cAMP RECEPTOR PROTEIN VARIANT AND PROCEDURE FOR PRODUCING L-AMINO ACID USING THE SAME.

Abstract

A cAMP receptor protein variant, a microorganism containing the same, and a procedure for producing an L-amino acid using the same are provided.

Description

cAMP RECEPTOR PROTEIN VARIANT AND PROCEDURE FOR PRODUCING L-AMINO ACID USING THE SAME TECHNICAL FIELD This disclosure relates to a cAMP receptor protein variant, a microorganism that includes the same, and a process for producing an amino acid using the same. TECHNICAL BACKGROUND The cyclic AMP (adenosine monophosphate) receptor protein (CRP), also called catabolite activator protein (CAP), is the best-known transcription regulator in E. coli. CRP is characterized by a carbon source-dependent regulatory mechanism, which is represented by the repression of catabolites. This action is triggered by an intracellular concentration of cyclic AMP (cAMP). In the presence of a preferred carbon source, such as glucose, adenylate cyclase activity is inhibited to reduce cAMP, and this signal inhibits the expression of catabolic genes. Conversely, in the absence of a preferred carbon source, adenylate cyclase activity is increased, resulting in the suppression of repressors and the initiation of catabolic gene expression.In addition, CRP is known to play various roles, such as transduction of intracellular signals through cAMP, osmotic regulation, responses to urgent cell situations, biofilm generation, nitrogen fixation, iron transport, etc. As reported, 418 E. coli genes are known to be regulated by CRP, but the corresponding mechanisms have not yet been clearly elucidated (J Biol Eng. (2009) 24; 3:13). With such a wide range of regulatory capabilities, CRP has the potential to exhibit a variety of phenotypes through mutations. Because of these advantages, CRP has been studied as a suitable target for strain redesign at the cellular level, applicable to diverse environments. Recently, several experiments have been conducted, including a procedure for altering gene expression by changing the degree of DNA binding through amino acid variation of CRP selected by bioinformatics (Nucleic Acids Research, (2009) 37: 2493-2503), and a procedure for selecting E. coli.Heat-, osmosis-, and low-temperature resistant coli using an artificial transcription factor (ATF) prepared by fusing a DNA-binding site with zinc fingers and CRP (Nucleic Acids Research, (2008) 36: e102), etc. In other words, since changes in CRP expression promote a wide range of changes in gene expression in the 3' direction, CRP is likely to be a good tool for preparing microorganisms with useful traits. DIVULGATION Technical problem The present inventors have developed a novel protein variant that includes one or more amino acid substitutions in an amino acid sequence of SEQ ID NO: 1, and found that this protein variant can increase L-amino acid productivity, thereby completing the present disclosure. Technical solution One objective of this disclosure is to provide a cAMP receptor protein variant. Another objective of this disclosure is to provide a polynucleotide that encodes the cAMP receptor protein variant. Another additional purpose of this disclosure is to provide a vector that includes the polynucleotide. Another additional purpose of this disclosure is to provide a microorganism of the genus Escherichia that includes the variant. Another additional objective of this disclosure is to provide a procedure for producing an L-amino acid, including the procedure for cultivating the microorganism of the genus Escherichia in a medium. Another additional purpose of this disclosure is to provide for the use of the variant or microorganism of the genus Escherichia that includes the variant in the production of L-amino acid. Advantageous effects When a microorganism of the genus Escherichia that produces an amino acid is cultivated, and the microorganism includes a cAMP receptor protein variant described herein, it is possible to produce the L-amino acid in high yield. Consequently, from an industrial perspective, a reduction in production costs can be expected, along with increased convenience in production. Best way to carry out the invention The present disclosure will be described in detail below. Each description and embodiment described in this disclosure may also apply to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this disclosure fall within its scope. Furthermore, the scope of this disclosure is not limited by the specific description provided below. To achieve the foregoing objectives, one aspect of this disclosure provides a cAMP receptor protein variant that includes one or more amino acid substitutions in an amino acid sequence of SEQ ID NO: 1. Specifically, this disclosure provides the cAMP receptor protein variant that includes one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, wherein the amino acid substitutions include the substitution of lysine for an amino acid at position 33 from the N-terminus. More specifically, this disclosure provides the cAMP receptor protein variant that includes the substitution of lysine for the amino acid at position 33 in the amino acid sequence of SEQ ID NO: 1. As used in the present invention, the term cAMP receptor protein (CRP) is the most well-known transcription regulator in E. coli, and CRP is also called a dual regulator because it has both activator and inhibitor functions. CRP typically binds to a symmetrical DNA sequence with 22 bases in the 5' direction of a structural gene to induce DNA bending. CRP acts as an activator by allowing a first active site at the C-terminus and a second active site at the N-terminus to interact with the RNA polymerase responsible for transcription. It acts as an inhibitor by regulating the position of the active site to prevent the active protein from binding to the active site or by binding to the active protein to convert the structure into one that does not bind to the active site. The cAMP receptor protein is a cAMP receptor protein encoded by a crp gene. The cAMP receptor protein (cyclic AMP receptor protein, CRP) of this disclosure may be used interchangeably with a catabolite activator protein (CAP), a CRP protein, a CAP protein, etc. In this disclosure, a CRP sequence can be obtained from a known database, GenBank at NCBL. For example, the CRP may be derived from the genus Escherichia (Escherichia sp.). More specifically, a polypeptide / protein includes, but is not limited to, the amino acid sequence represented by SEQ ID NO: 1. Furthermore, a sequence having the same activity as the above amino acid sequence may be included without limitation. Additionally, the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80% or more homology or identity with it may be included, but is not limited to. Specifically, the amino acid may include the amino acid of SEQ ID NO: 1 and an amino acid that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more homology or identity with SEQ ID NO: 1.Furthermore, it is evident that a protein having an amino acid sequence, part of which is deleted, modified, substituted, or added, may be within the scope of this disclosure, provided that the amino acid sequence has the above homology or identity and exhibits corresponding effectiveness to the above protein. As used in the present invention, the term variant refers to a polypeptide in which one or more amino acids differ from the sequence mentioned above by conservative substitutions and / or modifications, but which retains the functions or properties of the protein. Variant polypeptides differ from an identified sequence by the substitution, deletion, or addition of several amino acids. Such variants can generally be identified by modifying one of the aforementioned polypeptide sequences and evaluating the properties of the modified polypeptide. In other words, the capabilities of a variant may be increased, unchanged, or decreased compared to those of a native protein. Such variants can generally be identified by modifying one of the aforementioned polypeptide sequences and evaluating the reactivity of the modified polypeptide.In addition, some variants may include those in which one or more portions have been deleted, such as an N-terminal leader sequence or transmembrane domain. Other variants may include those in which a portion of the N- and / or C-terminus of a mature protein has been deleted. As used in the present invention, the term conservative substitution means the substitution of one amino acid for another amino acid having similar structural and / or chemical properties. The variant may have, for example, one or more conservative substitutions while maintaining one or more biological activities. Such amino acid substitutions can generally be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or the amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, thymine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, proline, glycine, and tryptophan. Furthermore, variants may include the deletion or addition of amino acids that have minimal influence on the properties and secondary structure of the polypeptide. For example, a polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of the protein, which co-translates or post-translates the transfer of the protein. The polypeptide may also be conjugated with another sequence or a linker for identification, purification, or synthesis of the polypeptide. As used in the present invention, the term cAMP receptor protein variant is a cAMP receptor protein variant that includes one or more amino acid substitutions in an amino acid sequence of a polypeptide having cAMP receptor protein activity, wherein the amino acid substitutions include the substitution of another amino acid for the amino acid at position 33 from the N-terminal end. Specifically, the variant may include a protein variant in which another amino acid is substituted for the amino acid at position 33 in the amino acid sequence of the polypeptide having cAMP receptor protein activity. For example, the protein variant may include a protein variant in which a variation occurs at position 33 from the N-terminal end of the amino acid sequence of SEQ ID NO: 1.More specifically, the protein variant can be a protein in which another amino acid is substituted for the amino acid at position 33 of the amino acid sequence of SEQ ID NO: 1. The 'other' amino acid is not limited, provided it is an amino acid other than L-glutamine, which is the amino acid at position 33. Specifically, the variant can be a protein in which a basic amino acid is substituted for the amino acid at position 33 in the amino acid sequence of SEQ ID NO: 1. The basic amino acid can be one of L-lysine, L-arginine, or L-histidine. More specifically, the variant can be a protein in which Ulysine is substituted for the amino acid at position 33 in the amino acid sequence of SEQ ID NO: 1, but is not limited to this. In addition, the variant means a variant that has a variation of the amino acid at position 33 from the N-terminal end in the amino acid sequence described above of SEQ ID NO: 1 and / or the amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more homology or identity with SEQ ID NO: 1. As used in the present invention, the term cAMP receptor protein variant may be used interchangeably with a variant CRP protein, a variant of CRP, a variant cAMP receptor protein, a variant CAP protein, a variant of CAP, a variant catabolite activator protein, a variant catabolite activator protein, etc. With respect to the subject matter of this disclosure, a microorganism containing the cAMP receptor protein variant is characterized by high L-amino acid productivity compared to a microorganism not containing a cAMP receptor protein variant. The CRP variant is characterized by gene regulatory activity that increases L-amino acid productivity compared to a wild-type or non-variant native cAMP receptor protein. This is significant because L-amino acid productivity can be increased by the microorganism introduced with the CRP variant described in this disclosure. Specifically, the L-amino acid can be L-threonine or L-tryptophan. However, any L-amino acid can be included without limitation, provided it can be produced by introducing or including the variant cAMP receptor protein. The cAMP receptor protein variant may be, for example, a variant that includes an amino acid sequence in which another amino acid is substituted for the amino acid at position 33 in the amino acid sequence represented by SEQ ID NO: 1, the variant composed of SEQ ID NO: 3. The variant in which lysine is substituted for the amino acid at position 33 in the amino acid sequence represented by SEQ ID NO: 1 may be composed of SEQ ID NO: 3, but is not limited to it. Furthermore, the CRP variant may include the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence that has 80% or more homology or identity with it, but is not limited to it. Specifically, the CRP variant in this disclosure may include the protein having SEQ ID NO: 3 and a protein having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more homology or identity with it.Furthermore, it is evident that a protein having an amino acid sequence, part of which is deleted, modified, substituted, or added, in addition to the amino acid sequence at position 33, may be within the scope of this disclosure, provided that the amino acid sequence has the above homology or identity and exhibits corresponding effectiveness to the above protein. In other words, although the present invention describes a protein having an amino acid sequence of a particular SEQ ID NO, it is evident that a protein having an amino acid sequence, part of which is deleted, modified, substituted, conservatively substituted, or added, may be used herein, provided it has activity identical to or corresponding to that of the protein composed of the amino acid sequence of the corresponding SEQ ID NO. For example, provided a protein has activity identical to or corresponding to that of the variant protein, the addition of a sequence that does not alter the function of the protein before and after the amino acid sequence, naturally occurring mutations, silent mutations, or conservative substitutions thereof are not excluded.It is evident that, even if the protein has such an addition or sequence mutation, it falls within the scope of this disclosure. As used in the present invention, the term homology or identity means the degree of relevance between any two given amino acid sequences or nucleotide sequences, and may be expressed as a percentage. The terms homology and identity can be used interchangeably. The homology or sequence identity of the conserved polynucleotide or polypeptide can be determined using standard alignment algorithms, and default space penalties imposed by the software can be applied. Substantially, homologous or identical sequences can hybridize under moderate or stringent conditions, such that the entire sequence length, or at least approximately 50%, 60%, 70%, 80%, or 90% or more of the full length, can hybridize. Furthermore, polynucleotides containing degenerate codons instead of codons can also be considered in the hybridization process. It is possible to determine whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity using known computer algorithms such as the FASTA program, using, for example, predetermined parameters as in Pearson et al (1988) [Proc. Nati. Acad. Sel. USA 85]: 2444, or be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (including the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F„] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .] (1988) SIAM J Applied Math 48: 1073).For example, BLAST from the National Center for Biotechnology Information database or ClustalW can be used to determine homology, similarity, or identity. The homology, similarity, or identity of polynucleotides or polypeptides can be determined, for example, by comparing sequence information using a GAP computer program such as Needleman et al. (1970), J Mol Biol. 48: 443, as described in Smith and Waterman, Adv. Api. Math (1981) 2:482. In summary, the program GAP defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids) that are similar, divided by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program may include: (1) a nail-match comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov et al. (1986) Nuci. Acids Res. 14: 6745, as disclosed in Schwartz and Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353–358 (1979) (or the EDNAFULL substitution matrix (EMBOSS version of NCBI NUC4.4)); (2) a penalty of 3.0 for each space and an additional penalty of 0.10 for each symbol in each space (or open space penalty of 10, space extension penalty of 0.5); and (3) no penalty for end spaces.Therefore, as used in the present invention, the term homology or identity represents relevance between sequences. Another aspect of this disclosure provides a polynucleotide encoding the CRP variant, or a vector including the polynucleotide. As used in the present invention, the term polynucleotide refers to a strand of DNA or RNA of a predetermined length or longer, which is a long-chain polymer of nucleotides formed by linking nucleotide monomers through covalent bonds. More specifically, the polynucleotide refers to a polynucleotide fragment that encodes the vanishing protein. The polynucleotide encoding the CRP variant of this disclosure may include any polynucleotide sequence without limitation, provided it is a polynucleotide sequence that encodes the cAMP receptor protein variant of this disclosure. The polynucleotide encoding the CRP variant may include any sequence without limitation, provided it is a sequence that encodes the variant protein in which another amino acid is substituted for the amino acid at position 33 in the amino acid sequence of SEQ ID NO: 1. Specifically, the polynucleotide may be a polynucleotide sequence that encodes the variant in which lysine is substituted for the amino acid at position 33 in the amino acid sequence of SEQ ID NO: 1.For example, the polynucleotide encoding the CRP variant of this disclosure may be, but is not limited to, a polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 3. More specifically, the polynucleotide may be composed of, but is not limited to, a polynucleotide sequence of SEQ ID NO: 4. Various modifications may be made to the coding region of the polynucleotide, provided they do not change the amino acid sequence of the protein, either due to codon degeneracy or in consideration of the codons preferred by the organism in which the protein will be expressed. Therefore, it is evident that, due to codon degeneracy, a polynucleotide that can be translated into the polypeptide composed of the amino acid sequence of SEQ ID NO: 3, or a polypeptide homologous to it, may also be included. In addition, a probe that can be produced from a known nucleotide sequence may also be included without limitation, for example, a sequence that hybridizes with a sequence complementary to all or part of the nucleotide sequence under rigorous conditions to encode the CRP variant in which another amino acid is substituted for the amino acid at position 33 in the amino acid sequence of SEQ ID NO: 1. The term stringency conditions means conditions under which specific hybridization between polynucleotides is permitted. Such conditions are described in detail in the literature (e.g., J. Sambrook et al., supra). For example, stringency conditions may include, for example, conditions under which genes having high homology or identity, 80% or more, 85% or more, specifically 90% or more, more specifically 95% or more, much more specifically 97% or more, particularly specifically 99% or more homology or identity hybridize with each other and genes having lower homology or identity than the above homology or identity do not hybridize with each other, or ordinary Southern hybridization washing conditions, i.e., washing once, specifically, two or three times at a salt concentration and temperature corresponding to 60 °C, 1XSSC, 0.1% SDS, specifically, 60 °C, 0.1*SSC, 0.1% SDS, and more specifically 68 °C, 0.1*SSC, SDS at 0.1%. Although nucleotide mismatches can occur due to the strictness of hybridization, the two nucleic acids are required to have a complementary sequence. The term complementary describes the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Therefore, this disclosure may include not only substantially similar nucleic acid sequences but also isolated nucleic acid fragments that are complementary to the complete sequence. Specifically, the polynucleotide that has homology or identity can be detected using hybridization conditions that include hybridization at a Tm value of 55 °C and the conditions described above. Furthermore, the Tm value can be 60 °C, 63 °C, or 65 °C, but is not limited to these, and can be appropriately controlled by a person skilled in the art according to the specific purpose. The appropriate rigor for polynucleotide hybridization depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the technique (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8). As used in the present invention, the term vector refers to a DNA construct comprising a polynucleotide sequence encoding a target variant protein operatively linked to an appropriate regulatory sequence to enable expression of the target variant protein in an appropriate host cell. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding an appropriate mRNA ribosome-binding domain, and a sequence regulating transcriptional termination and translation. After the vector is transformed into the appropriate host cell, it can replicate or function independently of the host genome and can integrate into the genome itself. The vector used in this disclosure is not particularly limited, provided it is capable of replicating in the host cell, and any vector known in the technique may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and natural or recombinant bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc., may be used as phage vectors or cosmid vectors. As plasmid vectors, the pBR, pUC, pBluescriptlI, pGEM, pTZ, pCL, and pET types, etc., may be used. Specifically, the pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCCIBAC vectors, etc., may be used. For example, a polynucleotide encoding a target variant protein on the chromosome can be replaced with a mutated polynucleotide using a vector for intracellular chromosomal insertion. The chromosomal insertion of the polynucleotide can be performed using any known technique, such as homologous recombination, but is not limited to it. A selection marker can also be included to confirm the chromosomal insertion. The selection marker is used to select cells transformed with the vector, that is, to confirm the insertion of the desired polynucleotide, and the selection marker can include markers that provide selectable phenotypes, such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of modified surface proteins.Since only cells expressing the selection marker can survive or exhibit different phenotypes in the environment treated with a selective agent, the transformed cells can be selected. As an additional aspect of this disclosure, this disclosure provides a microorganism that produces the amino acid, including the microorganism, the variant protein, or the polynucleotide encoding the variant protein. Specifically, the microorganism containing the variant protein and / or the polynucleotide encoding the variant protein may be, but is not limited to, a microorganism prepared by transformation with the vector containing the polynucleotide encoding the variant protein. As used in the present invention, the term transformation means the introduction of a vector comprising a polynucleotide encoding a target protein into a host cell such that the protein encoded by the polynucleotide is expressed in the host cell. Provided the transformed polynucleotide can be expressed in the host cell, it may integrate into and be placed on the host cell's chromosome, or it may exist extrachromosomically, or independently thereof. Furthermore, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form, provided it can be introduced into the host cell and expressed therein. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a gene construct comprising all the elements necessary for its autonomous expression.Typically, the expression cassette may include a promoter operatively linked to the polynucleotide, transcription termination signals, μbosome binding sites, and translation termination signals. The expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide as is may be introduced into the host cell and operatively linked to sequences required for expression within the host cell, but this is not the only possibility. As used in the present invention, the term operatively linked means a functional link between the polynucleotide sequence encoding the desired variant protein of the present disclosure and a promoter sequence that initiates and mediates transcription of the polynucleotide sequence. Another additional aspect of this disclosure provides a microorganism of the genus Escherichia (Escherichia sp.) that includes the cAMP receptor protein variant.As used in the present invention, the term microorganism including the CRP variant may refer to a recombinant microorganism capable of expressing the CRP variant of the present disclosure. For example, the microorganism refers to a host cell or a microorganism that is capable of expressing the variant including the polynucleotide encoding the CRP variant or of being transformed with the vector including the polynucleotide encoding the CRP variant.With respect to the objects of this disclosure, the microorganism is a microorganism that expresses the cAMP receptor protein variant that includes one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, and the microorganism may be a microorganism that expresses the protein variant that has cAMP receptor protein activity, wherein the amino acid substitution is the substitution of Usina by the amino acid at position 33 from the N-terminal end, but is not limited to it. The microorganism that includes the CRP variant can be any microorganism, provided it includes the CRP variant to express an L-amino acid, for example, L-threonine or L-tryptophan, but is not limited to them. For example, the microorganism that includes the CRP variant can be a recombinant microorganism with increased L-amino acid productivity, prepared by expressing the CRP variant in a wild-type microorganism or in a microorganism that produces the L-amino acid. The recombinant microorganism with increased L-amino acid productivity can be a microorganism that has higher L-amino acid productivity compared to the wild-type or unmodified microorganism, where the L-amino acid can be L-threonine or L-tryptophan, but is not limited to them. As used in the present invention, the term "L-amino acid producing microorganism" includes a wild-type microorganism or a microorganism in which a natural or artificial genetic modification occurs. It may also be a microorganism having a particular mechanism weakened or enhanced due to the insertion of a foreign gene or due to the potentiation or inactivation of the activity of an endogenous gene, in which a genetic variation is produced or the activity is enhanced to produce the desired L-amino acid. With respect to the subject matter of this disclosure, the L-amino acid producing microorganism may include the variant protein for having increased productivity of the desired L-amino acid.Specifically, the microorganism that produces the L-amino acid or the microorganism that has the L-amino acid productivity in the present disclosure may be a microorganism in which some of the genes involved in the L-amino acid biosynthesis pathway are enhanced or weakened, or some of the genes involved in the L-amino acid degradation pathway are enhanced or weakened. The unmodified microorganism refers to a naturally occurring strain as is, or a microorganism that does not include the CRP variant, or a microorganism that is not transformed with the vector that includes the polynucleotide encoding the CRP variant. The microorganism may include any prokaryotic or eukaryotic microorganism, provided it is capable of producing the L-amino acid. For example, the microorganism may include microorganisms from the genera Escherichia, Erwinia, Serratia, Providencia, Corynebacterium, and Brevibacterium. Specifically, the microorganism may be a microorganism from the genus Escherichia, and more specifically E. coli, but is not limited to it. Another additional aspect of this disclosure provides a procedure for producing the L-amino acid, including the procedure of cultivating the microorganism of the genus Escherichia in a medium, the microorganism produces the L-amino acid and includes the cAMP receptor protein variant. The terms cAMP receptor protein variant and L-amino acid are the same as those described above. In this procedure, the microorganism can be cultured using various methods, including batch culture, continuous culture, and semi-continuous culture. Culture conditions are not particularly restricted; an optimal pH (e.g., pH 5 to 9, specifically pH 6 to 8, and more specifically pH 6.8) can be maintained using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid). Aerobic conditions can be maintained by introducing oxygen or an oxygen-containing gas mixture into the cell culture. The culture temperature can be maintained between 20°C and 45°C, and specifically between 25°C and 40°C. Culture can be carried out for approximately 10 hours to approximately 160 hours, but this is not a limiting factor.The L-amino acid produced by the previous culture can be excreted into a culture medium or can remain within the cells. In addition, the culture medium to be used may include, as carbon sources, sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), oil and fat (e.g., soybean oil, sunflower seed oil, peanut oil and coconut oil), fatty acids (e.g., palmitic acid, stearic acid and linoleic acid), alcohols (e.g., glycerol and ethanol) and organic acids (e.g., acetic acid) individually or in combination, but is not limited to them. As nitrogen sources, organic compounds containing nitrogen (e.g., peptone, yeast extract, meat broth, malt extract, corn liquor, soy flour and urea) or inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate) can be used individually or in combination, but are not limited to them.Phosphorus sources may include dipotassium hydrogen phosphate, potassium dihydrogen phosphate, and their corresponding sodium salts, either individually or in combination, but are not limited to these. The medium may also include essential growth-stimulating substances such as other metal salts (e.g., magnesium sulfate or ferrous sulfate), amino acids, and vitamins. The procedure may also include collecting the L-amino acid from the microorganism or the medium. A procedure for collecting the L-amino acid produced in the culture described herein may involve collecting the desired L-amino acid from the culture broth using an appropriate procedure known in the art, in accordance with the culture procedure. For example, centrifugation, filtration, anion-exchange chromatography, crystallization, HPLC, etc., may be used, and the desired L-amino acid may be collected from the medium or microorganism using an appropriate procedure known in the art. Furthermore, the collection may include a purification process and can be carried out using an appropriate procedure known in the technique. Therefore, the L-amino acid to be collected may be a purified form or a fermentation broth from the microorganism containing the L-amino acid (Introduction to Biotechnology and Genetic Engineering, AJ Nair, 2008). Another additional aspect of this disclosure provides the use of the cAMP receptor protein variant in the production of L-amino acid, including the cAMP receptor protein variant one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1. Another aspect of this disclosure provides the use of the microorganism of the genus Escherichia in the production of L-amino acid, including the microorganism of the genus Escherichia the cAMP receptor protein variant. The terms cAMP receptor protein variant and L-amino acid are the same as those described above. Mode for the invention The following disclosure will be described in more detail with reference to the examples. However, it is evident to those skilled in the art that these examples are for illustrative purposes only, and the scope of this disclosure is not intended to be limited by them. Example 1. Preparation of the recombinant vector pCC1BAC-crp 1-1. Preparation of the crp gene fragment To obtain approximately 0.96 kb of a DNA fragment from SEQ ID NO: 5 that includes the crp gene and an expression regulatory region, genomic DNA (gDNA) was extracted from wild-type E. coli W3110 using a Qiagen Genomic Tip System, and PCR (polymerase chain reaction) was performed using the gDNA as a template and an HL PCR Premix Kit (manufactured by BIONEER Co., the same applies hereafter). PCR for amplification of the crp gene fragment was performed using primers from SEQ ID NO: 6 and 7 for 27 cycles consisting of denaturation at 95 °C for 30 seconds, annealing at 56 °C for 30 seconds, and elongation at 72 °C for 2 minutes. The PCR product was digested with EcoR I and electrophoresis was performed on a 0.8% agarose gel and elution to obtain a 0.96 Kb DNA fragment (hereafter referred to as the crp fragment). Table 1 SEQ ID NO. Primer name Sequence (5'-3j 6 crp-F CACGAATTCTTTGCTACTCCACTGCGTCA 7 crp-R ACACGAATTCTTAACGAGTGCCGTAAACG 1-2. Preparation of the recombinant vector pCC1BAC-crp The Copycontrol vector pCCIBAC (EPICENTRE, USA) was treated with EcoR I, electrophoresis was performed on a 0.8% agarose gel and eluted to obtain a product, which was then ligated with the crp fragment obtained in Example 1-1, thus preparing a pCC1BAC-crp plasmid. Example 2. Preparation of the pCC1BAC-crp recombinant vector variant library 2-1. Preparation of the mutant crp fragment by error-prone PCR The PCR was performed using wild-type E. coli W3110 genomic DNA as a template and a Clonetech Diversified PCR Random Mutagenesis Kit (Catalog #: K1830-1, Table III, Mutagenesis Reactions 4). Specifically, the PCR was performed using the primers from SEQ ID NO: 6 and 7 as used in Example 1-1 for 27 cycles consisting of denaturation at 94 °C for 30 seconds and extension at 68 °C for 1 minute. The PCR product was digested with EcoR I and electrophoresis was performed on a 0.8% agarose gel and elution to obtain a 0.96 Kb mutated crp fragment (hereafter referred to as the crpm fragment). 2-2. Preparation of the pCC1BAC-crp recombinant vector variant library A pCCIBAC vector was treated with the restriction enzyme EcoRI and then with alkaline phosphatase (NEB). The prepared vector was ligated with the crpm fragment obtained in Example 2-1, and the ligation product was transformed into electrocompetent E. coli TransforMax EPI300 (EPICENTRE, USA) by electrophoresis. The transformed strain was cultured on LB solid medium (15 pg / ml) containing chloramphenicol for colony selection. The colonies obtained in this manner were collected and subjected to plasmid preparation, thereby creating a pCC1BAC-crpm library. Example 3. Introduction of the crp variant library in threonine-producing staining and selection of enhanced growth strain 3-1. Introduction of the pCC1BAC-crpmen threonine-producing staining library The pCC1BAC-crpm library obtained in Example 2 was transformed into electrocompetent cells of KCCM10541, a threonine-producing microorganism, by electroporation. E. coli KCCM10541 (Korean Patent No. 10-0576342) used in this Example is E. coli prepared by inactivating the gaIR gene in an L-threonine-producing E. coli KFCC10718 (Korean Patent No. 10-0058286). As a control group of the microorganism introduced into the pCCIBACcrpm library, pCC1BAC-crp was transformed into KCCM10541 in the same way as previously to prepare KCCM10541 / pCC1BAC-crpfl / lzT). 3-2. Comparison of the growth rate of the recombinant microorganism A minimal M9 medium containing 1% glucose and 0.2 g / L yeast extract was dispensed into a deep-well microplate, and the transformant and control strains prepared in Example 3-1 were then inoculated onto them, respectively. The strains were cultured using a micro-sized, constant-temperature shaker incubator (TAITEC, Japan) at 37 °C and 200 rpm using a high-throughput screening (HTS) procedure for 20 hours, and the strains with the best growth were selected. From these, one strain type was finally selected (Table 2). The KCCM10541 strain introduced with the wild-type crp gene showed a slight increase in OD value due to the additional introduction of crp, while the growth-enhanced transformant showed a high OD value after the same culture time, compared to the strain introduced with wild-type crp. Furthermore, the selected crp variant underwent plasmid minipreparation followed by sequencing analysis. The results are summarized in Table 2. ^η / πηη / ι 7n7 / E / Yl· Table 2. Information on the enhanced growth transformant after the introduction of the crpmen library to the threonine-producing strain Strain OD600 Variation KCCM10541 / pCC1BAC 2.3 - KCCM10541 / pCC 1 BM>crp(WT) 2.8 - KCCM10541 / pCC1BAC-crpTM3 3.9 Q33K 3-3. Comparison of the threonine titer of the recombinant microorganism To measure the threonine titer of the recombinant microorganism selected in Example 3-2, the recombinant microorganism was cultured in a threonine titration medium prepared as in the composition of Table 3 below to examine the enhancement of L-threonine productivity. Table 3. Composition of the threonine titration medium Composition Concentration (per liter) Glucose 70 g KH2PO4 2 g (NH4)2SO4 25 g MgSO4-7H2O 1 g FeSO4-7H2O 5 mg MnSO4-4H2O 5 mg Yeast extract 2g Calcium carbonate 30 g pH 6.8 ^η / πηη / ι znz / E / YL In detail, each platinum loop of E. coli KCCM 10541 / pCC1BAC-crp(WT) and E. coli KCCM10541 / pCC1BAC-c / p77W3 grown overnight on LB solid medium in an incubator at 33 °C was inoculated into 25 ml of the titration medium from Table 3, respectively, and then grown in an incubator at 33 °C and 200 rpm for 48 hours to compare sugar consumption rates and threonine concentrations. As a result, as described in Table 4 below, the KCCM10541 / pCC1BAC-crp(l / VT) strain as a control group showed a sugar consumption of 26.1 g / L at 24 hours, while the mutant strain introduced by crpTM3 showed an improvement of approximately 21% and 16% in the sugar consumption rate, compared to the parent strain and the wild-type crp-introduced strain, respectively. Furthermore, when cultured for 48 hours, the wild-type crp-introduced strain showed 29.0 g / L of L-threonine production, while the L-threonine production of the previously obtained mutant strain increased to 32.5 g / L, although the culture rate was increased, showing approximately 13% and 12% improvement in concentration, compared to the parent strain and the wild-type crp-introduced strain, respectively. Since the introduction of the crp variant increased the yield and sugar consumption of the strain, it appears to be a good variant trait, which can greatly contribute to improving production efficiency during fermentation. Table 4. Comparison of the threonine strain titer including the crp vanant Strain Sugar intake (g / L)* Threonine (g / L)** KCCM 10541 / pCC1BAC 25.0 28.8 KCCM10541 / pCC 1 BAC-crp(WT) 26.1 29.0 KCCM10541 / pCC 1 BAC-crp TM3 30.2 32.5 * Value measured at 24 hours ** Value measured at 48 hours Example 4. Introduction of the pCC1BAC-crp7~M3 variant into the tryptophan-producing strain 4-1. Introduction of pCC\BAC-crpTM3 into the evaluation strain The pCCjBAC-crpTMS obtained in Example 3 was transformed into electrocompetent cells of a tryptophan-producing strain KCCM11166P by electroporation. KCCM11166P used in this Example is an L-tryptophan-producing E. coli in which the tehB gene was deleted and NAD kinase activity was enhanced (Korean Patent No. 10-1261147). As a control group of the introduced microorganism pCC1 BAC-crpTM3, pCC1BAC-crp(1AT) was transformed into KCCM11166P in the same way as previously to prepare KCCM11166P / pCC1 BAC-crp(WT). 4-2. Comparison of the growth rate of the recombinant microorganism A minimal M9 medium containing 1% glucose and 0.2 g / L yeast extract was dispensed into a deep-well microplate, and the transformant and control strains prepared as in Example 4-1 were then inoculated, respectively. The strains were cultured using a micro-sized, constant-temperature shaker incubator (TAITEC, Japan) at 37 °C and 200 rpm using a high-throughput screening (HTS) procedure for 16 hours to confirm the enhanced growth of the transformant KCCM11166P / pCC1BAC-crp77W3 (Table 5). The KCCM11166P strain introduced with the wild-type crp gene showed an equivalent level of OD due to the additional introduction of crp after the same culture time, while the enhanced growth transformant showed a high OD value, compared to the wild-type crp. Table 5. Information on the enhanced growth transformant after the introduction of crpTM3 into the tryptophan-producing strain ^η / πηη / ι znz / E / YL Strain OD600 Variation KCCM11166P / pCC1BAC 3.4 - KCCM11166P / pCC1 BAC-crp(WT) 3.5 - KCCM11166P / pCC1BAC-crpT / W3 3.9 Q33K 4-3. Comparison of the tryptophan titer of the recombinant microorganism To measure the tryptophan titer of the recombinant microorganism prepared in Example 4-2, the recombinant microorganism was grown in a tryptophan titration medium prepared as in the composition of Table 6 below to examine the enhancement of L-tryptophan productivity. ^η / πηη / ι znz / E / YL Table 6. Composition of the tryptophan titration medium Composition Concentration (per liter) Glucose 60 g K2HPO4 1 g (NH4)2SO4 10 g NaCl 1 g MgSO4-7H2O 1 g Sodium citrate 5 g Yeast extract 2 g Calcium carbonate 40 g Sodium citrate 5 g Phenylalanine 0.15 g Tyrosine 0.1 g pH 6.8 In detail, each platinum loop of E. coli KCCM11166P / pCC1BAC-crp(l / VT) and E. coli KCCM11166P / pCC1BAC-crp77W3 grown overnight on LB solid medium in an incubator at 37 °C was inoculated into 25 ml of the titration medium from Table 6, respectively, and then grown in an incubator at 37 °C and 200 rpm for 48 hours to compare sugar consumption rates and tryptophan concentrations. As a result, as described in Table 7 below, the KCCM11166P / pCC1BAC-crp(WT) strain as a control group showed a sugar consumption of 30.2 g / L at 22 hours, while the mutant strain introduced by crpTM3 showed an improvement of approximately 12% and 8% in the sugar consumption rate, compared to the parent strain and the wild-type crp-introduced strain, respectively. When cultured for 48 hours, the wild-type crp-introduced strain showed 8.4 g / L of L-tryptophan production, while the L-tryptophan production of the previously obtained mutant strain increased to 9.0 g / L, even with increased culture rate, showing approximately a 7% and 10% improvement in concentration, compared to the parent strain and the wild-type crp-introduced strain, respectively. Since the introduction of the crp variant increased the strain's sugar consumption and yield, it appears to be a good variant trait, which can greatly contribute to improving production efficiency during fermentation. Table 7. Comparison of the tryptophan strain titer that includes the crp variant Strain Sugar intake (g / L)* Tryptophan (g / L)** KCCM11166P / pCC1BAC 29.0 8.2 KCCM11166P / pCC1BAC-crp(W7) 30.2 8.4 KCCM11166P / pCC1 &KC-crpTM3 32.5 9.0 * Value measured at 10 PM ** Value measured at 48 hours Example 5· Introduction of an endogenous vector of an effective crp variant in wild-type E. coli 5-1. Introduction of effective pCC1BAC-crp variant in wild-type derived threonine-producing strain To examine whether the vector containing the crp variant evaluated in Example 3 also showed equivalent effects in the wild-type strain, the vector pCCIBACcrp(WT) or pCC1 BAC-crpTM3 was transformed into the wild-type-derived strain capable of producing threonine by electroporation, respectively. In addition, a strain introduced with pCC1 B / \C-crp(WT) was prepared as a control group. The wild-type derived strain capable of producing threonine used in this example is W3110::PcysK-ppc / pACYC184-thrABC. W3110::PcysK-ppc / pACYC184-thrABC is a strain in which a native promoter of a ppc gene encoding phosphoenolpyruvate carboxylase on the chromosome was replaced with a promoter of a cysK gene, and a threonine biosynthesis operon gene was introduced in the form of a copy number vector, thereby increasing threonine productivity. In detail, a W3110::PcycK-ppc strain was prepared using pUCpcycKmloxP in the same manner as described in Korean Patent No. 10-0966324, and pACYC184-thrABC (Korean Patent No. 10-1865998) was transformed into the strain by electroporation. The prepared strains were grown in a threonine test medium prepared as in the composition of Table 8 below, and the growth rates and L-threonine productivities were compared. Table 8. Composition of the threonine test medium Composition Concentration (per liter) Glucose 70 g KH2PO4 2 g (NH4)2SO4 25 g MgSO4-7H2O 1 g FeSO4-7H2O 5 mg MnSO4-7H2O 5 mg DL-methionine 0.15 g Yeast extract 2 g Calcium carbonate 30 g pH 6.8 ^η / πηη / ι 7n7 / E / Yl· In detail, each platinum loop from W3110 and the respective strains, grown overnight on LB solid medium in an incubator at 33 °C, was inoculated into 25 mL of the titration medium from Table 8, respectively, and then cultured in an incubator at 33 °C and 200 rpm for 48 hours. The corresponding results are shown in Table 9 below. As shown in the following results, the variant protein selected in this disclosure is also capable of efficiently producing threonine with high yield in the wild-type strain. Table 9. Results of growth and threonine productivity tests of wild-type derived strains Strain OD Threonine (g / L)** W3110::PcysK-ppc / pACYC184-thrABC / pCC1 BAC 10.8 1.5 W3110::PcysK-ppc / pACYC184-thrABC / pCC1 BAC-crp(WT) 11.0 1.6 W3110::PcysK-ppc / pACYC184-thrABC / pCC1BAC-c / p TM3 13.5 2.5 5-2. Introduction of the effective pCC1BAC-crp variant into the wild-type derived tryptophan-producing strain To examine whether the vector that includes the crp variant evaluated in Example 4 also showed equivalent effects in the wild-type strain, the vector pCCIBACcrp(WT) or pCC1BAC-crpTM3 was transformed into the wild-type-derived strain capable of producing tryptophan, respectively. The wild-type tryptophan-producing strain used in this Example is W3110 trpA2 / pCL-Dtrp_att-trpEDCBA. W3110 trpA2 / pCL-Dtrp_att-trpEDCBA is a vector-introduced strain in which a regulatory mechanism of a tryptophan operon regulatory region was released, and the expression of the tryptophan operon was enhanced to overexpress tryptophan (Korean Patent No. 10-1532129). The vector-introduced strains were cultured in a tryptophan test medium prepared according to the composition in Table 10 below, and their L-tryptophan productivities were compared. Table 10. Composition of the tryptophan test medium Composition Concentration (per liter) Glucose 2g K2HPO4 1g (NH4)2SO4 12g NaCl 1g Na2HPO4-H2O 5g MgSO4-H2O 1g MnSO4-H2O 15mg CuSO4-H2O 3mg ZnSO4-H2O 30mg Sodium citrate 1g Yeast extract 1g Phenylalanine 0.15g pH 6.8 In detail, each platinum loop from the strains cultured overnight on LB solid medium in an incubator at 37 °C was inoculated into 25 ml of the test medium from Table 9, respectively, and then cultured in an incubator at 37 °C and 200 rpm for 48 hours. OD values ​​and tryptophan concentrations were compared and are shown in Table 11. As shown in the following results, the variant protein selected in this disclosure is also capable of efficiently producing tryptophan with high yield in the wild-type strain. Table 11. Results of tryptophan growth and productivity tests of wild-type derived strains Strain OD Tryptophan (g / L)** W3110 trpA2 / pCL-Dtrp_att-trpEDCBA / pCC1BAC 10.8 0.5 W3110 trpA2 / pCL-Dtrp_att-trpEDCBA / pCC1BAC-crp(WT) 11.0 0.6 W3110 trpÁ2 / pCL-Dtrp_att-trpEDCBA / pCC1BAC-crpTM3 12.7 0.9 The present inventors designated the strain introduced by pCC1BAC-crp77W3 based on KCCM11166P having improved tryptophan productivity and sugar consumption rate (KCCM11166P / pCC1BAC-crp77W3) as “CA04-2807”, and then deposited the strain with the Korean Center for Microorganism Culture (KCCM), which is the International Depositary Authority under the Budapest Treaty, on November 7, 2018 with Accession Number KCCM12373P. These results indicate that the sugar consumption rate improved and L-amino acid productivity increased in the microorganism introduced by the crp variant of the genus Escherichia of the present disclosure and, consequently, L-amino acid productivity increased, compared to the unmodified strain. Based on the foregoing description, those skilled in the art will understand that the present invention can be implemented in a specific, different manner without altering its technical spirit or essential characteristics. Therefore, the foregoing embodiment should be understood as not limiting but illustrative in all respects. The scope of the invention is defined by the appended claims rather than by the preceding description, and all changes and modifications falling within the limits of the claims, or equivalent provisions thereof, are therefore intended to be covered by the claims.

Claims

1. A cAMP receptor protein variant, in which lysine is substituted by an amino acid at position 33 in an amino acid sequence of SEQ ID NO:

1.

2. A polynucleotide encoding the cAMP receptor protein variant of claim 1.

3. A vector comprising a polynucleotide encoding the cAMP receptor protein variant of claim 1.

4. A microorganism of the genus Escherichia (Escherichia sp.) comprising a cAMP receptor protein variant in which lysine is substituted by an amino acid at position 33 in an amino acid sequence of SEQ ID NO:

1.

5. The microorganism of the genus Escherichia according to claim 4, wherein the microorganism of the genus Escherichia is E. coli.

6. The microorganism of the genus Escherichia according to claim 4, wherein the microorganism of the genus Escherichia produces an L-amino acid.

7. The microorganism of the genus Escherichia according to claim 6, wherein the L-amino acid is L-threonine or L-tryptophan.

8. A process for producing an L-amino acid, the process comprising: cultivating a microorganism of the genus Escherichia in a medium, the microorganism including a cAMP receptor protein variant in which lysine is substituted by an amino acid at position 33 in an amino acid sequence of SEQ ID NO:

1.

9. The process according to claim 8, further comprising collecting the L-amino acid from the microorganism or the medium.

10. The process according to claim 8, wherein the L-amino acid is L-threonine or L-tryptophan.

11. Use of a cAMP receptor protein variant, wherein lysine is substituted by an amino acid at position 33 in an amino acid sequence of SEQ ID NO: 1, or a microorganism of the genus Escherichia that includes the variant in the production of L-amino acid.