagram of an exemplary PCR-based method for inserting a chosen neoepitope sequence into the MHC template. Two complementary NeoE-encoding primers are synthesized, the forward primer with a sequence 3' to the second universal site in the MHC template; and the reverse primer with a sequence 3' to the sequence complementary to the first universal site in the MHC template. These primers are mixed with a 5' fragment of the MHC template with the first universal sequence site, and a second fragment of the MHC template with the second universal site and the remainder of the comPACT mini-gene. The first cycle of 7Π7 / 3 / ΥΙΛΙ PCR amplification yields two nucleotide fragments, one fragment encoding the first universal site region with neoepitope downstream and the other encoding the neoepitope followed by the rest of the comPACT gene. These two fragments, which overlap in unique neoepitope sequence, are then assembled and the entire assembly amplified and cleaned up for transfection.
[00159] Figure 7 shows total protein expression in 30 mL of mammalian cells transfected with a comPACT gene (Neo12) over a seven-day cycle and a Western blot using an NTA-HRP reagent that detects the comPACT tag. his.
[0160] Figure 8 shows Ni-NTA affinity chromatography purification gels of neo12 comPACT protein. Pre means Used Crude, FT means Flow Through, W means Wash, and E means Elute.
[0161] Figure 9 shows the size exclusion chromatography spectra of the purified Neo12 protein. The major peak is the Neo12 protein, and the minor peak is ATP added during a biotinylation step.
[00162] Figure 10 shows a purification experiment similar to that shown in Figure 8, using a cell culture volume of 0.7.
[0163] Figure 11 shows the crude and purified protein of eight different NeoE comPACT proteins, each with a different antigenic sequence. Figure 11 describes SEQ ID NO 11 and 13, respectively, in order of appearance.
[00164] Figure 12 shows the size exclusion chromatography spectra of the eight NeoE comPACT proteins from Figure 11.
[00165] Figure 13A shows a NeoE comPACT protein (specifically the neo12 comPACT protein) produced using the PCR assembly method described in Figure 6 (linear amplicon) compared to a NeoE comPACT protein (specifically the neo12 comPACT protein). neo12 comPACT protein) produced from a plasmid (plasmid). Figure 13B shows a DNA gel of linear amplicons produced by the PCR assembly method. Each lane contains a comPACT minigene (specifically the neo12 comPACT minigene) with a different neoepitope sequence.
[0166] Figure 14 shows a streptavidin bead extraction assay to test for complete biotinylation of the comPACT protein. Figure 14 describes "(His6)" as SEQ ID NO: 34.
[00167] Figure 15 shows the biotinylation of different comPACT proteins in crude cell used, visualized by a Western blot using streptavidin-HRP. Figure 15 describes His6 as SEQ ID NO: 34. Figure 15 describes SEQ ID NO 280, 280-281 and 281, respectively, in order of appearance.
[00168] Figures 16A, 16B and 16C show the production and enzyme purification of BirA (Figures 16B and 16C) and TEV protease (Figure 16A) in E. coli.
[00169] Figure 17 shows biotinylation of a comPACT protein using BirA (lane 2) and cleavage of the His6 tag (SEQ ID NO: 34) using TEV protease (lane 3).
[0170] Figure 18 shows cell sorting of BirA and V5 transduced cells based on V5 expression.
[0171] Figure 19 shows antigen-specific capture of T cells using multimerized comPACT protein.
[00172] Figure 20 shows the production of comPACT NTAmer using a S88C β2Μ comPACT protein.
[00173] Figure 21 shows the coupling of Cy5 comPACT protein monomers to S88C,
[00174] Figure 22A shows an example diagram of a cloning strategy for making comPACT polynucleotides. Figure 22B provides sequence verification statistics obtained from 824 individual comPACT polynucleotides.
[00175] Figure 23 provides an example diagram of the workflow for making comPACT polynucleotides and proteins.
[00176] Figures 24A and 24B show the percentage of patients covered by major HLAI alleles in the United States of America relative to the size of the comPACT HLA repertoire.
[00177] Figure 25A shows the comPACT protein monodispersity for a representative selection of comPACT proteins. Figure 25B shows the comPACT protein yield for a representative selection of comPACT proteins. Figure 25C shows comPACT protein expression for a representative selection of comPACT proteins.
[00178] Figure 26 provides a schematic of the imPACT signal-to-noise neoantigen T-cell isolation process.
[0179] Figure 27A provides an illustration of non-specific barcode signal strength for identifying signal and noise. Figure 27B provides an illustration of specific bar code signal strength for identifying signal and noise.
[00180] Figure 28 provides an illustration of single versus double barcode creation.
[00181] Figure 29A provides a schematic of the double tetramer staining process. Figure 29B provides data showing imPACT tetramer staining of MART5 antigen-specific T cells. Figure 29C provides data showing ImPACT tetramer staining of neo12 antigen-specific T cells.
[00182] Figure 30 provides an example of the sensitivity of isolated neoantigen T cells by neoID signal to noise ratio.
[00183] Figure 31 provides an example of the specificity of the impact neoantigen isolation process (ie, imPACT isolation technology).
[00184] Figure 32A provides a FACS plot of gene-edited specific T cells (full squares) exhibiting a NeoID signal-to-noise ratio greater than 10. Non-specific T cells (circles) exhibit S / N < 10 . Figure 32B shows the quantification of the signal-to-noise ratio and the average of specific and non-specific T cells.
[00185] Figure 33A provides an example of imPACT analysis of a PBMC sample using the single barcode method and validation for the imPACT isolated TCR. Figure 33A describes SEQ ID NO: 282-284, RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ respectively, in order of appearance. Figure 33B provides an example of imPACT analysis of a PBMC sample using the individual barcode method and validation for the imPACT isolated TCR.
[00186] Figure 34A provides a FACS plot for double stained T cells using ImPACT analysis of a PBMC sample using the single barcode method. Figure 34A depicts SEQ ID NO: 285-292, respectively, in order of appearance. Figure 34B provides a FACS plot for CD45RA and CD95 stained T cells after double tetramer staining. Figure 34A depicts SEQ ID NO: 285-292, respectively, in order of appearance. Figure 34C provides a table summarizing the sequences of TRA (SEQ ID NO 293-300, respectively, in order of appearance), TRB (SEQ ID NO 285-292, respectively, in order of appearance), gene, and peptide. neoantigen (SEQ ID NOs 204, 203, 203, 203, 205,203, and 206-207, respectively, in order of appearance) from T cells isolated after imPACT analysis. Figure 34D provides a summary of isolated neoantigen-specific T cells. Figure 34E provides a summary of the number of lymphocytes isolated for each TCR identified using the ImPACT method.
[00187] Figure 35A provides an example of the ImPACT assay validation scan of the PBMC sample used in Figure 34. Figure 35A describes SEQ ID NOs 207, 301, 206 and 302, respectively, in order of appearance. Figure 35B provides an example of the imPACT assay validation scan of the PBMC sample used in Figure 34.
[00188] Figure 36 provides an illustration of mutation-targeted T cells from the PBMC sample used in Figure 34.
[0189] Figure 37A provides a FACS plot for double stained T cells using ImPACT analysis of a PBMC sample using the double barcode method. Figure 37B provides a FACS plot for CD45RA and CD95 stained T cells after double tetramer staining. Figure 37A describes SEQ ID NO: 303-305 respectively, in order of appearance. Figure 37C provides a table summarizing the peptide sequences of neoantigen, TRA, TRB and genes from isolated T cells after ImPACT analysis. Figure 37C describes the sequences of topl.NeoAg as SEQ ID NO 306, 306, 208, 208, 208, 208, 208, 208, the sequences of top2.NeoAg as SEQ ID NO 307, 306,208,208, 208,208, the sequences of tra .CDR3 as SEQ ID NO 308-310, 310-312, 312, 312, and 312, the trb.CDR3 sequences as SEQ ID NO 313-314, 304, 304, 303, 305, 305, 305 and 305 and the peptide tumor sequences as SEQ ID NO 306, 306, 208, 208, 208, 208, 208 and 208, all, respectively, in order of appearance. Figure 37D provides an example of the imPACT assay validation screening using comPACT dextramers.
[0190] Figure 38A provides a summary of neoantigen-specific TCRs isolated from patient samples. Figure 38B provides a table summarizing the HAL types, cancer, number of targets, and number of TCRs found in the TILs.
[0191] Figure 39A shows the antigen specificity of HCMV and EBV T cells. Figure 39B shows the number of TCR hits.
[00192] Figure 40A shows a comparison of tetramer, trimer, and dextramer isolation methods. 7Π7 / 3 / ΥΙΛΙ using F5 T cells. Figure 40B shows a comparison of tetramer, trimer, and dextramer isolation methods using neo12 T cells.
[00193] Figure 41A shows a comparison of trimer and dextramer isolation methods using PBMC samples and neo12 T cells, CMV T cells, and M1W T cells. Figure 41B shows the average barcode signal to noise ratio when using a trimer or a dextramer.
[0194] Figure 42A shows changes in neoantigen-specific T cells in peripheral blood from patient PACT157 over time. Figure 42A depicts SEQ ID NO: 315-317, respectively, in order of appearance. Figure 42B shows changes in peripheral blood neoantigen-specific T cells from patient PACT132 over time. Figure 42B depicts SEQ ID NO: 318-319, respectively, in order of appearance. Figure 42C shows changes in peripheral blood neoantigen-specific T cells from patient PACT131 over time. Figure 42C depicts SEQ ID NO: 320-323, respectively, in order of appearance.
[00195] Figure 43 shows the phenotypic characterization of neoantigen-specific T cells from a patient.
[0196] Figure 44A shows the functional characterization of TCR clones isolated against a PIK3CA neoantigen target. Figure 44B shows the functional characterization of TCR clones isolated against a PIK3CA neoantigen target.
[00197] Figure 45 provides a summary of the number of neoantigen-specific T cells per CD8 T cells in each T cell sample collected during the course of anti-PD-1 antibody treatment in patient PACT135. Figure 45 describes KTYFKPFHPK as SEQ ID NO: 256 and YFKPFHPKF as SEQ ID NO: 227.
[00198] Figure 46 shows strong T cell gene editing efficiency of the 14 neoTCRs in both CD4 and CD8 T cells.
[0199] Figure 47 shows that neoTCRs were internalized after co-cultivation of the comPACT-cognate dextramers of neoTCR T cells and the melanoma-matched cell line M489 with and without IFNγ preincubation.
[00200] Figure 48 shows that neoTCR T cells derived from patient PACT135 expressed activation markers 4-1BB.
[00201] Figure 49 shows that neoTCR T cells derived from patient PACT135 expressed OX40 activation markers.
[00202] Figure 50 provides a graph of the percentage confluence of tumor cells after cocultivation with all neoTCR T cells identified from PACT135.
[00203] Figure 51A provides individual graphs of the percentage confluence of tumor cells after co-cultivation with each neoTCR T cell. Figure 51B provides individual plots of the percentages of tumor cell confluence after co-cultivation with each neoTCR T cell.
[00204] Figure 52 shows the secretion of IFNγ, IL2, and TNFα by TCR218 T cells after cocultivation with M489 cells.
[00205] Figure 53 shows the secretion of IFNγ, IL2 and TNFα by TCR221 and TCR227 T cells after cocultivation with M489 cells. 7Π7 / 3 / ΥΙΛΙ
[00206] Figure 54 shows IFNy and TNFa secretion by TCR222 T cells after cocultivation with M489 cells.
[00207] Figure 55 shows IFNγ secretion by T cells from TCR219, TCR220, TCR223, TCR224, TCR225, TCR228, TCR229, TCR232, TCR240, TCR241 after cocultivation with M489 cells with or without IFNγ pretreatment.
[00208] Figure 56 provides a summary of the number of neoantigen-specific T cells isolated from patient PACT035.
[00209] Figure 57A shows HLA-A2 expression in the KV1858 cell line. Figure 57B shows HLA-A2 expression in the KV1832 cell line. Figure 57C shows the expression of HLA-A2 in the SW620 cell line. Figure 57D shows GFP expression in transfected SW620 cells.
[00210] Figure 58 shows the expression of Nur77 in TCR089 neoTCR T cells that were co-cultured with SW620 cells homozygous for the COX6C-R20Q mutation.
[00211] Figure 59A shows SW620 homozygous tumor cells killed by T cells expressing neoTCR. Figure 59B does not show killing of wild-type SW620 cells.
[00212] Figure 60 shows that TCR089 killed SW620 cells homozygous for the COX6C-R20Q mutation but not wild-type SW620 cells.
[00213] Figure 61 shows IFNγ secretion in TCR089 T cells after cocultivation with SW620 cells homozygous for the COX6C-R20Q mutation.
[00214] Figure 62 shows the methodology of the imPACT isolation technology: neoE-specific TCRs were isolated from patients treated with a checkpoint inhibitor, sequencing was performed, tumor antigens were identified, algorithms were used to select Neoepitopes were examined using comPACT polypeptides and ImPACT isolation technology, and neoepitope-specific T cells were captured.
[00215] Figure 63 shows a patient sample from a patient who failed to respond to anti-PD-1 treatment with a breakdown of the patient's neoE-HLA complexes and the resulting identified TCRs. Figure 63 depicts SEQ ID NO: 324.
[00216] Figure 64 shows that neoTCR T cells kill autologous melanoma tumor cells.
[00217] Figure 65A shows the ability of neoTCR T cells to kill autologous tumor cells. Figure 65B shows that neoTCR T cells express activation markers after co-cultivation with autologous tumor cells. Figure 65C shows that neoTCR T cells secrete gamma interferon after cocultivation with autologous tumor cells.
[00218] Figure 66A shows that neoTCR T-cell therapy eradicated a tumor that was implanted in a mouse. Figure 66B shows the number of human CD8 T cells / mL present in mouse blood on day 4 after neoTCR T cell infusion and on day 35 after infusion.
[00219] Figures 67A and 67B illustrate the neoantigen-specific TCR construct design used to integrate neoantigen-specific TCR (neoTCR) constructs into the TCRa locus. Figure 67A illustrates the target TCRa locus (endogenous TRAC, upper panel) and its CRISPR Cas9 target site (horizontal band, cleavage site designated by arrow), and the circular plasmid homologous recombination (HR) template (panel 2). bottom) with the polynucleotide encoding the neoTCR, which is located between the left and right homology arms (LHA" and RHA" respectively) prior to integration. RNP: CRISPR / Cas9 complex. Figure 67B illustrates the neoTCR integrated into the TCRa locus (upper panel), the transcribed and spliced neoTCR mRNA (middle panel), and the translation and processing of the expressed neoTCR (lower panel). Detailed description of the invention Definitions
[00220] Terms used in the claims and specifications are defined as set forth below, unless otherwise specified.
[00221] As used herein, the term "antigen-specific T cells" refers to cells that are distinguished from one another by their T cell receptors (TCRs), which give them their antigen specificity.
[00222] Embodiments of the compositions and methods described herein include a recombinant MHC antigen complex that is capable of mating with cognate T cells. As used herein, "MHC antigen," "MHC-antigen complex," "recombinant MHC-antigen complex," "MHC peptide," and "p / MHC" are used interchangeably to refer to a larger complex of histocompatibility with a peptide in the antigen-binding groove.
[00223] As used herein, "antigen" includes any antigen including patient-specific antigens.
[00224] "Antigen peptide" and "antigenic peptide and "Neoepitope" and "NeoE" are used interchangeably and refer to the peptide that was derived from an antigen that was identified on a cell of interest (for example, if it is a a tumor cell, the antigen being expressed by the tumor cell), which is incorporated into a comPACT polypeptide using molecular biology techniques described herein. In addition, as expressly specified in the examples, the terms "neoantigen sequence" and "neoantigen insert" may have the same meaning as "antigen peptide" and "antigenic peptide" and "neoepitope" and "neoE". The terms also refer to a peptide or peptide fragment capable of binding to an MHC molecule.
[00225] "Antigen-MHC Complex" and "Antigen-MHC Complex" and "Antigen-MHC Recombinant Complex" and "MHC Peptide" and p / MHC" and "Neoantigen-MHC Complex" are used interchangeably and mean the ternary complex consisting of an HLA / MHC heavy chain, a β2Μ chain, and an antigen peptide.
[00226] The antibody "Anti-CTLA4 Antibody" that binds to CTLA-4 and stops it from working. This can increase the body's immune response against cancer cells, includes ipilimumab. Include AB154 (Arcus), tiragolumab (Genentech / Roche), BMS-986297 (BMS), MK-7684 (Merck), and etigilimab (OncoMed). In addition to anti-CTLA4 antibodies, CTLA4 inhibitors (large and small molecules) can be used in combination with any neoTCR product.
[00227] "Anti-PD-1 antibody and an antibody that binds to PD-1 and anti-PD-1 therapy means an antibody that binds and is capable of binding to PD-1 with sufficient affinity such that the antibody is useful as a diagnostic and / or therapeutic agent for targeting PD-1. In certain embodiments, antibodies that bind or are capable of binding PDRMi7lf\l\7.f\7.nrVW ΖηΖ / 3 / ΥΙΛΙ can block the interaction of PD-1 and PD-L1 and strengthen the immune response against cancer cells. Anti-PD-1 antibodies include but are not limited to pembrolizumab, nivolumab, and cemiplimab. In addition to anti-PD1 antibodies, PD1 inhibitors (large and small molecule) can be used in combination with any neoTCR product.
[00228] "Anti-PD-L1 antibody and an antibody that binds to PD-L1' and anti-PD-L1 therapy" means an antibody that binds and is capable of binding to PD-L1 with sufficient affinity such that the antibody is useful as a diagnostic and / or therapeutic agent for targeting PD-L1. In certain embodiments, antibodies that bind or are capable of binding PD-L1 can block the interaction of PD-1 and PD-L1 and enhance the immune response against cancer cells. Anti-PD-L1 antibodies include but are not limited to atezolizumab, avelumab, durvalumab. In addition to anti-PD-L1 antibodies, PD-L1 inhibitors (large and small molecule) can be used in combination with any neoTCR product.
[00229] "Binding moiety" refers to any chemical or biological moiety that can be used to bind polynucleotides or polypeptides to a chemical or biological substrate. As used herein, binding moieties are used to attach polynucleotides or polypeptides to particles.
[00230] "Checkpoint inhibitor" means a type of drug that blocks certain proteins produced by some types of immune system cells, such as T cells, and some cancer cells. These proteins help keep immune responses in check and may prevent T cells from killing cancer cells. When these proteins are blocked, the brakes on the immune system are released and T cells are better able to kill cancer cells. Examples of checkpoint proteins found on T cells or cancer cells include PD-1 / PD-L1 and CTLA-4 / B7-1 / B7-2. Some immune checkpoint inhibitors are used to treat cancer.
[00231] Barcode” and barcode sequence” and “nucleotide barcode” and “barcoded polynucleotide” and “neoID” and “neoID barcode” can be used interchangeably and refer to a nucleotide sequence that is used to label and identify a specific peptide.
[00232] "Barcoded particle" means a particle with a barcode attached thereto. "Beta-2-microglobulin", "β-2-microglobulin", "β2Μ" are used interchangeably and have the same meaning.
[00233] "comPACT" and "comPACT construct" are used interchangeably and mean either a polynucleotide or a polypeptide, based on the context of how the term is used, comprising a neoantigen and a MCH complex. A comPACT may further comprise signal sequences, universal target sites, linkers, and purification pools. Figure 1 shows a non-limiting representation of a comPACT.
[00234] "comPACT library" and "comPACT-neoID library" are used interchangeably and mean one or more comPACTs.
[00235] "ComPACT mini-gene" or "comPACT polynucleotide" or "comPACT gene" or "comPACT polynucleotide molecule" are used interchangeably and mean the nucleic acid sequence encoding the comPACT protein.
[00236] "comPACT protein" or "comPACT polypeptide" or "comPACT polypeptide molecule" means 7.f\7.nrVW MHC molecules expressed as a single polypeptide fusion of a universal target sequence, an antigen peptide, a second universal target sequence, a β2-microglobulin, and an MHC class I heavy chain comprising the α1 domains , a2 and a3 which form a display portion of MHC. The comPACT polypeptides described herein may further optionally comprise linker sequences between any or all of the individual components of the comPACT polypeptide. An example of the placement of optional linker sequences within a comPACT polypeptide is presented in the comPACT mini-gene of Figure 1.
[00237] "Effective amount" means an effective amount, in dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result.
[00238] "Epitope" or "Epitope tag" means an affinity tag where a peptide sequence is engineered into a polypeptide and where an antibody can bind to the peptide sequence. Epitope tags include but are not limited to V5 tags, Myc tags, HA tags, Spot tags, NE tags, and all other epitopes that can be used as an affinity tag. Epitope tags can be formed either from stretches of contiguous amino acids (linear epitope) or comprise non-contiguous amino acids (conformational epitope), for example, which come into spatial proximity due to antigen folding. "Linker" means any amino acid sequence (or the nucleic acid sequence encoding the amino acid sequence) that is used to link components in a fusion protein. As applied to comPACT proteins (fusion proteins), linkers can be used to link, for example, NeoE to β2Μ or β2Μ to MHC heavy chain or MHC heavy chain to purification pool .
[00239] Both "host cell" and "producer cell" mean cells into which exogenous nucleic acid has been introduced, including the progeny of these cells. Host cells include the primary transformed cell and progeny derived therefrom without regard to the number of passages. The progeny cannot be completely identical in nucleic acid content to an original cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected in the originally transformed cell are included herein.
[00240] An "individual" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (for example, cows, sheep, cats, dogs, and horses), primates (for example, humans and non-human primates such as monkeys), rabbits, and rodents (for example, , mice and rats). In certain aspects, the individual or subject is a human.
[00241] An "isolated" nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a different chromosomal location than its natural chromosomal location.
[00242] "MHC Complex" means a complex comprising a β2 microglobulin and MHC heavy chain. The MHC complex can be a polypeptide or a polynucleotide encoding the polypeptide, an MHC complex is included in all comPACT proteins and polynucleotides encoding β2-microglobulin and β2-microglobulin heavy chain. MHC are included in all comPACT mini-genes. Figure 1 and Figure 2 show two examples of the inclusion of the MHC complex in comPACT mini-genes. Figure 11, for example, shows a Western blot of a comPACT protein comprising an MHC class I heavy chain complex.
[00243] MHC display portion means the MHC class I heavy chain comprising the α1, α2, and α3 domains.
[00244] "MHC" means major histocompatibility complex which is a set of genes that code for cell surface proteins essential for the acquired immune system or for recognizing foreign molecules. The main function of MHC molecules is to bind foreign antigens (including antigens presented on endogenous cells that cause damage to the organism, eg, a human) and display them on the cell surface for recognition by the appropriate T cell. The three subgroups of the MHC family are class I, class II, and class III.
[00245] "MHC class I" means the subgroup of the MHC family that comprises a beta-2 microglobulin subunit.
[00246] "Neoantigen" refers to an antigen that has at least one alteration that makes the neoantigen or neoantigen presentation distinct from its corresponding wild-type antigen, eg, polypeptide sequence mutations, the differences being modifications after translation or differences in expression level. "Neoantigen" and "tumor neoantigen" refer to a specific antigen on a cell that can be used as an identification target for killing. As applied to cancer and tumors, a neoantigen is an antigen that is specific for the tumor or cancer. As applied to pathogens and pathogen-infected cells, a neoantigen is an antigen that is specific for the pathogen or pathogen-infected cell. "Tumor neoantigens" refers to neoantigens that are derived from a tumor or cancer, eg, from a patient's tumor.
[00247] "neoTCR product" and "neoTCR T cell therapy" and "neoTCR T cell treatment" and "neoTCR T cells" are used interchangeably and all refer to the genetically engineered T cell that expresses a TCR which recognizes the neo-epitope that was identified and designed using comPACT polypeptides and polynucleotides and the imPACT isolation technology.
[00248] "Neo12" and "Neo12 protein" mean an exemplary neo-epitope.
[00249] "NTAmer" means a complex comprising comPACT polypeptides.
[00250] Available means, with respect to the design of a comPACT polynucleotide and the comPACT polypeptide made therefrom, the comPACT mini-gene comprising a Beta-2 microglobulin, an MHC heavy chain allele, and a place within this construct to insert a neoepitope. In certain embodiments, the order of the construct from 5' to 3' is 1) the neoepitope, 2) the Beta-2 microglobulin, and 3) the MHC heavy chain allele. In certain embodiments, signal sequences, universal target sites (eg, restriction enzyme sites), flexible linkers, and a purification pool are also incorporated into the construct. In certain embodiments, the structure of the construct with additional elements is the construct depicted in Figure 2.
[00251] "Operably associated" means, with respect to the particle construct, that each particle constructed using a given comPACT (with a specific neoantigen expressed therein) is associated with one or more barcodes unique to that particle. In this way, the downstream sequencing determination of which barcodes bind to a specific cell can be used to determine which comPACT (and in turn which neoantigen) was responsible for that binding.
[00252] Particle”, “set of particles”, “pair of particles” and “distinct set of particles” mean, with respect to the term “particle”, and refer to the comPACT core comprising substrates capable of being specifically sorted or isolated and to which components of the comPACT (and additional polypeptide, polynucleotide, and chemical matter) can be attached. In certain embodiments, a "set of particles" refers to a plurality of particles.
[00253] The terms "pharmaceutical composition" or "pharmaceutical formulation" refer to a preparation that is in such a form as to allow the biological amount of an active ingredient contained therein to be effective, and that does not contain additional components that are unacceptably toxic to a subject to which the pharmaceutical composition would be administered.
[00254] A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical composition or formulation, other than an active ingredient, that is non-toxic to a subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffering agent, excipient, stabilizer, or preservative.
[00255] As used herein, a polynucleotide or a nucleic acid are used interchangeably and include any compound and / or substance that comprises a polymer of nucleotides. Each nucleotide is made up of a base, specifically a purine or pyrimidine base (i.e. cytosine (C), guanine (G), adenine (A), thymine (T), or uracil (U)), a sugar (i.e. , deoxyribose or ribose), and a phosphate group. Often, the nucleic acid molecule is described by the sequence of bases, whereby the bases represent the primary structure (linear structure) of a nucleic acid molecule. The base sequence is usually represented from 5' to 3'. Polynucleotide refers to any DNA (including, but not limited to, cDNA, ssDNA, and dsDNA) and any RNA (including, but not limited to, ssRNA, dsRNA, and mRNA), and further includes synthetic forms of DNA and RNA, and mixed polymers comprising two or more of these molecules. One skilled in the art can understand which form is being referred to, eg, based on the context in which the polynucleotide is being used. The polynucleotide can be linear or circular. Furthermore, the term polynucleotide includes both sense and antisense strands, as well as single-stranded and double-stranded forms. The polynucleotide may contain naturally occurring or non-naturally occurring nucleotides. Examples of non-naturally occurring nucleotides include nucleotide bases modified with derived sugars or phosphate backbone bonds or chemically modified residues. Polynucleotides comprise DNA and RNA molecules that are suitable as a vector for direct expression of a polypeptide of the invention in vitro θ / or in vivo.
[00256] "Proliferative disorder" means excessive cell proliferation of one or more subsets of cells in a multicellular organism that results in damage (ie, discomfort or decreased lifespan) to the multicellular organism. Cell proliferative disorders can occur in different types of animals and humans. As used herein, proliferative disorders include neoplastic disorders.
[00257] "Protein" and "Polypeptide" are used interchangeably herein. 7Π7 / 3 / ΥΙΛΙ
[00258] "Purification pool" means the optional portion of the comPACT that includes a genetically encoded element that allows purification of the comPACT.
[00259] "Signal sequence" means a short peptide present at the N-terminus of a newly synthesized protein that is destined for the secretory pathway. A signal sequence can be included in a comPACT design and production.
[00260] As used herein, "treatment" (and grammatical variations thereof such as "treat" or "that treats") refers to clinical intervention in an attempt to alter the natural course of disease in the individual being treated and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing the occurrence or recurrence of the disease, alleviation of symptoms, lessening of any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression. , improvement or palliation of the disease state, and remission or improved prognosis. In some aspects, the antibodies of the invention are used to retard the development of a disease or to slow the progression of a disease.
[00261] Universal target site, universal target sequence, and universal sequence can be used interchangeably and mean a polynucleotide sequence that can be cleaved by a restriction enzyme or a primer binding site that can be used for the attachment of a primer and amplification of a desired sequence.
[00262] Vector", "expression vector" and "expression construct" can be used interchangeably and refer to discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof. As used herein, a vector can be modified and used for in vivo or in vitro expression of a polypeptide gene product encoded by a coding sequence inserted into the vector.
[00263] Young or younger as far as T cells are concerned means memory stem cells (TMSC) and central memory cells (TCM). These cells have T cell proliferation after specific activation and are competent for multiple cell divisions. They also have the ability to engraft after reinfusion, to rapidly differentiate into effector T cells after exposure to their cognate antigen and to target (or target) and kill tumor cells, as well as to persist for continued surveillance and control of the disease. cancer.
[00264] As used herein, the terms "barcoded T cell", "paired T cell", "T cell bound nanoparticle", and "T cell paired antigen MHC complex" refer to the complex of a cell T having a T cell receptor that binds to an antigen peptide presented by an MHC molecule in a barcoded NP-antigen-MHC complex (i.e., the particle-comPACT complex)
[00265] As used herein, antibody or antibodies is used in the broadest sense and encompasses various antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (eg, bispecific antibodies ) and antibody fragments, provided they exhibit the desired antigen-binding activity. An "antibody fragment" refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds to the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab1, Fab'-SH, F(abj2; diabodies; linear antibodies; single chain antibody molecules (for example, scFv and scFab); single domain (dAb) and multispecific antibodies formed from antibody fragments.
[00266] The term "in vivo" refers to processes that occur in a living organism, including a cell.
[00267] The term "mammal" as used herein includes both humans and non-humans and includes, but is not limited to, humans, non-human primates, canines, felines, murine, bovine, equine, and porcine.
[00268] The term percent sequence identity, in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotide or amino acid residues that are the same, when compared and aligned for maximum match, as measured using one of the sequence comparison algorithms described below (eg, BLASTP and BLASTN or other algorithms available to those skilled in the art) or by visual inspection. Depending on the application, percent sequence identity may exist over a region of the sequence being compared, eg, over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.
[00269] For sequence comparison, typically one sequence acts as a reference sequence, against which the test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequences relative to the reference sequence, based on the designated program parameters.
[00270] Optimal alignment of sequences for comparison can be accomplished, for example, by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981), for the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), for the search for a similarity method of Pearson and Lipman, Proc. Nat'l. Acad. Sci. USA85:2444 (1988), by computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics software package, Genetics Computer Group, 575 Science Dr., Madison, Wis.) or by visual inspection (see generally Ausubel et al., infra).
[00271] An example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyzes is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).
[00272] It should be noted that, as used in the specification and accompanying claims, the singular forms one, one, the" and "the" include plural referents unless the context clearly dictates otherwise. Other interpretative conventions
[00273] It is understood that the ranges cited herein are abbreviations for all values within the range, including the endpoints mentioned. For example, an interval from 1 to 50 is understood to include any number or fraction thereof, combination of numbers or fractions thereof, or subinterval of the group (including fractions of any of the numbers in the group) consisting of 1, 2 , 3, 4, 5, 6, 7, 8, 9, 10, 11,12, 13, 14, 15, 16, 17, RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50. Introduction
[00274] T cell-mediated immunity can be characterized by the activation of antigen-specific cytotoxic T cells that are capable of inducing death in cells displaying antigen on a major histocompatibility complex (MHC) on their surface. These cells that display an antigen-loaded MHC complex include virus-infected cells, cells with intracellular bacteria, cells that have internalized or phagocytosed extracellular sources of protein, and cancer cells that display tumor antigens.
[00275] A natural MHC class I heavy chain comprises approximately 350 amino acids; a natural β2 microglobulin comprises about 100 amino acids, and a class I antigen peptide is usually about 7 to about 15 amino acids in length. Class I heavy chains are encoded by major histocompatibility complex genes, designated HLA-A, -B, and -C in humans, and H-2K, D, and L in mice. Class I heavy chains and β2 microglobulin are encoded separately on different chromosomes. Antigen peptides are normally processed by cells from protein sources such as, for example, viruses, bacteria, or cancer cells. Various variants have been identified for the polypeptides encoded by the human HLA-A, -B, and -C MHC genes, as well as the murine H-2K, D, and L MHC genes.
[00276] The embodiments of the method described herein refer to a method of producing a single molecule in which a selected neoantigen binds to an MHC complex comprising a β2 microglobulin (β2Μ) and an MHC heavy chain. Different MHC heavy chains can be linked to the β2Μ molecule to form a variable number of MHC templates. The methods described herein for inserting a neoantigen into an MHC template via restriction digest or PCR-based assembly by using universal target sequences flanking the neoepitope insertion site (also known as the neoepitope insertion site). neoantigens) result in the ability to build a library of different neoantigen-MHC complexes in a high-throughput method that can be customized for a given patient. These complexes are referred to as comPACT proteins and can then be linked, for example, to a particle, barcoded particle, or surface for use in isolating and identifying patient-specific T cell populations targeted to patient-specific neoantigens. Methods of binding antigen-MHC complexes and the use of these complexes are described in PCT / US2018 / 21611, filed March 8, 2018, incorporated herein by reference in its entirety. Peptide and nucleotide compositions MHC complex
[00277] In summary, as used herein, comPACT polypeptide refers to MHC molecules expressed as a single fusion polypeptide of a universal target sequence, an antigen peptide, a second universal target sequence, a β2 microglobulin , and an MHC class I heavy chain comprising the cd, cc2 and a3 domains which form an MHC display portion. The comPACT polypeptides described herein may further optionally comprise linker sequences between any or all of the individual components of the comPACT polypeptide. An example of the placement of optional linker sequences within a comPACT polypeptide is presented in the comPACT mini-gene of Figure 1. An MHC display portion can include a recombinant MHC molecule. The design and manufacture of individual comPACT polypeptides and libraries of comPACT polypeptide molecules are described in International Application PCT / US2019 / 025415, filed April 2, 2019, which is hereby incorporated by reference in its entirety. In certain embodiments, the comPACT polypeptides may comprise disulfide traps, as described in US Publication No. 2009 / 0117153 and US Publication No. 2008 / 0219947; each of which is incorporated herein by reference. The antigen-MHC complex formed by a comPACT protein results in the display of antigens such that they are capable of recognition by a cognate TCR molecule. In some embodiments, the MHC complex may be an MHC class I (MHC I) complex that pairs with CD8-positive (CD8+) "killer T" cells. In some embodiments, the MHC complex may be an MHC class II (MHC II) complex that pairs with CD4-positive (CD4+) T cells.
[00278] In some embodiments, the MHC class I heavy chain sequence of a comPACT may include individual amino acid substitutions, additions, and / or deletions, such as a substitution of Tyr-84 with a non-aromatic amino acid other than proline. . In these embodiments, the amino acid substitution can be any amino acid encoded by the standard genetic code such as leucine, isoleucine, valine, serine, threonine, alanine, histidine, glutamine, asparagine, usin, aspartic acid, glutamic acid, cysteine, arginine, serine or glycine, or it may be a modified or unusual amino acid. In one embodiment, the MHC class I heavy chain sequence of a comPACT comprises a tyrosine-84 to alanine substitution. In another embodiment, the MHC class I heavy chain sequence of a comPACT comprises a tyrosine-84 to cysteine substitution.
[00279] β2-microglobulin (β2Μ) may include a recombinant β2Μ molecule. In some embodiments, the β2Μ sequence may include individual amino acid substitutions, additions, and / or deletions as described above. In one embodiment, this substitution comprises a substitution of Serine-88 to cysteine. In one embodiment, the substitution may be a substitution of any naturally occurring non-cysteine amino acid of β2Μ to a cysteine wherein the substitution does not adversely affect the function of β2Μ within the comPACT polypeptide and the substitution allows for conjugation of moieties. thiol reactive. These substitutions can be achieved, for example, by cysteine screening of the protein using mutagenesis techniques known to one of skill in the art. These thiol-reactive moieties can be used to utilize the comPACT β2Μ polypeptide or whole polypeptide detection. In certain embodiments, the thiol-reactive portion is a thiol-reactive dye (fluorophore) conjugate which enabled the comPACT to be used to measure TCR-comPACT binding kinetic parameters (see, eg, Example 8). In certain embodiments, the thiol-reactive moiety is a dye (fluorophore) comprising a sulfhydryl-reactive crosslinker reactive group, including but not limited to maleimides, iodoacetamide or derivatives thereof, haloacetyls, pyridyl disulfides, and all others. thiol-reactive conjugation partners (see, for example, Haugland, 2003, Molecular Probes Handbook of Fluorescent Probes and Research Chemicals, Molecular Probes, Inc.; Brinkley, 1992, RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ Bioconjugate Chem. 3:2; Garman, 1997, Non-Radioactive Labelling: A Practical Approach, Academic Press, London; Means (1990) Bioconjugate Chem. 1:2; Hermanson, G. in Bioconjugate Techniques (1996) Academic Press, San Diego, pp. 40-55, 643-671). Universal Sequences
[00280] An antigenic peptide is generally flanked by universal sequences or portions thereof. These sequences allow rapid, high-throughput methods to replace or insert the antigenic peptide encoding the nucleotide into the polynucleotide MHC template. Universal sequences may comprise restriction sites for restriction digest-based cloning. Exemplary restriction sites include, but are not limited to, Nco1, BamHI, Blpl, BspEI, BstBI, Xbal, Hindlll, EcoRI, Apal, Notl, any restriction sites not present on the β2Μ, the heavy chain of MHC, the NeoE, the signal sequence (if present) the purification pool (if present), or the fusion of any component thereof (including optional linker sequences), and any combination of these. Alternatively, the universal sequence can be a primer binding site. Universal primer sequences known in the art can be used in the compositions and methods described herein, or the sequences can be different than the universal primer sequences described above and can be designed to promote specific binding / amplification and eliminate binding / nonspecific amplification. Universal sequences can be 4-50, 4-15, 15-40, 15-35, 15-30, 20-40, 25-40, or 30-40 nucleotides in length. Universal sequences can be at least 4, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotides in length. In some embodiments, the universal target sequence is 4-8 nucleotides in length. In other embodiments, the universal target sequence is between 9-25 nucleotides in length. In other embodiments, the universal target sequence is between 25-35 nucleotides in length. In other embodiments, the universal target sequence is at least about 15 nucleotides in length. In certain aspects, one or more universal target sequences are not present in the genetic material being manipulated, for example, to reduce or eliminate off-target effects and / or to increase specificity. Liqadores
[00281] In various embodiments, a comPACT may comprise a first flexible linker interposed between the antigenic peptide segment and the β2-microglobulin segment. These linkers can extend from and connect the carboxyl terminus of the antigenic peptide segment to the amino terminus of the β2 microglobulin segment. In a non-limiting example, when a comPACT is expressed, the linked peptide ligand can fold into the binding groove resulting in a functional comPACT protein. In various embodiments, the linker is at least about 10 amino acids and up to about 15 amino acids. In various embodiments, the linker is between 4 and 32 amino acids.
[00282] In various embodiments, a comPACT may comprise a second flexible linker interposed between the β2-microglobulin segment and the MHC heavy chain segment. These linkers can extend from and connect the carboxyl terminus of the β2 microglobulin segment to the amino terminus of the heavy chain segment of RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ 7Π7 / 3 / ΥΙΛΙ MHC. In a non-limiting example, when a comPACT is expressed, β2 microglobulin and the MHC heavy chain can fold into the junction gap resulting in a molecule that can function to promote T cell expansion. In various embodiments, this linker can comprise at least about 15 amino acids, up to about 20 amino acids. In various embodiments, the linker is at least about 10 amino acids and up to about 15 amino acids. In various embodiments, the linker is between 4 and 32 amino acids.
[00283] In various embodiments, a comPACT may comprise a third flexible linker interposed between the MHC heavy chain segment and the purification pool. These linkers can extend from and connect the carboxyl terminus of the MHC heavy chain segment and the amino terminus of the purification group. In various embodiments, the linker is at least about 10 amino acids and up to about 15 amino acids. In various embodiments, the linker is between 4 and 32 amino acids. In various embodiments, the linker is only 2 or 3 amino acids long.
[00284] In certain embodiments, the same linker can be used for the first and second linkers, and optionally the third linker if present. In certain embodiments, the same linker is used for the first, second, and third linker. In certain embodiments, the three linkers are the (G4S)4 linker (SEQ ID NO: 19). In certain embodiments, all three linkers are a (G3S)n linker (SEQ ID NO: 201). In certain embodiments, all three linkers are a (GSGGS)n linker (SEQ ID NO: 11). In certain embodiments, all three linkers are a (GCGGS)n linker (SEQ ID NO: 13).
[00285] In certain embodiments, different sequences are used for each of the first and second linkers, and optionally the third linker if present.
[00286] In certain embodiments, two of the first, second, and optionally third linkers are the same and one is different.
[00287] Any suitable flexible linker sequence known in the art can be used. Appropriate linker sequences include, but are not limited to, glycine-serine sequences comprising repeat units of a sequence motif of GGGGS (G4S) (SEQ ID NO: 9), GGGS (G3S) (SEQ ID NO: 201), GSGGS (SEQ ID NO: 11), or GCGGS (SEQ ID NO: 13). In certain embodiments, a cleavable linker could be used for any of the first, second, and third linkers. In certain embodiments, a cleavable linker is used only for the first, second, or third linker. In certain embodiments, a cleavable linker is used only for the first linker. In certain embodiments, a cleavable linker is used only for the second linker. In certain embodiments, a cleavable linker is used only for the third linker.
[00288] In certain embodiments, the linkers (first, second, and / or third) could be selected from a group comprising rigid or less flexible linkers. signal sequences
[00289] In various embodiments, the comPACT polynucleotide and polypeptide comprises a signal sequence and a signal peptide. In one embodiment, the signal sequence is the human growth hormone (hGH) signal sequence. Additional signal sequences may also be used, including but not limited to the β2Μ signal sequence, or any other eukaryotic or prokaryotic signal sequence known in the art. Any signal sequence that directs the comPACT protein to the secretory pathway (for secretion of the comPACT from the cell) could be used.
[00290] In certain embodiments, the signal sequence comprises the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the signal sequence comprises the nucleic acid sequence of SEQ ID NO: 1.
[00291] The signal sequence can be between 70 and 80 nucleotides in length. The signal sequence can be between 40-90, 40-60, 45-70, 50-80, 60-90, 55-70, 60-80, or 70-80 nucleotides in length. The signal peptide can be between 10-30, 10-20, 15-30 or 20-30 amino acids in length. promoters
[00292] A comPACT polynucleotide composition may further comprise a promoter for transcription of the encoded polynucleotide into an mRNA transcript that can be translated by the host cell. Promoters can be prokaryotic, viral, or eukaryotic (eg, but not limited to mammalian) in origin. Any suitable promoter can be used for gene transcription in a cell. In certain embodiments, a eukaryotic promoter may be used. In certain embodiments, the type of eukaryotic promoter is a constitutive promoter, an inducible promoter, or a specific promoter. In certain embodiments, the eukaryotic promoter is an EF1a, cytomegalovirus (CMV), CAG, PGK, RE, U6, or UAS promoter. In certain embodiments, a prokaryotic promoter may be used. In certain embodiments, the type of prokaryotic promoter is a constitutive promoter, a constitutive promoter that requires the presence of a specific polymerase (for example, a T7 or Sp6 RNA polymerase), a promoter that is constitutive in the absence of a repressor and inducible in the presence of an inducer (for example, and not limited to, the lac promoter that is constitutive in the absence of a lac repressor but can be induced by IPTG or lactose), an inducible promoter, a repressible promoter, or a regulated promoter. In certain embodiments, the prokaryotic promoter is a T7, Sp6, lac, araBad, trp, or Ptac promoter. In certain embodiments, a viral promoter can be used. In certain embodiments, the type of viral promoter is an AAV promoter or an SV40 promoter.
[00293] In some embodiments, the comPACT polynucleotide comprises an SV40 or any viral promoter. In certain embodiments, a strong viral promoter may be beneficial depending on the cell line and reagents.
[00294] In some embodiments, the comPACT polynucleotide comprises a CMV promoter. affinity tags
[00295] A comPACT polynucleotide composition may further comprise at least one sequence encoding an affinity tag or epitope tag. In some embodiments, the comPACT polynucleotide comprises at least two affinity tag or epitope tag sequences. Any suitable affinity tag or epitope tag can be used on the comPACT polynucleotide or polypeptide. These epitope tags include, but are not limited to, AviTag (or any avidin / streptavidin tag), strep tag, polyhistidine (His6) tag (SEQ ID NO: 34), FLAG tag, HA tag, and Myc label. Sequences in the comPACT gene of polynucleotides are translated into peptides in the comPACT polypeptide. These epitope tags can be used for affinity chromatography purification or quantification of the expressed comPACT polypeptide. For example, the His6 tag (SEQ ID NO: 34) can be used to purify the comPACT protein by HA-tag binding affinity chromatography. In certain embodiments, a metal ion resin can be used to purify an HA-tagged protein. In certain embodiments, a NI2+ (nickel) resin, Co2+ (cobalt) resin, Cu2+ (copper) resin, Ca2+ (calcium) resin, Zn2+ (zinc) resin, or any combination thereof can be used to purify a protein tagged with HA. In certain embodiments, a NI2+ resin is used to purify an HA-tagged comPACT protein. In certain embodiments, a mixture of a NI2+ and Zn2+ resin is used to purify an HA-tagged comPACT protein. In certain embodiments, the resin is an immobilized metal affinity chromatography (IMAC) resin. In certain embodiments, the metal ion is coupled to the resin matrix with a chelating ligand. In certain embodiments, the metal ion is coupled to the resin matrix with nitrilotriacetic acid (NTA) or iminodiacetic acid (Ida).
[00296] In addition, the AviTag encodes a known biotinylation site that is recognized by the BirA enzyme. Inclusion of this peptide sequence in a protein allows biotinylation of the sequence by enzymatic modification by BirA. Accordingly, a comPACT polypeptide comprising an AviTag sequence (or any avidin / streptavidin tag) and a His6 tag (SEQ ID NO: 34) can be biotinylated, purified by metal affinity chromatography (eg, affinity with Ni-NTA or any other metal affinity resin described herein) by His6 tag (SEQ ID NO: 34), and the purity or quantity of the purified protein assessed by biotin visualization with streptavidin or other reagents of avidin. In some embodiments, the comPACT polynucleotide comprises an AviTag (or any avidin / streptavidin tag) sequence. In some embodiments, the comPACT polypeptide comprises an AviTag (or any avidin / streptavidin) epitope. In some embodiments, the comPACT polynucleotide comprises a His6 sequence (SEQ ID NO: 34). In some embodiments, the comPACT polypeptide comprises a His6 epitope (SEQ ID NO: 34). In some embodiments, the comPACT polynucleotide comprises an AviTag (or any avidin / streptavidin) sequence and a His6 sequence (SEQ ID NO: 34). In some embodiments, the comPACT polypeptide comprises an AviTag (or any avidin / streptavidin) epitope and a His6 epitope (SEQ ID NO: 34). Protease cleavage sites
[00297] A comPACT polynucleotide composition may further comprise a sequence encoding a protease cleavage site in the purification pool. This cleavage site can be encoded between the first and second affinity tag sequences and allows for cleavage of the second affinity tag from the comPACT protein once the comPACT has been expressed and subjected to a round of purification. Any suitable protease cleavage site known in the art can be used, including, but not limited to, cleavage sites that are recognized by TEV, thrombin, Factor Xa, enteropeptidases, and rhinovirus 3C protease, among others. In one embodiment, the nucleotide sequence of the protease cleavage site encodes a TEV cleavage site. In another embodiment, the comPACT polypeptide comprises a TEV protease cleavage site. poly A tail
[00298] A comPACT polynucleotide composition may further comprise a polyadenylation (polyA) tail. Eukaryotic (including mammalian) or prokaryotic polyA sequence motifs may be used. This sequence can be included when the comPACT polynucleotide is assembled by PCR for direct transfection into a host cell (eg, not in the context of a vector or expression construct). Any appropriate poly A tail and sequence motif can be used in the comPACT polynucleotide, including, but not limited to, the polyA tails of the SV40, hGH, bGG, and rbGlob sequences. These sequences include the AAUAA sequence motif. In one embodiment, the comPACT polynucleotide comprises a BHG polyA tag sequence. antigenic sequences
[00299] Antigenic sequences (ie, the sequence of the neoantigen that the neoepitope portion of the comPACT polypeptide is designed to bind to) can be between 20-60, between 20-30, between 25-35, between 20-45 , between 30-45, between 40-60 or between 45-60 nucleotides in length. The antigenic peptide may be or may be derived from an exogenous antigen, an endogenous antigen (including heterologous, autologous, and homologous antigens), or an autoantigen. The antigenic peptide may be or may be derived from an antigen that originates as an exogenous antigen and then later becomes an endogenous antigen (eg, an intracellular virus). The antigenic peptide can be or can be derived from a tumor antigen, a neoantigen, a tumor neoantigen, a viral antigen, a bacterial antigen, a phosphoantigen, or a microbial antigen. In one embodiment, the antigenic peptide is a neoantigen. Antigenic peptides may be selected from patient data and may comprise one or more somatic mutations.
[00300] In order to make a comPACT library inclusive of multiple neoepitopes and, in turn, multiple comPACT polypeptides, antigenic sequences need to be predicted and identified. The antigenic peptide prediction can include an algorithm that is predictive and can be designed to predict the binding of the antigenic peptide or neoantigen and an MHC allele. Antigenic peptide prediction is discussed further below.
[00301] In some embodiments, the nucleotide sequence encoding an antigenic peptide is between 20-60, between 20-30, between 25-35, between 20-45, between 30-45, between 40-60 or between 45-60 nucleotides in length. In other embodiments, the nucleotide sequence encoding an antigenic peptide is between 20-30 nucleotides in length. In some embodiments, the antigenic peptide is 7-15 amino acids, 7-10, 8-9, 7, 8, 9, 10, 11,12,13, 14, or 15 amino acids in length. biotinylation
[00302] The comPACT proteins described herein can be further biotinylated by any appropriate method. One of these methods uses the biotinylated BirA-protein ligase and is commercially available. A specific amino acid sequence, known as the AviTag sequence (GLNDIFEAQKIEWHE (SEQ ID NO: 30)), is encoded in the protein of interest. BirA ligase, d-biotin, and ATP are added to a reaction mixture containing the protein of interest. BirA covalently ligates biotin to Physin in the AviTag sequence, thereby biotinylating the protein of interest. The freshly biotinylated protein can then be purified and used in downstream applications. Other methods known in the art for biotinylating proteins can also be used. For clarity, any applicable avidin / streptavidin sequence can be used in the comPACT protein preparation. Expression constructs and vectors
[00303] comPACT polynucleotide molecules can be inserted into expression constructs or vectors RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ, eg, for plasmid (to increase the amount of expression constructs or expression vectors encoding the comPACT polynucleotide for protein production) and protein production. The expression construct or expression vector can be a eukaryotic, prokaryotic, or viral expression vector. Any suitable expression construct or expression vector known in the art may be used, including bacterial expression plasmids, such as Escherichia coli or Bacillus subtilis plasmids; eukaryotic expression vectors, such as mammalian expression vectors or yeast expression vectors; or viral vectors, such as adenovirus expression vectors, lentiviral expression vectors, vaccinia expression vectors, or baculovirus expression vectors. Mammalian expression constructs or expression vectors (eg, transfected) can be used in cultured mammalian cell lines such as Chinese Hamster Ovary (CHO), J558, NSO, SP2-O, HEK293, HECK293T, Exp¡293, HeLa, or any derivative or modification of CHO, HEK293, Exp¡293, or HeLa cell lines, and any other suitable mammalian cell line. The mammalian expression constructs or expression vectors can be used in primary mammalian cell lines such as immune cells or tumor cells purchased directly from an organism (eg, a human) or harvested (eg, from a human). , frozen, and then thawed as needed. In addition to mammalian expression vectors and expression constructs, where appropriate, eukaryotic (eg, transfected) expression vectors and expression constructs may be used in insect cell lines such as Sf9 or Sf12 (or any derivatives or modifications). of these) or yeast cell lines such as Pichia pastoris (or any derivative or modification thereof). Additionally, the expression construct or expression vector may comprise a nucleotide barcode. The nucleotide barcode may be unique for each expression vector or construct. In some embodiments, the nucleotide sequences encoding the signal sequence, beta-2 microglobulin, and MHC allele can be ligated into an expression construct or expression vector with a dummy or antisense antigen insert. This non-coding antigen insert can then be removed by an appropriate cloning technique, such as restriction digest, and a desired antigen sequence (as used herein for clarity, antigen sequence refers to the sequence of neoantigen) inserted by ligation or any other appropriate cloning technique.
[00304] In some aspects, a comPACT library is provided herein comprising two or more comPACT polypeptides. These libraries are created by encoding two or more comPACT polypeptides into expression constructs or expression vectors. In certain embodiments, each expression construct or expression vector comprises an individual comPACT polynucleotide. In certain embodiments, the number of expression constructs or expression vectors (each expression construct or expression vector may be the same expression construct or expression vector) is the same number as the number of different comPACT polynucleotides. In certain embodiments, comPACT polynucleotides are inserted into expression constructs or expression vectors using the same or a different universal target site. In other aspects, MHC libraries comprising two or more MHC are provided herein. These libraries are created by encoding two or more MHC polypeptides into expression constructs or expression vectors. In other aspects, HLA libraries are provided herein RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ comprising two or more HLAs. These libraries are created by encoding two or more HLA polypeptides into expression constructs or expression vectors. host cells
[00305] In another aspect, provided herein are host cells comprising the polynucleotide molecule or expression construct as described herein. The host cell can be any suitable host cell known in the art, including, but not limited to, bacterial cells such as Escherichia coli or Bacillus subtilis, or eukaryotic host cells such as Chinese Hamster Ovary (CHO), J558, NSO, SP2- Or, HEK293, HEK293T, Exp¡293, HeLa, insect cell lines such as Sf9 or Sf12, yeast cells such as Pichia pastoris, another suitable eukaryotic or prokaryotic cell line that would be scientifically reasonable based on construct and vector selection , or any derivative or modification of any of these cell lines. Host cells can also stably express the BirA biotinylation enzyme. The host cell can be a primary cell or an immortalized cell line.
[00306] In some embodiments, the polynucleotide integrates into the cellular genome. In some embodiments, the polynucleotide is extrachromosomal. In some embodiments, the host cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is selected from the group consisting of a stem cell, a tumor cell, an immortalized cell, and a fetal cell. In some embodiments, the host cell is a prokaryotic cell. In some embodiments, the cell is an Escherichia coli cell. In some embodiments, the cell expresses a BirA protein or fragment thereof.
[00307] In certain embodiments, any of the expression constructs or expression vectors described herein can be inserted into a host cell (eg, inserted via transfection, transformation, or a similar process based on the type of host cell) for the production of polypeptides. In certain embodiments, expression constructs or expression vectors encoding comPACT polypeptide, MHC, or HLA libraries as described above can be inserted into a host cell (eg, inserted via transfection, transformation, or a similar process based on the host cell type) for the production and purification of polypeptides. In certain embodiments, expression constructs or expression vectors encoding comPACT polypeptide libraries as described below can be inserted into a host cell (eg, inserted via transfection, transformation, or a similar process with based on host cell type) for the production and purification of polypeptides. Libraries
[00308] In certain embodiments, the libraries comprise two or more different comPACT polynucleotide molecules. In certain embodiments, the libraries comprise two or more distinct polypeptide molecules. In certain embodiments, the libraries comprise two or more different comPACT polypeptide molecules bound to particles.
[00309] In certain embodiments, any of the 1) comPACT polynucleotide library, 2) comPACT polypeptide library, or 3) comPACT polypeptide binding particle libraries, contain more than RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ two respective molecules in the respective library. In certain embodiments, any of the 1) comPACT polynucleotide library, 2) comPACT polypeptide library, or 3) comPACT polypeptide binding particle libraries, have no upper limit to the number of respective molecules in the respective library and in turn contain as many respective comPACT polypeptides, particle-bound comPACT polypeptides, or comPACT polynucleotides. In certain modalities, the upper limit is determined by the amount of tumor neoantigens detected. In certain embodiments, the upper limit is determined by the number of potential neoepitopes identified based on the detected tumor neoantigens. In certain embodiments, the upper limit is determined by an algorithm.
[00310] A library can comprise from 2 to 1000 comPACT polypeptides, particle-bound comPACT polypeptides, or comPACT polynucleotides. In some embodiments, a library comprises between 2-900, 2-800, 2700, 2-600,2-500, 2-480, 2-400, 2-300, 2-200, 2-100, 2-50, 2-66, 2-48, 2-30, 2-20, 2-19, 10-1000,10-900,10-800, 10-700, 10-600,10-500,10-480,10- 400,10-300,10-200,10-100,10-50,10-66,10-48,10-30,10-20, 20-1000, 20-900, 20-800, 20700, 20- 600, 20-500, 20-480, 20-400, 20-300, 20-200, 20-100, 20-50, 20-50, 20-66, 20-48, 20-30, 30-1000, 30-900, 30800, 30-700, 30-600, 30-500, 30-480, 30-400, 30-300, 30-200, 30-100, 30-50, 30-50, 30-66, 30-48, 30-40, 40-1000, 40900, 40-800, 40-700, 40-600, 40-500, 40-480, 40-400, 40-300, 40-200, 40-100, 40-60, 40-50, 40-66, 40-48, 50-1000, 50-900, 50-800, 50-700, 50-600, 50-500, 50-480, 50-400, 50-300, 50-200, 50-100, 50-60, 50-66, 60-1000, 60-900, 60-800, 60-700, 60-600, 60-500, 60-480, 60-400, 60- 300, 60-200, 60-100, 70-1000, 70-900, 70-800, 70-700, 70-600, 70-500, 70-480, 70-400, 70-300, 70-200, 70- 100, 70-80, 70-90, 80-1000, 80-900, 80-800, 80-700, 80-600, 80-500, 80-480, 80-400, 80-300, 80-200, 80-100 comPACT polypeptides, particle-bound comPACT polypeptides, or comPACT polynucleotides. In some embodiments, the library comprises between 2-19, 48-480, between 48-66, between 66-480, between 220-240, between 40-60, between 48-66, between 50-70 or between 60-80 polypeptides of comPACT, particle-bound comPACT polypeptides, or comPACT polynucleotides. In some embodiments, the library comprises at least 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 48, 50, 55, 60, 65, 66, 70, 75, 80, 85, 90 , 100, 110,120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 600 comPACT polypeptides, particle-bound comPACT polypeptides, or comPACT polynucleotides. In some embodiments, the library comprises 2, 10, 15, 20, 24, 48, 66, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 comPACT polypeptides, comPACT polypeptides linked to comPACT particles, or polynucleotides. In some embodiments, the two or more comPACT polypeptides, particle-bound comPACT polypeptides, or comPACT polynucleotides in a library have different neoepitope sequences and different MHC sequences.
[00311] In certain embodiments, the library comprises two or more comPACT polynucleotides wherein each comPACT polynucleotide in the library comprises a neoepitope sequence and an MHC heavy chain sequence corresponding to the neoantigen detected from a patient sample.
[00312] In some embodiments, the library comprises more than or equal to two distinct polynucleotide molecules, wherein each distinct polynucleotide molecule comprises (i) the first universal sequence, (ii) the first universal sequence, ΖηΖ / 3 / ΥΙΛΙ of nucleotides encoding an antigenic peptide, where the nucleotide sequence is not the same for each of the more than or equal to two polynucleotide molecules, (iii) the second universal target sequence, (iv ) the sequence of β2Μ, and (v) the sequence of MHC alleles. In some embodiments, the MHC allele sequence is not the same for each of the greater than or equal to two polynucleotide molecules.
[00313] In one embodiment, the library comprises at least two or more of HLA-A*01:01, HLA-A*02:01, HLAA*03:01, HLA-A*24:02, HLA-A* 30:02, HLA-A*31:01, HLA-A*32:01, HLA-A*33:01, HLA-A*68:01, HLA-A*11:01, HLAA*23:01, HLA-A*30:01, HLA-A*33:03, HLA-A*25:01, HLA-A*26:01, HLA-A*29:02, HLA-A*68:02, HLA- B*07:02, HLAΒΊ4Ό2, HLA-B*18:01, HLA-B*27:02, HLA-B*39:01, HLA-B*40:01, HLA-B*44:02, HLA- B*46:01, HLA-B*50:01, HLAB*57:01, HLA-B*58:01, HLA-B*08:01, HLA-B*15:01, HLA-B*15: 03, HLA-B*35:01, HLA-B*40:02, HLA-B*42:01, HLAB*44:03, HLA-B*51:01, HLA-B*53:01, HLA- B*13:02, HLA-B*15:07, HLA-B*27:05, HLA-B*35:03, HLA-B*37:01, HLAB*38:01, HLA-B*41: 02, HLA-B*44:05, HLA-B*49:01, HLA-B*52:01, HLA-B*55:01, HLA-C*02:02, HLA-C*03:04, HLAC*05:01, HLA-C*07:01, HLA-C*01:02, HLA-C*04:01, HLA-C*06:02, HLA-C*07:02, HLA-C* 16:01, HLA-C*03:03, HLAC*07:04, HLA-C*08:01, HLA-C*08:02, HLA-C*12:02, HLA-C*12:03, HLA-C*14:02, HLA-C*15:02, and HLA-C*17:01 alleles. In one embodiment, the library comprises at least HLA-A*01:01, HLA-A*02:01, HLA-A*03:01, HLA-A*24:02, HLA-A*30:02, HLA -A*31:01, HLA-A*32:01, HLA-A*33:01, HLA-A*68:01, HLA-ΑΊ 1:01, HLA-A*23:01, HLA-A* 30:01, HLA-A*33:03, HLAA*25:01, HLA-A*26:01, HLA-A*29:02, HLA-A*68:02, HLA-B*07:02, HLA-B*14:02, HLA-B*18:01, HLA-B*27:02, HLAB*39:01, HLA-B*40:01, HLA-B*44:02, HLA-B* 46:01, HLA-B*50:01, HLA-B*57:01, HLA-B*58:01, HLA-B*08:01, HLAΒΊ5Ό1, HLA-B*15:03, HLA-B* 35:01, HLA-B*40:02, HLA-B*42:01, HLA-B*44:03, HLA-B*51:01, HLA-B*53:01, HLAΒΊ3Ό2, HLA-B* 15:07, HLA-B*27:05, HLA-B*35:03, HLA-B*37:01, HLA-B*38:01, HLA-B*41:02, HLA-B*44: 05, HLAB*49:01, HLA-B*52:01, HLA-B*55:01, HLA-C*02:02, HLA-C*03:04, HLA-C*05:01, HLA- C*07:01, HLA-C*01:02, HLAC*04:01, HLA-C*06:02, HLA-C*07:02, HLA-C*16:01, HLA-C*03: 03, HLA-C*07:04, HLA-C*08:01, HLA-C*08:02, HLAC*12:02, HLA-C*12:03, HLA-C*14:02, HLA- C*15:02, and HLA-C*17:01 alleles.
[00314] In certain embodiments, the HLA library comprises HLA-A*01:01, HLA-A*02:01, HLA-A*03:01, HLAΑΊ1Ό1, HLA-A*23:01, HLA-A* 24:02, HLA-A*25:01, HLA-A*26:01, HLA-A*29:02, HLA-A*30:01, HLA-A*30:02, HLAA*31:01, HLA-A*32:01, HLA-A*33:01, HLA-A*33:03, HLA-A*68:01, HLA-A*68:02, HLA-B*07:02, HLA- B*08:01, HLAΒΊ3Ό2, HLA-B*14:02, HLA-B*15:01, HLA-B*15:03, HLA-B*15:07, HLA-B*18:01, HLA- B*27:02, HLA-B*27:05, HLAB*35:01, HLA-B*35:03, HLA-B*37:01, HLA-B*38:01, HLA-B*39: 01, HLA-B*40:01, HLA-B*40:02, HLA-B*41:02, HLAB*42:01, HLA-B*44:02, HLA-B*44:03, HLA- B*44:05, HLA-B*46:01, HLA-B*49:01, HLA-B*50:01, HLA-B*51:01, HLAB*52:01, HLA-B*53: 01, HLA-B*55:01, HLA-B*57:01, HLA-B*58:01, HLA-C*01:02, HLA-C*02:02, HLA-C*03:03, HLAC*03:04, HLA-C*04:01, HLA-C*05:01, HLA-C*06:02, HLA-C*07:01, HLA-C*07:02, HLA-C* 07:04, HLA-C*08:01, HLAC*08:02, HLA-C*12:02, HLA-C*12:03, HLA-C*14:02, HLA-C*15:02, HLA-C*16:01, HLA-C*17:01. In certain embodiments, the HLA library consists of HLA-A*01:01, HLA-A*02:01, HLA-A*03:01, HLA-A*11:01, HLA-A*23:01, HLA-A*24:02, HLAA*25:01, HLA-A*26:01, HLA-A*29:02, HLA-A*30:01, HLA-A*30:02, HLA-A* 31:01, HLA-A*32:01, HLA-A*33:01, HLAA*33:03, HLA-A*68:01, HLA-A*68:02, HLA-B*07:02, HLA-B*08:01, HLA-B*13:02, HLA-B*14:02, HLA-B*15:01, HLAΒΊ5Ό3, HLA-B*15:07, HLA-B*18:01, HLA-B*27:02, HLA-B*27:05, HLA-B*35:01, HLA-B*35:03, HLA-B*37:01, HLA7.f\7.nrVW B*38:01, HLA-B*39:01, HLA-B*40:01, HLA-B*40:02, HLA-B*41:02, HLA-B*42:01, HLA-B* 44:02, HLA-B*44:03, HLAB*44:05, HLA-B*46:01, HLA-B*49:01, HLA-B*50:01, HLA-B*51:01, HLA-B*52:01, HLA-B*53:01, HLA-B*55:01, HLAB*57:01, HLA-B*58:01, HLA-C*01:02, HLA-C* 02:02, HLA-C*03:03, HLA-C*03:04, HLA-C*04:01, HLA-C*05:01, HLAC*06:02, HLA-C*07:01, HLA-C*07:02, HLA-C*07:04, HLA-C*08:01, HLA-C*08:02, HLA-C*12:02, HLA-C*12:03, HLAC* 14:02, HLA-C*15:02, HLA-C*16:01, HLA-C*17:01. In certain embodiments, the HLA library comprises at least 50%, 60%, 70%, 80%, or 90% or more of the following HLA alleles: HLA-A*01:01, HLA-A*02:01 , HLA-A*03:01, HLAΑΊ1Ό1, HLA-A*23:01, HLA-A*24:02, HLA-A*25:01, HLA-A*26:01, HLA-A*29:02 , HLA-A*30:01, HLA-A*30:02, HLAA*31:01, HLA-A*32:01, HLA-A*33:01, HLA-A*33:03, HLA-A *68:01, HLA-A*68:02, HLA-B*07:02, HLA-B*08:01, HLAΒΊ3Ό2, HLA-B*14:02, HLA-B*15:01, HLA-B *15:03, HLA-B*15:07, HLA-B*18:01, HLA-B*27:02, HLA-B*27:05, HLAB*35:01, HLA-B*35:03 , HLA-B*37:01, HLA-B*38:01, HLA-B*39:01, HLA-B*40:01, HLA-B*40:02, HLA-B*41:02, HLAB *42:01, HLA-B*44:02, HLA-B*44:03, HLA-B*44:05, HLA-B*46:01, HLA-B*49:01, HLA-B*50 :01, HLA-B*51:01, HLAB*52:01, HLA-B*53:01, HLA-B*55:01, HLA-B*57:01, HLA-B*58:01, HLA -C*01:02, HLA-C*02:02, HLA-C*03:03, HLAC*03:04, HLA-C*04:01, HLA-C*05:01, HLA-C*06 :02, HLA-C*07:01, HLA-C*07:02, HLA-C*07:04, HLA-C*08:01, HLAC*08:02, HLA-C*12:02, HLA -C*12:03, HLA-C*14:02, HLA-C*15:02, HLA-C*16:01, HLA-C*17:01.
[00315] In some embodiments, the library comprises more than or equal to two distinct polypeptide molecules, where the antigenic peptide is not the same for each of the more than or equal to two polypeptide molecules, and where each polypeptide distinct binds to a particle. In some embodiments, the library further comprises a unique defined barcode sequence operatively associated with the identity of each distinct polypeptide.
[00316] Embodiments include barcoded polynucleotides comprising a defined barcode sequence. The barcoded polynucleotides can be a polynucleotide that provides a unique antigen-specific sequence for identification after T-cell isolation. Accordingly, each unique comPACT binds to a particle with a unique defined barcode sequence. This allows for a working association between a given antigen and a given barcode that is unique to the pair.
[00317] The barcoded polynucleotides can be ssDNA or dsDNA. Polynucleotides comprising the barcodes may be modified at their 5' end to comprise a binding moiety for binding to a particle. For example, polynucleotides comprising the barcode sequences are conjugated to a biotin molecule to bind to a particle-bound streptavidin core, such as dextran. However, any suitable binding moiety can be used for binding polynucleotides to a particle. As described herein and as understood by a person skilled in the art, suitable binding moiety pairs are known in the art. Non-limiting examples of linking moieties include thiol, maleimide, adamantane, cyclodextrin, amine, carboxy, azide, and alkyne. particles
[00318] As used herein, "nanoparticles" or alternatively known as ''particles'' refer to substrates that can be specifically classified or isolated, and to which other entities can be attached. In certain embodiments, the entities attached to the particles are the comPACT and the barcode. In certain embodiments, in addition to the comPACT and the barcode, additional entities (eg, fluorophores or other imaging agents) may be attached to the particle. In certain embodiments, in addition to the comPACT and the barcode, additional proteins can be attached to the particle. For example, additional proteins can be attached to the particle to facilitate T cell attachment or to increase the stability of the comPACT. In certain embodiments, the comPACT proteins, barcodes, imaging agents, and additional proteins can be attached to the particle. In certain embodiments, multiple comPACT proteins are bound to a particle.
[00319] In some embodiments, the particle is magnetic, eg for isolation using a magnet. In some embodiments, the magnetic particle comprises magnetic iron oxide. Examples of magnetic particles include, but are not limited to, Dynabeads (Thermo Fisher). In some embodiments, the particle is a polystyrene particle, for example, for gravity insulation. In other embodiments, the particle can be a surface, a bead, or a polymer. Examples of beads include, but are not limited to, agarose beads and Sepharose beads. In particular embodiments, the particle may be fluorescent or may bind to a fluorophore directly or indirectly.
[00320] According to certain embodiments, the particle is modified with a binding moiety to bind additional molecules. The particle modification includes a binding moiety that is mateable with (eg, covalently linked to) a corresponding (eg, complementary) cognate binding moiety linked to polynucleotides. Any suitable pair of binding moieties can be used to modify the particle and polynucleotide detection tag for binding. Non-limiting examples of binding moiety pairs include a streptavidin / biotin system, a thiol group (eg, cysteine) and a cysteine reactive moiety (eg, maleimide, adamantane, and cyclodextrin), an amino group, and a carboxy group, and an azido group and an alkynyl group. In some embodiments, the joining portion may comprise a cleavage portion. In other embodiments, the binding moiety attached to the complementary cognate binding moiety may be reversible, such as a reducible thiol group. In an exemplary embodiment, the modified particle is a streptavidin-coated magnetic nanoparticle, such as a 1 pm particle (for example, ThermoFisher Scientific Dynabeads MyOne T1 streptavidin beads), and the polynucleotides can be biotinylated for binding to the particle. modified.
[00321] The particle can be a dextran, such as a biotinylated dextran or streptavidin-coated dextran. Modified dextrans are described in further detail in Bethune et al., BioTechniques 62:123-130 Mar. 2017 and United States of America Publication No. 2015 / 0329617, incorporated herein by reference in its entirety. Biotinylated comPACTs can be attached to streptavidin-coated dextran.
[00322] The comPACT proteins can also be assembled into tetramers, comprising 1, 2, 3, or 4 biotinylated comPACT proteins attached to a streptavidin core. The tetramer can also comprise a fluorophore, such as phycoerythrin (PE) or allophycocyanin (APC) attached to the streptavidin core. MHC class I and II tetramers are well known in the art. MHC class I tetramers are described in further detail in Burrow SR et al, J Immunol 2000 Dec 1,165(11) 6229-6234 and MHC class II tetramers are described in further detail in Nepom GT, J Immunol March 15, 2012, 188 (6) 2477-2482, both of which are incorporated herein by reference in their entireties.
[00323] The comPACT proteins can also be assembled into multimers. In some embodiments, the comPACT protein multimers can be a dimer, trimer, tetramer, pentamer, hexamer, or higher order multimer. In some embodiments, a multimer can comprise at least two or more comPACT proteins. In some embodiments, a multimer can comprise at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 comPACT proteins. Particle ensembles and libraries
[00324] Also considered are distinct particle sets, each distinct particle set comprising a unique antigen peptide (as used herein referring to comPACT) and at least one defined barcode operatively associated with the identity of the antigen peptide. A set of particles comprises at least two particles, each individual particle comprising a unique antigen peptide and at least one defined barcode operatively associated with the identity of the antigen peptide. In some embodiments, the distinct set of particles comprises at least two particles. In some embodiments, the distinct set of particles comprises at least three particles. In some embodiments, the distinct set of particles comprises at least four particles. In some embodiments, the single antigen peptide (as used herein with reference to comPACT) comprises a comPACT polynucleotide molecule, or polypeptide molecule.
[00325] Libraries of distinct particle sets are also considered. The library of distinct particle sets can comprise 2 to 1000 particle sets. In some embodiments, the library comprises between 2-900, 2-800, 2-700, 2-600, 2-500, 2-480, 2-400, 2-300, 2-200, 2-100, 2- 50, 2-66, 2-48, 2-30, 2-20, 2-19, 10-1000, 10-900, 10-800,10-700, 10-600, 10-500, 10-480, 10-400,10-300,10-200, 10-100, 10-50,10-66,10-48, 10-30, 10-20, 201000, 20-900, 20-800, 20-700, 20-600, 20-500, 20-480, 20-400, 20-300, 20-200, 20-100, 20-50, 20-50, 20-66, 20-48, 2030, 30-1000, 30-900, 30-800, 30-700, 30-600, 30-500, 30-480, 30-400, 30-300, 30-200, 30-100, 30-50, 30-50, 30- 66, 3048, 30-40, 40-1000, 40-900, 40-800, 40-700, 40-600, 40-500, 40-480, 40-400, 40-300, 40-200, 40- 100, 40-60, 40-50, 4066, 40-48, 50-1000, 50-900, 50-800, 50-700, 50-600, 50-500, 50-480, 50-400, 50- 300, 50-200, 50-100, 50-60, 50-66, 601000, 60-900, 60-800, 60-700, 60-600, 60-500, 60-480, 60-400, 60- 300, 60-200, 60-100, 70-1000, 70-900, 70-800, 70700, 70-600, 70-500, 70-480, 70-400, 70-300, 70-200, 70- 100, 70-80, 70-90, 80-1000, 80-900, 80-800, 80-700, 80-600, 80-500, 80-480,80-400, 80-300, 80-200, 80-100,100-150,150-200, 200-250, 250-300, 300-350, 350-400, 400-450, or 450-500 particle sets. In some embodiments, the library comprises between 2-19, 48-480, between 48-66, between 66480, between 220-240, between 40-60, between 48-66, between 50-70 or between 60-80 sets of particles. In some embodiments, the library comprises at least 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 48, 50, 55, 60, 65, 66, 70, 75, 80, 85, 90 , 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550 , 600, 562, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, or 1000 particle sets. In some embodiments, the library comprises 2, 10, 15, 20, 24, 48, 66, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 particle sets.
[00326] In certain embodiments, a library of particle arrays of the present disclosure may comprise one, two, three, four, five, or more particle arrays. In certain embodiments, each set of RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ 7Π7 / 3 / ΥΙΛΙ particles can comprise one, two, three, four, five or more types of particles. In certain embodiments, a set of particles may comprise an individual type of particle. In certain embodiments, a set of particles may comprise multiple types of particles. For example, but not by way of limitation, a set of particles may comprise particles attached to the same barcode or particles attached to different barcodes, or a combination thereof. In certain embodiments, a set of particles can comprise particles bound to a comPACT polypeptide. In certain embodiments, a set of particles can comprise particles bound to the same comPACT polypeptide, different compact polypeptides, or a combination thereof. Dextramers and Tetramers
[00327] comPACT polypeptides can be linked to a dextran, such as a biotinylated dextran or streptavidin-coated dextran. Modified dextrans are described in further detail in Bethune et al., BioTechniques 62:123-130 Mar. 2017 and United States of America Publication No. 2015 / 0329617, incorporated herein by reference in its entirety. Biotinylated comPACT polypeptides can be bound to streptavidin-coated dextran. In certain embodiments, the dextran is coated with streptavidin. In certain embodiments, streptavidin is covalently conjugated to dextran. In certain embodiments, streptavidin is not covalently conjugated to a biotin-dextran.
[00328] comPACTs can also be assembled into tetramers, comprising 1, 2, 3, or 4 biotinylated comPACT proteins attached to a streptavidin core. The tetramer can also comprise a fluorophore, such as phycoerythrin (PE) or allophycocyanin (APC) attached to the streptavidin core. In certain embodiments, the fluorophore is selected from the group consisting of PerCP, Cy3, Cy5, and Alexa488. In certain embodiments, the fluorophore is quantum dots (a non-limiting example being Qdot800). In certain embodiments, any fluorophore with a high extinction coefficient could be used. MHC class I and II tetramers are well known in the art. MHC class I tetramers are described in further detail in Burrow SR et al, J Immunol 2000 Dec 1,165(11) 6229-6234 and MHC class II tetramers are described in further detail in Nepom GT, J Immunol March 15, 2012, 188 (6) 2477-2482, both of which are incorporated herein by reference in their entireties. Methods for producing comPACT polypeptides Antigen prediction
[00329] To fabricate a comPACT, one of the initial steps may include identification of the patient's tumor-specific antigens (eg, neoantigens). Compositions produced by this method can then be used in a T-cell mediated immune process, eg, for patient-specific cancer immunotherapy. For the identification of a patient's apparent neoantigens (tumor or pathogen), in silico predictive algorithmic programs can be used that analyze tumor, viral, or bacterial sequencing data including whole genome, whole exopathic, or whole genome sequencing data. transcriptome, to identify one or more mutations that correspond to apparently expressed neoantigens. In addition, human leukocyte antigen (HLA) typing can be determined from a patient's tumor or blood sample, and this HLA information can be used in conjunction with the identified apparent neoantigen peptide sequences in a predictive algorithm to MHC binding, (see, Fritsch et al., 2014, Cancer Immunol Res., 2:522-529, all contents of which are incorporated herein by reference). HLAs commonly found in the human population can also be included in neoantigen prediction algorithms, such as HLA-A*02, 24, 01; HLA-B*35, 44, 51; DRB1*11, 13, 07 in Caucasians, HLA-A*02, 03, 30; HLA-B*35, 15, 44; DRBV13, 11, 03 in Afro-Brazilians, and HLA-A*24, 02, 26; HLA-B*40, 51, 52; DRB1*04,15, 09 in Asians. HLA allele specific matching can also be used. Common alleles found in the human population are further described in Bardi et al. (Rev Bras Hematol Hemoter. 2012; 34(1): 25-30.)
[00330] Additional examples of methods to identify neoantigens include the combination of sequencing with mass spectrometry and prediction of MHC presentation (eg, United States of America Publication No. 2017 / 0199961), and the combination of sequencing with prediction for MHC binding affinity (eg, US Patent Issued 9,115,402). In addition, methods useful for identifying whether neoantigen-specific T cells are present in a patient sample can be used in combination with the methods described herein, for example, as described in United States Publication No. 2017 / 0003288 and PCT / US17 / 59598, incorporated herein by reference in their entirety. These analyzes result in a qualified list of candidate neoantigen peptides from the patient that can be readily synthesized using routine methods for cognate antigen-specific T cell screening. Restriction Digest Assembly
[00331] In general, preparation of a comPACT polynucleotide can be accomplished by procedures described herein and by recognized recombinant DNA techniques, eg, plasmid DNA preparation, restriction enzyme DNA cleavage, DNA ligation , transforming or transfecting a host, culturing the host, and isolating and purifying the expressed fusion complex. These procedures are generally known and described in standard references such as in Sambrook et al., supra.
[00332] In some aspects, the DNA encoding an MHC class I heavy chain may be obtained from a suitable cell line such as, for example, human lymphoblastoid cells. In various configurations, a gene or cDNA encoding a class I heavy chain can be amplified by polymerase chain reaction (PCR) or other means known in the art. In some aspects, a PCR product may also include sequences coding for linkers, and / or one or more restriction enzyme sites for ligation of the sequences.
[00333] In some embodiments, a vector encoding a comPACT polynucleotide can be prepared by ligating sequences encoding MHC class I heavy chain and β2-microglobulin to a sequence encoding an antigen peptide.
[00334] The DNA encoding the antigen peptide can be obtained by isolating the DNA from natural sources or by known synthetic methods, eg, the phosphate triester method. See, for example, Oligonucleotide Synthesis, IRL Press (M. Gait, ed., 1984). Synthetic oligonucleotides can also be prepared using commercially available automated oligonucleotide synthesizers. A DNA sequence encoding a universal target sequence as discussed herein may be interposed between a sequence encoding a signal sequence and a sequence encoding an antigenic peptide, and a second universal target sequence may be interposed between the sequence coding for an antigen peptide segment and a sequence coding for a β2 microglobulin segment. In some embodiments, the segments can be joined using a ligase. PCR assembly
[00335] In some aspects, the comPACT can be assembled by polymerase chain reaction (PCR) amplification. Similar to the restriction digest method, the DNA encoding the MHC heavy chain and β2-microglobulin can be obtained from a suitable source. A second DNA fragment encoding a chosen signal sequence can also be obtained from a suitable source. Both DNA fragments may have different universal target sequences, such that primers for one universal sequence do not hybridize to the second universal sequence. Two sequences encoding a chosen antigenic peptide can be synthesized; a forward primer with the antigenic sequence at the 5' end and the complement of the universal primer sequence in the MHC DNA fragment at the 3' end; and a reverse primer with the reverse complement of the chosen antigenic sequence at the 5' end and the reverse complement of the universal primer of the signal sequence fragment at the 3' end. A PCR reaction with all four DNA fragments and primer for the 5' end of the signal sequence fragment and the 3' end of the MHC allele fragment will result in the amplification of two DNA fragments, one with the signal sequence at the 3' end and the sequence antigenic at the 5' end, and one with the antigenic sequence at the 3' end and the MHC allele at the 3' end. A further PCR amplification cycle will allow overlapping antigenic peptide sequences to anneal and result in a single full-length DNA fragment. In some embodiments, the signal peptide fragment further comprises a promoter sequence. In some embodiments, the MHC fragment further comprises a purification pool and / or a polyA tail. Transfection, transduction, and genetic modification of host cells
[00336] A comPACT polynucleotide can be inserted into the host cell by any appropriate known method, including, but not limited to, transfection, transduction, electroporation, lipofection, sonoporation, mechanical disruption, or viral vectors. Examples of transfection reagents include, but are not limited to, FectorPro, Expifectamine, Lipofectamine, Polyethyleneimine (PEI), Fugene, or any other transfection reagent that provides optimal transfection rates based on cell type, transfection system , type of transfection, transfection conditions, and construct to be transfected. In some examples, Expifectamine is used to transfect mammalian cells with the comPACT polynucleotide. In some examples, polyethyleneimine is used to transfect mammalian cells with the comPACT polynucleotide. In some examples, FectorPro is used to transfect mammalian cells with the comPACT polynucleotide.
[00337] A comPACT polynucleotide can be transiently or stably expressed in the host cell. In some embodiments, the comPACT polynucleotide is integrated into the host genome. In other embodiments, the comPACT polynucleotide remains extrachromosomal. Any suitable gene editing technique known in the art can also be employed to modify the host cell with the polynucleotide of Rhh7JRIl 7Π7 / 3 / ΥΙΛΙ comPACT, including CRISPR / Cas9, zinc finger nucleases, or TALEN nucleases. Expression
[00338] A number of strategies can be employed to express a comPACT polypeptide. For example, the comPACT polynucleotide can be incorporated into a suitable vector by known methods such as the use of restriction enzymes and ligases (see, eg, Sambrook et al., supra). A vector can be selected based on factors related to the cloning protocol. For example, the vector may be compatible with and have the correct replicon for the host being used. Suitable host cells include eukaryotic and prokaryotic cells, and may be cells that can be easily transformed and exhibit rapid growth in culture medium. Examples of host cells include prokaryotes such as E. coli and Bacillus subtilis, and eukaryotes such as animal cells and yeast, such as, for example, mammalian cells and human cells. Non-limiting examples of mammalian cells that can be used as hosts to express a comPACT include J558, NSO, SP2-O, 293T, Exp¡293, and CHO (and any derivatives or modifications of any of the J558, NSO cell lines , SP2-O, 293T, Exp¡293, and CHO). Other examples of possible hosts include insect cells such as Sf9, which can be grown using standard culture conditions. See Sambrook, et al., supra. In various embodiments, cells expressing a comPACT polypeptide can be identified using known methods. For example, the expression of a comPACT polypeptide can be determined by an ELISA, FACS, or Western blot. In certain embodiments, expression of a comPACT polypeptide can be determined by ELISA, FACS, or Western blotting using an antibody probe directed against the MHC heavy chain portion of comPACT, or an antibody against an affinity tag, such as such as His6 (SEQ ID NO: 34), or a streptavidin reagent if the comPACT has been biotinylated.
[00339] In some aspects, a comPACT is expressed in mammalian cells. The benefits of expressing protein in mammalian cells rather than E. coli cells are multi-fold. Protein expressed in E. coli cells must be carefully purified away from lipopolysaccharide (LPS). Expression of proteins in mammalian cells does not result in LPS contamination of the purified proteins. Furthermore, mammalian cells are more likely to properly fold mammalian proteins, since mammalian cells produce proteins with the correct post-translational modifications required for proper folding, including proper disulfide bond formation. In addition, mammalian cells provide the correct chaperone proteins to help with protein folding in the endoplasmic reticulum or Golgi apparatus. This results in increased purification of homogeneously well-folded proteins, compared to proteins expressed in E. coli cells.
[00340] In some aspects, a comPACT is expressed in prokaryotic cells. In certain embodiments, a prokaryotic cell that has been genetically engineered to post-translationally modify comPACT. In certain embodiments, comPACT that was expressed in prokaryotic cells is substantially free of LPS or has no detectable LPS as measured using LPS detection methods known in the art.
[00341] A comPACT can be substantially free of LPS. A comPACT may be free of LPS, for RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ For example, a comPACT may not have detectable LPS as measured using LPS detection methods known in the art. A comPACT can be glycosylated. A comPACT may have one or more post-translational modifications. A comPACT can be modified by expression in a eukaryotic mammalian cell or in specific modalities, eg, by one or more post-translational modifications such as glycosylation. A comPACT may include one or more post-translational modifications. A comPACT can (1) be substantially LPS-free or LPS-free, and (2) can be glycosylated. Sample comPACT Workflow Process
[00342] Figure 23 shows an exemplary schematic representation of the assembly and expression of a comPACT protein. Sense and antisense oligos encoding the desired neoantigen peptide sequence are synthesized and annealed to form a double-stranded oligo with overhangs at the 5' and 3' ends, which can then be ligated into a plasmid containing a β2Μ gene and an MHC allele. The complete comPACT oligo can be amplified into a double-stranded amplicon and transfected into cells for protein expression and optional biotinylation. The comPACT protein can be assessed by SDS-PAGE. comPACT polynucleotides can then be chosen for scale-up plasmid production in E. coli. Protein-producing cells are transfected with the selected plasmids and comPACTs are purified from the producer cells for use in functional assays. Purification (chromatography)
[00343] An expressed comPACT polypeptide can be isolated and purified by known methods. For example, a comPACT comprising a His6 affinity tag (SEQ ID NO: 34) can be purified by affinity chromatography on a metal affinity chromatography column (for example, a Ni-NTA column or any other column). of metal affinity resins described herein, such as Co2+, Ca2+, Zn2+, Cu2+ resins, or any combination thereof (including NI2+)) by procedures that are generally known and described. In addition, a comPACT containing human HLA sequences can be purified by affinity chromatography on a monoclonal antibody-Sepharose column by procedures that are generally known and described. Methods for isolating antigen-specific T cells
[00344] The comPACT library described herein has been used to isolate antigen-specific T cells and can be used to isolate any cell presenting a neoantigen. A diagram of a T cell isolation process, according to one modality, is shown in Figure 26. This process may also be referred to herein as the 'ImPACT' method or 'imPACT isolation technology'.
[00345] The steps and components of the imPACT isolation technology method include but are not limited to steps (1)-(5) diagrammed in Figure 26: (1) Create a comPACT element library produced for the isolation of patient-specific neoantigen T cells (2) Add a unique DNA oligonucleotide, neoID, or barcode to the comPACT element library (3) Each polypeptide of individual comPACT and its neoID barcode, DNA oligonucleotide, neoID, or corresponding barcode binds to two separate fluorescent streptavidin proteins (in the example RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ provided in Figure 26 phycoerythrin (PE) and allophycocyanin (APC)) (4) This assembly process resulted in two paired barcoded fluorescent tetramers per comPACT polypeptide and code element (5) A library of assembled tetramers with all comPACT polypeptides and neoID barcode, DNA oligonucleotide, neoID, or barcode targeting the predicted neoantigen candidates per patient is pooled together for isolation of T cells specific for neoantigens from the subject's peripheral blood.
[00346] The use of a comPACT library to identify and characterize neoantigen-specific T cells is also shown in Figure 26 in panels 6-8. Incubation of the comPACT neoID library with patient samples (6) is followed by fluorescence activated cell sorting (FACS) (7). A fixed amount of T cells engineered to express a tool neoTCR can be added to the patient sample as an internal positive control to calibrate each run. T cells specific for double fluorescently labeled tetramer-bound neoantigens (PE and APC), as well as internal positive control cells, and potential non-specific T cells are sorted as single cells into individual wells in plates for subsequent analysis of RT-PCR, including barcode sequencing and neo-TCR (8). Barcode signal-to-noise (S / N) analysis
[00347] True positive neoantigen-specific double labeled T cells can be resolved from false positive T cells identified by flow cytometry by sequence analysis of the neoID barcodes bound to the isolated T cell. The presence of multiple copies of the same neoID barcode produces a high ratio of specific neoID barcode species compared to non-specific conjoined barcodes. This results in a higher signal-to-noise barcode (S / N) ratio. Non-specific T cells bind relatively equal numbers of different tetramer species, resulting in a lower ratio of distinct neoID barcodes. A scheme of binding of non-specific T cells vs. specific is shown in Figure 27A (non-specific) and Figure 27B (specific). The numbers indicate the different neoID barcodes. In Figure 27A, the ratio of the unique DNA copy number for the most dominant neoID divided by the second most dominant neoID is 1, indicating a cell nonspecifically bound by comPACT elements. In Figure 27B, the ratio of the unique DNA copy number for the most dominant neoID divided by the second most dominant neoID is 5, indicating that this T cell is bound by a dominant comPACT element and represents a T cell of CD8 specific for true positive neoantigen. This can be further confirmed by functional characterization of T cells modified with the neoTCR cloned from that individual cell. Analysis of S / N1 and S / N2
[00348] In some embodiments, a TCR can recognize two different neoantigens. In these cases, although the T cell is specific, the S / N ratio may be less than 10. In these cases, two different S / N calculations, S / N1 and S / N2, may be used. S / N1 is the highest signal divided by the second highest signal, while S / N2 is the highest signal of one mutation divided by the highest signal of a different mutation. In an S / N2 analysis, the highest signal for a different mutation may not be the second highest signal in the sample.
[00349] In an illustrative example, 8 different TCRs can be identified in a sample. 6 of these can have a S / N1 ratio of more than 10, and can be confirmed to be neoantigen-specific T cells. For the other 2 T cells, the S / N1 ratio may be less than 10. However, the S / N2 may be higher than 10. Cloning of the 2 TCRs shows that they can recognize two different neoantigens that share the same TCR. mutation, which explains the reason for the low S / N1 ratio. In some modalities, S / N2 analysis may be useful for calling non-specific cells from specific cells, when there are multiple neoantigens derived from the same mutation.
[00350] In some embodiments, a higher S / N ratio indicates a higher TCR binding specificity. Threshold
[00351] In some embodiments, the isolated T cell is identified as the antigen-specific T cell if the barcode signal to noise ratio S / N1 or S / N2 is above a threshold.
[00352] In some embodiments, the threshold is at least or greater than 2, 5,10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85 , 90, 95, 100, 110, 120, 130,140, 150, 160, 170,180,190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900,950, or 1000. In some embodiments, the threshold is at least or greater than 2, 5, 10, or 20. In some embodiments, the ratio corresponds to the specificity of the specific T cell for isolated antigen. In some embodiments, the S / N ratio is 10 or more. brands
[00353] As used herein, "identifier tag" or "identifier tags" means a molecule or compound used to label an array of particles. In some embodiments, the identification label is a fluorophore. In some embodiments, the identification mark is a metal, lanthanide, quantum dot, radioisotope, nanoparticle, or dye. Any appropriate fluorophore can be used, including but not limited to allophycocyanin (APC), phycoerythrin (PE), fluorescein (FITC), rhodamine, Texas red, DAPI, C2, Cy3, Cy5, Cy7, AlexaFluor fluorophores, BODIPY fluorophores, DyLight fluorophores , FluoProbes fluorophores, or any combination thereof. barcodes
[00354] As used herein, "barcode" or "barcodes" means a nucleotide sequence used to label and identify a specific peptide, including but not limited to an antigen peptide. In certain embodiments, the barcode is selected from a group consisting of a 3-mer, 4-mer, 5-mer, 6-mer, 7-mer, 8-mer, 9-mer, 10-mer, 11-mer , 12-mer, 13-mer, 14-mer, 15-mer, 16-mer, 17-mer, 18-mer, 19-mer, and a 20-mer. In certain embodiments, the barcode is an 8-mer.
[00355] In some embodiments, the distinct particle pair comprises a unique antigen peptide and a defined barcode operatively associated with the identity of the antigen peptide.
[00356] In some embodiments, the first particle comprises a first barcode and the second particle comprises a second barcode distinct from the second barcode, wherein the first and second barcodes are associated with antigen identity.
[00357] In some embodiments, the pair of particles comprises a third particle comprising a third barcode other than the first and second barcodes, wherein the first, second, and third barcodes RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ are associated with the identity of the antigen.
[00358] An exemplary barcode and barcode structure is provided in Table A below. Barcodes can also be referred to as neoID. RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ Table A Name Sequence Structure Biotin barcode-universal primer 1-NNNNN-barcode-NNNNN-universal primer 2 Representative bar code sequence / 5Biosg / CTCGCCACGTCGGCTATCCTGATCGGATGNNNNNNNTCAATCCG NNNNNNCTGGACGTGAGCAAGCTACAGCGACCTC (SEQ ID NO: 202)
[00359] In some embodiments, the barcode signal to noise ratio is based on at least one barcode. In the embodiments, each of the paired particles comprises the same antigen, a different label, and at least one barcode, wherein the at least one barcode is associated with the neoantigen. In some embodiments, the paired particles have at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 barcodes.
[00360] In some cases, aggregates of the fluorophore-labeled particles can result in a high mean fluorescent intensity of individual fluorophore-stained cells during isolation. This is not due to specific binding of the fluorescent particles, but rather non-specific binding of an aggregate of comPACT particles, resulting in a high neoantigen barcode S / N, since there may be a large amount of the same barcode bound to a T cell in a specific way. The use of a dual barcode system can be used to address this problem.
[00361] In some embodiments, each particle pair of the comPACT library elements comprises at least two barcodes. Double barcoding conjugates two different DNA barcodes per antigen to each comPACT tetramer, respectively. A diagram of the comparison of single and double barcode creation for an antigen is shown in Figure 28. In the upper panels, the same neoantigen is associated with two different particles, two different fluorophores, and a single barcode. , marked 1. In the lower panels, the same antigen is associated with two different particles, two different fluorophores, and two different barcodes, marked Ί" and "2". This results in increased identification of false positives with high signal / noise ratios caused by tetramer aggregation. The signal to noise ratios of each DNA barcode assigned to each fluorescent particle and the same antigen can be analyzed separately.
[00362] In some embodiments, each particle pair of the comPACT library elements comprises at least two barcodes. Double barcoding conjugates two different DNA barcodes per antigen peptide to each comPACT tetramer, respectively. A diagram of the comparison of single and double barcoding for an antigen peptide is shown in Figure 28. In the upper panels, the same antigen peptide is associated with two different particles, two different fluorophores, and one individual barcode, labeled 1. In the lower panels, the same antigen peptide is associated with two different particles, two different fluorophores, and two different barcodes, labeled "1" and 2". This results in increased identification of false positives with high signal / noise ratios caused by tetramer aggregation. The signal to noise ratios of each DNA barcode assigned to each fluorescent particle and the same antigen peptide can be analyzed separately. cell samples
[00363] The imPACT method (i.e., imPACT isolation technology) can be used to isolate immune cells, such as T cells and B cells, from any appropriate patient-derived sample comprising immune cells including, but not limited to , blood, plasma, peripheral blood mononuclear cell (PBMC) samples, bone marrow, tumor infiltrating lymphocyte (TIL) samples, tissues, solid tumors, hematologic cancers, and fluid tumors, or any combination of these. For example, both CD4+ and CD8+ T cells can be labeled and sorted from PBMC or TIL using anti-CD4 and anti-CD8 fluorescent antibodies, with live populations of individual CD4+ and CD8+ positive cells sorted using fluorescence-activated cell sorting ( FACS), to isolate only CD4+ or CD8+ cells. In some embodiments, T cells that are positive for both CD4 and CD8 can be isolated using an anti-CD3 fluorescent antibody followed by FACS. In addition, the imPACT method can also be used for the discovery of antibodies to B cells. One skilled in the art is able to determine the type of immune cells to isolate for the type or types of comPACT protein that are used. In some embodiments, the sample is a blood sample. In some embodiments, the sample is a PBMC sample. In some embodiments, the sample is a solid tumor sample. In some embodiments, the sample is a hematologic tumor sample. In some embodiments, the sample is a bone marrow sample. In some embodiments, the sample is a tumor sample comprising tumor-infiltrating lymphocytes. The T cells can be CD8+ T cells or CD4+ T cells. In some embodiments, the T cell is a CD8+ T cell. In some embodiments, the T cell is a CD4+ T cell. In some embodiments, the T cell is a human T cell. In some embodiments, the T cell is a human CD8+ T cell. T cell isolation
[00364] In another aspect, provided herein are methods of isolating an antigen-specific T cell, the method comprising the steps of (a) providing a polypeptide comprising, in an amino to carboxy terminus orientation, (i ) a first universal target peptide, (ii) an antigenic peptide, (iii) a second universal target peptide that is distinct from the first universal target peptide, (iv) a β2Μ peptide, and (v) an MHC peptide, in where the polypeptide binds to a particle; (b) providing a sample known or suspected to comprise one or more T cells; (c) contacting the polypeptide with the sample, wherein the contacting comprises providing conditions sufficient for an individual T cell to bind to the polypeptide bound to the particle, and (d) isolating the individual T cell associated with the particle.
[00365] The isolation and identification of patient-derived and antigen-specific T cells using RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ 7Π7 / 3 / ΥΙΛΙ a comPACT as described herein may include incubating the comPACT protein with patient-derived T cells or with a sample containing patient-derived T cells. In some embodiments, a library comprising at least two comPACTs can be incubated with patient-derived T cells. T cells can be prepared using standard methods starting from a tissue such as blood, a lymph node, or a tumor.
[00366] Incubation of the comPACT or comPACT library with the T cell suspension allows complete and exhaustive exposure of the particle-bound antigen peptide to the various T cell receptors. This method may include king or rotating the cells. In some embodiments, the comPACT is associated with a particle.
[00367] After incubation of the comPACT or comPACT library (both of which bind to a particle) and the T cells, the bound comPACT-T cell complex is selectively separated or selectively harvested. T cells will likely bind many identical copies of identical comPACT library items (ie, individual comPACT polypeptides and particle-associated comPACT polypeptides) and may separate based on these interactions. For example, if the comPACT or comPACT that associates with a particle comprises a fluorophore, or binds to a particle with a fluorophore, fluorescence-associated cell sorting (FACS), including single cell sorting, can be used to selectively isolate T cells. If comPACT or the particle with which it is associated binds to a magnetic particle, application of a magnet to the suspension may allow separation of particles complexed with antigen-paired T cells and removal of cells. T unpaired. Alternatively, if the particle that associates with the comPACT is a polystyrene particle, unpaired T cells can be separated by gravity (eg, centrifugation). Following removal of unpaired T cells, in some embodiments, the separated bound particles are washed at least once to remove any non-specifically associated T cells.
[00368] comPACT-bound T cells can also be separated by FACS into individual collection vessels, such as a multi-well plate. The individual collection vessel may be single cell reaction vessels. For example, components used for further processing and analysis can be added to each individual cell reaction vessel. comPACT-bound T cells can be separated by FACS in a bulk collection container (eg, each isolated T cell is collected in the same container).
[00369] comPACT-bound T cells can also be individually isolated in droplets using a droplet-generating microfluidic device (ie, droplet generator). Droplet generating devices used to encapsulate individual cells are known to those skilled in the art, for example, as described in United States of America Publication No. 2006 / 0079583, United States of America Publication No. 2006 / 0079584. , United States of America Publication No. 2010 / 0021984, United States of America Publication No. 2015 / 0376609, United States of America Publication No. 2009 / 0235990 and United States of America Publication No. 2004 / 0180346.
[00370] After isolation of comPACT-bound T cells in single cell reaction vessels (eg, isolated in single concavities or beads), the comPACT-bound T cell nucleic acid can be further processed for subsequent analysis. Specifically, expressed TCRA and ΤΟΡβ mRNA transcripts can first be converted to cDNA by reverse transcription and the cDNA amplified for next-generation sequencing (NGS) methods known to those skilled in the art, including, but not limited to , sequencing by synthesis technologies (for example, lllumina or any other NGS sequencing machine). Methods to identify the antigen specificity of T cells
[00371] In certain embodiments, the presently disclosed subject matter provides methods for identifying the antigen specificity of a T cell. In certain embodiments, the T cell isolation methods described herein provide information regarding the antigen specificity of a T cell. the isolated T cell. For example, but not by way of limitation, information regarding antigen specificity can be obtained by nucleic acid analysis of the isolated T cell. In certain embodiments, isolated T cell nucleic acids can be analyzed to determine the sequence of T cell receptor gene sequences (eg, TCR alpha and TCR beta sequences). In certain embodiments, the information regarding the antigen specificity of isolated T cells can be used for downstream applications. Non-limiting examples of downstream applications include analysis of the immune repertoire, manufacturing processes, and clinical monitoring of a patient undergoing immunotherapy. In certain embodiments, information regarding the antigen specificity of an isolated T cell can be used to prepare reagents and composition for producing cells useful in adoptive cell transfer therapies.
[00372] In non-limiting modalities, monitoring of the immune repertoire is performed. In certain modalities, monitoring of the immune repertoire is performed before, during, or after a treatment. In certain modalities, the treatment is an immunotherapy. Non-limiting examples of immunotherapy include administration of vaccines, oncolytic viruses, antibodies, chimeric antigen receptor-expressing T cells, recombinant T-cell receptor-expressing T cells, tumor-infiltrating lymphocytes. Methods of treatment
[00373] In certain embodiments, the presently disclosed subject matter provides methods of treatment, including, but not limited to, inducing, and / or augmenting an immune response in a subject in need thereof. In certain embodiments of the present disclosure, the methods of treatment described herein involve the isolation and / or administration of cells. For example, but not by way of limitation, the cells employed in the methods described herein may be obtained, in certain embodiments, from a subject. In certain embodiments, the cells are tumor cells, non-cancer cells, T cells, or any combination thereof. In certain embodiments, nucleic acids can be extracted from cells as highlighted herein. In certain embodiments, the nucleic acids of cells can be sequenced as highlighted herein. In certain embodiments, information, eg, nucleic acid sequence information, obtained from the subject provides information regarding antigen-specific T cells. In certain embodiments, the information relates to the identity (eg, amino acid sequence) of antigen peptides. In certain embodiments, the antigen peptide is a tumor neoantigen. In certain embodiments, the information relates to the identity of the MHC sequences. RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ
[00374] In certain embodiments, the methods described herein relate to the treatment of cancer. In certain embodiments, the cancer is a solid cancer. Non-limiting examples of tumors treatable by the methods described herein include, for example, carcinomas, lymphomas, sarcomas, blastemas, and leukemias. Specific non-limiting examples include, for example, breast cancer, pancreatic cancer, liver cancer, lung cancer, prostate cancer, colon cancer, kidney cancer, bladder cancer, head and neck carcinoma, thyroid carcinoma. , soft tissue sarcoma, ovarian cancer, primary or metastatic melanoma, squamous cell carcinoma, basal cell carcinoma, brain cancers of all histopathological types, angiosarcoma, hemangiosarcoma, bone sarcoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, sarcoma osteogenic, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, testicular cancer, uterine cancer, cervical cancer, gastrointestinal cancer, mesotheloma, cancers associated with viral infection (such as, but not limited to, tumors (for example , cervical cancer, carcinomas of the vagina, vulva, head and neck, anal, and penis) associated with human papillomavirus (HPV)).
[00375] In certain embodiments, a comPACT mini-gene comprising a candidate antigen peptide is produced according to the methods described herein. In certain embodiments, a comPACT polypeptide comprising the antigen peptide is produced. In certain embodiments, a particle comprising a comPACT polypeptide is produced according to the methods described herein. In certain embodiments, at least one set of particles comprising a comPACT polypeptide is produced according to the methods described herein.
[00376] In certain embodiments of the treatment methods described herein, a T cell is isolated by virtue of binding to a particle. In certain embodiments, the T cell isolated in this manner was obtained from the subject. In certain embodiments, the T cell is a CD8+ T cell.
[00377] In certain embodiments, the isolated T cell is sorted and its genome analyzed. In certain embodiments, the TCR sequences of the isolated T cell are obtained. In certain embodiments, the TCR gene sequences, or portions thereof, are inserted into a homologous recombination template. In certain embodiments, the homologous recombination template comprises the features described in International Patent Application No. PCT / US2018 / 058230, the contents of which are incorporated herein by reference in their entirety.
[00378] In certain embodiments, a T cell is modified by the insertion of the homologous recombination template comprising the TCR gene sequences, or portions thereof, of the isolated T cell.
[00379] In certain embodiments, the modified T cell is adoptively transferred to the patient. Adoptive cell transfer (ACT) is an effective form of immunotherapy and involves the transfer of immune cells with antitumor activity into cancer patients. The lymphocytes used for adoptive transfer can be derived from the blood or stroma of resected tumors, although other sources of these cells are known in the art. In certain embodiments, the lymphocytes used in ACT can be administered in a single dose. Administration can be by injection, eg intravenous injection. In certain embodiments, the lymphocytes can be administered in multiple doses. The dosage may be once, twice, three times, four times, five times, six times, or more than six times per year. The dosage may be once a month, once every two weeks, once a week, or once every other day. The administration of cytotoxic lymphocytes can continue as long as necessary. In certain embodiments, the methods described herein can be used to determine a subject's immunorepertoire. In certain embodiments, the immunorepertoire is analyzed: before a treatment, during a treatment, and / or after a treatment. In certain embodiments, the treatment is a cancer treatment. In certain modalities, the cancer treatment is an immunotherapy. In certain embodiments, immunotherapy comprises the administration of an antibody. In certain embodiments, the immunotherapy comprises an adoptive cell transfer of T cells. In certain embodiments, the T cells comprise a recombinant TCR or chimeric antigen receptor. In certain modalities, the immunorepertoire provides information to provide targeted therapy. Methods to modify a cell
[00380] In certain embodiments, the presently disclosed subject matter provides methods for modifying a cell. For example, but not by way of limitation, modified cells can be obtained using the methods and compositions described herein.
[00381] In certain embodiments, the presently disclosed subject matter provides a method of modifying a cell by introducing and recombining a homologous recombination (HR) template nucleic acid sequence into an endogenous locus of a cell. In certain embodiments, the cell is modified by non-viral methods. In certain embodiments, the HR template nucleic acid sequence is circular. In certain embodiments, the HR template nucleic acid sequence is linear. In certain embodiments, the HR template nucleic acid sequence comprises first and second arms of homology. In certain embodiments, the homology arms can be from about 300 bases to about 2,000 bases. For example, each homology arm can be 1,000 bases. In certain embodiments, the homology arms may be homologous to the first and second sequences endogenous to the cell. In certain embodiments, the endogenous locus is a TCR locus. For example, the first and second endogenous sequences are within a TCR alpha locus or a TCR beta locus. In certain embodiments, the HR template comprises a TCR gene sequence. In non-limiting embodiments, the TCR gene sequence is a patient-specific TCR gene sequence. In non-limiting embodiments, the TCR gene sequence is identified and obtained using the methods described herein. For example, methods for identifying the antigen specificity of a T cell can be used to obtain TCR gene sequences from a patient and the TCR sequences can be incorporated into the HR template. In certain embodiments, the HR template comprises a TCR alpha gene sequence and a TCR beta gene sequence. Additional information on HR template nucleic acids and methods for modifying a cell thereof can be found in International Patent Application no. PCT / US2018 / 058230, the content of which is incorporated herein by reference.
[00382] In certain embodiments, constructs containing genes of interest can be inserted into endogenous loci using non-viral gene editing methods. In certain embodiments, this can be accomplished with the use of homologous repair templates containing the coding sequence for the gene of interest flanked by left and right HR arms. In certain embodiments, in addition to the HR arms, the gene of interest is interspersed between 7Π7 / 3 / ΥΙΛΙ 2A peptides, a protease cleavage site that is upstream of the 2A peptide to remove the 2A tag from the downstream translated gene of interest, and signal sequences; wherein once integrated into the genome, the gene of the expression gene cassette of interest is transcribed as individual mRNA. In certain embodiments, during translation of the mRNA gene of interest, the flanking regions are cleaved from the gene of interest by the self-cleaving 2A peptide and the protease cleavage site is excised for removal of the 2A sequence in 5' direction of the translated gene of interest. In certain embodiments, in addition to the 2A and protease cleavage site, a gly-ser-gly (GSG) linker can be inserted before each 2A peptide to further enhance the separation of the gene of interest from the other elements on the cassette. expression. In certain embodiments, P2A peptides are used because they are superior to other 2A peptides due to their efficient cleavage. In certain embodiments, two (2) P2A peptides and codon divergence are used in order to express the gene of interest without introducing any foreign remaining amino acid epitopes at either end of the P2A peptide gene of interest.
[00383] In certain embodiments and as described in PCT / US / 2018 / 058230, neoTCRs integrate into the T-cell RoTC locus. In certain embodiments, a homologous repair template is used that contains a coding sequence of neoTCR flanked by left and right HR arms. In certain embodiments, the endogenous pTCR locus is disrupted leading to expression of only TCR sequences encoded by the neoTCR construct. In certain modalities, the general strategy is applied using circular HR templates. In certain modalities, the general strategy is applied using linear templates.
[00384] In certain embodiments, the target TCRo (Ca) locus is shown together with the plasmid HR template, and the resulting edited sequence and downstream mRNA / protein products are shown in Figures 67A and 67B . In certain embodiments, additional elements in the neoTCR cassette include: 2A = P2A ribosome skipping element; F = 2A upstream furin cleavage site which removes the 2A tag from the downstream TCRp protein; HGH = human growth hormone signal sequence. The HR template of the neoTCR expression gene cassette includes two sets of flanking homology to direct insertion into the Cas9 nuclease-driven CRISPR RNP TCRo genomic locus with the TCRo guide RNA. In certain embodiments, the homology arms (LHA and RHA) flank the neoE-specific TCR sequences of the neoTCR expression gene cassette. In certain embodiments, the protease cleavage site is any appropriate protease cleavage site known to one of skill in the art, could be used. In certain embodiments, any signal sequence known to one skilled in the art could be selected based on traffic and desired usage.
[00385] In certain embodiments, once integrated into the genome, the neoTCR expression gene cassette is transcribed as a single mRNA from the endogenous TCRo promoter, still including a portion of the endogenous TCRo polypeptide of that individual T cell . In certain embodiments, during ribosomal polypeptide translation of individual neoTCR mRNA, neoTCR sequences are cleaved from the endogenous CRISPR-disrupted TCRo polypeptide by autocleavage at a P2A peptide. In certain embodiments, the encoded neoTCRa and neoTCRp polypeptides are also unlinked from each other through cleavage by endogenous cellular human furin protease and a second self-cleaving P2A sequence motif included in the neoTCR expression gene cassette ( figure 67B). In certain embodiments, neoTCRa and neoTCRp polypeptides are separately targeted by signal leader sequences (eg, derived from human growth hormone, HGH) to the endoplasmic reticulum for multimer assembly and trafficking of protein complexes. of neoTCR to the surface of T cells. In certain modalities, the inclusion of the furin protease cleavage site facilitates removal of the 2A sequence from the TCRp chain downstream 5' to reduce potential interference with TCRp function . In certain embodiments, the inclusion of a gly-ser-gly linker before each 2A (not shown) further enhances the separation of the three polypeptides.
[00386] In certain embodiments, three repeat protein sequences are diverged codons within the HR template to promote genomic stability. In certain embodiments, the two P2A codons are diverged relative to each other, as well as the two HGH signal sequences relative to each other, within the TCR gene cassette to promote stability of the neoTCR cassette sequences introduced into the genome. of ex vivo modified T cells. In certain embodiments, the reintroduced 5' end of TRAC exon 1 (Figures 67A and 67B, vertical band) reduces the likelihood that the entire cassette will be lost over time through removal of the interspersed sequence of two repeats. direct.
[00387] The presently disclosed subject matter further provides compositions comprising cells modified by the methods described herein. Example modalities
[00388] A. In certain non-limiting embodiments, the presently disclosed subject matter provides a method comprising: (a) contacting a sample with a plurality of distinct sets of particles, each particle comprising a unique antigen peptide, an operatively associated barcode, and at least one identification mark, wherein the sample comprises T cells, and wherein the contacting comprises providing conditions suitable for an individual T cell to bind to a unique antigen peptide from at least one set of particles; (b) isolating one or more T cells bound to a particle; (c) identifying the barcode of the particle bound to the isolated T cell; and (d) determining a ratio of each barcode.
[00389] A1. The above method of A, where the ratio is calculated by identifying a copy number of a first barcode and a copy number of a second barcode and dividing the copy number of the first barcode by the number copy of the second barcode.
[00390] A2. The above method of A or A1, where the unique antigen peptide is the same for each different set of particles.
[00391] A3. The above method of any of A-A2, wherein each distinct set of particles comprises at least one or more barcodes, wherein each barcode is associated with the identity of the antigen peptide.
[00392] A4. The above method of any of A-A3, where the ratio of each barcode corresponds to the antigen specificity of the isolated T cell.
[00393] A5. The above method of any of A-A4, wherein the isolated T cell is identified as an antigen-specific T cell if the ratio of the first barcode is above a threshold. RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ
[00394] Α6. The above method of A5, the threshold is at least or greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 2-5, 3-6, 4-7, 5-8, 5-10, 7-10, or greater than 10.
[00395] A7. The above method of any of A-A6, wherein the barcode identification comprises a nucleotide-based assay.
[00396] A8. The above method of A7, where the nucleotide-based assay is a PCR, RT-PCR, sequencing, or hybridization assay.
[00397] A9. The above method of A7 or A8, wherein the nucleotide-based assay determines (a) a sequence of each barcode and / or (b) a copy number of each barcode.
[00398] A10. The above method of any of A-A9, further comprising obtaining a T cell receptor (TCR) CDR sequence.
[00399] A11. The above method of any of A-A10, further comprising obtaining a TCR gene sequence.
[00400] A12. The above method of A11, wherein the TCR sequence is a TCR alpha or TCR beta chain sequence.
[00401] A13. The above method of any of A-A12 to identify the antigen specificity of a cell T.
[00402] A14. The above method of A13, wherein the T cell antigen specificity comprises the antigen peptide sequence and the bound T cell TCR sequences.
[00403] A15. The above method of any of A-A14, where the at least one identification mark is the same on each different set of particles.
[00404] A16. The above method any of A-A15, comprising at least two different identification marks.
[00405] A17. The above method of any of A-A16, wherein the at least one identification label is a fluorophore.
[00406] A18. The above method of A17, wherein the fluorophore is selected from the group consisting of allophycocyanin (APC) and phycoerythrin (PE).
[00407] A19. The above method of A18, wherein the at least two different identification labels are fluorophores, wherein the fluorophores are selected from the group consisting of allophycocyanin (APC) and phycoerythrin (PE).
[00408] A20. The above method of any of A-A19, wherein the antigen peptide is selected from the group consisting of a tumor antigen, a neoantigen, a tumor neoantigen, a viral antigen, a bacterial antigen, a phosphoantigen, and an antigen microbial.
[00409] A21. The above method of A20, wherein the neoantigen is identified from a subject's tumor sequencing data.
[00410] A22. The previous method of A21, where an in silico predictive algorithm is used to determine the neoantigen.
[00411] Α23. The above method of A22, wherein the predictive algorithm further comprises an MHC binding algorithm for predicting binding between the neoantigen and an MHC peptide.
[00412] A24. The above method of any of A-A23, wherein the sample is selected from a blood sample, a bone marrow sample, a tissue sample, a tumor sample, or a peripheral blood mononuclear cell (PBMC) sample. .
[00413] A25. The above method of any of A-A24, wherein the T cell is a human T cell.
[00414] A26. The above method of A25, where the T cell is a CD8+ T cell.
[00415] A27. The above method of any of claims A-A26, wherein the method comprises a library of distinct particle sets.
[00416] A28. The above method of A27, where the library comprises 2 to 500 distinct particle sets.
[00417] A29. The above method of any of A-A28, wherein each particle comprises an MHC peptide.
[00418] A30. The above method of A29, wherein the MHC peptide is a human MHC peptide.
[00419] A31. The above method of A29, wherein the MHC peptide is an HLA class I peptide.
[00420] A32. The above method of A29, wherein the HLA peptide comprises a peptide of HLA-A, HLA-B, or HLA-C.
[00421] A33. The above method of A32, wherein the HLA peptide comprises HLA-A*01:01, HLA-A*02:01, HLAA*03:01, HLA-A*24:02, HLA-A*30:02 , HLA-A*31:01, HLA-A*32:01, HLA-A*33:01, HLA-A*68:01, HLA-ΑΊ 1:01, HLAA*23:01, HLA-A* 30:01, HLA-A*33:03, HLA-A*25:01, HLA-A*26:01, HLA-A*29:02, HLA-A*68:02, HLA-B*07: 02, HLAΒΊ4Ό2, HLA-B*18:01, HLA-B*27:02, HLA-B*39:01, HLA-B*40:01, HLA-B*44:02, HLA-B*46: 01, HLA-B*50:01, HLAB*57:01, HLA-B*58:01, HLA-B*08:01, HLA-B*15:01, HLA-B*15:03, HLA- B*35:01, HLA-B*40:02, HLA-B*42:01, HLAB*44:03, HLA-B*51:01, HLA-B*53:01, HLA-B*13: 02, HLA-B*15:07, HLA-B*27:05, HLA-B*35:03, HLA-B*37:01, HLAB*38:01, HLA-B*41:02, HLA- B*44:05, HLA-B*49:01, HLA-B*52:01, HLA-B*55:01, HLA-C*02:02, HLA-C*03:04, HLAC*05: 01, HLA-C*07:01, HLA-C*01:02, HLA-C*04:01, HLA-C*06:02, HLA-C*07:02, HLA-C*16:01, HLA-C*03:03, HLAC*07:04, HLA-C*08:01, HLA-C*08:02, HLA-C*12:02, HLA-C*12:03, HLA-C* 14:02, HLA-C*15:02, or HLA-C*17:01.
[00422] A34. The above method of any of A-A33, wherein each particle comprises an HLA peptide and a β2Μ peptide.
[00423] A35. The above method of A34, wherein the β2Μ peptide is a human β2Μ peptide.
[00424] A36. The above method of A35, wherein the β2Μ peptide comprises a mutation.
[00425] A37. The above method of A36, where the mutation is S88C.
[00426] A38. The above method of any of A-A37, wherein each particle comprises a polypeptide comprising, in an amino to carboxyl terminus orientation, (i) the antigen peptide, (ii) a β2Μ peptide and (iii) a peptide from MHC.
[00427] A39. The above method of any of A-A38, where the antigen peptide is 7-15 amino acids, 7-10, 8-9, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids in length.
[00428] Α40. The above method of A38 or A39, where the polypeptide is biotinylated.
[00429] A41. The above method of any of A-A40, wherein the particles are selected from the group consisting of magnetic beads, agarose beads, styrene polymer particles, and dextran polymer particles.
[00430] A42. The above method of any of A-A41, where the particles are coated with streptavidin.
[00431] A43. The above method of any of A-A42 for monitoring an immune repertoire in a subject.
[00432] A44. The above method of A43, further comprising monitoring changes in antigen-specific T cells in the subject.
[00433] A45. The above method of A43 or A44, comprising administering an immunotherapy to the subject.
[00434] A46. The previous method of A45, where the immunotherapy is a foster cell transfer or a checkpoint inhibitor.
[00435] A47. The above method of any of A-A46 to identify at least one TCR sequence.
[00436] A48. The above method of A47, wherein the at least one TCR sequence is a TCR alpha sequence, a TCR beta sequence, or a combination thereof.
[00437] A49. The above method of A47 or A48, further comprising making a soluble TCR polypeptide.
[00438] B. In certain non-limiting embodiments, the presently disclosed subject matter provides a library comprising at least two sets of particles, each set of particles comprising an antigen peptide, a barcode operatively associated with the identity of the peptide of antigen, and at least one identifying mark.
[00439] B1. The above library of B, where the at least one identification mark is the same in each set of particles.
[00440] B2. The above library of B or B1, comprising at least two different identification marks on each different set of particles.
[00441] B3. The above library of any of B-B2, wherein the at least one identification tag is a fluorophore.
[00442] B4. The above library from B3, wherein the fluorophore is selected from the group consisting of allophycocyanin (APC) and phycoerythrin (PE).
[00443] B5. The above library from B2, wherein the at least two different identification tags are fluorophores, wherein the fluorophores are selected from the group consisting of allophycocyanin (APC) and phycoerythrin (PE).
[00444] C. In certain non-limiting embodiments, the presently disclosed subject matter provides a particle comprising at least one polypeptide, a barcode, and an identification tag, wherein the polypeptide comprises an antigen peptide, a β2Μ, and an MHC peptide, and wherein the barcode is operatively associated with the identity of the antigen peptide.
[00445] C1. The above particle of C is selected from the group consisting of magnetic beads, agarose beads, styrene polymer particles, and dextran polymer particles.
[00446] C2. The above particle of C or C1, where the identification label is a fluorophore. RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ
[00447] C3. The above particle of any of C-C2 that is coated with streptavidin.
[00448] C4. The previous particle of any of C-C3, where the polypeptide is labeled.
[00449] D. In certain non-limiting embodiments, the presently disclosed subject matter provides a method of treating cancer in a subject, comprising: (a) preparing a plurality of particles each comprising a plurality of labeled polypeptides, wherein The polypeptides comprise an antigenic peptide, a β2Μ sequence, an HLA sequence, and a detectable label; (b) contacting the plurality of particles with a plurality of T cells of the subject under conditions suitable for antigen-specific binding of a T cell to the particle; (c) isolating the T cells bound to the particle and identifying the TCR gene sequence of the isolated T cell; (d) preparing a polynucleotide comprising homology arms and at least one TCR gene sequence, wherein the TCR gene sequence is positioned between the homology arms; (e) recombining the polynucleotide at an endogenous locus of the subject's T cell; (f) culturing the modified T cell from the passage to produce a population of T cells; and (g) administering a therapeutically effective amount of the modified T cells to thereby treat the cancer.
[00450] E. In certain non-limiting embodiments, the presently disclosed subject matter provides a method of modifying a cell, comprising: (a) introducing into the cell a homologous recombination (HR) template nucleic acid sequence, wherein The HR template nucleic acid sequence comprises (i) first and second homology arms homologous to the first and second sequences endogenous to the cell, (ii) a T cell receptor (TCR) gene sequence obtained by a method according to any of A-A49, wherein the TCR gene sequence is located between the first and second arms of HR, and (iii) a first 2A coding sequence located 5' of the gene sequence TCR and a second 2A coding sequence located downstream of the TCR gene sequence, wherein the first and second 2A coding sequences code for the same amino acid sequence that diverge in codons from each other; and (b) recombining the HR template nucleic acid at an endogenous locus of the cell comprising the first and second endogenous sequences homologous to the first and second arms of homology of the HR template nucleic acid.
[00451] F. In certain non-limiting embodiments, the presently disclosed subject matter provides a composition comprising a modified cell, wherein the modified cell comprises an exogenous nucleic acid sequence integrated into an endogenous locus, the exogenous nucleic acid sequence that comprises: (a) a TCR gene sequence identified by a method according to any of A-A49, and (b) a first 2A coding sequence located upstream of the TCR gene sequence and a second 2A coding sequence located downstream of the TCR gene sequence, wherein the first and second 2A coding sequences code for the same amino acid sequence that diverge in codons from each other. examples
[00452] The following examples are merely illustrative of the presently disclosed subject matter and should not be construed as limiting in any way. Example 1: Design and cloning of compact mini-qenes by restriction digest cloning Structure of the comPACT mini-genes for restriction digestion:
[00453] The basic components of a comPACT mini-gene include a signal sequence that directs secretion of the encoded protein, universal target sequences such as restriction sites or primer binding sites, an encoded antigenic peptide (or neoantigen, NeoE), a second universal target site, a β2ιτι, an extracellular domain of an MHC allele, and a purification pool, for example, that allows for enzymatic modification (eg, biotinylation) and purification of comPACT via affinity tags. The pool may also contain a protease cleavage site and linker sequences between the components as done and shown in the figures and examples. The mini-gene can also encode cysteine mutations that can act as a disulfide trap. Certain comPACT mini-genes, as made and described herein encode cysteine mutations that act as a disulfide trap. These min-genes were made to include a disulfide trap in order to increase the success rate of manufacturing comPACT polypeptides by protein stabilization. A diagram of a comPACT mini-gene is shown in Figure 1. Additional restriction sites upstream and downstream of the MHC heavy chain sequence can be used to insert other MHC alleles to construct different MHC templates and build an MHC template library (Figure 2). The DNA encoding the signal sequence, the universal target sequences, p2m, and the extracellular domain of an MHC allele are the basic MHC template.
[00454] For restriction digest cloning methods, each comPACT DNA construct is a base MHC template with a mock antigenic sequence insert containing stop codons in three frames and a unique restriction site for kill uncut or religated template (Figure 3) and can be used as part of an off-the-shelf platform to rapidly assemble antigenic peptide libraries complexed with that MHC allele. The MHC alleles can also be modified or mutated (eg Y84A or Y84C), for example, to improve folding or increase binding of the antigenic peptide to the MHC protein. In addition, the p2m protein can also be mutated (eg S88C), eg to allow it to bind thiol dyes.
[00455] In this example, a comPACT mini-gene is shown with the following structure: a Notl restriction site at the 5' end; the signal sequence for human growth hormone, hGH, shown in Table 1; a Blp1 restriction site 5' of the antigenic peptide region and a BamHI restriction site 3' of the antigenic peptide regions, shown in Table 2; a linker sequence encoded from predominantly glycine and serine residues (ie, Gly-Ser linkers); the p2m sequence; a second Gly-Ser linker sequence encoded with a Bspl restriction site; an MHC heavy chain; a third Gly-Ser linker sequence encoded with a BstBI restriction site; and a purification pool encoded with an AviTag (or any avidin / streptavidin) sequence, a TEV cleavage site, and a concatenated histidine tag. RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ Table 1. Signal Sequence SEQ ID NO. Signal Protein Sequence 1 Human growth hormone nucleotide sequence ATGGCGACGGGTTCAAGAACTTCCCTACTTCTTGCATT TGGCCTGCTTTGTTTGCCGTGGTTACAGGAGGGCTCA GCA 2 Human growth hormone peptide sequence MATGSRTSLLLAFGLLCLPWLQEGSA RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ Table 2. Universal target sequences SEQ ID NO. Restriction site Sequence 3 Blpl CGTGGTTACAGGAGGGCTCAGCA 4 BamHI GGATGCGGAGGATCCGGCG 5 BamHI GGAAGCGGAGGATCCGGCG 6 BamHI GGAAGCGGAGGATCCACCAGC Cloning by restriction digestion and assembly of comPACT mini-genes
[00456] Three different methods for inserting an encoded neoantigen by restriction digest are described herein. In the first, shown as a diagram in Figure 4, the primer encoding the antigenic peptide (NeoE) spans the first restriction site (Blpl in this example) at the 5' end and the second restriction site (BamHI in this example) at the 3' end. This primer amplifies a universal reverse primer encoding the second restriction site, producing a ~70 bp primer dimer.
[00457] In the second method, the primer encoding antigenic peptides spans the second restriction site as the 5' end and is the reverse complement of the antigen-encoding sequence. This primer primes in the reverse orientation of the template DNA encoding the signal sequence. Together with a forward primer spanning the first restriction site sequence, this reaction produces a 70 bp product, or a -140 bp product if a forward primer spanning a restriction site further 5' of the sequence is used. antigen site.
[00458] In both the first and second methods, the insert is typically cleaned up on a commercial column, digested with appropriate restriction enzymes, cleaned up again on a commercial column, and then ligated with a predigested MHC template in a vector. Ligation reactions are transformed into E. coli and plasmids prepared from transformed E. coli are used in mammalian producer cell transfection reactions. Example 2: Design and cloning of comPACT mini-qenes using primer annealing
[00459] In a third variation on MHC template vector ligation, PCR and restriction digest were derived by annealing two primers encoding reverse complementary neoantigens. These primers were designed to have 5' and 3' ends beginning and ending in complementary sequences that mimic restriction digest overhangs (Figure 5). Sense and antisense primers were incubated with T4 polynucleotide kinase and ATP to phosphorylate the 5' ends (Figure 22A). When these primers annealed to each other, they formed a double-stranded oligonucleotide sequence that had overhanging nucleotides as if it had been digested with a restriction enzyme.
[00460] The phosphorylated neoantigen insert (alternatively known as the neoepitope) was ligated into a precut MHC template in a vector. The comPACT mini-gene had the same structure as that described in Example 1. The ligation product was then used for PCR amplification of a linear comPACT amplicon using scattered universal primers to amplify the complete comPACT mini-gene and was sequenced. 824 comPACT minigenes with unique neoantigen sequences (alternatively known as the neoepitope sequences) were made using this method, with more than 99% of the comPACT minigenes generated having the correct neoantigen sequence (alternatively known as the comPACT sequences). of neoepitopes) (Figure 22B). Neoantigen sequences (alternatively known as neoepitope sequences) cloned into comPACT polynucleotides and expressed as polypeptides were based on tumor neoantigens identified from patient samples (for example, tumor samples or other patient samples that express tumor antigens). Based on the identified neoantigens, a series of predicted neoantigen sequences (alternatively known as the neoepitope sequences) was made for each identified neoantigen.
[00461] E.coli was then transformed with the ligation product plasmids and plated on selective agar plates containing ampicillin. Individual colonies were picked and grown overnight for plasmid purification and sequenced for full gene verification. After sequencing verification, the plasmid batches were archived and propagated in larger numbers.
[00462] Alternatively, T4 kinase is not used if the pre-cut MHC template vector retains 5' phosphates at its overhanging ends. The hybridized antigen insert neoantigen sequences (alternatively known as the neoepitope insert) can then be ligated with the cut MHC vector and the ligation product transformed into E. coli for plasmid production. Example 3: Design and cloning of comPACT mini-genes by PCR assembly Structure of comPACT mini-genes for PCR assembly:
[00463] A fourth method can also be used to insert an antigen, eg, a neoantigen, (as used for this example for clarity, both referred to as the NeoE insert in Figure 6 and described as neoepitopes in Figure 6). example 2). In this method, the antigen coding sequence (as used for this example for clarity, antigen coding sequence refers to the neoepitope sequences described in Example 2) is inserted into the flanking MHC template. by a 5' promoter and a 3' polyadenylation signal by polymerase chain reaction to form a 2.5 kb mini-gene. A diagram of the PCR assembly reaction is shown in Figure 6.
[00464] In this example, a comPACT mini-gene is shown with the following structure: a promoter at the 5' end; a signal sequence with a first universal target sequence; an encoded antigenic peptide; A second Rhh7JRIl 7Π7 / 3 / ΥΙΛΙ universal target sequence with a linker sequence encoded by predominantly glycine and serine residues (ie, GlySer linkers); a sequence of β2Μ; a second encoded Gly-Ser linker sequence; an MHC heavy chain allele; a third Gly-Ser linker sequence; a purification pool; and a polyA sequence. The universal target sequences are not the same in this exemplary method, ie, they are different from each other. PCR assembly of comPACT mini-qenes:
[00465] In this method, two primers (<60 nt) are synthesized with a chosen antigen sequence (as used for this example for clarity, antigen sequence refers to neoantigen sequence). The first primer has the neoantigen sequence (as used for this example for clarity, neoantigen sequence refers to the neoepitope sequences described in Example 2) at the 5' end followed by a stretch of the second sequence universal target at the 3' end. The second primer has the reverse complement of the neoantigen sequence (as used for this example for clarity, neoantigen sequence refers to the neoepitope sequences described in Example 2) at the 5' end and the reverse complement of the first universal sequence at the 3' end. These primers are mixed with a DNA fragment encoding the promoter region, the signal sequence, and the first universal target sequence, and another DNA fragment encoding the second universal target sequence, the p2m sequence, the allele of MHC, the purification pool and a polyA sequence. Each antigenic peptide primer is annealed to its complementary sequence and a PCR reaction is run that amplifies the neoantigen sequence (as used for this example for clarity, neoantigen sequence refers to the neoepitope sequences described in Example 2). ) on either the promoter fragment or the allele fragment of MHC. These two newly synthesized fragments now each have the neoantigen sequence (as used for this example for clarity, neoantigen sequence refers to the neoepitope sequences described in Example 2). Other PCR reactions, together with primers for the 5' end of the promoter sequence and the 3' end of the polyA sequence, allow neoantigen sequences (as used for this example for clarity, the sequence of neoantigen refers to the neoepitope sequences described in example 2) hybridize to each other and prime the assembly of a full-length linear comPACT amplicon.
[00466] The fully assembled linear comPACT polynucleotide is then cleaned up for direct transfection into mammalian producer cells, deriving steps using E. coli and plasmid production together. Example 4: Expression and purification of comPACT proteins from plasmids protein expression
[00467] Neoantigen12 (neo12) was ligated into an HLA-A2 template sequence and inserted into an expression plasmid (pPACT0010) by restriction digest of the Notl and BamHI restriction sites and ligation as described above in example 1.
[00468] Mammalian Exp¡293 producer cells in a shake flask volume of 30 mL were transfected with pPACT0010 incubated with Expifectamine transfection reagent on day -1. the enhancers RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ included in the Expifectamine transfection kit were added on day 0. Cell supernatant samples were collected on days 1 to day 7 and assessed for secreted protein by SDS-PAGE and staining. of total protein using Safestain (ThermoFisher). Levels of secreted comPACT protein increased until day 3, at which point protein secretion leveled off (Figure 7). The secreted comPACT protein was initially identified by its apparent molecular weight (=53 kDa) and confirmed by Western blotting using NTA-HRP to detect the His6 affinity tag (SEQ ID NO: 34). protein purification
[00469] Neo12 comPACT protein harvested on day 7 was purified by Ni-NTA affinity chromatography by binding the affinity tag to His6 (SEQ ID NO: 34). Samples were evaluated for total protein using SDS-PAGE and Safestain. The lack of comPACT protein in the flow-through fraction (FT) from the affinity column confirmed that the His6 tag (SEQ ID NO: 34) was not cleaved during expression and purification (Figure 8). The purified yield was >400 mg per L of culture volume.
[00470] The neo12 comPACT protein was biotinylated (discussed below in Example 5) and further purified by size exclusion chromatography. A single major peak was observed, suggesting that the protein folded properly and was monomeric, with little aggregation (Figure 9). The second peak is ATP, which was added for the BirA-catalyzed biotinylation reaction.
[00471] While Ni-NTA chromatography was used in Example 4, any HA affinity chromatography (including but not limited to the metal affinity chromatography described herein) could be used to purify comPACT labeled with HA. Production volume optimization and parallel production
[00472] comPACT production was scaled down from a 30 mL culture volume in a shake flask to 0.7 mL in a 96 deep well shake block. Mammalian Exp¡293 producer cells were transfected with plasmid DNA containing plasmid pPACT0010, and the secreted neo12 comPACT protein was purified as described above. 437 mg / L of purified neo12 comPACT protein was collected from a 0.7 mL concavity volume compared to the previously described yield of >400 mg / L from the 30 mL purification experiment (Figure 10). The protein yield of the 0.7 mL experiment corresponds to >300 micrograms of protein, or -1000 times more than what is needed for a typical flow cytometry experiment.
[00473] Next, the parallel expression of multiple comPACT constructs was evaluated. Eight different comPACT constructs with different neoantigens (neoantigens 10, 15, 64, 65, 66, 67, 80, and 83) were expressed in 30 mL shake flasks as a mean yield assay (Figure 11). Each comPACT construct was transfected into cells as described above where the comPACT protein was expressed and secreted into the cell supernatant. The expressed protein was purified as described above, concentrated, and normalized. Samples of crude supernatant and concentrated protein were analyzed for total protein as described above. The comPACT proteins were purified by size exclusion chromatography (Figure 12). A single peak, containing 2-20 mg of protein, was observed for each protein, also suggesting that the comPACT proteins folded appropriately and were monomeric. Example 5: Expression and purification of comPACT proteins from linear amplicons
[00474] In the above examples, the comPACT proteins were expressed from plasmids transfected into mammalian producer cells. As an alternative approach, linear amplicons of the neo12 comPACT mini-gene (neoantigen 12 assembled into a mini-gene with the HLA-A2 template sequence) flanked by a promoter sequence and a polyA sequence were transfected into 0.7 mL of Producer cells in a 96-well dish. As a control, plasmid pPACT0010 was also transfected into separate producer cells. Protein from both samples was expressed, purified and assayed for total protein as described above. Similar levels of proteins expressed by both the linear amplicon and the plasmid were produced (Figure 13A), suggesting that the protein encoded by a comPACT mini-gene can be produced without the need for a plasmid intermediate. Multiple different comPACT mini-genes with different neoepitope sequences (Figure 13B) have been produced for direct transfection of producer cells.
[00475] Additional comPACTs with different HLA alleles were performed using the hybridization and phosphorylation workflow described in Example 2. Linear amplicons were derived from the expression vector using sparse PCR and universal primers, and transfected into Exp¡ cells. 293F for comPACT protein production (data not shown). Example 6: Biotinylation of comPACT proteins In vitro biotinylation of comPACT with isolated BirA enzyme
[00476] The comPACT purification pool included a BirA recognition sequence (Avitag) for biotinylation. Purified comPACT proteins were unbiotinylated (without BirA treatment) or biotinylated with commercial BirA protein according to manufacturer's instructions (BirA treated). After overnight enzymatic treatment with BirA, samples were bound to two different types of streptavidin magnetic beads (C1 and T1) and incubated to allow the biotinylated protein to bind to the streptavidin beads. The supernatant (SN) and the beads (pellet", P) were separated by SDS-PAGE. Samples were analyzed for total protein with Safestain and the presence of comPACT protein by Western blotting with NTA-HRP (Figure 14). In the untreated samples, the comPACT protein was found mainly in the SN fraction, confirming that it was biotinylated. In the biotinylated samples, the comPACT protein was found in both the C1 and T1 streptavidin bead granule samples, although the interaction between the biotinylated proteins and the C1 streptavidin beads was the most complete. Biotinylated comPACT protein was not detected by Western blotting in the supernatant depleted by streptavidin C1 beads, suggesting that -100% of the comPACT protein was biotinylated.
[00477] The comPACT proteins can also be biotinylated in the cleared supernatant, prior to purification. Multiple comPACT proteins were expressed in producer cells as described above. Cell culture supernatant was collected and clarified by centrifugation. The clarified supernatant was treated with RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ commercial BirA protein according to manufacturer's instructions and then purified by Ni-NTA affinity chromatography and assessed for biotinylation by Western blotting (Figure 15). All comPACT proteins tested were biotinylated using this method, indicating that biotinylation of comPACT proteins in cleared cell supernatants is effective. While Ni-NTA chromatography was used in Example 6, any HA affinity chromatography (including but not limited to the metal affinity chromatography described herein) could be used to purify the HA-tagged comPACT.
[00478] To produce enough BirA for high-throughput biotinylation of comPACT proteins, a His6-tagged BirA protein (SEQ ID NO: 34) was expressed in E. coli cells. This His6-tagged BirA (SEQ ID NO: 34) was purified by Ni-NTA affinity chromatography (Figure 16B) and can be used to biotinylate comPACT proteins. A second version of BirA-His6 (His6 described as SEQ ID NO: 34) with a His6 tag cleaved by TEV (SEQ ID NO: 34) was also expressed and purified by Ni-NTA affinity chromatography (Figure 16C). This BirA-TEV-His6 protein (His6 described as SEQ ID NO: 34) can be purified by Ni-NTA, the His6 tag (SEQ ID NO: 34) removed by TEV cleavage, and the untagged BirA then was used to biotinylate the comPACT proteins. After biotinylation of the comPACT proteins, the untagged BirA protein can then be purified by Ni-NTA affinity chromatography. In addition, TEV protease was heterologously expressed in E. coli for use with BirA-TEV-His6 (His6 described as SEQ ID NO: 34) ( Figure 16A ) for use in the production of biotinylated comPACT protein. While Ni-NTA chromatography was used in Example 6, any HA affinity chromatography (including but not limited to the metal affinity chromatography described herein) could be used to purify the HA-tagged comPACT.
[00479] Cleavage of the His6 tag (SEQ ID NO: 34) in comPACT proteins after biotinylation was also evaluated and the results shown in Figure 17. The comPACT proteins were treated or not treated with BirA to biotinylate them. as described above (lanes 1 and 2 of Figure 17). A third comPACT protein sample was treated with BirA and then TEV to cleave the His6 tag (SEQ ID NO: 34) present in the protein (lane 3). Samples were separated by SDS-PAGE, and total protein was assessed by Safestain. All three samples had equal amounts of comPACT protein. Biotinylation of the comPACT proteins and cleavage of the His6 tag (SEQ ID NO: 34) was assessed by Western blotting using a SA-HRP reagent for the biotin signal and an NTA-HRP reagent for the His6 tag (SEQ ID NO: 34). The non-biotinylated sample showed no biotin signal, but did have a His6 signal (SEQ ID NO: 34) and the biotinylated uncleaved sample had both signals. The biotinylated TEV-cleaved sample had only the biotin signal, indicating that the His6 tag (SEQ ID NO: 34) was successfully cleaved from the comPACT protein.
[00480] A third approach to biotinylate comPACTs in vitro is to express BirA in Exp¡293 producer cells. Exp¡293 cells co-expressing BirA and a V5-tagged cell surface transduction marker were generated. Transduced cells sorted for V5+ also express BirA (Figure 18). These cells can be used to produce biotinylated comPACTs in vivo prior to comPACT protein purification. Example 7: Antigen-specific T cell staining and affinity assessment using comPACT proteins RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ
[00481] To compare antigen-specific T-cell staining using standard comPACT and peptideMHC proteins, comPACT dextramers were prepared according to a published protocol (Bethune, Μ. T., et al. BioTechniques 62, 123-130, doi:10.2144 / 000114525 (2017)). T cells were engineered to express a TCR specific for A2 / neo12 and stained with either HLA-A2 / neo12 peptide-MHC dextramers or HLA-A2 / neo12 peptide-comPACT dextramers. Staining with the comPACT dextramers was at least as efficient as that of the peptide-MHC dextramers (Figure 19). These data suggest that the comPACT dextramers can be used to sort antigen-specific T cells for TCR sequencing. Example 8: Functional T Cell Assays
[00482] Beyond antigen-specific capture of T cells, the modular design and ease of production of comPACT facilitate its use in functional T cell assays. For example, the incorporation of a mutated version (S88C) of β2m allows comPACTs to be labeled with a maleimide-dye conjugate, assembled as NTAmers, and used to measure TCR-comPACT binding kinetic parameters. S88C mutant comPACT proteins were constructed and expressed at -150 mg / L. These mutant comPACTs exhibit similar purity and elution profiles to wild-type comPACTs (Figure 20). Other dyes, such as Cy5, can also be conjugated to comPACT S88C (Figure 21). Example 9: comPACT library production
[00483] The diversity of HLA alleles across the human populations of the United States of America was analyzed from the Allele Frequency Network Database (www.allelefrequencies.net) by bioinformatics to identify the optimal number of alleles. alleles to include in the HLA repertoire to effect high coverage of the present HLA frequencies. 9736 alleles were analyzed. Figure 24A shows the analysis of the percentage of patients in which one or both alleles of each of the HLA A, B, and C loci are covered by a library of 66 HLA alleles. Solid lines indicate 1 allele is covered, while dashed lines indicate both alleles are covered. 66 alleles allow coverage of at least 4 of 6 HLA alleles per patient in >95% of the total population and 6 / 6 alleles in >80% of the population (Figure 24B). The most common HLA-I allele is HLA-A02O1 with -50% prevalence in the United States of America. Therefore, the HLA libraries shown for the first time herein allow the greatest potential for broad implementation of personalized neoTCR T cell therapies for a global and diverse population.
[00484] Next, a comPACT protein library with different selected HLA alleles and neoepitopes was made. Neoepitope candidates were chosen from the immune epitope database (www.iedb.org). The complete sequences for each of the 66 HLA-I alleles in the repertoire were obtained from the IMGT database and modified to include the Y84C mutation. All clones were sequence verified and deposited into the database and reagent inventory. Ten neo-epitope peptides were selected from the IEDB database and inserted into a panel of 36 HLA alleles. comPACT polypeptides of the selected neoepitopes and HLA alleles were expressed and purified by size exclusion chromatography column (Agilent Sec Bio 300) connected to an Agilent Infinity II HPLC (SEC-HPLC) system according to the 7Π7 / 3 / ΥΙΛΙ manufacturer's instructions. The results are shown in Figure 25A-25C. The comPACT polypeptides were purified as monodisperse polypeptides, as assessed by SEC-HPLC by measuring the area under the curve of the monomer peak divided by the area under the entire chromatogram (Figures 25A and 25B). Most of the comPACT polypeptides were expressed at a high titer (Figure 25C). At least one comPACT protein for each HLA allele described has been purified and characterized by HPLC, indicating that the comPACT platform is robust and susceptible to many alleles. Example 10: imPACT T-Cell Isolation Method
[00485] Materials and methods
[00486] comPACT library preparation
[00487] PE and APC tetramer particles paired with three comPACT library elements and a barcode were prepared prior to the experiment. comPACT biotin side (1 μΜ, internally generated) and DNA barcode (1 μΜ, IDT) were mixed in a 3:1 molar ratio. PE-streptavidin (3.33 μΜ, Life Technologies) or APC-streptavidin (6.26 μΜ, Life Technologies) were added to react with biotin in a ratio of 1:4. After incubation, additional biotin was introduced to occupy free streptavidin sites.
[00488] Staining of CD8 T cells
[00489] Cells were incubated with 40 nM fluorescent comPACT tetramers for neoantigen-specific T-cell staining. Fe receptor blocking solution was subsequently added to minimize non-specific antibody staining. Samples were also incubated with an antibody cocktail containing FITC CD4, CD14, CD19, CD20, CD40, PerCp-Cy5.5 CD8, BV711 CD45RA, BV786 CD95, and BV510 IP26 (Biolegend) to identify the T cell phenotype.
[00490] Classification of individual cells
[00491] Fluorescently labeled cells were sorted into single cells using FACSAria III (BD Biosciences). Cells were first sorted for T-cell phenotype based on IP26 and CD3 staining, then sorted for dual p-HLA binding based on APC and PE staining. comPACT-positive cells were sorted into a 96-well plate containing 10 mM Tris lysis buffer and RNase inhibitor (Promega).
[00492] TCR cloning
[00493] An RT-PCR master mix was prepared containing the following reagent: nuclease-free water (Invitrogen), 5x buffering agent (Qiagen), 10mM dNTP (Qiagen), alpha multi-primer mix, beta multi-primer mix , alpha antisense primer, beta antisense primer, DNA barcode sense primer, DNA barcode antisense primer (all primers ordered via IDT), Onestep RT-PCR enzyme (Qiagen ) and KOD polymerase (Millipore). The RTPCR master mix was then added to each concavity to initiate reverse transcription and polymerase chain amplification for TCR and DNA barcode sequences.
[00494] Sensitivity and Y / N test
[00495] CD8 T cells expressing a TCR against a MARTI antigen (F5) or a neo12 neoantigen were incubated with fluorescent comPACT particles with the corresponding comPACT neoantigen element (MART1 or neo12). Cells were stained and sorted by FACS as described previously (Figures 29A-29C).
[00496] CD8 T cells expressing a TCR against neoantigen neo12 were spiked in a control PBMC sample at a ratio of 1:300,000. The contaminated sample was incubated with a library of 33 tetramers, comprising the neo12 comPACT and an additional 32 neoantigen comPACT elements. Individual cells were sorted based on the separation strategy described above for APC and PE double labeled CD8 T cells (Figure 30).
[00497] Specificity and Y / N Assay
[00498] CD8 T cells expressing a TCR against neoantigen neo12 were spiked into a control PBMC sample at a ratio of 1 to 300,000 or at a ratio of 1 to 30,000. PBMCs alone were used as a negative control. The contaminated sample was incubated with a library comprising the neo12 comPACT and 28 irrelevant control comPACT elements. Individual cells were sorted based on the separation strategy described above for APC and PE double labeled CD8 T cells. The barcodes and S / N ratios of each barcode associated with a given cell were determined. Results Sensitivity
[00499] Figure 29A provides a diagram of the endogenous TCR separation strategy for isolating PACT neoantigen CD8 T cells (upper panel) and tetramer-positive double labeled T cells (lower panel). T cells expressing the F5 (Figure 29B) or neo12 (Figure 29C) neoantigens were labeled and sorted according to the sorting strategy. Corresponding tetramer staining produced greater than 99% accuracy for F5 and neo12 comPACT neoantigen T cells. A replicate of this assay resulted in greater than 99% tetramer staining of both F5 and neo12 gene-edited T cells (data not shown). Consequently, the imPACT method has a high staining and grading sensitivity of more than 98% or 99%.
[00500] To test the sensitivity of the imPACT tetramer method, a cell doping experiment was performed. T cells expressing neo12 neoantigen were spiked in a control PBMC sample at a ratio of 1 to 300,000 (1 neo12 T cell per 300,000 PBMC). ImPACT tetramer analysis was performed using tetramers made from neo12 comPACT and 32 irrelevant control comPACT. Cells positive for all 33 comPACT tetramers were sorted from CD8 T cell sorting as described above. Cells were sequenced for the relevant neoID and TCR sequence. After sequencing, a signal-to-noise (S / N) ratio was used to determine the specificity of tetramer binding. The S / N calculation for this example was the DNA copy number for the most dominant neoID divided by the second most dominant neoID. In this example, an S / N greater than 10 was considered to be specific binding of comPACT to a T cell. The indexed flux result of IP26 staining for each cell indicates whether a given cell is gene-edited or non-gene-edited. previous treatment. RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ
[00501] Table 4 summarizes the cells sorted from this experiment. Total 1686,717 cells were analyzed by flow cytometry and 11 cells from the separated portion were classified as positive. Table 4 Number of the number of cells processed Number of cells sorted Number of neo12 cells in theory Number of neo12 cells identified Number of non-specific cells Average S / N 1686717 11 5.6 5 - 83.1 - - 6 1.1
[00502] 5 of the 11 positive cells have a S / N greater than 10 (average S / N = 83.1), while the other 6 have a S / N less than 10 (average = 1.1). Based on the ratio of neo12-doped cells (1:3000,000) and the number of cells processed (1,686,717), there should be approximately 5-6 ned 2 cells in the sample tested. The sequencing result shows that 5 neo12 cells were isolated using the method. Therefore, the imPACT tetramer method is sensitive enough to isolate antigen-specific cells at a frequency as low as 1 / 300,000. Figure 30 shows the separated FACS cells for the 1:300,000 doped sample. TCR- indicates neo12-positive T cells, while TCR+ indicates non-specifically bound T cells. The mean S / N ratio of neo12-specific cells was 83, while the mean S / N ratio of non-specific cells was 1.1. specificity
[00503] Next, the imPACT isolation method was evaluated for neoantigen specificity. The neo12 doping assay was repeated with a second library comprising the neo12 comPACT and 28 irrelevant control comPACTs spiked into a PBMC sample. PBMCs alone were used as a negative control. Double positive cells were isolated, barcodes sequenced, and the S / N ratio of each barcode associated with a given cell was determined. Figure 31 shows the FACS separation data of PE and ACP for the neo12 antigen-doped PBMC sample and the undoped PBMC sample. Tables summarizing the barcode S / N sequencing results are shown below each test. In the specific test, the average S / N was 162, indicating 162 neoID barcode copies of neo12 for each non-neo12 neoID barcode. This indicates a high specificity of the neo12 barcode for cells sorted from the neo12 and PBMC samples. In contrast, the average S / N in the non-specific test was 1.7, indicating only 1.7 copies of the neo12 neoID barcode for each non-neo12 neoID barcode. This indicates a low specificity of the neo12 barcode for sorted cells in the single PMBC sample.
[00504] The assay was repeated with a 33-item comPACT library spiked to a PBMC sample at a ratio of 1 neo12 T cell to 30,000 PBMC. Figure 32A shows separate double positive cells, while Figure 32B shows the average barcoded S / N of specific and non-specific T cells. The signal to noise ratio of 33 tetramer-positive cells was determined. The mean S / N of specifically binding T cells was 124.9, while the nonspecific S / N ratio was 1.2, confirming the high specificity of the ImPACT method for isolating neoantigen-specific T cells. Table 3 summarizes the information for the classified cells, as well as whether the isolated cell was genetically modified (it is gene-edited). RMi7lf\l\ ZnZ / 3 / ΥΙΛΙ Table 3 Edited Gene Cell Number Y / N Edited Gene Cell Number Y / N Edited Gene Cell Number Y / N 1 Yes 285.2 13 Yes 42.8 22 No 1.4 2 Yes 231.5 14 Yes 42.6 23 No 1.4 3 Yes 227.0 15 Yes 42.3 24 No 1.4 4 Yes 217.8 16 Yes 41.1 25 No 1.2 5 Yes 215.9 17 Yes 38.6 26 No 1.2 6 Yes 215.4 18 Yes 35.1 27 No 1.2 7 Yes 180.8 19 Yes 31.0 28 No 1.1 8 Yes 171.4 20 Yes 29.1 29 No 1.1 9 Yes 166.4 21 Yes 25.7 30 No 1.1 10 Yes 145.4 31 No 1.1 11 Yes 135.8 32 No 1.0 12 Yes 100.9 33 No 1.0 Example 11: Isolation of Neoantigen T Cells from Patient Samples Materials and methods
[00505] Tetramer preparation
[00506] Tetramers were prepared as discussed above.
[00507] CD8 selection and cell staining
[00508] Cryopreserved patient PBMCs were thawed and CD8 T cells selected using the CD8+ T cell isolation kit (Miltenyi) according to the manufacturer's recommended protocol. Isolated CD8 T cells were used for subsequent staining. Cells were incubated with 40 nM fluorescent comPACT tetramer libraries for staining of neoE-specific T cells. Fe receptor blocking solution was subsequently added to minimize non-specific antibody staining. Samples were incubated with an antibody cocktail containing FITC CD4, CD14, CD19, CD20, CD40, PerCp-Cy5.5 CD8, BV711 CD45RA, BV786 CD95, and BV510 IP26 (Biolegend) to identify the T cell phenotype. used near IR live / dead cell staining (Invitrogen) to differentiate between viable and non-viable cells. BV605 Annexin-V (Biolegend) was used to further differentiate between viable and apoptotic cells.
[00509] Single Cell Sorting and TCR Cloning
[00510] Fluorescently labeled cells were sorted into single cells using FACSAria III (BD Biosciences). Viable, CD8+, tetramer-positive cells were sorted into a 96-well plate containing 10 mM Tris lysis buffer and RNase inhibitor (Promega). Cells were then frozen for subsequent TCR cloning. An RT-PCR master mix was prepared containing the following reagent: nuclease-free water (Invitrogen), 5x buffering agent (Qiagen), 10mM dNTP (Qiagen), alpha multi-primer mix, beta multi-primer mix, alpha antisense, beta antisense primer, DNA barcode sense primer, DNA barcode antisense primer (all primers ordered via IDT), Onestep RT-PCR enzyme (Qiagen), and polymerase KOD (Millipore). The RT-PCR master mix was then added to each concavity to initiate reverse transcription and polymerase chain amplification for TCR and DNA barcode sequences. Two additional rounds of PCR were performed to further amplify the TCR and DNA barcode sequence, as well as to append adapter sequences for next generation sequencing (NGS). [00511 ] Next generation sequencing
[00512] Next generation sequencing was performed on a Miniseq (lllumina) using the recommended reagents. Library preparation was performed according to the lllumina recommended protocol. Target and PhiX species were mixed in equal parts to provide diversity. Results
[00513] First, a stage IIIA melanoma patient sample (PACT032) was analyzed using a 26-part comPACT library with an allele type of HLA A02:01. Of the 3.9x106 PBMC in the sample, 231 were double positive for APC and PE. Cells were analyzed for neoID barcoding and signal-to-noise ratios of all double positive cells were determined. Figure 33A shows the FACS dot plot of double positive T cells. After neoID sequencing, one T cell showed specificity for one mutation, with a signal-to-noise (S / N1) of greater than 10. This neoantigen TCR was cloned and screened against the predicted neoantigen. The remaining double positive cells had signal / noise ratios of 1, and were not specific for the neoantigen associated with the bound comPACTs. A secondary analysis ( Figure 33B ) confirmed the specificity of the isolated neoantigen TCR by hit analysis. Table 5 below provides a summary of the signal-to-noise ratio of specific and non-specific T cell.
[00514] Table 5 TCR clonotype S / N count (UMI) TCR+ 230 1 PACT32-TCR75 1 13 Example 12: Analysis of S / N1 and S / N2 to identify TCR
[00515] A stage III melanoma patient sample (PACT077) was then analyzed using a 138-item comPACT library with HLA types A02:01, A24:02, B18:01, and C07:01. Of the 5.1x106 PBMC in the sample, 250 were double positive for APC and PE. Cells were analyzed for neoID barcoding and signal-to-noise ratios of all double positive cells were determined. Figure 34A shows the FACS dot plot of double positive T cells. Figure 34D shows the neoantigen-specific T cells identified in peripheral blood. Stars indicate that the same TCR clonotype is found in tumor-infiltrating lymphocytes (TILs) from tumor sequencing. After neoID sequencing, 25 T cells showed specificity for one mutation, with a signal-to-noise (S / N1) of more than 10 (Figure 34C). Figure 34B shows that all candidate cells come from antigen-proven CD95+ cells. Neoantigen TCRs were cloned and screened against the predicted neoantigens. Figure 34E shows the percentage of neoTCR gene-edited lymphocytes that can recognize the cognate antigens. The remaining double positive cells had signal / noise ratios of 1, and were not specific for the neoantigen associated with the bound comPACTs. Table 6 below provides a summary of the T cell signal-to-noise ratio for selected neoantigens. RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ
[00516] Table 6 SEQ ID NO: Average S / N neoantigen 203 EYIPGTTFL 25 204 IYNIIVTTL 43 205 KTSVALHLI 19 206 HLSLELLGVD 21 207 DEYIPGTTF 32
[00517] Interestingly, analysis of the PACT077 TCRs identified 8 different TCRs. 6 of them had S / N1 ratios of more than 10, and were confirmed to be neoantigen-specific T cells. For the other 2 T cells, the S / N1 ratios were lower than 10, but the S / N2 ratios were higher than 10 (Figure 34C). Cloning of the two TCRs (TCR143 and TCR164) revealed that they can recognize two different neoantigens sharing the same mutation, further explaining the reason for the low S / N1 (Figure 35A). These results indicate that S / N2 ratios can be used to distinguish non-specific cells from specific cells, when there are multiple neoantigens derived from the same mutation.
[00518] A secondary analysis (Figure 35B) confirmed the specificity of the neoantigen TCRs TCR135, TCR136, TCR139, TCR142, TCR144 and TCR145 isolated by imPACT analysis.
[00519] Figure 36 shows that the isolated TCRs varied across mutations with various levels of clonality, truncation capacity, and in situ neoantigen expression levels. Example 13: Isolation of double neoID barcoded neoantigen T cells Materials and methods
[00520] Tetramer preparation
[00521] Paired fluorescent tetramer particles were prepared as discussed above, with the exception that each pair of particles had a different unique neoID barcode associated with the neoantigen (see Figure 28 for a diagram of the paired particles with double barcode).
[00522] CD8 selection and cell staining
[00523] Cryopreserved patient PBMCs were thawed and CD8 T cells selected using the CD8+ T cell isolation kit (Miltenyi) according to the manufacturer's recommended protocol. Isolated CD8 T cells were used for subsequent staining as described above.
[00524] Single Cell Sorting and TCR Cloning
[00525] Fluorescently labeled cells were sorted into single cells using FACSAria III (BD Biosciences) as described previously.
[00526] Next Generation Sequencing
[00527] Next generation sequencing was performed on a Miniseq (lllumina) using the recommended reagents as described above. Results
[00528] PBMCs from PACT049 (stage 4 CRC, naive) were examined using the imPACT process and dual barcoding. A six element double barcoded comPACT library (HLA-B57:01, Α01Ό1, and C06:02) was produced and used to interrogate neoantigen TCRs. 352 individual cells were sorted. After sequencing analysis, three neoantigen TCR candidates against an HLA-B57O1 neoantigen, RCSPEQLKKAW (SEQ ID NO: 208) were identified (Figure 37A). These three candidates were classified based on tetramer MFI (mean fluorescent intensity) and all were considered CD95+ antigen-experienced ( Figure 33B ). After cloning PACT049 neoantigen T cells, these TCRs were confirmed by dextramer staining with the relevant predicted neoantigen ( Figure 37C and Figure 37D ). Example 14: Further Isolation of Neoantigen T Cells from Patient Samples
[00529] Additional patient samples were incubated with comPACT libraries and isolated according to the ImPACT method described above. Patient samples were analyzed using the ImPACT signal-to-noise method and single or dual barcode creation methods. A graph of the numbers of neoantigens and HLA types identified from each sample and cancer type is provided in Figure 38A and the HLA type is tabulated in Figure 38B. Thirty-two neoantigen-specific TCRs were identified across five cancer types and thirteen periphery HLA types. Neoantigens were identified in samples from colorectal cancer (11), melanoma (7), bladder cancer (3), endometrial adenocarcinoma (1), and head and neck cancer (1). Two patient samples (PACT056 and 095) did not produce any neoantigen-specific TCRs. Four patient samples (PACT032, 052, 053, and 078) have a neoantigen-specific TCR. Multiple neoantigen-specific TCRs were isolated in each of the following seven samples: PACT035, 036, 037,049, 077,131, and 133. Multiple neoantigen-specific TCRs allow selection of the best TCR for patients. Two samples (PACT077 and 078) had peripheral TCRs that were also found in situ by deep TIL sequencing. These results indicate that the neoantigen-specific TCR identification success rate is 100% for a patient undergoing drug treatment and greater than 80% for a patient without treatment.
[00530] The results indicate that the ImPACT technology is capable of successfully isolating antigen-matched neoantigen-specific TCRs from patient samples with high precision and specificity. As the imPACT technology targets (or targets) neoantigens and the antigen presentation pathway is universal, the imPACT platform technology can be applied to different types of cancer, enabling the development of T-cell therapies neoTCR tests for the eradication of solid tumors. Example 15: Reproducibility of the T cell isolation method
[00531] Next, a library of comPACT items was used to analyze PBMCs from a healthy donor. 15 matched fluorescent comPACTs (HLA Α02Ό1) were performed with neoantigens for cytomegalovirus (CMV), Epstein-Barr virus (EBV) and influenza as described previously. The comPACT libraries were incubated with PBMC and double positive T cells sorted and isolated. neoID barcodes were sequenced and TCRs cloned and sequenced as described above. The experiment was performed in triplicate.
[00532] Figure 39A shows the percent antigen specificity for isolated T cells with neoantigens against CMV and EBV in each of three replicates. Figure 39B shows the number of TCR alpha chains isolated from each experiment. Table 7 provides a summary of the identified TCR alpha chains. 14 unique alpha TCR chains were identified and 10 of the 14 are shared across all three experiments. This reproducibility experiment shows that the ImPACT method can consistently isolate antigen-specific T cells from the same sample at similar levels in independent experiments, indicating that the method for isolating double-positive T cells by incubating the cells with tetramers of comPACT paired with different fluorophores is highly reproducible in multiple settings. RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ
[00533] Table 7 TCR No. SEQID NO: TCRa TCR Count 1st 2nd 3rd 1 209 CAVRDVSARLMF 40 46 41 2 210 CARNTGNQFYF 20 23 24 3 211 CAVLMDSNYQLIW 15 8 7 4 212 CAVRDVNARLMF 8 7 10 5 213 CAVMLYT DKLIF 6 4 3 6 214 CAFNDYKLSF 4 3 5 7 215 CAVFFGNVLHC 1 5 2 8 216 CASSPVAGNNRKLIW 3 1 3 9 217 CILVNNNDMRF 2 3 2 10 218 CAVLRDSNYQLIW 3 1 1 11 219 CALVYDKIIF 4 0 0 12 220 CAFPYGSNRLAF 0 1 2 1 3 221 CAHNYGQNFVF 1 1 0 14 222 CAGPHAGGTSYGKLTF 1 0 0 Example 16: Comparison of T cell isolation with comPACT tetramers, dextramers, and trimers
[00534] Efficiency of isolation of tetramers, dextramers, and trimers from comPACT library items in the double staining method was evaluated. Tetramers of a streptavidin core were incubated with four copies of each comPACT element (tetramer), trimers of a streptavidin core were incubated with three copies of each comPACT element and a nucleic acid barcode (trimer + DNA), and dextramers. of a dextran polymer with multiple copies of a comPACT element with and without a nucleic acid barcode (dextramer and dextramer + DNA), with T cells engineered to overexpress F5 (MARTI) or neo12 neoantigen. T cells were isolated based on the activation strategy described in Example 10 above and the percentage of double stained T cells isolated by each staining method was quantified. As shown in Figure 40A (F5 T cells) and Figure 40B (neo12 antigen-specific T cells), greater than 98% of the gene-edited cells stained with the corresponding comPACT elements. The data indicate that for tetramer, dextramer, trimer with DNA, and dextramer with DNA, similar staining efficiency was achieved for T cells with a common TCR (F5 Mart-1) and a neoantigen (neo 12) TCR. Example 17: Comparison of signal to noise analysis
[00535] PACT Neo12 T cells, PACT M1W T cells and viral donor PBMC were incubated with comPACT particles of nucleic acid barcoded trimer (Trimer+DNA) and dextramers with multiple copies of an element of comPACT with a nucleic acid barcode (Dextramer + DNA). Cells were sorted into single cells by FACS. TCR alpha / beta and neoID barcodes for each sample were cloned and sequenced. All TCRs were confirmed to be correct for neo12, CMV, or M1W. S / N analysis was performed on each cell as described above. The S / N ratios of each method (trimer, T; or dextramer, D) for each sample are shown in Figure 41A. The average S / N ratio of each method is given in Figure 41B. Notably, neoID barcode DNA signal-to-noise analysis indicates a higher signal-to-noise ratio for the cell isolated with the Trimer+DNA particles compared to the cells isolated with Dextramer+DNA. The data indicates that Trimer+DNA particles have a much better S / N ratio compared to Dextramer+DNA. Example 18: Isolation and characterization of neoantigen T cells from patient samples after cancer immunotherapy
[00536] Subjects with pMMR colorectal cancer (generally not considered responsive to anti-PD1 antibody therapy) or endometrial adenocarcinoma were treated with AB122 (anti-PD-1 antibody). Pretreatment blood samples were incubated with comPACT libraries and isolated according to the ImPACT method described above to identify the baseline repertoire of neoantigen-specific T cells. PBMC were then collected at different time points and analyzed by the ImPACT signal-to-noise method to monitor the evolution of mutation-targeted T-cell repertoire treatment. Changes in the neoantigen-specific T cell repertoire were monitored during AB122 treatment to allow correlation of immune phenotyping with clinical outcomes. Results
[00537] The upper panels of Figures 42A-42C show the longitudinal evolution of neoantigen-specific T cells in peripheral blood during treatment for patients with colorectal cancer, PACT157 (Figure 42A) and PACT132 (Figure 42B); or endometrial cancer, PACT131 ( Figure 42C ). RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ
[00538] The lower panels of Figures 42A-42C show the neoantigen clonality and the predicted neoantigen-HLA binding affinity for each sample. The upper dot indicates a clonal mutation, while the lower dot indicates a subclonal mutation.
[00539] The gene sequences, HLA types, and neoantigen for each of the TCRs identified by the ImPact method in each subject are also shown in Figures 42A-42C.
[00540] Longitudinal monitoring of patients during therapy allows analysis of neoantigen-targeting T cells and identifies driver mutations that correlate with therapeutic benefit. In addition, monitoring changes in the neoantigen-specific T cell repertoire in response to immunotherapy may inform the next steps of treatment. Example 19: Phenotype and functional characterization of T cells specific for PACT131 neoantigens
[00541] T cells isolated by the imPACT isolation technology method from the PACT131 patient sample were characterized for cell surface markers CD45RA, CD95, CD39, and CD103 by flow cytometry. Flow cytometry results of T cells isolated from the patient at days 1, 15, and 57 are shown in Figure 43. Black dots indicate neoantigen-specific T cells. CD45RA+CD95+ T cells are tested for antigen, while CD39+CD103+ positivity suggests that the T cells have been trafficked through the tumor compartment.
[00542] Next, three TCR clones (TCR200, TCR202, and TCR205) were characterized against the same PIK3CA neoantigen target captured from the patient sample. T cells were edited to express the selected TCRs. The percentage of live, CD8+ and CD4+ T cells is shown in Figure 44A. Neoantigen-specific T cell activation was determined by incubating the edited T cells with increasing amounts of an HLA cognate peptide and measuring the secretion of IFN, IL2, and TNFa. Cytokine release for each TCR clone is shown in Figure 44B. All T cells were activated by the cognate neoantigen. No cytokine release against non-cognate neoantigens was detected (data not shown). Example 20: Validation of neoTCR isolated from melanoma patient samples using the imPACT method
[00543] Materials and Methods
[00544] comPACT Library Preparation
[00545] Whole exorn sequencing of a tumor biopsy and the patient's normal PBMC was used, and RNA-Seq transcriptome sequencing of the tumor biopsy identified non-synonymous somatic mutations in patient PACT135. The patient has stage IV metastatic melanoma and was undergoing anti-PD1 antibody therapy with nivolumab. 2566 coding mutations were identified. 632 neoepitopes were predicted from the tumor mutational burden, and a library of 243 comPACTs (HLA-neoepitope complexes) was produced across HLAA*03:01, A*24:02, and C*12:03, as shown. described in Examples 10 and 11. HLA typing was predicted by the OptiType program based on whole exorn sequencing of the patient's normal PBMC. 3 of 6 HLAs were matched in the library.
[00546] Isolation of T cells Rhh7JRIl 7Π7 / 3 / ΥΙΛΙ 7Π7 / 3 / ΥΙΛΙ
[00547] PBMC and TIL samples were collected from subject PACT135 at various time points before or during anti-PD-1 antibody therapy. PBMC samples were collected on day 14, day 43, and day 84 after the start of therapy. TIL samples were collected on day -37 before anti-PD1 treatment was started and on day 82 after therapy was started. T cells were incubated with the comPACT library and neoantigen-specific T cells were isolated using the imPACT method as described in Examples 10 and 11.
[00548] 14 TCRs specific for 5 neoantigen-HLA were isolated; one neoTCR that recognizes PUM1, one neoTCR that recognizes TTP2, two neoTCRs that recognize IL8-HLA-A*24:01, and ten neoTCRs that recognize IL8-HLA-A*03:01. T cells expressing neoTCR were expanded in medium containing IL2, IL7, IL15, or combinations thereof for 14 days. At the end of expansion, T cells retained a younger T cell phenotype, resulting in NeoTCR-P1 T cells exhibiting memory T stem cell and core memory T cell phenotypes.
[00549] NeoTCR gene editing
[00550] Donor-derived healthy CD4 and CD8 T cells were engineered to express each identified neoantigen-specific TCR using a non-viral CRISPR-based method as described in International Patent Application No. WO2019089610, published May 9, 2019, hereby incorporated by reference in its entirety.
[00551] Expression of neoTCR
[00552] Expression of neoTCRs on gene-edited CD4 and CD8 T cells was analyzed using a fluorophore-comPACT trimer dextran complex. Biotinylated comPACT proteins were bound to streptavidin dextramer and incubated with neoTCR CD4 and CD8 T cells. Binding of a comPACT dextramer to the respective neoTCR-expressing T cell was determined by the method described in more detail in Bethune, et al. (BioTechniques 62:123-130 Mar. 2017) and Bethune, et al. (eLife 5: 2016), each incorporated herein by reference for all that they teach. Dextramers were prepared using fluorescently labeled streptavidin (Life Technologies, Carlsbad, CA).
[00553] Production of matched autologous melanoma cell line
[00554] A matched autologous melanoma cell line was established from a biopsy of a patient (M489). As a negative control, a second mismatched melanoma cell line was established from a biopsy from a different patient (M202). The functionality of NeoTCR-expressing T cells (expression of activation markers, secretion of cytokines, killing of antigen-specific target cells, and proliferation of T cells) was assessed using the autologous matched and mismatched melanoma cell lines.
[00555] T cell activation
[00556] T cells expressing NeoTCR were incubated with or without IFNγ and co-cultured with the M489 matched melanoma tumor cell line and neoantigen matched comPACT dextramers. As a negative control, neoTCR T cells incubated with or without IFNγ were also co-cultured with the M202 mismatched melanoma tumor cell line and neoantigen matched comPACT dextramers. T cell stimulation with the anti-CD3 antibody OKT3 was used as a positive control. Internalization of neoTCRs after comPACT dextramer binding was assessed by FACS.
[00557] Expression of the activation markers 4-1BB and OX-40 were also determined in CD4 and CD8 neoTCR T cells co-cultured with the matched and mismatched melanoma cell lines. The expression of the activation markers was determined by FACS. Anti-OX-40 antibody (clone Ber-ACT35, cat# 350012) and anti-4-1BB antibody (clone 4B4-1, cat# 309810) were purchased from Biolegend.
[00558] T cell cytotoxicity assay
[00559] T cell-induced killing of tumor cells over time was monitored by immunofluorescence using the IncuCyte imaging system (Essen BioSciences). Each of the 14 neoTCR expressing T cells was co-cultured with the patient matched M489 tumor cells. NeoTCR T cells were also co-cultured with the mismatched M202 mismatched cell line as a negative control. M489 and M202 tumor cells were labeled using the NucLight Red Lentivirus (Essen BioSciences).
[00560] M489 or M202 tumor cells were seeded in a 96-well plate at 25,000 cells / well and incubated overnight in the incubator. The next day, neoTCR T cells were added at the following concentration: 25,000 T cells / concavity (T cell:tumor cell ratio of 1:1) or 100,000 T cells / concavity (T cell:tumor cell ratio of 5 :1). The co-culture preparations were then monitored by time-lapse image collection at 2-hour intervals for 12 days using the IncuCyte imaging system with the 10X objective.
[00561] Cytokine secretion assay
[00562] Cytokine production was assessed in the supernatant of co-cultured T cells and melanoma cell lines using the cytokine bead assay (CBA bead-based immunoassay, BD BioSciences). CBA is a flow cytometric multiplexed bead-based immunoassay application that allows quantification of multiple proteins simultaneously by the use of antibody-coated beads to efficiently capture analytes. After 24 or 48 hours of co-cultivation of T cells and target cells, supernatants were collected and analyzed for IFNγ, IL-2, and TNFo secretion.
[00563] Results
[00564] Identification of neoTCR in PACT135 over time
[00565] The imPACT analysis resulted in the isolation of 14 TCRs specific for 5 HLA-neoantigens, one neoTCR recognizing PUM1, one neoTCR recognizing TTP2, two neoTCRs recognizing IL8-HLA-A24O2, and ten neoTCRs recognizing IL8 -HLA-A03:01. The sequences of neoantigen peptides, alpha and beta TCR CDR3 sequences, and HLA alleles isolated from patient PACT135 are shown in Table 8 below. Table 8 ID# Gen SEQ ID NO: Neoantigen Peptide SEQ ID NO: CDR3Alpha SEQ ID NO: CDR3 Beta HLA TCR218 TPP 2 223 CFSEVSAKF 228 CAESSPSGGYNKLIF 242 CASSAIRTYEQYF A24:02 TCR219 IL8 224 KTYF(S)KPFHPK 229 CAVNSGSARQLTF 243 CASSNNNEQFF Α03Ό1 TCR220 IL8 224 KTYF(S)KPFHPK 230 CWNGENDYKLSF 244 CASQRMYDNEQFF Α03Ό1 TCR221 IL8 225 YF(S)KPFHPKF 231 CAMTYGNNRLAF 245 CASSMGQGADEQYF A24:02 TCR222 PU M1 226 AMMD YFFQR 232 CAVRRGSGAGSYQLTF 246 CASGPDTPLYGYTF Α03Ό1 TCR223 IL8 224 KTYF(S)KPFHPK 233 CAVRDYNQGGKLIF 247 CASSEAWGYEQYF Α03Ό1 TCR224 IL8 224 KTYF(S)KPFHPK 234 CAVNDPNDYKLSF 248 CASSHKWSTEAFF Α03Ό1 TCR225 IL8 224 KTYF(S)KPFHPK 235 CAGYQGGSEKLVF 249 CASSQNNEQYF Α03Ό1 TCR 227 IL8 227 YFKPFHPKF 236 CAVGSNAGGTSYGKLTF 250 CASSSDRAPPLHF A24:02 TCR228 IL8 224 KTYF(S)KPFHPK 237 CWNVPNDYKLSF 251 CASSLAYRVEQYF Α03Ό1 TCR229 IL8 224 KTYF(S)KPFHPK 238 CWNPSGGSYIPTF 252 CASSYEGGLAAFTGEL FF Α03Ό1 TCR232 IL8 224 KTYF(S)KPFHPK 239 CWNLSNDYKLSF 253 CASSSSWNTEAFF Α03Ό1 T CR240 IL8 224 KTYF(S)KPFHPK 240 CAVSGDDYKLSF 254 CASSSSTWEQYF Α03Ό1 TCR241 IL8 224 KTYF(S)KPFHPK 241 CWNSNDYKLSF 255 CASSPRWSTEAFF Α03Ό1 TCR218 TPP 2 223 CFSEVSAKF 228 CAESSPSGGYNKLIF 242 CASSAIRTYEQYF Α24Ό2 TCR219 IL8 224 KTYF(S)KPFHPK 229 CAVNSGSARQLTF 243 CASS NNNEQFF Α03Ό1 TCR220 IL8 224 KTYF(S)KPFHPK 230 CWNGENDYKLSF 244 CASQRMYDNEQFF Α03Ό1 TCR221 IL8 225 YF(S)KPFHPKF 231 CAMTYGNNRLAF 245 CASSMGQGADEQYF Α24Ό2 TCR222 PU M1 226 AMMDYFFQR 232 CAVRRGSGAGSYQLTF 246 CASGPDTPLYGYTF Α03Ό1 TCR223 IL8 224 KTYF(S)KPFHPK 233 CAVRDYNQGGKLIF 247 CASSEAWGY EQYF Α03Ό1 TCR224 IL8 224 KTYF(S)KPFHPK 234 CAVNDPNDYKLSF 248 CASSHKWSTEAFF Α03Ό1
[00566] Figure 45 provides a summary of the number of neoantigen-specific T cells for CD8 T cells in each sample collected during the course of anti-PD-1 antibody treatment. Each box represents one T cell, each cross represents ten T cells. Each column of boxes or crosses represents a single neoTCR clonotype.
[00567] TCR219, TCR220, TCR223, TCR224, TCR225, TCR228, TCR229, TCR232, TCR240 and TCR241 recognize the neoantigen IL8-KTYFKPFHPK (SEQ ID NO: 256).
[00568] TCR221 and TCR227 recognize the IL8-YFKPFHPKF neoantigen (SEQ ID NO: 227).
[00569] TCR218 recognizes the TPP2-CFSEVSAKF neoantigen (SEQ ID NO: 223).
[00570] TCR222 recognizes the neoantigen PUM1-AMMDYFFQR (SEQ ID NO: 226).
[00571] Expression of neoTCR
[00572] Figure 46 shows that T cell gene editing efficiency was strong for all 14 neoTCRs on both CD4 and CD8 T cells. For 13 of the neoTCR T cells, CD4 and CD8 T cells bound to the cognate comPACT dextramer complexes. However, only CD8 T cells expressing the neoTCR against PUM1 (TCR222) bound the cognate comPACT dextramer, and no comPACT dextramer binding was observed on CD4 neoTCR T cells.
[00573] T cell activation
[00574] The neoTCRs were internalized after co-cultivation of the comPACT-dextramer cognate of neoTCR T cells and the melanoma-matched cell line M489 with and without IFNγ preincubation (Figure 47). A decrease in the percentage of comPACT dextramer-positive T cells indicates internalization of the neoTCR, which is a surrogate marker for T cell activation. Cells incubated with only RPMI medium did not internalize neoTCR-bound dextramer complexes, in so much so that T cells incubated with the anti-CD3 antibody OKT3 internalized the neoTCR-linked dextramer complexes. Neo12 antigen was also used as a negative control for each sample.
[00575] Patient PACT135-derived neoTCR T cells also expressed activation markers 4-1BB (Figure 48) and OX40 (Figure 49) after incubation with the M489 cell line with and without IFNγ preincubation. No expression of 4-1 BB or OX40 was observed on TCR222 CD4 T cells since the neoTCR did not bind to the cognate neoantigen.
[00576] 4-1 BB expression was increased in IL8-HLA-A03 TCRs when tumor cells were pretreated with IFΝγ to activate the immunoproteasome and enhance HLA expression (Figure 48). OX40 expression was increased in IL8-HLA-A03 TCRs when tumor cells were pretreated with IFNγ to activate the immunoproteasome and enhance HLA expression (Figure 49).
[00577] T cell cytotoxicity assay
[00578] All 14 T cell preparations expressing the identified neoTCRs showed specific cytotoxicity against the matched autologous melanoma cell line M489, as determined by the cytotoxicity assay. Figure 50 provides a graph of percent tumor cell confluence after co-cultivation with all neoTCR T cells identified from PACT135 compared to percent tumor cell confluence after treatment with mock, or incubation with mock media. RPMI or neo12 TCR T cells. Figures 51A and 51B provide individual graphs of the percentage confluence of tumor cells after co-cultivation with each neoTCR T cell.
[00579] T cells expressing neoTCR demonstrated strong killing of matched tumor cells at both ratios of T cells: tumor cells tested (1:1 and 5:1 (data not shown)). No cytotoxic activity was observed against the mismatched M202 tumor cell line (data not shown). The control sample had 42% nuclei confluence compared to less than 20% nuclei confluence in each sample incubated with a 1:1 ratio of neoTCR T cells at 96 hours post incubation (p < 0.000001 for each neoTCR T cell sample; Figure 50 and Figures 51A-51B). Importantly, as the number of tumor cells decreased, the number of T cells increased indicating that neoTCR T cells proliferated in response to cognate antigens endogenously expressed by the matched patient tumor cells (data not shown). Two days after co-cultivation with the cognate tumor cells, the neoTCR T cells became activated, indicated by the formation of clusters. T cells proliferated and by day 5 covered the surface of the entire concavity and no tumor cells were detected.
[00580] Even neoTCRs with low frequency in PBMC or TIL samples, such as neoTCRs expressed only on a T cell, had strong activity against matched patient tumor cell lines, demonstrating the high accuracy and sensitivity of the test. imPACT technology.
[00581] Secretion of cytokines from T cells
[00582] T cells expressing NeoTCR were evaluated for the production of antigen-specific cytokines. NeoTCR T cells secreted IFNγ, IL-2 and TNFα cytokines after co-cultivation in the presence of the matched patient melanoma cell line M489. Cytokine secretion was not measured when neoTCR T cells were co-cultured with the mismatched melanoma cell line M202. Figure 52 shows the secretion of ΙΡΝγ, IL2, and TNFa by TCR218 T cells after co-cultivation in the presence of M489. Figure 53 shows IFNγ, IL2, and TNFα secretion by TCR221 T cells and IFNγ secretion by TCR227 T cells after cocultivation in the presence of M489. Figure 54 shows the secretion of IFNγ and TNFα by TCR222 T cells after co-cultivation in the presence of M489. IL2 was not detected at 48 hours. Figure 55 shows IFNγ secretion by T cells from TCR219, TCR223, TCR224, TCR225, TCR229, TCR240 and TCR241 after co-cultivation in the presence of M489 alone (black bars) and after M489 cells were pretreated with IFNy for one hour (grey bars). TCR220, TCR228, and TCR232 T cells secreted IFNγ after co-cultivation with IFNγ pretreated M489 cells. No IL2 or TNFa was detected at 48 hours. Example 21: Validation of neoTCR isolated from samples of patients with colorectal cancer using the imPACT method
[00583] Materials and Methods
[00584] comPACT Library Preparation
[00585] 144 neoepitopes were predicted for a previously untreated patient with colorectal cancer. A library of 61 comPACTs (HLA-neoepitope complexes) was produced across HLA-A*03:01, A*02:01 and B*07:03, as described in Examples 10 and 11.
[00586] Isolation of T cells
[00587] PBMC collected from one subject (PACT035) were incubated with the comPACT library. Neoantigen-specific T cells were isolated using the ImPACT method as described in Examples 10 and 11. Seven neoTCR clonotypes against the COX6C protein were identified.
[00588] NeoTCR gene editing
[00589] CD4 and CD8 T cells derived from healthy donors were engineered to express the seven COX6C neoantigen-specific TCRs using a CRISPR-based non-viral method as described in International Patent Application No. WO2019089610, published 9 May 2019, hereby incorporated by reference in its entirety.
[00590] Cell lines of stable expression of COX6C R20Q
[00591] PACT's precision genome engineering expertise was used to generate stable tumor cell lines expressing the COX6C R20Q neoantigen under control of endogenous regulatory elements. The SW620 colon cancer cell line expressing high levels of cell surface HLA-A02 was used to express the neoantigen. SW620 cells were nucleofected with gRNA / Cas9 and an HDR template to make COX6C R20Q replacement cell lines. Edited cells with individual classification and propagation. The COX6C locus was sequenced. Sequencing analysis showed high editing in approximately 80% of individual cells. Four cell lines expressing COX6C R20Q at the endogenous locus were selected: SW620 cells expressing the wild-type COX6C gene, SW620 cells heterozygous for the COX6C-R20Q mutation, and two lines of RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ SW620 cells homozygous for the COX6C-R20Q mutation (one shown).
[00592] HLA-A02 expression in the modified SW620 cell line was confirmed by flow cytometry using the anti-HLA*A2 antibody BB7.2. K562 cell lines constitutively expressing HLAA*02 and HLA-C*02 were used as positive and negative controls, respectively. SW620 cells were nucleofected with a GFP construct to confirm transfection efficiency.
[00593] T cell activation
[00594] Expression of the activation marker Nur77 was also determined in CD4 and CD8 TCR089 neoTCR T cells co-cultured with SW620 cells homozygous for the COX6C-R20Q mutation. As a negative control, TCR089 neoTCR T cells were also co-cultured with wild-type SW620 cells, or alone. Cells were stained for Nur77 using an anti-Nur77 mAb (eBiosciences) and Nur77 expression was assessed by flow cytometry.
[00595] T Cell Cytotoxicity Assay, Incucyte
[00596] T cell-induced killing of NeoTCR of tumor cells over time was also determined by immunofluorescence using the IncuCyte imaging system (Essen BioSciences). T cells expressing each of the seven identified COX6C neoTCR clonotypes were used in this assay. SW620 cells homozygous for the COX6C-R20Q mutation or wild-type SW620 cells were stained red using NucLight Red Lentivirus (Essen). Labeling tumor cells in red allows them to be differentiated from co-cultured T cells and to monitor tumor cell killing over time. 40,000 tumor cells / well were seeded in a 96-well plate and left overnight in the incubator. The next day neoTCR T cells were added at a 1:1 T cell:tumor cell ratio. Each neoTCR T cell was added to an individual tumor cell sample. RNP (T cells electroporated with ribonucleoprotein (RNP) complexes only), neo12 TCR T cells, and media alone were used as negative controls. Co-culture samples were monitored by time-lapse image collection at 2-hour intervals for 5 days using the IncuCyte imaging system with the 10X objective.
[00597] T cell cytotoxicity assay, flow cytometry
[00598] TCR089 neoTCR T cells were evaluated for antigen-specific T cell-mediated killing. 100,000 TCR089 neoTCR T cells were co-cultured with SW620 cells homozygous for the COX6C-R20Q (+ / +) mutation or wild-type SW620 in different T cell:tumor cell ratios.
[00599] After 24 hours of co-cultivation of T cells and target cells, cells were stained using the Live / Dead Cell Stain Kit (Live / Dead Near-IR Viability Stain for Flow, cat# NC0584313, ThermoFisher) for 20 min at 4 °C in the dark. In cells with compromised membranes, the dye reacts with free amines both within the cell and on the cell surface, producing intense fluorescent staining. In viable cells, dye reactivity is restricted to cell surface amines, resulting in less intense fluorescence. The difference in intensity is usually greater than 50-fold between live and dead cells, allowing easy discrimination. After the incubation cells were washed, they were fixed with the buffering agent of RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ Cl binding from eBioscience (ThermoFisher, cat# 00-8222-49) and analyzed by flow cytometry.
[00600] Cytokine secretion assay
[00601] TCR089 neoTCR T cells were co-cultured with SW620 cells homozygous for the COX6C-R20Q mutation or SW620 cells heterozygous for the COX6C-R20Q mutation at a T cell:tumor cell ratio of 5: 1. As a positive control, TCR089-expressing T cells co-cultured with SW620 WT were boosted with 1μΜ for 1 hour. As a negative control, TCR089-expressing T cells were co-cultured with SW620 wild-type cells. After 24 hours, the supernatant was collected, and cytokine production was assessed using the cytokine bead assay (CBA, BEAD-BASED IMMUNOASSAY from BD BioSciences). CBA is a flow cytometric multiplexed bead-based immunoassay application that allows quantification of multiple proteins simultaneously by the use of antibody-coated beads to efficiently capture analytes.
[00602] Results
[00603] Identification of neoTCR in PACT035
[00604] Seven neoTCR clonotypes against the COX6C protein were identified in the patient sample using the ImPACT T-cell isolation method (Figure 56, indicated by arrows). Two of the seven HLA-neoantigen complexes bind when modified on CD4 T cells and are therefore CD8-independent neoTCRs. COX6C is a subunit of the mitochondrial enzyme cytochrome C oxidase, which is expressed in essentially all tissues at a moderate level. The neoantigen target peptide was residues 18-20, with an R20Q mutation. The neoTCRs that bound to the R20Q COX6C peptide (residues 18-26) were named TCR089, TCR091, TCR092, TCR094, TCR097, TCR098, and TCR099. The sequences of neoantigen peptides, alpha and beta TCR CDR3 sequences, and HLA alleles isolated from patient PACT035 are shown in Table 9 below. Table 9 ID# Gene SEQ ID NO: Neoantigen Peptide SEQ ID NO: CDR3Alpha SEQ ID NO: CDR3 Beta HLA TCR089 COX6C 257 RLQNHMAVA 258 CAVGELDTGFQKLVF 264 CASSEDSYEQYF Α02Ό1 TCR091 COX6C 257 RLQNHMAVA 2 59 CAYPSGNQFYF 265 CASWGAGLPLNTEAFF Α02Ό1 TCR092 COX6C 257 RLQNHMAVA 260 CAVEDSGYALNF 266 CSASRPTDGEQFF Α02Ό1 TCR094 COX6C 257 RLQNHMAVA 261 CALQDSNYQLIW 267 CSAIAGLTDTQYF Α02Ό1 TCR097 COX6C 257 RLQNHMAVA 262 CAFGNFNKFYF 268 CASSLQVPYNEQFF Α02Ό1 TCR098 CO X6C 257 RLQNHMAVA 260 CAVEDSGYALNF 266 CSASRPTDGEQFF Α02Ό1 TCR099 COX6C 257 RLQNHMAVA 263 CAEDYDMRF 269 CASLKEGEAQNIQYF Α02Ό1
[00605] Transfection of SW620 cell lines
[00606] Figure 57A shows no HLA*A2 expression in the KV1858 cell line (it expresses HLA*C2, but not HLA*A2). Figure 57B shows HLA*A2 expression in the KV1832 cell line (expresses HLA*A2). Figure 57C shows HLA*A2 expression in the SW620 cell line (expresses HLA*A2). Figure 57D shows the quantification of GFP in nucleofected SW620 cells. Isotype control antibodies were used as negative controls.
[00607] T cell activation
[00608] Nur77 is an immediate early gene whose expression is increased in a rapidly regulated manner by TCR signaling. Nur77 expression is upregulated in a rapidly regulated manner by TCR antigen signaling. Nur77 expression was detected in TCR089 neoTCR T cells that were co-cultured with SW620 cells homozygous for the COX6C-R20Q mutation (Figure 58). No induction of Nur77 was observed when TCR089 neoTCR T cells were cocultured alone or with SW620 cells expressing the COX6C WT protein.
[00609] T-Cell Cytotoxicity Assay, IncuCyte
[00610] Target cell killing was also measured for each COX6C neoTCR T cell. All T cells expressing neoTCR demonstrated strong killing of SW620 homozygous tumor cells ( Figure 59A ). No cytotoxic activity was observed against SW620 cells expressing the wild-type COX6C protein (Figure 59B). The amount of T cell-induced killing was dose-dependent and increased with increasing T cell:tumor cell ratios.
[00611] IncuCyte images collected during the kill assay using the TCR089 neoTCR T cells also showed that as the number of tumor cells decreased, the number of T cells increased (data not shown). This indicates that TCR089 T cells proliferated in response to the cognate antigen endogenously expressed by SW620 cells homozygous for the COX6C-R20Q mutation.
[00612] TCR089 T cell cytotoxicity assay, flow cytometry
[00613] TCR089 killed SW620 cells homozygous for the COX6C-R20Q mutation but not wild-type SW620 cells. No cytotoxic activity was observed against SW620 cells expressing the wild-type COX6C protein (Figure 60). The amount of T cell-induced killing was dose-dependent and increased with increasing ratios of T cells:TCR089 tumor cells.
[00614] Cytokine secretion assay
[00615] Strong IFNγ secretion was measured in TCR089 T cell samples after co-cultivation with SW620 cells homozygous for the COX6C-R20Q mutation (Figure 61). Half the amount of IFNγ was measured when TCR089 T cells were co-cultured with SW620 cells heterozygous for the COX6CR20Q mutation. Similar I FNy was detected for TCR089 T cells alone, in the absence of tumor cells, or when the T cells were co-cultured with wild-type SW620 cells. Example 22: Method for treating cancer patients with neoTCR T cells
[00616] Patients with cancer or other proliferative disease may require interventional therapy to slow or stop cell proliferation and to kill existing cells that can or do cause harm to the patient (eg, cause pain, discomfort, or disease). . Specifically, the neoTCR T cells described herein can be used to treat cancer.
[00617] As shown in Figure 62, Neo-E-specific TCRs were isolated from patients treated with PD-1 therapy. RNA and DNA were collected from the biopsies and tumor cell lines and RNAseq and WES (whole exorn sequencing) were performed on the biopsies and cells. DNA was also collected from the PBMCs of the patients for WES to use as a control. Once the tumor antigens were identified using RNAseq and WES, they were RMi7lf\l\ 7Π7 / 3 / ΥΙΛΙ used algorithms to select candidate neoepitopes for screening using comPACT polypeptides (with the predicted neoepitopes expressed on them) and the ImPACT isolation technology. Barcoded comPACT particle libraries were assembled and pooled with patient samples. The comPACT particles were able to associate with and capture neo-epitope-specific T cells. Example 23: Example of imPACT insulation technology
[00618] Based on the computational prediction of patient-specific neoE, hundreds of capture reagents consisting of the patient's HLA class I subtypes loaded with the corresponding predicted neoE were made (Peng et al. AACR 2019); neoE-specific T cells were then isolated and alpha and beta TCRs sequenced. The isolated neoTCRs were functionally studied by the generation of primary human T cells expressing the neoTCRs using non-viral accuracy genome modification to replace endogenous TCRs (Jacoby et al., AACR 2019, Sennino et al., AACR 2019).
[00619] T cell responses were analyzed in two patients with metastatic melanoma who received anti-PD-1 therapy. neoE-specific T cells were isolated from peripheral blood mononuclear cells (PBMC) and tumor-infiltrating lymphocytes (TIL) at different time points. Patient PT476 had a durable response; the tumor mutational load (TMB) was 2556; 243 neoE-HLA complexes were produced across 3 HLA types, HLAA03:01, A24:01 and C12:03. This resulted in the isolation of 17 TCRs specific for 5 neoE-HLAs. NeoE-specific T cells were present at baseline in TIL and expanded during treatment in TIL and PBMC. Patient PT461 had rapid disease progression on anti-PD-1; BMR was 61; 78 neoE-HLA complexes covering HLA-A02:01, Α03Ό1, B07:02, C05:01 and C07:02 were produced, resulting in the isolation of 2 TCRs to 1 neoE-HLA.
[00620] To further characterize T cell responses, T cells were gene-edited to express 14 different TCR isolates from patient PT476, specific for neoE in the mutated IL8, PUM1, and TPP2 genes. All 14 T cell preparations showed specific cytotoxicity against a matched autologous melanoma cell line established from a biopsy of patient PT476 (50-75% inhibition of tumor growth compared to melanoma cell line growth co-cultivated with a mismatched control TCR, 96 hour assay using P:T 1:1, p < 0.000001 for each comparison), and had no cytotoxic effect against a mismatched control human melanoma cell line. After co-cultivation with the matched autologous melanoma cell line, neoE TCR T cells upregulated 4-1BB and OX-40, secreted IFNγ, IL-2, and TNFα, and induced cell proliferation and degranulation. T. No responses were observed when T cells were co-cultured with mismatched targets.
[00621] These results show that anti-PD-1 therapy induces neoE-specific T cell responses targeted to a restricted amount of neoE, and that non-viral accuracy genome engineering can successfully redirect T cells to tumors expressing neoE that can be used as an approach for personalized ACT therapy.
[00622] Similarly, in addition to anti-PD-1 therapy, other checkpoint therapies and RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ additional combinations; for example, anti-PD-L1 or anti-CTLA4 therapy could be used.
[00623] As partially described in Example 20, biopsies and PBMCs were collected at multiple time points after anti-PD-1 treatment (Figure 45: Responding patient PT476, and Figure 63: Responding patient). does not respond to PT461 treatment). TIL and cell lines were established from patient biopsies. imPACT isolation technology was used to isolate NeoE-specific T cells and monitor their evolution over time. NeoE derived from non-synonymous mutations was predicted using whole exorn sequencing (WES) and RNAseq of reference point cell lines and scored according to predicted HLA-binding affinity, mutation truncation ability, and the expression level. HLA-NeoE capture reagents for high-level NeoEs were used to isolate NeoE-specific T cells. Figure 45 shows PT476: 243 neoE-HLA complexes were produced across 3 HLA types, HLA-A03:01, A24:01 and C12:03 and 17 TCRs specific for 5 neoE-HLA were isolated. Figure 63 shows patient PT461: 78 neoEHLA complexes covering HLA-A02:01, A03:01, B07:02, C05:01, and C07:02 were produced, resulting in the isolation of 2 TCRs at 1 neoE-HLA. Example 24: Example of imPACT insulation technology methodology
[00624] As described in Example 22, NeoE-specific T cells can be isolated from patient samples. In this example, the ImPACT isolation technology resulted in the identification of 14 neoTCR T candidates including: 12 IL-8(HLA-A24:02 and HLA-A03O1) neoTCR T candidates, 1 PUM1 neoTCR (HLA-A3O1), and 1 TPP2 neoTCR candidate (HLA-A24:02).
[00625] As shown in Figure 62, the imPACT isolation technology methodology includes three workflows: gene editing, cocultivation assay, and cell-based assay.
[00626] Gene editing: CD8 and CD4 T cells from a healthy donor were precisely engineered to express the neoTCR. Briefly, neoE-specific TCR sequences were cloned into homologous recombination (HR) DNA templates. These HR templates were used with site-specific nucleases to modify primary human T cells. Single passage accuracy genome modification (non-viral) resulted in the seamless replacement of the endogenous TCR with the patient's neoE-specific TCR (native sequence), the expression of which is under endogenous regulation.
[00627] Cocultivation assay: NeoTCR-P1 T cells were cocultivated with a melanoma cell line derived from the baseline biopsy of the same patient (M489) or a mismatched melanoma tumor cell line in a final product to target (P:T) ratio of 1:1 or 5:1. Target cell kill was assessed over 6 days using the IncuCyte system. The expression of the proliferation marker KÍ67 was evaluated by flow cytometry at 48h. The expression of the activation marker was evaluated by flow cytometry at 24 h. Cytokine secretion was measured in the cell supernatant at 48 h using the BD Cytokine Accountability (CBA) II Human Th1 / Th2 Cytokine Kit.
[00628] Coculture Assay: Peptide-HLA: recognition / stimulation, target cell killing, proliferation, activation markers, and cytokine secretion assays. RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ Example 25: Modified neoTCR T cells kill autologous tumor cells
[00629] As shown in Figure 64, neoTCR T cells kill autologous melanoma tumor cells. Using time-lapse microscopy of tumor cell death and T cell proliferation, NeoTCR T cells were co-cultured with autologous melanoma cell lines expressing a nuclear red fluorescent protein (RFP) in a stable manner. More specifically, NeoTCRs were made to target the IL-8-HLA-A*03:01 neoantigen in melanoma cell lines and those NeoTCRs were cultured with the IL-8-HLA-A neoantigen melanoma cell line. *03:01 (top three images in figure 64) and that was compared to the negative control (bottom three images in figure 64). The images shown here were collected at time 0 (left panels), 2 days (middle panels), and 5 days (right panels). Accordingly, NeoTCRs are specific for tumor neoantigen and are capable of effectively killing autologous tumor cells.
[00630] The ability of neoTCR T cells to kill autologous tumor cells can also be seen in Figure 65A. NeoTCR T cells were co-cultured with autologous (black bars) or mismatched (white bars) melanoma tumor cells and after 48 h the percentage of CD8 neoTCR T cells expressing KÍ67 (proliferation marker) was evaluated by flow cytometry. * p<0.05 compared to mismatched melanoma tumor cells (t-test with Holm-Sidak method for multiple comparison correction). T cells expressing the NeoTCR neo12 were used as a negative control.
[00631] Similarly, NeoTCR T cells were shown to express activation markers after co-cultivation with autologous tumor cells. This can be seen in Figure 65B. NeoTCR T cells were cocultured with autologous cells (black bars) or mismatched tumor cell line (white bars) and after 24 h the percentage of CD8 neoTCR T cells expressing activation markers 4-1BB (part top) or the percentage of CD4 neoTCR T cells expressing the activation marker OX40 (bottom bar graph) was assessed by flow cytometry. * p<0.05 compared to mismatched melanoma tumor cells (t-test with Holm-Sidak method for multiple comparison correction). T cells expressing the NeoTCR neo12 were used as a negative control. To measure the upregulated OX-40 in CD4 neoTCR T cells, melanoma cells were pretreated with IFNγ for 24 h before co-cultivation with T cells.
[00632] Finally, NeoTCR T cells were shown to secrete gamma interferon after co-cultivation with autologous tumor cells. This can be seen in Figure 65C. NeoTCR T cells were co-cultured with autologous melanoma tumor cells and after 48 h IFN secretion was assessed by flow cytometry (CBA). Mock T cells were used as a negative control. * p<0.05 (t test with Holm-Sidak method for multiple comparison correction).
[00633] This collectively shows that newly generated NeoTCR T cells expressing the TCRs isolated using the ImPACT isolation technology upregulate activation and proliferation markers after co-cultivation with autologous tumor cells. Most importantly, all NeoTCR T cells specifically kill patient-derived autologous melanoma cells Example 26: T cell dosing of NeoTCR eradicates tumors in mice and in vitro in a modified cell line
[00634] Tumors expressing neoantigens were implanted in the flank of 15 NOD scid gamma (NSG) mice. When the tumors reached 95 mm3 in size, the mice were divided into two groups: control group (7 mice), which received PBS, and treated group (8 mice), which were dosed with neoTCR T cells (5*106 T cells). totals / mouse; gene editing efficiency 50%). As shown in Figure 66A after infusion of the NeoTCR T cells (see arrow in the figure), the tumor size decreased and by day 19 the tumors were completely eradicated. Figure 66B shows the number of human CD8 T cells / mL present in mouse blood on day 4 after neoTCR T cell infusion and on day 35 after neoTCR T cell infusion. Despite the fact that NSG mice lack human cytokines, NeoTCR T cells were present in circulation after tumor eradication, showing that NeoTCR T cells not only kill target cells, but also proliferate and persist. . Example 27: Design of NeoTCR T cells that are specific for stem tumor mutations
[00635] The subclonal mutation nature of tumor progression in primary tumors and in metastases creates a problem in the field of oncology because oncology drugs that are personalized in the sense that they are designed to target a protein, product chemical, or cell with a specific mutation (for example, many small molecule drugs are designed to target tumors based on point mutation). Because tumors often mutate (mutations accumulate during cancer growth and the duration of the disease) in later stages of primary tumors and in metastasis, a drug that worked well to shrink or slow tumor progression when first detected and treated, it may lose its effectiveness over time.
[00636] Described herein is the ability to engineer and produce NeoTCR T cells that are specific for tumor stem cell mutations. Using algorithms and bioinformatics approaches, tumor-unique stem mutations that are expressed by all cancer cells in a patient were identified. Example 28: NeoTCR T cells address all HLA types in the global population
[00637] There are 13,000 HLAs in the human population. Each person has a set of 6 HLAs. As a result, less than 1% of any NeoE-HLA tumor target is the same between patients (data generated from analysis of 60,000 patients (Hartmaier et al. (2017) Genome Medicine) and 20,000 patients (Schumacher & Schrieber (2015) ) Science) The analysis performed shows that the HLA allele catalog for PBMC interrogation is: >99% with at least 1 HLA allele covered, >90% with between 4 and 6 alleles covered, and >60% of potential clinical trial subjects in the United States of America are predicted to have all 6 covered alleles. Example 29: NeoTCR therapy can be used for tumors with a low mutational load, a moderate mutational load, and a high mutational load
[00638] Because the imPACT isolation technology is extremely sensitive, it is possible to detect neoantigens in the tumor at all grades of mutational loads. For example, NeoTCR T cells can be used to treat tumors with a low tumor mutational burden such as prostate and breast cancer, tumors with a medium tumor mutational burden such as ovarian and colorectal cancer, and tumors with a low tumor mutational burden. discharge such as bladder cancer and melanoma.
[00639] Accordingly, the ImPACT isolation technology described herein can be used to design, modify, and produce NeoTCRs for low, medium, and high tumor mutational burden tumors. In certain aspects, imPACT isolation technology methods can be used to detect neoantigens in tumors of low, medium, and high tumor mutational burden. In certain aspects, ImPACT isolation technology methods have been used to detect neoantigens in tumors of low, medium, and high tumor mutational burden. In certain aspects, ImPACT isolation technology methods can be used to produce a composition comprising NeoTCR for treating low, medium, and high tumor mutational burden tumors in patients suffering from this tumor. In certain aspects, the imPACT isolation technology methods can be used to produce a population of NeoTCRs to treat low, medium, and high tumor mutational burden tumors in patients suffering from this tumor. Example 30: Method for treating patients with a NeoTCR T-cell therapy
[00640] The initial step in treating patients with a NeoTCR T-cell therapy is examination of the patients. Once they are examined and biopsies are taken, the patient can be enrolled and leukapheresis will be performed. During the time of manufacturing NeoTCR T cells (patient-specific) as described herein, which includes comPACT library creation, ImPACT isolation technology screening, and editing T cells to express the NeoTCR, patients may optionally be enrolled in a bridging therapy (eg, a standard of care therapy that includes first-line, second-line, third-line, and post-line therapies for the specific indication of cancer). This bridging therapy can be prescribed and administered between 0 and 60 days and on average between 21 and 42 days. After optional bridging therapy, the patient can be prescribed a conditional chemotherapy. This conditioning chemotherapy can be administered 5, 4, and 3 days prior to the administration of NeoTCR T-cell therapy. On the day of administration, patients will receive an infusion of the NeoTCRs. After this, the tumors will be evaluated. Example 31: Compositions and Method for Treating Non-Cancer Diseases and Disorders Using NeoTCR T Cells
[00641] Without limitation, diseases other than cancer can be treated with NeoTCR T cell therapy. Specifically, any disease or disorder that causes the afflicted cell population to produce a disease / disorder-specific neoantigen can be treated with a NeoTCR T-cell therapy. The cells include cells that are infected by a virus, a fungus, or a bacterium that, as a result of the infection, present infection-specific neoantigens that are detectable by a NeoTCR T cell. Cells associated with inflammatory or autoimmune disease may also present disease-specific neoantigens from which NeoTCR T cells will be produced. For example, if a patient is suffering from an allergy or an inflammatory disease, a NeoTCR can be performed against a neoantigen that is specific for the inflammatory cytokine ligand that is presented on the inflamed cell. Example 32: Imaging method using a NeoTCR T cell
[00642] Once the comPACT and imPACT isolation technology methods have been employed in a patient tumor sample, the NeoTCR T cells can be used to treat the disease, as described herein, and can also be use to image, detect, and / or monitor tumor burden, progression, remission, and eradication. This can be done by labeling the NeoTCR T cells with a detectable label (for example, any imageable label such as with a dye or with a zirconium label; see, for example, US Pat. America No. 8,771,966 which is hereby incorporated by reference in its entirety).
[00643] For example, a NeoTCR T cell can be genetically engineered to express a fluorescent dye or protein. The labeled NeoTCR T cell can be used to determine the efficacy of NeoTCR T cell therapy in eradicating tumors; wherein if the labeled NeoTCR T cell can be imaged by proliferating and expanding, it can be extrapolated that NeoTCR T cell therapy is effective because the cells differentiate into effector T cells after target antigen encounter.
[00644] For example, a NeoTCR T cell can be labeled with an agent such as zirconium89. The labeled NeoTCR T cell can be used to determine the presence of any tumor NeoTCR T cell therapy (before, during, or after) based on the interaction or lack thereof between the NeoTCR T cell and the tumor cell (if present).
[00645] Without limitation, cells other than tumor cells presenting neoantigens that allow the production of NeoTCR T cells may also be imaged. These cells include but are not limited to those described in Example 30. For example, if an inflammatory disease was treated by the design and delivery of a NeoTCR T-cell therapy using the methods described herein such that a inflammatory cell-specific neo-epitope (for example, a neo-epitope on the inflammatory cytokine ligand that causes inflammation) and NeoTCR T cells were designed and produced from it, the NeoTCR T cell itself could be labeled with an imaging agent to then determine whether the cell-presenting ligand is still present or whether the NeoTCR effectively eradicated or sufficiently reduced the cell population to ameliorate the patient's disease state. Example 33: Method for determining the efficacy of neoTCR T cell therapy and methods for adjusting neoTCR T cell therapy dosage
[00646] After dosing a patient with a NeoTCR T-cell therapy, efficacy can be monitored using imaging methods known in the art. For example, a patient can be infused with a NeoTCR T-cell therapy as described herein, followed by administration of an imageable tumor tracer 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days after tracer administration. In certain modalities, the tracer can be administered the same week as NeoTCR T cell therapy, the week after NeoTCR T cell therapy, two weeks after NeoTCR T cell therapy, three weeks after NeoTCR T-cell therapy, or one to months after NeoTCR T-cell therapy.
[00647] In certain modalities, if the tumor, after NeoTCR T-cell therapy, does not progress but does not shrink (as visualized using imaging), additional administrations of the therapy may be given RMi7lf\l\ ΖηΖ / 3 / ΥΙΛΙ of NeoTCR T cells. In certain embodiments, if the tumor, following NeoTCR T-cell therapy, does not optionally shrink and increase in size (as visualized using imaging), additional administrations of NeoTCR T-cell therapy may be administered.
[00648] In certain modalities, a tracer and imaging is used every 3-6 months after NeoTCR T-cell therapy to monitor disease status. In certain modalities, a tracer and imaging are used every 6-12 months after NeoTCR T-cell therapy to monitor disease status. Example 34: Methods of treating a patient using a neotcr T cell
[00649] Neoepitope candidates are synthesized and cloned into the comPACT polynucleotide as described in Examples 1-9. Briefly, a polynucleotide sequence encoding a candidate antigen peptide is inserted into an MHC template depicted in Figures 1-5. Mammalian cells are seeded and transfected with the comPACT polynucleotides comprising the candidate antigen peptide sequence. The transfected cells express and secrete the comPACT polypeptides into the cell medium. Conditioned media is harvested from the cells and the comPACT polypeptides are purified by size exclusion chromatography. The purified comPACT polypeptides are then assembled with multimer particles (eg, tetramers, dextramers, NTAmers) comprising multiple copies of the comPACT polypeptides, a DNA barcode, and a fluorophore (eg, APC or PE). One of the advantages of this approach is the high throughput production and screening of multiple neoepitope candidates at the same time. Furthermore, this process can be automated. Two different types of particles, a first with APC and a second with PE as a fluorophore, are combined to obtain a set of particles capable of recognizing a patient-specific antigen peptide.
[00650] In order to identify neoTCR T cells and their TCR sequences, freshly isolated or cryopreserved T cells from the patient are stained with the multimer particles as well as with a pool of antibodies for phenotypic characterization. Barcoded and viable T cells are sorted into individual cells and their DNA and RNA are extracted and analyzed by next generation sequencing. As described in Examples 11-13, sequencing data obtained from comPACT positive T cells are analyzed to identify and validate the predicted antigen peptide, neoTCR T cells and validated neoepitope TCR candidates and their sequences.
[00651] Neo-epitope TCR sequences are cloned into a homology-directed recombination (HDR) template for T-cell genome editing. Additional details on the sequence and structure of the template can be found in the International Patent Application No. PCT / US2018 / 058230, the contents of which are incorporated herein by reference. T cells from the patient, freshly harvested or previously cryopreserved, are engineered for TCR gene disruption and HDR template integration using non-viral methods. A CRISPR / Cas9 approach comprising gRNA to the endogenous loci of TCRalpha and TCR-beta gene sequences can be used to disrupt the endogenous TCR loci. The HDR template will recombine with one of the endogenous disrupted TCR gene sequences to introduce the identified neo-epitope TCR. Consequently, the modified T cells lack expression of the endogenous TCR and express the neoepitope TCR. These T cells Rhh7JRIl 7Π7 / 3 / ΥΙΛΙ neoTCRs are then adoptively transferred into the patient and specifically target tumor cells expressing the neoantigen.
[00652] Compared to other adoptive cell transfer methods, this process has significant advantages including, but not limited to: i) it is flexible as it allows for personalized targeting of tumor-only mutations presented in the context of specific HLAs of patient; ii) provides a clinical tool to attack cancer cells that express neoantigens that are not expressed on the cell surface; ¡ü) works regardless of the patient's ethnicity or type of cancer; and iv) it can be automated for multiple steps and has a small manufacturing footprint.
[00653] While the invention has been shown and described in particular with reference to a preferred embodiment and various alternative embodiments, it will be understood by those skilled in the pertinent art that various changes in form and detail may be made thereto without deviate from the spirit and scope of the invention.
[00654] All references, issued patents, and patent applications cited within the body of this specification are hereby incorporated by reference in their entirety, for all purposes.
Claims
1. A method comprising: a. contacting a sample with a plurality of distinct particle assemblies, i. wherein each particle comprises a unique antigen peptide, an operatively associated barcode, and at least one identification mark, ii. wherein the sample comprises T cells, and iii. wherein the contact comprises providing suitable conditions for an individual T cell to bind to a unique antigen peptide of at least one particle assemblies; b. isolating one or more T cells bound to a particle; c. identifying the barcode of the particle bound to the isolated T cell; d. determining a relationship of each barcode.
2. The method of claim 1, wherein the ratio is calculated by identifying a copy number of a first barcode and a copy number of a second barcode and by dividing the copy number of the first barcode by the copy number of the second barcode.
3. The method of any of claims 1-2, wherein the single antigen peptide is the same for each distinct particle set.
4. The method of any of claims 1-3, wherein each distinct particle assembly comprises at least one or more barcodes, wherein each barcode is associated with the identity of the antigen peptide.
5. The method of any of claims 1-4, wherein the ratio of each barcode corresponds to the antigen specificity of the isolated T cell.
6. The method of any of claims 1-5, wherein the isolated T cell is identified as an antigen-specific T cell if the ratio of the first barcode is above a threshold.
7. The method of claim 6, the threshold is at least or greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 2-5, 3-6, 4-7, 5-8, 5-10, 7-10, or greater than 10.
8. The method of any of claims 1-7, wherein the barcode identification comprises a nucleotide-based assay.
9. The method of claim 8, wherein the nucleotide-based assay is a PCR, an RT-PCR, a sequencing, or a hybridization assay.
10. The method of any of claim 8 or 9, wherein the nucleotide-based assay determines (a) a sequence of each barcode and / or (b) a copy number of each barcode.
11. The method of any of claims 1-10, further comprising obtaining a T cell receptor (TCR) CDR sequence.
12. The method of any of the preceding claims, further comprising obtaining a TCR gene sequence.
13. The method of claim 12, wherein the TCR sequence is a sequence of alpha TCR or beta TCR chain.
14. The method of any of the preceding claims for identifying the antigen specificity of a T cell.
15. The method of claim 14, wherein the antigen specificity of the T cell comprises the antigen peptide sequence and the TCR sequences of the bound T cell.
16. The method of any of claims 1-15, wherein the at least one identification mark is the same on each distinct particle set.
17. The method according to any of claims 1 to 16, comprising at least two different identification marks.
18. The method of any of claims 1-17, wherein the at least one identification mark is a fluorophore.
19. The method of claim 18, wherein the fluorophore is selected from the group comprising allophycocyanin (APC) and phycoerythrin (PE).
20. The method of claim 17, wherein the at least two different identification marks are fluorophores, wherein the fluorophores are selected from the group comprising allophycocyanin (APC) and phycoerythrin (PE).
21. The method of any of claims 1-20, wherein the antigen peptide is selected from the group consisting of a tumor antigen, a neoantigen, a tumor neoantigen, a viral antigen, a bacterial antigen, a phosphoantigen, and a microbial antigen.
22. The method of claim 21, wherein the neoantigen is identified from tumor sequencing data of a subject.
23. The method of claim 22, wherein an in silico predictive algorithm is used to determine the neoantigen.
24. The method of claim 23, wherein the predictive algorithm further comprises an MHC binding algorithm to predict the binding between the neoantigen and an MHC peptide.
25. The method of any of claims 1-24, wherein the sample is selected from a blood sample, a bone marrow sample, a tissue sample, a tumor sample, or a peripheral blood mononuclear cell (PBMC) sample.
26. The method of any of claims 1-25, wherein the T cell is a human T cell.
27. The method of claim 26, wherein the T cell is a CD8+ T cell.
28. The method of any of claims 1-27, wherein the method comprises a library of distinct particle sets.
29. The method of claim 28, wherein the library comprises from 2 to 500 distinct sets of particles.
30. The method of any of claims 1-29, wherein each particle comprises an RMi7lf\l\ ZηZ� / 3 / YILI MHC peptide.
31. The method of claim 30, wherein the MHC peptide is a human MHC peptide.
32. The method of claim 30, wherein the MHC peptide is an HLA class I peptide.
33. The method of claim 30, wherein the HLA peptide comprises an HLA-A, HLA-B, or HLA-C peptide.
34. The method of claim 33, where the HLA peptide comprises HLA-A*01:01, HLA-A*02:01, HLAA*03:01, HLA-A*24:02, HLA-A*30:02, HLA-A*31:01, HLA-A*32:01, HLA-A*33:01, HLA-A*68:01, HLA-ΑΊ 1:01, HLA-A*23:01, HLA-A*30:01, HLA-A*33:03, HLA-A*25:01, HLA-A*26:01, HLA-A*29:02, HLA-A*68:02, HLA-B*07:02, HLAB*14:02, HLA-B*18:01, HLA-B*27:02, HLA-B*39:01, HLA-B*40:01, HLA-B*44:02, HLA-B*46:01, HLA-B*50:01, HLAB*57:01, HLA-B*58:01, HLA-B*08:01, HLA-B*15:01, HLA-B*15:03, HLA-B*35:01, HLA-B*40:02, HLA-B*42:01, HLAB*44:03, HLA-B*51:01, HLA-B*53:01, HLA-B*13:02, HLA-B*15:07, HLA-B*27:05, HLA-B*35:03, HLA-B*37:01, HLAB*38:01, HLA-B*41:02, HLA-B*44:05, HLA-B*49:01, HLA-B*52:01, HLA-B*55:01, HLA-C*02:02, HLA-C*03:04, HLAC*05:01, HLA-C*07:01, HLA-C*01:02, HLA-C*04:01, HLA-C*06:02, HLA-C*07:02, HLA-C*16:01, HLA-C*03:03, HLAC*07:04, HLA-C*08:01, HLA-C*08:02, HLA-C*12:02, HLA-C*12:03, HLA-C*14:02, HLA-C*15:02, o HLA-C*17:
01.
35. The method of any of claims 1-34, wherein each particle comprises an HLA peptide and a β2M peptide.
36. The method of claim 35, wherein the β2M peptide is a human β2M peptide.
37. The method of claim 36, wherein the β2M peptide comprises a mutation.
38. The method of claim 37, wherein the mutation is S88C.
39. The method of any of claims 1-38, wherein each particle comprises a polypeptide comprising, in an amino-to-carboxyl-end orientation, (i) the antigen peptide, (ii) a β2M peptide, and (iii) an MHC peptide.
40. The method of any of claims 1-39, wherein the antigen peptide is 7-15 amino acids, 7-10, 8-9, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids in length.
41. The method of claim 39 or 40, wherein the polypeptide is biotinylated.
42. The method of any of claims 1-41, wherein the particles are selected from the group consisting of magnetic beads, agarose beads, styrene polymer particles, and dextran polymer particles.
43. The method of any of claims 1-42, wherein the particles are coated with streptavidin.
44. The method of any of claims 1-43 for monitoring an immune repertoire in a subject.
45. The method of claim 44, further comprising monitoring changes in antigen-specific T cells in the subject.
46. The method of claim 44 or 45, comprising administering immunotherapy to the subject.
47. The method of claim 46, wherein the immunotherapy is an adoptive cell transfer or a checkpoint inhibitor. 100 48. The method of any of claims 1-47 for identifying at least one TCR sequence.
49. The method of claim 48, wherein the at least one TCR sequence is an alpha TCR sequence, a beta TCR sequence, or a combination thereof.
50. The method according to claim 48 or 49, further comprising manufacturing a soluble TCR polypeptide.
51. A library comprising at least two particle sets, each particle set comprising an antigen peptide, a barcode operatively associated with the identity of the antigen peptide, and at least one identification mark.
52. The library of claim 51, wherein the at least one identification mark is the same on each set of particles.
53. The library of claim 51 or 52, comprising at least two different identification marks on each distinct particle set.
54. The library of any of claims 51-53, wherein the at least one identification mark is a fluorophore.
55. The library of claim 54, wherein the fluorophore is selected from the group comprising allophycocyanin (APC) and phycoerythrin (PE).
56. The library of claim 53, wherein the at least two different identification marks are fluorophores, wherein the fluorophores are selected from the group comprising allophycocyanin (APC) and phycoerythrin (PE).
57. A particle comprising at least one polypeptide, a barcode, and an identification mark, wherein the polypeptide comprises an antigen peptide, a β2M peptide, and an MHC peptide, and wherein the barcode is operatively associated with the identity of the antigen peptide.
58. The particle of claim 57 selected from the group consisting of magnetic beads, agarose beads, styrene polymer particles, and dextran polymer particles.
59. The particle of claim 57 or 58, wherein the identifying mark is a fluorophore.
60. The particle of any of claims 57-59 that is coated with streptavidin.
61. The particle of any of claims 57-60, wherein the polypeptide is labeled.
62. A method for treating cancer in a subject, comprising: a. preparing a plurality of particles, each comprising a plurality of labeled polypeptides, wherein the polypeptides comprise an antigen peptide, a β2M sequence, an HLA sequence, and a detectable label; b. contacting the plurality of particles with a plurality of the subject's T cells under conditions suitable for antigen-specific binding of a T cell to the particle; c. isolating the particle-bound T cells and identifying the TCR gene sequence of the isolated T cell; d. preparing a polynucleotide comprising homology clusters and at least one TCR gene sequence, wherein the TCR gene sequence is located between the homology arms; e. recombining the polynucleotide at an endogenous locus of the subject's T cell; f. culturing the modified T cell to produce a T cell population; and g.administer a therapeutically effective amount of the modified T cells to the subject to treat cancer in this way.
63. A method for modifying a cell, comprising: a. introducing into the cell a homologous recombination template (HR) nucleic acid sequence comprising: i. first and second homology arms homologous to the first and second endogenous sequences of the cell; ii. a T cell receptor (TCR) gene sequence obtained by a method according to any one of claims 1-50, wherein the TCR gene sequence is located between the first and second HR arms; and iii. a first 2A coding sequence located in the 5' direction of the TCR gene sequence and a second 2A coding sequence located in the 3' direction of the TCR gene sequence, wherein the first and second 2A coding sequences encode for the same amino acid sequence that diverge at codons from each other; b.recombine the HR template nucleic acid at an endogenous cell locus comprising the first and second endogenous sequences homologous to the first and second homology arms of the HR template nucleic acid.
64. A composition comprising a modified cell, wherein the modified cell comprises an exogenous nucleic acid sequence integrated into an endogenous locus, the exogenous nucleic acid sequence comprising: a. a TCR gene sequence identified by a method according to any of claims 1-50, and b. a first 2A coding sequence located in the 5' direction of the TCR gene sequence and a second 2A coding sequence located in the 3' direction of the TCR gene sequence, wherein the first and second 2A coding sequences encode for the same amino acid sequence that diverge at codons from each other.