COMBINED ANTITUMOR IMMUNOTHERAPY
Patent Information
- Application Number
- MX2022008338
- Authority / Receiving Office
- MX · MX
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2015-02-19
- Filing Date
- 2017-06-28
- Publication Date
- 2026-06-12
- Estimated Expiration
- 2035-12-22
AI Technical Summary
Current cancer immunotherapy methods, including checkpoint inhibitors and Toll-like receptor (TLR) agonists, have limited efficacy and often induce immune suppression, particularly in tumors lacking preexisting immunity, necessitating improved strategies to enhance antitumor immune responses.
The use of specific subtypes of CpG ODNs with reduced phosphorothioate modifications, administered intratumorally or peritumorally, in combination with checkpoint inhibitors and/or radiotherapy, to induce high levels of type I interferon and promote CD8+ T cell infiltration and activation, converting 'cold' tumors into 'hot' ones amenable to treatment.
This approach enhances cancer immunotherapy by increasing tumor infiltration of activated T cells, overcoming immune suppression, and improving treatment responses in tumors resistant to other therapies.
Abstract
Description
COMBINED ANTITUMORAL IMMUNOTHERAPY BACKGROUND OF THE INVENTION Many scientists have sought to treat cancer by activating the immune system against the tumor. However, despite occasional successes, durable responses from immunotherapy have been rare and limited to only a few tumor types. The current understanding of cancer immunotherapy among experts in the field is summarized in recent review articles including, for example, Chen and Mellman, Immunity 2013 39(1): 1-10. The cycle for the induction of therapeutic immune responses against tumors has been divided into seven different stages (figure 1): 1. Release of antigens from cancer cells; 2. presentation of cancer cell antigens by antigen-presenting cells (APCs, usually in draining lymph nodes); 3. T cell priming and activation; 4. movement of CD8+ T lymphocytes towards tumors; 5. infiltration of CD8+ T lymphocytes into the tumors; QecQnn / zznz / E / YiAi Ref. 334019 6. recognition of cancer cells by infiltrating CD8+ T lymphocytes; and 7. lysis of cancer cells. The technique describes that there are multiple negative and positive mediators of each stage of the antitumor response. Recent research interest has focused on understanding and resolving the role that negative mediators play in inhibiting the antitumor immune response. For example, interleukin-10 (IL-10) is a factor that can have complicated, locally immune suppressive effects on the tumor, but systemically it actually has antitumor activity (reviewed in Vicari and Trinchieri, Immunol. Rev., 2004 ). Although Toll-like receptor (TLR) agonists such as TLR9-activating CpG oligonucleotides (CpG ODN) have immune stimulatory effects that can promote antitumor responses, they are also known in the art to induce suppressive factors. immune cells such as IL-10 (reviewed in Lu, Frontiers Immunol, 2014). The art does not disclose designs of TLR9 agonists that have enhanced antitumor effects as a result of inducing lower amounts of IL-10 production. However, this recent increasing compression of the tumor immune cycle has raised awareness that it is possible to increase the QecQnn / zznz / E / YiAi - 3clinical efficacy of cancer immunotherapy using combinations of agents acting at different points in this cycle for induction of therapeutic immune responses against tumors but the scope does not provide sufficiently deep understanding of cancer immunobiology to predict which of the many possible combinations different ones will be preferred. Another possible way to consider the development of the anticancer T cell response is the 3-signal model for the induction of a T cell response, summarized by Kim and Cantor, Cancer Immunol Res 2014 2: 929-936) and presented in Figure 2. In this model, signal 1 to the T cell comes from the presentation of antigen by an APC on the appropriate CPH to the T cell receptor. Signal 2 is the requirement for a costimulatory signal through the interaction of CD28 on the T lymphocyte by B7-1 or B7-2 on the APC (this signal is antagonized by CTLA-4 present in Treg: the effectiveness of anti-CTLA-4 antibodies in cancer immunotherapy results from their inhibition of this off signal ). Finally, signal 3 is the modulation of T cell function that results from signals through inflammatory cytosine receptors and PD-1. In particular for the induction of optimal CD8+ T cell responses, which is known to be critical for a QPCQnn / zznz / E / YiAi - 4successful immunotherapy against cancer, type 1 IFN signaling is a very positive signal but when it is chronic or prolonged it can also lead, paradoxically, to T lymphocyte exhaustion and lack of response which is mediated through upregulation of PD-1 expression. Blockade of PD-1 by antibodies to it, or against its main anti-tumor immunity regulatory ligand, PD-L1, therefore restores the ability of T lymphocytes to proliferate and produce cytosines in a tumor microenvironment. Recently there have been several early clinical successes with the use of checkpoint inhibitor (CPI) compounds, such as antibodies, which block the negative immune effects of checkpoint molecules such as CTLA- 4, PD-1 and its ligand, PD-L1. Systemic administration of anti-CTLA-4 antibodies has generated durable responses in ~10% of melanoma patients and some encouraging early results in other tumor types, but at the cost of a high rate of adverse effects including death in some patients. Human anti-PD-l / PD-Ll clinical trials have reported encouraging results, apparently with a lower rate of severe toxicity. However, analyzes of patient responders have shown that through QPCQnn / zznz / E / YiAi - 5 different types of cancer, responses to anti-PD-Ll treatment are relatively restricted to patients with tumor-infiltrating lymphocytes (TILs) and a Thl pattern of gene expression in the tumor (Powles et al ., Nature 2014 515: 558; Herbst et al., Nature 2014 515; 563; Tumeh et al., Nature 2014 515:568). That is, responses can be observed in certain patients with preexisting immunity to the tumor but are unlikely to occur in patients without it. In addition, in melanoma, in which preexisting antitumor immunity is relatively common, TILs are relatively rare in most other tumor types indicating that CPI may be of limited benefit in most cancer types. . Thus, there is a need to improve the efficacy of CPI for anticancer treatment. SUMMARY OF THE INVENTION The present invention provides methods for immune activation and reduction of immune inhibition and thus metaphorically press the accelerator and release the brakes on the immune system to treat cancer. The invention can be used, for example, to convert cold cancers or tumors (resistant or refractory to treatment) into hot ones amenable to treatment, including treatment with QecQnn / zznz / E / YiAi - 6checkpoint inhibition. This invention provides specific subtypes of CpG ODNs with reduced amounts of phosphorothioate modifications compared to CpG ODNs more widely used in previous cancer immunotherapy, and methods of their intratumoral and peritumoral administration in combination with CPI and / or radiotherapy ( XRT), for enhanced cancer immunotherapy, which includes cancers that are unlikely to respond to either of these therapies alone, or in other combinations. CpG ODN binds and stimulates TLR9, an innate immune receptor which is constitutively expressed in only two types of human immune lymphocytes: B lymphocytes, which respond to stimulation by TLR9 by proliferating and secreting immunoglobulin; and plasmacytoid dendritic cells (pDCs) which respond to TLR9 stimulation by secreting large amounts of type 1 IFN (IFN-α and IFN-β). The present invention is based, at least in part, on the finding that the IFN-α response to CpG ODN is important for immunotherapy against tumors. The present invention is based, at least in part, on the finding that a strong IFN-α response to CpG ODN is important for tumor immunotherapy, including tumor immunotherapy using intratumoral administration of CpG ODN. QecQnn / zznz / E / YiAi - 7Preferred CpG ODNs of the invention are characterized, at least in part, by their susceptibility to inducing large amounts of type I IFN. Type I IFN is considered to play a key role in tumor rejection. For example, type I IFN increases the survival, expansion, and effector differentiation of CD8+ T lymphocytes; promotes dendritic cell (DC) maturation, cross-penetration of tumor-associated antigens to CD8 + T lymphocytes; required for immune surveillance against carcinogen-induced tumors; and is required for rejection of implanted tumors. Additionally, amounts of type I IFN-related mRNA correlate with tumor-infiltrating lymphocytes (TILs) in human metastases. In addition to inducing greater amounts of type I IFN than any other, TLR9 ligands such as CpG ODN also activate pDC and induce secretion of hundreds of other Thl-promoting genes and factors; and convert pDCs from an immature / tolerance-promoting phenotype to a mature, activated, cytotoxic T lymphocyte (CTL)-inducing phenotype. The present invention is also based, at least in part, on the finding that delivery of CpG ODN into tumors (directly or indirectly) induces the expression of adhesion molecules in the - 8local vasculature in and around the tumor, and promotes the exit of activated T lymphocytes (CD4+ and CD8+) from capillaries in the tumor and the surrounding region. Some of these T cells will be specific for non-mutated and mutated tumor-associated antigens (TAA). In the absence of checkpoint inhibitors and / or verification or XRT by themselves. The present invention, in certain aspects, is based on the use of classes of CpG ODNs different from those that have historically been used for cancer immunotherapy. In particular, the present invention in certain aspects is based on the use of high secretory classes of IFN-α, class A and class E, with reduced amounts of phosphorothioate (PS) modifications compared to Class B CpG ODN that has been widely used in the past. Class B CpG ODNs are typically completely phosphorothioate modified to increase their nuclease resistance and the magnitude of B cell activation. In contrast, since a focus of the present invention is on obtaining a high type I IFN response , instead of B cell activation, the preferred CpG ODNs herein QPCQnn / zznz / E / YiAi _9_ invention have either no phosphorothioate modifications or only one or two phosphorothioate modifications at the 5' end and 1 to 4 phosphorothioate modifications at the 3' end. The preferred class E ODNs of the invention also contain phosphodiester (PO) bonds in the cpG dinucleotides, and optionally in other positions within the ODN, in order to reduce B cell activation (and the concomitant induction of IL-10 and indoleamine 2,3-dioxygenase (IDO)) and also preferably contain one or more palindromes to form duplex chains or concatemers. Those skilled in the art will understand that intratumoral or peritumoral CpG in human cancer patients will activate APC in the lymph nodes draining from the tumor, which increases stage 2 of the cancer immunity cycle (see Figure 3). However, what is still not well understood by those experts in the field is that this high IFN-inducing CpG ODN administration route will also induce TILs and convert the tumor microenvironment to a more Thl-like state that is more conductive. induction of clinically beneficial antitumor immunity. Intratumoral administration of high IFN-inducing CpG ODN induces T cell infiltration into tumors, notably including CD8+ T cell infiltration. The importance of this is that this infiltration of QPCQnn / zznz / E / YiAi - 10 CD8+ T lymphocytes in tumors are considered to be the best predictor of response to treatment with anti-PD-1 or anti-PD-Ll. Because past human clinical trials with intratumoral administration of CpG oligonucleotides used class B ODN, there would be significant local production of IL-10 in the tumor which would have inhibited the antitumor immune response. The present invention describes improved preferred CpG ODN as well as designs and screens to identify the same which induce lower amounts of IL-10 production and higher amounts of type I IFN secretion compared to class B ODN used in the past. This preferred CpG ODN will provide improved synergy in cancer therapy when combined with checkpoint inhibitors using the methods of the invention. One aspect of the invention is a method of treating a cancerous tumor, comprising administering to a subject in need thereof an effective amount of a TLR9 agonist and a checkpoint inhibitor (CPI), in wherein the TLR9 agonist is administered within or substantially adjacent to the tumor. One aspect of the invention is a method of treating a cancerous tumor, comprising administering to a QPCQnn / zznz / E / YiAi - 11subject in need of the same effective amount of radiotherapy, a TLR9 agonist and a checkpoint inhibitor (CPI), where the radiotherapy is initiated before administration of the TLR9 agonist, and the TLR9 agonist is administered within or substantially adjacent to the tumor. One aspect of the invention is a method of treating a cancerous tumor, comprising administering to a subject in need thereof an effective amount of a TLR9 agonist, a first checkpoint inhibitor (CPI) and a second CPI, wherein the TLR9 agonist and the first CPI are administered within or substantially adjacent to the tumor and the second CPI is administered systemically. In certain embodiments, the TLR9 agonist induces IFN-α. In certain embodiments, the TLR9 agonist is CpG DNA, for example CpG ODN. In certain embodiments, the TLR9 agonist is selected from the group consisting of class A CpG DNA, class C CpG DNA, class E CpG DNA, class P CpG DNA and any combination thereof. In certain embodiments, the TKL9 agonist is a class A CpG DNA. QPCQnn / zznz / E / YiAi In certain embodiments the DNA sequence of - 12CpG class A is GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 82). In certain embodiments, the TLR9 agonist is a class C CpG DNA. In certain embodiments, the TLR9 agonist is a class E CpG DNA. In certain embodiments, the TLR9 agonist is a class A / E CpG DNA. In certain embodiments, the TLR9 agonist is a class P CpG DNA. In certain embodiments, the TLR9 agonist that includes CpG DNA is linked entirely by a phosphodiester backbone. In certain embodiments, the TLR9 agonist is a CpG DNA with only a single phosphorothioate internucleotide bond at the 5' end and only a single phosphorothioate internucleotide bond at the 3' end. In certain embodiments, the TLR9 agonist is a CpG DNA with a single phosphorothioate bond. In certain embodiments, the TLR9 agonist is circular, with a native phosphodiester DNA backbone. In certain embodiments, CPI is administered systemically. QecQnn / zznz / E / YiAi In certain embodiments the CPI is an antibody or - 13 antigen-binding fragment thereof which specifically binds to an antigen that is selected from the group consisting of PD-1, PD-L1, CTLA-4, TIM3 and LAG3. In certain embodiments, the CPI is an antigen-binding antibody or fragment thereof which specifically binds to one or more antigens selected from the group consisting of PD-1, PD-L1 and CTLA-4. In certain embodiments, the CPI is an antigen-binding antibody or fragment thereof which specifically binds to an antigen that is selected from the group consisting of PD-1, PD-L1 and CTLA-4. In certain embodiments, the CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-1. In certain embodiments, the CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-L1. In certain embodiments, the CPI is an antigen-binding antibody or fragment thereof which specifically binds to CTLA-4. In certain embodiments, the cancerous tumor is a lymphoma or a cancerous tumor of an organ or tissue that is selected from the group consisting of skin, upper respiratory and digestive tract, esophagus, stomach, liver, colon, rectum, pancreas, lung , breast, cervix, - 14ovary, kidney, bladder, prostate, thyroid, brain, muscle and bone. In certain embodiments, the cancerous tumor is melanoma. In certain embodiments, the cancerous tumor is a lintorna. In certain embodiments, the cancerous tumor is a cancer of the bone marrow. In certain embodiments, the cancerous tumor is a carcinoid tumor. In certain embodiments, the cancerous tumor is neuroblastoma. In certain embodiments, the subject is a human. BRIEF DESCRIPTION OF THE FIGURES Figure 1 (prior art) is a schematic representation of a cancer immunity cycle showing seven stages. From Chem and Mellman, Immunity 2013. Figure 2 is a schematic representation of the three signals necessary for induction of antitumor immunity. Each T cell expresses a unique TCR that recognizes a specific antigen in the context of a specific HPC (signal 1). CD4 and CD8 coreceptors increase the sensitivity of antigen recognition by TCR. Optimal T cell expansion and QPCQnn / zznz / E / YiAi - 15acquisition of the effector function requires signals transduced by costimulatory receptors (signal 2). The CD28-BB7-1 / B7-2 interaction provides an activation signal while the CTLA-4-B71 / B7-2 interaction inhibits T cell activation. Signaling via CD28 and CTLA-4 is also critical for development. and CD4 Treg function. Inflammatory signals frequently induce upregulation of surface cytosine receptors and other receptors, including PD-1 (signal 3). PD-1 expression is associated with the acquisition of the T cell-depleted phenotype during infection and cancer. The PD-1-PD-L1 interaction is involved in the inhibition of TFR activity and has also been implicated in the generation of pTreg. Preclinical and clinical data with checkpoint blockade using anti-CTLA-4, anti-PD-1 and anti-PD-Ll Abs suggest that increased antitumor immunity can be obtained by the combined effects of increased Teff activity and suppression or reduced suppression of CD4 Tregs. From Kim and Cantor, Cancer Immunol. Res. 2014 2: 926-936. Figure 3 is a schematic representation of a cancer immunity cycle, showing the roles for CpG ODN, CPI and XRT. Adapted from Chem and Mellman, Immunity 2013. Figure 4 is a graph showing the QecQnn / zznz / E / YiAi - 16IFN-α induction for Set 1 CpG-A oligonucleotides. PBS, phosphate-buffered saline control. Figure 5 is a graph showing the induction of IFN-α for selected Set 1 CpG-A oligonucleotides. PBS, phosphate-buffered saline control. Figure 6 is a graph showing the induction of IFN-α for Set 2 CpG-A oligonucleotides. Ordinate axis, pg / ml of IFN-α. PBS, phosphate-buffered saline control; TE, Tris-EDTA. Figure 7 is a graph showing the induction of interleukin-10 (IL-10) for oligonucleotides Set 2 CpG-A. Ordinate axis, pg / ml of IL-10. PBS, phosphate-buffered saline control; TE, Tris-EDTA. Figure 8 is a graph showing the effect of phosphorodithioate backbone modification on the induction of IFN-α by Set 3 CpG-A oligonucleotides. Figure 9 is a graph showing the structure-activity relationship of reducing the number of 5' and / or 3' Gs in the CpG-A oligonucleotide G10 or changing the palindrome on the induction of IFN-α secretion. from normal human peripheral blood mononuclear cells (PBMCs). nAb, QecQnn / zznz / E / YiAi - 17new anti-Qb antibody; oAb, anti-ancient Qb antibody; PBS, phosphate-buffered saline control. Figure 10 is a graph showing the relationship between structure and activity by reducing the number of 5' and / or 3' G in the CpG-A oligonucleotide G10 or by changing the palindrome on the induction of IP10 secretion from normal human peripheral blood mononuclear cells (PBMC). nAb, novel anti-Qb antibody; oAb anti-old Qb antibody; PBS, phosphate-buffered saline control. Figure 11 is a graph showing the relationship between structure and activity by reducing the number of 5' and / or 3' G in the CpG-A oligonucleotide G10 or by changing the palindrome on the induction of IL-10 secretion to from normal human peripheral blood mononuclear cells (PBMCs). nAb, novel anti-Qb antibody; oAb anti-old Qb antibody; PBS, phosphate-buffered saline control. Figures 12A-12B are a pair of graphs showing tumor volumes in mice presenting with A20 lymphoma. All mice were primed with a low dose (20 μg) of CMP-001 to induce anti-Qb antibodies so that virus-like particles (VLPs) will be opsonized and activate DCs once treatment is initiated. QPCQnn / zznz / E / YiAi Lymphoma cells were inoculated on both sides of - 18 mice on day 0. Starting on day 7, tumors on one side (treated) of the mice were directly injected with CpG (CMP-001) or saline, while tumors on the other side (untreated) , they were not injected. Mice then also received intraperitoneal anti-PD-1 or saline twice weekly, as indicated. Figure 12A shows the average tumor volumes for untreated (distant) tumors. Figure 12B shows the average tumor volumes for treated tumors. N = 10 for each group. Figure 13 shows a graph presenting the survival curves of mice in the experiment in Figure 12. DETAILED DESCRIPTION OF THE INVENTION Toll-like receptor (TLR) ligands are generally known to be potential inducers of cancer cell antigen presentation by APC. However, it was not previously known which particular TLR ligands are preferred, and even in the case of TLR9 ligands, it was not previously known which class, if any, of CpG ODNs are preferred nor their doses. and preferred and previously known days of administration. Almost all human clinical trials of CpG ODN in oncology have used class B ODN administered via the systemic route while some trials have explored - 19intratumoral administration (discussed further below). The invention of immune-stimulatory CpG oligodeoxynucleotides (ODNs) and subsequent inventions of various classes and designs of CpG ODNs provide novel opportunities for cancer immunotherapy. Based on encouraging preclinical data in rodent models, human clinical trials of CpG ODNs have been conducted in oncology patients using systemic and intratumoral administration of several different CpG ODNs alone or in combination with various chemotherapy regimens, vaccines, antibodies and radiotherapy but, again, clinical responses have been rare and despite some encouraging early clinical trial results, phase 3 trials have so far failed (reviewed in Krieg, Nucleic Acid Ther. 2012 22 (2): 77 -89) . Therefore, there is a need to provide improved oligonucleotide therapeutic approaches to increase the success rate of cancer immunotherapy. Tumor vaccines in which a cancer patient is vaccinated with a conserved non-mutated autoantigen along with an adjuvant have been the goal of immuno-oncologists for many years, despite successfully inducing immunity against the antigen. QecQnn / zznz / E / YiAi - 20selected, have almost uniformly failed to provide clear clinical benefits. CpG class B ODNs have increased the induction of antitumor CD8+ T cell responses in multiple cancer vaccine clinical trials (e.g., Kruit et al. J Clin Oncol 2013; Tarhini et al., J Immunother 2013; Lovgren et al., Cancer Immunol Immunother 2012; Karbach et al., Clin Cancer Res 2011; Karbach et al., Int J Cancer 2010, Speiser et al., JCI 2005, and in a single trial an unmodified class A CpG ODN was used as a vaccine adjuvant (Speiser et al., J Immunother 2010), although these have rarely been associated with clinical responses, and a phase 3 clinical trial of this approach carried out by GSK (GlaxoSmithKline) using an antigen tumor MAGE-3 so far appears to have been unsuccessful. In particular, it is notable that the vaccine clinical trial using the CpG class A ODN shows relatively weak induction of a CTL response that increases approximately two-fold from baseline in only approximately half of the patients, compared to an approximate average CTL response increased to 10-fold in those melanoma patients previously vaccinated with CpG class B ODN, indicating the state of the art. The immune system may not easily overcome self-tolerance to unmutated self-antigens to a certain degree. - 21sufficient to reject a tumor, which has led many experts in the field to search for ways to induce antitumor immunity against alternative mutated tumor antigens. Recent research using deep sequencing of tumor transcriptomes has shown that all cancers contain variable numbers of unique mutated antigens, termed tumor-specific neoantigens (Rajasagi et al., Blood 2014 124(3): 453-462) and those experts in The technique has sought ways to direct the antitumor immune response against these antigens. One approach being sought is to synthesize part or all of these neoantigens as peptides and vaccinate a cancer patient with the appropriate antigenic peptides to be presented on CPH class II in a formulation such as viral-like particle and use a very strong adjuvant such as example a CpG class B ODN. This approach would be extremely complex and expensive to develop. Therefore, there is a need for improved methods to induce antitumor immune responses against tumor-specific neoantigens. The present invention provides a superior approach by targeting the tumor itself in a vaccine by altering the tumor microenvironment in a manner that releases the brakes on checkpoint inhibitors and at the same time induces immune-mediated immunity. - 22 cells strong, using TLR9 agonists. Radiotherapy has long been used in cancer treatment and is currently used in the treatment of approximately 60% of patients with solid tumors (reviewed in Prasanna et al., J Thoracic Dis. 2014 6(4): 287- 302). Although radiation therapy can often shrink tumors, this effect is most commonly palliative and durable responses are extremely rare. Furthermore, radiation therapy is generally only available to treat one or a small number of tumor lesions and is therefore generally not used in the treatment of metastatic cancer. In some rare cases, XRT can induce regression of distant tumor metastasis as a result of the induction of a specific immune response against tumor antigens present not only in the irradiated lesion but also in distant metastases. This has been termed the abscopic effect and particularly since a recent case report by Postow et al. (N. Engl. J. Med. 2012 366(10) 925-31), this term has been converted and used to include other forms of localized tumor treatment in addition to just radiation therapy. Abscopic effects have been observed when XRT is given either before or after anti-CTLA-4 treatment: for example, more than half of 21 patients QecQnn / zznz / E / YiAi - 23 with melanoma treated with XRT followed by anti-CTLA-4 treatment showed evidence of distal tumor regressions (Grimaldi et al., Oncoimmunol. 2014 3: e28780). I. DEFINITIONS Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. Furthermore, unless the context otherwise requires, terms in the singular form shall include plural forms and terms in the plural form shall include singular forms. Generally, the nomenclatures used in connection with, and the techniques of, cell and tissue culture, molecular biology, immunology, microbiology, protein and nucleic acid genetics and chemistry, and hybridization described herein are those well known and commonly used in the field. . The methods and techniques of the present invention are generally carried out in accordance with methods well known in the art and as described in various general and more specific references that are mentioned and described throughout this specification unless indicated in another sense. These references include, for example, Sambrook and Russell, Molecular Cloning, A QPCQnn / zznz / E / YiAi - 24Laboratory Approach, Coid Spring Harbor Press, Coid Spring Harbor, N. Y. (2001), Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, NY (2002), and Harlow and Lane Antibodies: A Laboratory Manual, Coid Spring Harbor Laboratory Press, Coid Spring Harbor, N.Y. (1990), which are incorporated herein by reference. Enzymatic reactions and purification techniques are performed in accordance with the manufacturer's specifications, as commonly performed in the field or as described herein. The nomenclatures used in connection with the laboratory procedures and techniques of analytical chemistry, organic synthesis chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the field. Conventional techniques are used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation and patient delivery and treatment. As used herein, each of the following terms has the meaning associated with it in this section. The articles a and one are used herein to refer to one or more than one (that is, to at least one) of a grammatical object of the article. By way of example, an element means one element or more than one QPCQnn / zznz / E / YiAi element. - 25As used herein, the twenty conventional amino acids and their abbreviations follow conventional usage. See Immunology--A Synthesis (2nd Edition, E. S. Golub and D. R. Gren, Eds. Sinauer Associates, Sunderland, Mass. (1991)), in which it is incorporated herein by reference. Conventional notation is used herein to show polypeptide sequences: the left end of a polypeptide sequence is the amino-terminal part; The right end of a polypeptide sequence is the carboxyl-terminal part. A conservative amino acid substitution is one in which one amino acid residue is replaced by another amino acid residue that has a side chain R group with similar chemical properties (e.g. charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent sequence identity or degree of similarity can be adjusted upward to correct for the conservative nature of the substitution. The means for making this adjustment are well known to those skilled in the art. See, for example, Pearson, Methods Mol. Biol. 243: 307-31 (1994). QPCQnn / zznz / E / YiAi - 26Examples of groups of amino acids that have side chains with similar chemical properties include: 1) aliphatic side chains: glycine, alanine, valine, leucine and isoleucine; 2) side chains with aliphatic hydroxyl: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine and tryptophan; 5) basic side chains: lysine, arginine and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containing side chains: cysteine and methionine. Preferred conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspartate and asparagine-glutamine. Alternatively, a conservative substitution is any change that has a positive value in the PAM250 log probability matrix described in Gonnet et al., Science 256: 1143-45 (1992), incorporated herein by reference. A moderately conservative substitution is any change that has a non-negative value in the PAM250 log probability matrix. Preferred amino acid substitutions are those which (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter the affinity of QecQnn / zznz / E / YiAi - 27union to form protein complexes, and (4) confer or modify other physicochemical or functional properties of these analogues. Analogues comprising substitutions, deletions and / or insertions may include various muteins of a sequence in addition to the peptide sequence as they occur naturally. For example, single or multiple amino acid substitutions (preferably conservative amino acid substitutions) can be made in the sequence as it occurs naturally (preferably, in the portion of the polypeptide outside one or more of the domains that form the intermolecular contacts. ). A conservative amino acid substitution must not substantially change the structural characteristics of the source sequence (for example, an amino acid replacement must not have a tendency to break a helix that occurs in the source sequence or break other types of secondary structure that characterize the source sequence). Examples of polypeptide secondary and tertiary structures recognized in the field are described in Proteins, Structures and Molecular Principles (Craughton, Ed., W. H. Freeman and Company, New York (1984)); Introduction to Protein Structure (C. Branden and J. Tooze, eds., Garland Publishing, New York, N.Y. (1991)); and Thorton et al., Nature 354 105 (1991), each of which is QPCQnn / zznz / E / YiAi - 28incorporated herein by reference. Sequence similarity for polypeptides and sequence identity in similarity for polypeptides are typically measured using a sequence analysis program. The protein analysis program matches similar sequences using similarity measures mapped to various substitutions, deletions, or other modifications including conservative amino acid substitutions. For example, GCG contains programs such as Gap and Bestfit which can be used with factory parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a protein. wild type and a mutein thereof. See, for example, GCG version 6.1. Polypeptide sequences can also be compared using FASTA using factory or recommended parameters, a program in GCG version 6.1 FASTA (e.g., FASTA2 and FASTA3) provides alignments and percent sequence identity of the regions that overlap best between the sequences subjected to analysis and the search sequences (Pearson, Methods Enzymol. 183: 63-98 (1990); Pearson, Methods Mol. Biol. 132: 185-219 (2000)). Another preferred algorithm when comparing a - 29sequence of the invention with a database containing a large number of sequences from different organisms is the BLAST computer program, especially blastp or tblastn, using factory parameters. See, for example, Altschul et al., J. Mol. Biol. 215: 403-410 (1990); Altschul et al., Nucleic Acids Res. 25: 3389-402 (1997); incorporated herein by reference. An intact antibody comprises at least two heavy chains (H) and two light chains (L) interconnected by disulfide bonds. See generally, Fundamental Immunology, Ch. 7 (Paul, W., ed., 2nd ed Raven Press, N. Y. (1989)) (incorporated herein by reference in its entirety for all purposes). Each heavy chain is made up of a heavy chain variable region (HCVR or VH) and a heavy chain constant region (Ch). The heavy chain constant region is made up of three domains, CH1, CH2 and CH3. Each light chain is made up of a light chain variable region (LCVR or VL) and a light chain constant region. The light chain constant region is comprised of a domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, called complementarity determining regions (CDR), interspersed with regions that are more conserved, called infrastructure regions (FR). QPCQnn / zznz / E / YiAi - 30 for its acronym in English). Each Vh and Vl is made up of three CDRs and four FRs, arranged from the amino-terminal to the carboxyl-terminal part in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The assignment of amino acids to each domain is according to the definitions of Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md (1987 and 1991)) or Chothia & Lesk, J. Mol. Biol. 196: 901-917 (987); Chothia et al., Nature 342: 878-883 (1989). The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of antibodies can mediate immunoglobulin binding to tissues or host factors that include various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. The term "antibody" may include antigen-binding portions of an intact antibody that retain the ability to specifically bind the antigen of the intact antibody, for example, PD-1. Antigen-binding portions can be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies. Examples of antigen binding moieties - 31include: (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, Cl and CH1 domains; (ii) an F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge in the hinge region; (iii) an Fd fragment consisting of the VHy CH1 domains; (iv) an Fv fragment consisting of the Vl and Vh domains of a single arm of an antibody, (v) a single domain antibody (dAb) which consists of a VE domain as described in Ward et al., Nature 341 : 544-546 (1989); and (vi) an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VH and VL are encoded by separate genes, they can be linked using recombinant methods by a synthetic linker that allows them to be made as a single protein chain in which the pair of Vh and Vl regions form monovalent molecules (known as single-chain Fv (scFv); see, for example, Bird et al., Science 242: 423-426 (1988); and Huston et al., Proc. Nati. Acad. Sci USA 85: 5879 -5883 (1988)). These single chain antibodies are included by reference in the term antibody. A bispecific antibody has two different binding specificities, see, for example, U.S. Pat. No. 5,922,845 and U.S. Pat. No. 5,837,243; Zeilder J. Immunol. 163: 1246-1252 (1999); Somasundaram Hum. QPCQnn / zznz / E / YiAi - 32Antibodies 9: 47-54 (1999); Keler Cancer Res. 57: 4008-4014 (1997). For example, the invention provides bispecific antibodies that have a binding site for a cell surface antigen, such as human PD-1, and a second binding site for an Fe receptor on the surface of an effector cell. The invention also provides multispecific antibodies which have at least three binding sites. The present invention contemplates bispecific antibodies which can bind to any two different checkpoint inhibitors. For example, the different CPI can be selected from the group consisting of PD-1, PD-L1, CTLA-4, TIM3 and LAG3. Thus, for example, bispecific antibodies can bind PD-1 and PD-L1, PD-1 and CTLA-4, PD-1 and TIM3, PD-ly LAG3, PD-L1 and CTLA-4, PD-L1 and TIM3 , PD-L1 and LAG3, CTLA-4 and TIM3, and CTLA-4 and LAG3, or TIM3 and LAG3. In certain embodiments, the bispecific antibodies can bind PD-1 and PDL1, PD-1 and CTLA-4, PD-1 and TIM3, or PD1 and LAG3. In certain embodiments, the bispecific antibodies can bind PD-L1 and CTLA-4, PD-L1 and TIM3, PD-L1 and LAG3. In certain embodiments, the bispecific antibodies can bind PD-1 and PD-L1, or PD1 and CTLA-4. In certain embodiments, bispecific antibodies can bind PD-1 and PD-L1. In certain embodiments, bispecific antibodies can bind PD-L1 QPCQnn / zznz / E / YiAi - 33y CTLA-4. In certain embodiments, bispecific antibodies can bind PD-L1 and CTLA-4. The present invention also contemplates methods of the invention using bispecific antibodies which bind any two different checkpoint inhibitors. For example, the different CPI can be selected from the group consisting of PD-1, PD-L1. CTLA-4, TIM3 and LAG3. Thus, for example, bispecific antibodies can bind PD-1 and PD-L1, PD-1 and CTLA-4, PD-1 and TIM3, PD-1 and LAG3, PD-L1 and CTLA-4, PD-L1 and TIM3, PD-L1 and LAG3, CTLA-4 and TIM3, and CTLA-4 and LAG3, or TIM3 and LAG3. In certain embodiments, the bispecific antibodies can bind PD-1 and PDL1, PD-1 and CTLA-4, PD-1 and TIM3, or PD1 and LAG3. In certain embodiments, the bispecific antibodies can bind PD-L1 and CTLA-4, PD-L1 and TIM3, PD-L1 and LAG3. In certain embodiments, the bispecific antibodies can bind PD-1 and PD-L1, or PD1 and CTLA-4. In certain embodiments, bispecific antibodies can bind PD-1 and PD-L1. In certain embodiments, bispecific antibodies can bind PD-L1 and CTLA-4. In certain embodiments, bispecific antibodies can bind PD-L1 and CTLA-4. The term bispecific antibodies also includes diabodies. Diabodies are bivalent bispecific antibodies in which the VHY VL domains are expressed on a single polypeptide chain, but QPCQnn / zznz / E / YiAi - 34using a linker that is too short to allow pairing between the two domains on the same chain and in this way forcing the domains to pair with complementary domains of another chain and generate binding sites for two antigens (See, for example Holliger et al., Proc. Nati. Acad. Sel. USA 90: 6444-6448 (1993); Pollak et al., Structure 2: 1121-1123 (1994)). The terms human antibody or human sequence antibody, as used interchangeably herein, include antibodies that have variable and constant regions (if present) derived from human germline immunoglobulin sequences. Human sequence antibodies of the invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). However, the term Human antibody, as used herein, is not intended to include chimeric antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human infrastructure sequences (i.e. i.e. humanized antibodies or PRIMATIZEDMR). The term chimeric antibody, as used QPCQnn / zznz / E / YiAi - 35herein, means an antibody that comprises regions of two or more different antibodies. For example, in one embodiment, one or more of the CDRs are derived from anti-human CTLA-4 antibody. In another embodiment, one or more of the CDRs are derived from anti-human CTLA-4 antibody. In another embodiment, all of the CDRs are derived from human anti-CTLA-4 antibody. In another embodiment, the CDRs of more than one human anti-CTLA-4 antibody are combined into a chimeric human antibody. For example, a chimeric antibody may comprise a light chain CDR1 of a first anti-human CTLA-4 antibody, a light chain CDR2 of a second anti-human CTLA-4 antibody, and a light chain CDR3 of a third. anti-human CTLA-4 antibody; and similarly the heavy chain CDRs can be derived from one or more different anti-CTLA-4 antibodies. Furthermore, the infrastructure regions can be derived from one of the same anti-CTLA-4 antibodies or from one or more different human ones. As another example in one embodiment, one or more of the CDRs are derived from an anti-human PD-1 antibody. In another embodiment, all of the CDRs are derived from an anti-human PD-1 antibody. In another embodiment, the CDRs of more than one human anti-PD-1 antibody are combined into a chimeric human antibody. For example, a chimeric antibody may comprise a CDR1 of the light chain of QecQnn / zznz / E / YiAi - a first anti-human PD-1 antibody, a CDR2 of the light chain of a second anti-human PD-1 antibody and a CDR3 of the light chain of a third anti-human PD-1 antibody; and similarly the heavy chain CDRs can be derived from one or more different anti-PD-1 antibodies. Furthermore, the infrastructure regions can be derived from one of the same anti-PD-1 antibodies or from one or more different humans. As a further example, in one embodiment, one or more of the CDRs are derived from an anti-human PD-Ll antibody. In another embodiment, all of the CDRs are derived from an anti-human PD-Ll antibody. In another embodiment, the CDRs of more than one human anti-PD-Ll antibodies are combined into a chimeric human antibody. For example, a chimeric antibody may comprise a CDR1 of the light chain of a first anti-human PD-Ll antibody, a CDR2 of the light chain of a second anti-human PD-Ll antibody and a CDR3 of the light chain of a third anti-human PD-Ll antibody; and similarly the heavy chain CDRs can be derived from one or more different anti-PD-Ll antibodies. Furthermore, the infrastructure regions can be derived from one or the same anti-PD-Ll antibody or from one or more different human ones. Furthermore, as previously described herein, the chimeric antibody includes an antibody that QecQnn / zznz / E / YiAi - 37comprises a portion derived from the germline sequences of more than one species. By the term compete, as used herein with respect to an antibody, it is meant that a first antibody, or a portion thereof that binds to antigen, competes for binding with a second antibody, or a second portion thereof. same as antigen binding, wherein the binding of the first antibody to its cognate epitope is detectably decreased in the presence of the second antibody compared to the binding of the first antibody in the absence of the second antibody. The alternative, where the binding of the second antibody to its epitope is also detectably decreased in the presence of the first antibody may occur, but need not be the case. That is, the first antibody can inhibit the binding of a second antibody to its epitope without the second antibody inhibiting the binding of the first antibody to its respective epitope. However, when each antibody detectably inhibits the binding of the other antibody to its cognate epitope or ligand, whether to an equal, greater, or lesser degree, the antibodies are said to cross-compete with each other for the binding of one or the other. several of the respective epitopes. For example, cross-competing antibodies may bind to the epitope, or portion of the epitope, to which the antibodies of the invention bind. The antibodies both QecQnn / zznz / E / YiAi - 38that compete and those that compete and remain cross-reactive are covered by the present invention. Regardless of the mechanism by which this competition or cross-competition occurs (for example, steric hindrance, conformational change or binding to a common epitope or portion thereof, and the like), a person skilled in the art will appreciate, based on the teachings provided herein, that these competing and / or cross-competing antibodies are encompassed and may be useful for the methods described herein. The term epitope includes any protein determinant capable of specific binding to an immunoglobulin or T cell receptor. Epitope determinants usually consist of clusters of chemically active surface molecules such as amino acids or sugar side chains and usually have specific three-dimensional structural characteristics such as as specific cargo characteristics. Conformational and non-conformational epitopes differ in that the binding of the former but not of the latter is lost in the presence of denaturing solvents. By the phrase specifically binds, as used herein, is meant a compound, for example, a protein, a nucleic acid, an antibody. QPCQnn / zznz / E / YiAi - 39and similar which recognizes and binds to a specific molecule but does not substantially recognize or bind to other molecules in a sample. For example, the phrase binds specifically may characterize an antibody or a peptide inhibitor which recognizes and binds a cognate ligand (e.g., an anti-PD-1 antibody that binds to its cognate antigen, PD-1). in a sample but does not recognize or bind substantially to other molecules in the sample. Thus, under the designated assay conditions, the specified binding portion (e.g., an antibody or an antigen-binding portion thereof) preferentially binds to a particular target molecule and does not bind in an amount significant to other components present in a test sample. A variety of assay formats can be used to select an antibody that specifically binds to a molecule of interest. For example, solid-phase ELISA immunoassay, immunoprecipitation, BIAcore assays, and Western blot are used to identify an antibody that specifically reacts with PD-1. Typically, a specific or selective reaction will be at least twice the background signal or noise and more typically more than 10 times the background, even more specifically an antibody is said to specifically bind to an antigen when the dissociation constant (Kd) at equilibrium is < 1 - 40μΜ, preferably < 100 ηΜ and more preferably < 10 nM. Preferably, an antibody which specifically binds to a CPI is an antigen-binding antibody or fragment thereof which, in addition to its binding to the target CPI, interferes with the reciprocal interaction between the bound target CPI and its cognate ligand. For example, an antibody that specifically binds to PD-1 is preferably an antibody or fragment thereof that binds to antigen which, in addition to binding to PD-1, interferes with the reciprocal interaction between PD-1 and its ligand. cognate, PD-L1. The term KD refers to the equilibrium dissociation constant of a particular antibody-antigen interaction. As used herein, the term substantially pure means an object species that is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition) and preferably a substantially purified fraction is a composition. wherein the target species (e.g., an anti-PD-1 antibody) comprises at least about 50 percent (on a molar basis) of all macromolecular species present. Generally, a substantially pure composition QecQnn / zznz / E / YiAi - 41will comprise more than about 80 percent of all macromolecular species present in the composition, more preferably more than about 85%, 90%, 95% and 99%. More preferably, the target species are purified to essential homogeneity (contaminating species cannot be detected in the composition by conventional detection methods) where the composition essentially consists of a single macromolecular species. By the term therapeutically effective amount, as used herein, is meant an amount that, when administered to a mammal, preferably a human, mediates a detectable therapeutic response compared to the response detected in the absence of the compound. A therapeutic response such as, but not limited to, inhibition of and / or decreased tumor growth (including tumor size stasis), tumor size, metastasis, and the like, can be readily determined by a wide variety of methods recognized in the art. scope that includes, for example, methods such as those described here. Those skilled in the art will understand that the effective amount of the compound or composition administered herein varies and can be easily determined based on various factors such as the disease or condition being treated, the stage of the disease, the age QecQnn / zznz / E / YiAi - 42and health as well as the physical condition of the mammal being treated, the severity of the disease, the particular compound being administered and the like. A therapeutically effective amount is intended to qualify the amount of an agent that is required to detectably reduce to some extent one or more of the symptoms of a neoplastic disorder including, but not limited to: 1) reduction in the number of cancer cells; 2) reduction in tumor size; 3) inhibition (i.e., slowing down to a certain extent, preferably stopping) the infiltration of cancer cells into peripheral organs; 4) inhibition (i.e. slowing down to a certain extent, preferably stopping) tumor metastasis; 5) inhibition to some extent of tumor growth; 6) relief or reduction to some extent of one or more of the symptoms associated with the disorder; and / or 7) alleviation or reduction of side effects associated with the administration of anticancer agents. A therapeutically effective amount of a TLR9 agonist can also be defined based on a biomarker response using any of the well-defined blood or tissue markers for TLR9 activation that are well known to those skilled in the art. The CpG ODN of this QecQnn / zznz / E / YiAi - 43invention is broadly similar to other CpG ODNs (e.g., class B) in its induction of a Thl-type cytosine and chemokine response in serum, plasma, PBMC and / or tissues or biopsies which can be measured as follows: described by Krieg et al., J. Immunother., 2004 27: 460-471 using, for example, cytosine analysis for IP-10, ITAC, MIG, ΜΙΡ-1β, ΜΙΡ-3β, IL-6, IL-12p40 or IFN-α for serum or plasma collected approximately 24 h after treatment, or can also be determined by RT-PCR analysis of PBMC. A therapeutically effective amount of the CpG ODN that is injected intratumorally into a cancer patient will increase serum IP-10 amounts at 24 hours to at least 100 pg / ml, and preferably between 100-100,000 pg / ml. , and more preferably between 1,000 to 10,000 pg / ml. In contrast to chemotherapy drugs, for which the dose is generally increased to the maximum tolerated dose (MTD), immune-stimulating drugs such as the CpG ODN of the present invention work best at a dose optimal biological balance (OBD), which is generally lower than the MTD. Serum cytosines and chemokines provide a simple measure to calculate the optimal biological dose. The intended biological effect of the CpG ODNs herein QPCQnn / zznz / E / YiAi - The invention is to convert the tumor microenvironment (and that of the draining lymph nodes) from an immunosuppressive one - with a low amount of IFN production and a lack of activated TIL - to an immune activated microenvironment that shows increased production of IFNs, especially IFN type I, and which now has increased TIL that presents activation markers such as PD-L1, as reflected, for example, in the tumor biopsy characteristics of patients who respond to treatment with anti-PD-1 or anti- PD-Ll reported by Tumeh et al., Nature 2014 515: 568-571; and by Herbst et al., Nature 2014 515: 563-567, respectively, or additionally by Taube et al., Clin Cancer Res. 2014. Stated another way, recent research has shown that anti-PD-1 treatment or anti-PD-Ll is generally only effective in patients who have already presented TILs, and who already have a humoral microenvironment that reflects effects of IFN (such as expression of PD-L1, which is induced by IFN). Patients who lack this feature on a tumor biopsy before treatment are unlikely to respond to treatment with anti-PD-1 or anti-PD-Ll unless they also receive treatment with an agent that induces TILs and high IFN production. type I: CpG ODN of the present invention are the perfect agent for this purpose. - 45The main endogenous source of type I IFN in humans and other animals is plasmacytoid dendritic cells (pDC). pDC produce more than 99% of the type I IFN that is produced in response to pathogen infection (Siegal et al., Science 1999). Although very few molecularly defined stimuli have been shown to activate pDcs to secrete high amounts of type I IFN. In fact, to date, class A CpG ODNs are by far the strongest stimulus for production by pDcs. type I IFN pDCs that have been reported in the scientific literature and, surprisingly, the CpG ODN of the present invention is even more effective than those previously known in the art. Certain preferred CpG ODNs induce high or large amounts of type I IFN. Assays for measuring type I IFN are well known in the art and include in vitro enzyme-linked immunosorbent assays (ELISA) and cell-based assays, such as those are described herein. Without wishing to be limiting, large or high amounts of type I IFN can refer to greater than or equal to about 1000 pg / ml of IFN-α, measured according to these in vitro assays. In certain embodiments, large or high amounts of type I IFN may refer to greater than or equal to about 2000 pg / ml of IFN-α measured from QPCQnn / zznz / E / YiAi - 4 6 agreement with these in vitro analyses. In certain embodiments, large or high amounts of type I IFN refer to greater than or equal to about 3000 pg / ml of IFN-α measured according to these in vitro assays. In certain embodiments, large or high amounts of type I IFN refer to greater than or equal to about 4000 pg / ml of IFN-α measured according to these in vitro assays. In certain embodiments, large or high amounts of type I IFN may refer to greater than or equal to about 5,000 pg / ml of IFN-α measured according to these in vitro assays. Combined with the teachings provided herein, by selecting among the various active compounds and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side effects, and preferred mode of administration, a prophylactic or therapeutic treatment regimen Effective treatment can be planned that does not cause substantial toxicity but at the same time is effective in treating a particular subject. The effective amount for any particular application may vary based on factors such as the disease or condition being treated, the severity of the disease or condition and the health and size of the subject. A person usually expert in the field can determine - 47empirically the effective amount of TLR9 agonist (e.g., CpG ODN), CPI (e.g., anti-PD-1 antibodies, anti-OD-Ll antibodies, anti-CTLA-4 antibodies) and / or other therapeutic agents without needing undue experimentation. For example, a human clinical trial of a CpG class B together with an anti-CTLA-4 antibody has been reported by Millward et al., 2013. The clinical trial demonstrated a way to combine a TLR9 agonist provided by subcutaneous injection with a systemically provided anti-CTLA-4 antibody that may be used in future clinical trials of other CpG ODNs and other checkpoint inhibitors, but the trial failed to demonstrate clear significant clinical benefit from the combination. This failure demonstrates the non-obviousness of the present invention. Although there have been publications of CpG class A ODN with high IFN-α secretion, it has not been obvious for researchers to conduct the clinical trial to use this CpG ODN instead of the CpG class B ODN. It is not obvious to provide CpG ODN or anti-CTLA-4 antibody locally in the tumor rather than systemically. As a result, the approach was abandoned after completing the trial. Similarly, Mangsbo et al., {J. Immunother 2010 33: 225) reported the combination of an intratumoral CpG class B ODN with - 48anti-CTLA-4 or anti-PD-1 in mouse tumor model. Positive results are seen with the combinations, but again there is no guideline for carrying out this therapy using a high IFN-inducing type of CpG ODN, such as class A or other ODN of the present invention. To date there appears to be no awareness among experts in the field of the desirability and advantage of combining a high IFN-inducing class of CpG ODN together with checkpoint inhibitor treatment. For a combination of agents to have optimal synergy in cancer immunotherapy, the immune suppressive effects of one agent must be reversed by another. For example, IFN induces PD-L1 expression in tumors, which suppresses the immune response. The high IFN-inducing CpG ODN of the invention induces PD-L1 expression, but when used in combination with anti-PD-Ll antibody or anti-PD-Ll antibody, the potential immune suppressive effects of PD-L1 are overcome by the antibody. Furthermore, the present invention is based, at least in part, on the discovery that the combination of an intratumoral class B CpG ODN with a less than optimally synergistic (or non-synergistic) systemic checkpoint inhibitor any way) due to the induction of IL-10 results in effects QecQnn / zznz / E / YiAi - 49pleiotropic immune suppressants that are not reversed by checkpoint inhibitor treatment. Thus, the present invention provides combinations of agents that together provide unexpected benefits, for example synergistic in cancer immunotherapy. The therapeutically effective amount of CpG ODN and / or antibodies alone or together can initially be determined from in vitro and / or animal models. A therapeutically effective dose can also be determined from human data for the specific CpG ODN and / or specific antibodies or for other compounds which are known to exhibit similar pharmacological activities. The applied dose can be adjusted based on the relative bioavailability and potency of administered compound. Adjusting the dosage to obtain maximum efficacy based on the methods described above and other methods is well known in the art and is within the capabilities of a person typically skilled in the art. Instructional material as the term is used herein includes a publication, record, diagram or any other means of expression which may be used to communicate the usefulness of the compound, combination and / or composition of the invention in the QPCQnn / zznz / E / YiAi - 50kit to alter, alleviate or treat various diseases or disorders mentioned herein. Optionally or alternatively, the instruction material may describe one or more methods of alleviating diseases or disorders in a cell, tissue, or mammal including those described elsewhere herein. The instruction material in the kit may, for example, be attached to the container containing the compound and / or composition of the invention or may be transported together with a container which contains the compound and / or composition. Alternatively, the instruction material may be shipped separately from the container with the intention that the recipient will use the instruction material and the compound cooperatively. The CpG ODN and / or antibody of the invention may be provided in a medicinal dispenser. A medicinal dispenser is a package that defines a plurality of medicinal storage compartments, each compartment for housing an individual unit of medication. In one embodiment, the entire medicinal treatment course is housed in a plurality of medicinal storage compartments. A package defines a plurality of medicinal storage compartments and can be any type of disposable pharmaceutical package or card. QecQnn / zznz / E / YiAi - 51that retains medications in individual compartments. For example, the packaging is a blister packaging constructed from a card which can be made from a rigid paper material, a blister film, and a backing sheet. These cards are well known by those usually experts in the field. As an example, a medicinal dispenser may house an entire medicinal treatment course. The dispenser may include day signs to indicate which day individual units of the medication should be ingested. This may be marked along a first side of the medical packaging. Dose signs may also be marked, for example along a second side of the medicinal package perpendicular to the first side of the medicinal package to thereby indicate the time at which the individual unit of medication is to be ingested. The unit doses may be contained in the dispenser which is a blister-type packaging. Except where indicated, the terms patient or subject are used interchangeably and refer to mammals such as human patients and non-human primates as well as veterinary subjects such as rabbits, rats and mice and other animals. Preferably, a patient or subject refers to a QecQnn / zznz / E / YiAi human. - 52In certain modalities, a subject is an adult human. In certain embodiments, a subject is a child. In certain embodiments, a subject is less than approximately 18 years of age. In certain embodiments, a subject is less than about 12 years of age. As used herein, treat means reduce the frequency with which symptoms of a disease (i.e., tumor growth and / or metastasis, or other effects mediated by the numbers and / or activity of immune cells, and similar) are experienced by a patient. Treatment may be prophylactic (to prevent or delay the onset of the disease or to prevent the manifestation of clinical or subclinical symptoms of the disease) or suppression or therapeutic relief of symptoms after the manifestation of the disease. The term "treat" includes the administration of the compounds or agents of the present invention to: (i) prevent or delay the onset of symptoms, complications or biochemical signs of, (ii) alleviate the symptoms of, and / or (iii) inhibit or suppress the further development of the disease, condition or disorder. The term polytherapy encompasses the administration of a TLR9 agonist, for example a certain CpG ODN, and a checkpoint inhibitor as part of a regimen. QecQnn / zznz / E / YiAi - 53specific treatment intended to provide a beneficial effect from the joint action of these therapeutic agents. In some embodiments, the checkpoint inhibitor is a CPI-specific antibody or an antigen-binding fragment thereof. In some embodiments, the checkpoint inhibitor is a bispecific CPI-specific antibody or a bispecific antigen-binding fragment thereof. The beneficial effect of the combination includes, but is not limited to, the joint pharmacokinetic or pharmacodynamic action that results from the combination of therapeutic agents. Administration of these therapeutic agents in combination is usually carried out over a defined period of time (usually minutes, hours, days or weeks, based on the combination that is selected). The term polytherapy is generally not intended to encompass the administration of two or more of these therapeutic agents as part of separate monotherapy regimens that incidentally and arbitrarily result in the combination of the present invention. Polytherapy encompasses the administration of these therapeutic agents in a sequential manner, that is, where each therapeutic agent is administered at a different time as well as the administration of these therapeutic agents, or at least two of the agents. QPCQnn / zznz / E / YiAi - 54therapeutics, in a substantially simultaneous manner. Sequential or substantially simultaneous administration of each therapeutic agent can be carried out by an appropriate route as described herein including, but not limited to intratumoral and peritumoral routes, systemic routes, for example intravenous, intraperitoneal, enteric (including oral), intramuscular, subcutaneous and transmucosal; and topical and transdermal routes. As described herein, generally a first therapeutic agent (e.g., CpG ODN) can be administered by intratumoral or peritumoral injection and a second agent (e.g., anti-PD-1 antibody) can be administered systemically ( for example, intravenously). Polytherapy may also encompass the administration of TLR9 agonist, for example, certain CpG ODN and checkpoint inhibitor therapeutic agents as described above in additional combination with non-drug treatments (such as, but not limited to radiotherapy (XRT) or surgery). In some embodiments, the checkpoint inhibitor is a CPI-specific antibody or an antigen-binding fragment thereof. In some embodiments, the checkpoint inhibitor is a bispecific CPI-specific antibody or a bispecific antigen-binding fragment thereof. When the QecQnn / zznz / E / YiAi - Polytherapy also includes radiation treatment, the radiation treatment can be carried out at any suitable time to the extent that a beneficial effect is obtained from the joint action of the combination of the therapeutic agents and the radiation treatment. For example, in appropriate cases, the beneficial effect is still had when the radiation treatment is temporarily suspended from the administration of the therapeutic agents, for days or even weeks. Polytherapy also encompasses the administration of TLR9 agonist, for example certain CpG ODN and checkpoint inhibitor therapeutic agents as described above in further combination with other biologically active ingredients (such as, but not limited to, an agent additional and different antineoplastic agent, a dendritic vaccine or another antitumor vaccine). In some embodiments, the checkpoint inhibitor is an antigen-binding antibody or fragment thereof. In some embodiments, the checkpoint inhibitor is a bispecific antibody or a bispecific antigen-binding fragment thereof. However, in certain embodiments, polytherapy specifically excludes the administration of a dendritic cell or tumor vaccine. II. CpG DNA CpG oligonucleotides (CpG DNA; QPCQnn / zznz / E / YiAi - 56CpG) contain specific sequences found to induce an immune response. These specific sequences are referred to as immunostimulatory motifs and oligonucleotides containing immunostimulatory motifs are referred to as immunostimulatory oligonucleotide molecules and, equivalently, immunostimulatory oligonucleotides. The immunostimulatory oligonucleotides include at least one immunostimulatory motif and preferably that motif is an internal motif. The term internal immunostimulatory motif refers to the position of the motif sequence within an oligonucleotide sequence which is at least one nucleotide longer (at both 5' and 3' ends) compared to the motif sequence. CpG oligonucleotides include at least one unmethylated CpG dinucleotide. An oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide molecule which contains a cytosine-guanine dinucleotide sequence (i.e., CpG DNA or DNA containing a 5' cytosine linked by a phosphate bond to a guanine 3 ') and activates the immune system. The entire CpG oligonucleotide may be unmethylated or portions may be unmethylated but QecQnn / zznz / E / YiAi at least the C of 5' CG 3' should be unmethylated. - 57E1 CpG ODN generally has a length of approximately 8 to 100 nucleotides. In certain modalities, QPCQnn / zznz / E / YiAi the CpG ODN has a length of about 8 to 50 nucleotides, a length of about 8 to 40 nucleotides, a length of about 8 to 30 nucleotides, a length of about 8 to 24 nucleotides, a length of about 8 to 20 nucleotides or a length of approximately 8 to 16 nucleotides. In 2004, investigations of the relationship between CpG ODN structure and activity have defined three families with distinct structural and biological characteristics (Hartmann et al., Eur. J. Immunol. 2003, 33: 1633-1641; Marshall et al., J. Leukocyte Biol. 2003 73: 781792; Vollmer et al., Eur. J. Immunol. 2004 34: 251-262). Typical class B ODN have an all-phosphorothiate backbone, do not form higher-order structures, and are strong stimulators of B lymphocytes, inducing relatively high levels of IL10 secretion, but inducing relatively poor NK activity of IFN-α secretion ( Krieg, 2002 and Krieg, unpublished observations). CpG class B ODN induces immunosuppressive counter-regulatory effects that include not only IL-10 secretion but also IDO expression, which may promote Treg development in vitro - 58 (Moseman et al., J. Immuno1. 2004 173(7): 4433-4442; Chen et al., J. Immunol: 2008 181(8): 5396-5404). The relevance of these in vitro data to in vivo antitumor immunotherapy has been uncertain, and has not delayed the clinical development of class B ODN, but the present invention is based, in part, on a novel discovery that these effects of class B ODN class B will suppress antitumor immune responses which can be avoided using other classes of CpG ODN that are structurally designed not to activate the NF-κΒ pathway that generates 11-10 secretion. The phosphorothioate backbone used in class B CpG ODNs has multiple complex effects on the resulting immune response compared to what is observed with a CpG ODN with the same sequence but without a phosphorothioate backbone. A very important effect of the phosphorothioate (PS) backbone is protection against nuclease degradation. ODN completely modified by PS are almost completely stable in serum and tissues for at least 24 h while an unmodified and unprotected ODN degrades within a few minutes. In serum, the main nuclease activity is a 3' exonuclease against which the CpG ODN can be protected by only one of a few PS bonds at the 3' end of the ODN. But in tissues there are also 5' exonucleases as well as endonucleases and these - 59can degrade native DNA that is otherwise not protected. Native DNA can be protected against exonucleases by circularization using techniques well described in the literature. See, for example, U.S. Pat. Nos. 8,017,591; 7,635,468; 7,074,772; 6,849,725; 6,451,593; and 6,451,563; and the published U.S. patent application. No. 2003 / 0125279; the entire contents of all of which are incorporated herein by reference. Alternatively or additionally, the native (i.e., otherwise unmodified and unprotected) ODN can be formulated into nanoparticles or other formulations well known in the art to block nuclease access to the ODN. In general, native CpG DNA (phosphodiester) activates TLR9 in both B cells and pDCs. B cells produce cytosine and initiate proliferation (this is activated predominantly through NF-κB activation), but unless TLR9 stimulation is sustained, proliferation is usually modest and there is relatively little stimulation of Ig secretion. and class commutation. pDCs are activated by native CpG DNA to secrete type I IFN and to express costimulatory receptors, but the magnitude of stimulation depends critically on the shape of the DNA. In contrast to these effects of native CpG DNA, CpG DNA f osf orothioate QPCQnn / zznz / E / YiAi - 60class B provides a much more powerful and sustained TLR9 signal for B lymphocytes, inducing them to proliferate strongly and leading to Ig secretion and class switching, as reported in the literature. But the phosphorothioate backbone has a very different effect on the TLR9-mediated pDC response, substantially reducing IFN secretion (apparently through suppression of IRF7-mediated signaling) but typically still providing strong induction of IFN expression. costimulatory molecules. Thus, for the present invention, the use of native DNA will typically provide superior type I IFN responses and will be therapeutically effective to the extent that the native DNA is protected from degradation. 1 to 3 phosphorothioate modifications can be added on the 5' and 3' terminal parts of the native DNA to protect it from nuclease degradation without diminishing the type I IFN response. Early in CpG ODN development for cancer immunotherapy, those skilled in the art will generally consider B cell activation desirable and therefore focus development efforts on class B ODN. In fact, possibly The activation of B lymphocytes is desirable for a tumor vaccine in order to boost the production of antitumor Ab, which is well known in the field. QPCQnn / zznz / E / YiAi - 61field that is capable of contributing to an antitumor response. Some early human clinical trials use intratumoral administration of class B CpG, which provides encouraging evidence of dendritic cell activation in tumor-draining lymph nodes (e.g., Molenkamp BG et al., Clin Cancer Res. 2007 13(10) : 2961-2969). However, clinical responses to this local intratumoral treatment are very limited and studies of the total lymphocyte population in draining lymph nodes show an approximately two-fold increase in IL-10 release in patients treated with CpG (Table 2 in MolenKamp et al.). Considering the negative effects of IL-10 for antitumor immunotherapy and the need for improved CpG ODN that does not induce its production or which induces minor amounts of this production, the present invention additionally provides improved CpG ODN with reduced induction of IL-10 . However, it has now been discovered, in accordance with the present invention, that for intratumoral administration, in particular, activation of B lymphocytes with the concomitant induction of IL-10 and IDO, is undesirable and possibly harmful. This is difficult or impossible to demonstrate using mouse models due to species-specific differences in the expression of TLR9 and QPCQnn / zznz / E / YiAi - 62the differences in responses to cytosine. The present invention is based on a new analysis of previously published and unpublished data on human immune cell responses to various CpG ODNs, together with a new analysis of the immune effects and deficiencies or other cancer immunotherapies and XRT. For cancer immunotherapy, IL-10 sometimes has positive effects (especially with systemic therapy, see, for example, Mumm and Oft, Bloessays 2013 35(7): 623-631), but IL-10 is generally considered to have negative immune effects on the local tumor microenvironment, inhibiting immune rejection (reviewed in Sato et al., Immunol Res. 2011 51(2-3): 170-182). Thus, the present invention is based, in part, on the discovery that the CpG class B ODN, which will induce high levels of IL-10, is not preferred for intratumoral treatment. Class B CpG oligonucleotides are represented by the formula: 5'XiCGX23' where Xi and X2 are nucleotides. In some embodiments Xi may be adenine, guanine or thymine and / or X2 may be cytosine, adenine or thymine. Class B CpG oligonucleotides are also represented by the formula: QecQnn / zznz / E / YiAi - 635' XiX2CGX3X43' where Χι, X2, X3 and X4 are nucleotides. X2 can be adenine, guanine or thymine. X3 can be cytosine, adenine or thymine. Class B of CpG oligonucleotides also includes oligonucleotides represented by at least the formula: 5' N1X1X2CGX3X4N23' where Χι, X2, X3 and X4 are nucleotides and N is any nucleotide and Ni and N2 are oligonucleotide sequences composed of approximately 0 to 25 N each. X 1 and Class B CpG oligonucleotides are described in published PCT patent applications, PCT / US95 / 01570 and PCT / US97 / 19791, as well as U.S. Pat. No. 6,194,388 B1 and U.S. Pat. No. 6,239,116 Bl, issued on February 27, 2001 and May 29, 2001, respectively. In contrast to CpG class B ODN, CpG class A ODN are potent activators of natural killer cell and IFN-α secretion from cells. QPCQnn / zznz / E / YiAi - 64dendritic plasmacytoid cells (pDC) but only weakly stimulate B lymphocytes, and induce very little secretion of 11-10. The canonical class A ODN contains polyG motifs at the 5' and / or 3' ends, which are capable of forming complex higher-order structures known as G strands and a central phosphodiester region containing one or more CpG motifs within a palindrome. of self-complementarity (reviewed in (Krieg, 2006). For example, U.S. Patent Nos. 6,949,520 and 7,776,344 show that in certain preferred embodiments, the class A CpG ODN has a sequence corresponding to any of the following: QPCQnn / zznz / E / YiAi ggGGTCAACGTTGAggggggG (SEQ ID NO: 43) ; tcgtcgttttgtcgttttgttcgtt (SEQ ID NO: 44) ; ggggtcgtcgttttgggggg (SEQ ID NO: 45) ; tcgtcgttttgtcgttttgggggg (SEQ ID NO: 46) ; ggggtcgacgtcgagggggg (SEQ ID NO: 47) ; ggggtcatcgagggggg (SEQ ID NO: 48) ; ggGGGACGATCGTCggggggG (SEQ ID NO: 49) ; gggggtcgtacgacgggggg (SEQ ID NO: 50) ; ggGGGACGATATCGTCgggggG (SEQ ID NO: 51) ; ggGGGACGACGTCGTCggggggG (SEQ ID NO: 52) ; ggGGGACGAGCTGCTCgggggG (SEQ ID NO: 53) ; ggGGGACGTACGTCggggggG (SEQ ID NO: 54) ; ggGGGACGATCGTTGgggggG (SEQ ID NO: 55) ; ggGGGAACGATCGTCggggG ggGGGGACGATCGTCggggggG ggGGGACGATCGTCGggggggG ggGGGTCATCGATGAggggggG (SEC (SEC (SEC (SEC ID ID ID ID NO: NO: NO: NO: 56) ; 57) ; 58) ; 59) ; 5 ggGGTCGTCGACGAggggggG (SEQ ID NO: 60) ; ggGGTCGTTCGAACGAgggggG (SEQ ID NO: 61) ; ggGGACGTTCGAACGTggggggG (SEQ ID NO: 62) ; ggGGAACGACGTCGTTgggggG (SEQ ID NO: 63) ; ggGGAACGTACGTCggggggG (SEQ ID NO: 64) ; 10 ggGGAACGTACGTACGTTgggggG (SEQ ID NO: 65) ; ggGGTCACCGGTGAggggggG (SEQ ID NO: 6 6); ggGGTCGACGTACGTCGAgggggG (SEQ ID NO: 67) ; ggGGACCGGTACCGGTggggggG (SEQ ID NO: 68) ; ggGTCGACGTCGAggggggG (SEQ ID NO: 69) ; 15 ggGGTCGACGTCGagggg (SEQ ID NO: 70) ; ggGGAACGTTAACGTTgggggG (SEQ ID NO: 71) ; ggGGACGTCGACGTggggG (SEQ ID NO: 72) ; ggGGGTCGTTCGTTgggggG (SEQ ID NO: 73) ; ggGACGATCGTCGgggggG (SEQ ID NO: 74) ; 20 ggGTCGTCGACGAggggggG (SEQ ID NO: 75) ; ggTCGTCGACGAGgggggG (SEQ ID NO: 76) ; ggGGACGATCGTCGggggggG (SEQ ID NO: 77) ; ggGGTCGACGTCGACGTCGAGgggggG (SEQ ID NO: 78) ; and ggGGACGACGTCGTGgggggG (SEQ ID NO: 79); 25 where each lowercase letter represents a - 66nucleotide linked to its 3' adjacent nucleotide by a f os f orothioate (PS) bond; and each uppercase letter represents a nucleotide linked to its adjacent 3' linked nucleotide (if present) by a phosphodiester (PO) bond, except that the 3' terminal nucleotide is represented by an uppercase letter since does not have an adjacent 3' nucleotide. In certain more preferred embodiments, the immunostimulatory nucleic acid has a sequence that corresponds to: QecQnn / zznz / E / YiAi ggGGGACGAGCTCGTCggggggG (SEQ ID NO: 80) ; ggGGGACGATCGTCGgggggG (SEQ ID NO: 58) ; ggGGACGATCGAACGTggggggG (SEQ ID NO: 81) ; ggGGTCGACGTCGACGTCGAGgggggG (SEQ ID NO: 7 8); or ggGGACGACGTCGTGgggggG (SEQ ID NO: 79); wherein each lowercase letter represents a nucleotide linked to its 3' adjacent nucleotide by a phosphorothioate (PS) bond; and each uppercase letter represents a nucleotide linked to its adjacent 3' nucleotide (if present) by a phosphodiester (PO) bond, except that the 3'-terminal nucleotide is represented by a capital letter since it does not have a 3' nucleotide. adjacent. In certain embodiments, a class A CpG ODN for use according to the methods of the present invention - 67has a sequence provided as: 5'-GGGGGGGGGGGACGATCGTCGGGGGGGGGG-3' (SEQ ID NO: 82; also referred to herein as G10). This oligonucleotide and formulations thereof useful in accordance with the present invention are described in WO 2003 / 024481; US 2003 / 0099668; US 2012 / 0301499; WO 2004 / 084940; US 7,517,520; US 2010 / 0098722; WO 2007 / 068747; US 2007 / 0184068; US 8,574,564; WO 2007 / 144150; US 8,541,559; WO 2008 / 073960; and US 8,586,728, the entire contents of each of which are incorporated herein by reference. The structure of class C ODN is typically based on a phosphorothioate backbone but is distinct in that the CpG motifs are followed by a 3' palindrome which can form a duplex. Class C ODNs are described in U.S. Patent No. 7,566,703 to Krieg et al; U.S. patent No. 8,198,251 to Vollmer et al.; and U.S. patent. No. 8,834,900 to Krieg et al. The CpG class C ODN has intermediate immune properties between classes A and B (Hartmann et al., 2003; Marshall et al., 2003; Marshall et al., 2005; Vollmer et al., 2004). Examples of class C ODNs include: QecQnn / zznz / E / YiAi TCGTCGTTTTCGGCGCGCGCCG (SEQ ID NO: 83) ; TCGTCGTTTTCGGCGGCCGCCG (SEQ ID NO: 84) ; TCGTCGTTTTCGGCGCGCCGCG (SEQ ID NO: 85) ; TCGTCGTTTTCGGCGCCGGCCG (SEQ ID NO: 86) ; TCGTCGTTTTCGGCCCGCGCGG (SEQ ID NO: 87) ; TCGTCGTTTTCGGCGCGCGCCGTTTTT (SEQ ID NO: 88); TCCTGACGTTCGGCGCGCGCCG (SEQ ID NO: 89) ; 5 TZGTZGTTTTZGGZGZGZGZZG (SEQ ID NO: 90) ; TCCTGACGTTCGGCGCGCGCCG (SEQ ID NO: 91) ; TCGGCGCGCGCCGTCGTCGTTT (SEQ ID NO: 92) ; TCGTCGTTTTCGGCGGCCGACG (SEQ ID NO: 93) ; TCGTCGTTTTCGTCGGCCGCCG (SEQ ID NO: 94) ; 10 TCGTCGTTTTCGACGGCCGCCG (SEQ ID NO: 95) ; TCGTCGTTTTCGGCGGCCGTCG (SEQ ID NO: 9 6); TCGTCGTTTCGACGGCCGTCG (SEQ ID NO: 97) ; TCGTCGTTTCGACGATCGTCG (SEQ ID NO: 98) ; TCGTCGTTTCGACGTACGTCG (SEQ ID NO: 99) ; 15 TCGTCGCGACGGCCGTCG (SEQ ID NO: 10 0); TCGTCGCGACGATCGTCG (SEQ ID NO: 101); TCGTCGCGACGTACGTCG (SEQ ID NO: 102) ; TCGTTTTTTTCGACGGCCGTCG (SEQ ID NO: 10 3); TCGTTTTTTTCGACGATCGTCG (SEQ ID NO: 104); and 20 TCGTTTTTTTCGACGTACGTCG (SEQ ID NO: 105), where each Z is 5-methylcytosine. According to certain embodiments, the immunostimulatory nucleic acid includes the sequence TCGGCGCGCGCCGTCGTCGTTT (SEQ ID NO: 92). The oligonucleotide may comprise 5' - 69T*T*T*C_G*T*C_G*T*T*T*C_G*T*C_G*T*T3' (SEQ ID NO: 106), where* represents a stabilized internucleotide bond. Optionally, when specifically stated, 5' may refer to the free 5' end of the oligonucleotide and 3' may refer to the free 3' end of the oligonucleotide. In some embodiments of the invention the oligonucleotide has one of the following formulas: TCGTCGTTCGGCGCGCCG (SEQ ID NO: 107), TCGTCGTCGTTCGGCGCGCGCCG (SEQ ID NO: 108), TCGTCGACGATCGGCGCGCGCCG (SEQ ID NO: 109), TTCGTCGTTTTGTCGTT (SEQ ID NO: 110) or TTTCGTCGTTTCGTCGTT (SEQ ID NO: 10 6). In other embodiments of the invention, the oligonucleotide has one of the following formulas: TCGTCGTC, CGTCGTCG, GTCGTCGT, TCGTCGTT, CGTCGTTC, GTCGTTCG, TCGTTCGG, CGTTCGGC, GTTCGGCG, TTCGGCGC, TCGGCGCG, CGGCGCGC, GGCGCGCG, GCGCGCGC, CGCGCGCC, or GCGCGCCG. In other embodiments of the invention, the oligonucleotide has one of the following formulas: T*C_G*T*C_G*T*C, C_G*T*C_G*T*C_G, G*T*C_G*T*C_G*T, T*C_G*T*C_G*T*T, C_G*T*C_G*T*T*C, G*T*C_G*T*T*C_G, T*C_G*T*T*C_G*G, C_G* T*T*C_G*G*C, G*T*T*C_G*G*C*G, T*T*C_G*G*C*G*C, T*C_G*G*C*G*G* C_G, C_G*G*C*G*C_G*C, G*G*C*G*C_G*C*G, G*C*G*C_G*C*G*C, C*G*C_G*C* G*C*C, or G*C G*C*G*C*C*G, where * represents a link QecQnn / zznz / E / YiAi - 70 stabilized internucleotide. In other embodiments of the invention an oligonucleotide is provided comprising: T*C_G*T*C_G*T*C, where * represents a stabilized internucleotide bond and represents a phosphodiester or phosphodiester type internucleotide bond. Optionally, the oligonucleotide may be 5,T*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*F*C*C 3' (SEO IDN NO: 111) 5 T*C_G *T*C_G*T*C_G*T*T*C_G*G*C*G*C 3' (SEO ID NO: 112) or 5,T*C_G*T*C_G*T*C*_G*T* T*C_G*G*C*G*C_G*C*G*C 3' (SEQ ID NO: 113) where 5' refers to the free 5' end of the oligonucleotide and 3' refers to the free 3' end of the oligonucleotide. In other embodiments, an oligonucleotide is provided that comprises: T*C_G*T*T*C_G*G, where* represents a stabilized internucleotide bond and represents a phosphodiester or phosphodiester type internucleotide bond. Optionally, the oligonucleotide may be: 5,C_G*T*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3, (SEQ ID NO: 114); 5' G*T*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEQ ID NO: 115): 5, t*c_g*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G3, (SEQID NO: 116) 5' C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEC QPCQnn / zznz / E / YiAi - 71ID NO: 117); 5' G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEO ID NO: 118); either 5' T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEO ID NO: 119), where 5' refers to the free 5' end of the oligonucleotide and 3' refers to the free 3' end of the oligonucleotide. More recently, a new class of CpG oligo has been identified with the structural feature of two palindromes (compared to the single palindrome in class O). See, for example, U.S. patent application publication 2008 / 0045473, the full content of which is incorporated herein by reference. Because the two palindromes of this class P CpG ODN are capable of forming higher-order concatamers, which are hypothesized to interact with TLR9 in a different way from the linear class B ODN or the duplex class C ODN. , with the observed result that class P ODN induces higher levels of type I IFN compared to class C (or class B), and substantially lower levels of IL-10. Examples of class P ODN include: T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G (SEC QPCQnn / zznz / E / YiAi ID NO:10 9) ; - 72T-C-G-T-C-G-A-C-G-A-T*T*T*T-A-C-G-A-C-G-T-C-G-TT*T*T*T(SEQ ID NO:120); T-C-G-T-C-G-A-C-G-A-T-T-T-T-A-C-G-A-C-G-T-C-G-T-TT-T (SEQ ID NO:121); T-C-G-T-C-G-A-C-G-A-A-C-G-A-C-G-T-C-G-T (SEQ ID NO: 122); T-C-G-T-C-G-A-C-G-A-T*T*T*T-T-C-G-T-C-G-A-C-G-AT*T*T (SEQ ID NO:123); T-C-G-T-C-G-A-C-G-A-T-T-T-T-T-C-G-T-C-G-A-C-G-A-TT-T (SEQ ID NO:123); T-C-G-T-C-G-A-C-G-A-T-C-G-T-C-G-A-C-G-A (SEC ID NO: 124); C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G (SEC ID NO: 125); G*A*G*A*A*C*G*C*T*C*G*A*C*C*T*T*C*G*A*T*biot (SEQ ID NO: 126); A*G*C*T*C*C*A*T*G*G*T*G*C*T*C*A*C*T*G (SEQ ID NO: 12 7) ; T*C*T*C*C*C*A*G*C*G*T*G*C*G*C*C*A*T(SEQ ID NO: 12 8) ; T*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*G*G*T*T (SEQ ID NO: 12 9); T*C*C*A*G*G*A*C*T*T*C*T*C*T*C*A*G*G*T*T (SEC ID NO: 130); T*C*C*A*C*G*A*C*G*T*T*T*T*C*G*A*C*G*T*T (SEC ID QPCQnn / zznz / E / YiAi NO: 131); QPCQnn / zznz / E / YiAi (SEO ID NO: 132); T*C*C*T*G*A*C*G*T*T*C*G*G*C*G*C*G*C*G*C*C*C (SEO ID NO: 91) ; T*C*G*C*G*T*G*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*A*C*G* T*T (SEQ ID NO:133); T*C*G*C*G*A*C*G*T*T*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO: 134); dig-C*C*G*G*C*C*G*G*C*C*G*G*C*C*G*G*C*C*G*G (SEC ID NO: 135); dig-C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G (SEC ID NO: 136); P*q*q*A*q*q*a*C*T*T*C*T*C*T*C*A*G*G*T*T*T*T*T*T (SEC ID NO: 137); G*T*G*C*T*C*G*A*G*G*A*T*G*C*G*C*T*T*C*G*C (SEC ID NO: 138); G*C*C*G*A*G*G*T*C*C*A*T*G*T*C*G*T*A*C*G*C (SEC ID NO: 139); T-C-G-C-G-T-G-C-G-T-T-T-T-G-T-C-G-T-T-T-T-G-A-C-GT-T (SEQ ID NO: 133); A*Q*c*g*A*T*A*C*C*G*G*T*G*C*C*G*G*T*G*A*C*G*G*C*A* C*C*A 74C*G (SEQ ID NO: 140); QPCQnn / zznz / E / YiAi A*C*C*G*A*T*A*A*C*G*T*T*G*C*C*G*G*T*G*A*C*G*G*C*A* C*C*A * C*G (SEQ ID NO:141); A*C*C*G*A*T*G*A*C*G*T*C*G*C*C*G*G*T*G*A*C*G*G*C*A* C*C*A C*G (SEQ ID NO: 142); C*G*G*C*G*C*G*C*G*C*C*G*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO:143); T*C*G*A*T*C*G*T*T*T*T*T*C*G*T*G*C*G*T*T*T*T*T (SEC ID NO: 14 4); T*C*G*T*C*C*A*G*G*A*C*T*T*C*T*C*T*C*A*G*G*T*T (SEC ID NO:14 5); T*C*G*T*C*G*T*C*C*A*G*G*A*C*T*T*C*T*C*T*C*A*G*G*T* T (SEQ ID NO:146); T*C*G*T*G*A*C*G*G*G*C*G*G*C*G*C*G*C*G*C*C*C (SEC ID NO: 147); A*C*G*A*C*G*T*C*G*T*tC*G*G*C*G*G*C*C*G*C*C*G (SEC ID NO:148) ; g*g*g-g-a-c-g-a-c-g-t-c-g-t-gC*G*G*C*G*G*C*C*G*C*C*G (SEQ ID NO:149); 75q*q*q*g*A*C*G*A*C*G*T*C*G*T*G*C*G*G*C*G*G*C*C*G*C* C*G QecQnn / zznz / E / YiAi (SEQ ID NO: 149); c*c-a*c-g*a*c-g*t*c-g*t*c-g-a-a-g*a*c-g*a*c-g*t*cg*t-g*g (SEQ ID NO:150); c*t-g*c*a*g-c*t-g-c*a*g-c*t-g-c*a*g-c*t-g*c*a*g (SEQ ID NO:151); c*g*g-c*c-g*c*t-g*c*a-g-c*g-g*c*c-g*c*t-g*c*a*g (SEQ ID NO:152); qT*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T (SEQ ID NO' 153); τ*C*G*T*T*T*T*T*G*A*T*G*T*T (SEQ ID NO 4); T*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T (SEQ ID NO: 155); ψ±C*G*T*T*T*T*T*G*A*T*G*T*T*G*T (SEQ ID NO* 15 6); T*C*C*A*T*G*A*C-G-T*T*T*T*T*G*A*T*G*T*T (SEC ID NO: 157) ; T*C*C*A*T*G*A-C-G-T*T*T*T*T*G*A*T*G*T*T (SEQ ID NO: 157) ; T*C*C*A*T*G*A*C*G*T*T*T*T*T*G*A*T-G~T*T (SEQ ID NO: 157) ; (SEQ ID NO: 157) ; T*C*C*A*T*G*A-C-G-T*T*T*T*T*G*A*T-G*T*T (SEC ID NO:157); QPCQnn / zznz / E / YiAi ^*P*G*A+C-G*T*T*T*T*T*G*A*T*G*T*T*G*T (SEQ ID NO* 15 6) ; Ά* rp * g*J^* Q * g* rj * rp * rp * rp * rp * Q* * rp _g* ip * rp * g* rp (SEO ID no · l 5 6) ,' gg 'p * g* g _ g * fp * fp * y * τ * ψ * g vg ψ _g * ψ * ψ * g * rp (SEQ ID NO' 15 6); A*T*G*A-C-G-T*T*T*T*T*G*A-T-G-T*T*G*T (SEC ID NO:156); T*C*C*A*T*G*C*G*T*T*T*T*T*G*A*A*T*G*T*T (SEC ID NO: 158); T*C*C*A*T*G*A*C*G*T*C*T*T*T*G*A*T*G*T*C (SEC ID NO: 159); A-C-G-A-C-G-T-C-G-T-T-C-A-C-G-A-C-G-T-C-G-T-col (SEQ ID NO: 160); A-C-G-A-C-G-T-C-G-T-G-G-C-C-A-C-G-A-C-G-T-C-G-T-DD-D (SEQ ID NO:161); A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-DD-D (SEQ ID NO:162); D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-CG-T-D-D-D (SEQ ID NO:163); D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-CG-T-col (SEQ ID NO:164); G*G*G-A-C-G-A-C-G-T-C-G-T-G*G*C*C-A-C-G-A-C-G-T-CG-T-C*C*C (SEQ ID NO:165); - 77C*C*C-A-C-G-A-C-G-T-C-G-T-G*G*G (SEO ID NO:166); QecQnn / zznz / E / YiAi C*C*C*V-A-C-G-A-C-G-T-C-G-T-G*G*G*G (SEO ID NO:167) T*C*G*A*T*C*G*T*T*T*T-T”C“G*T*G*C*G*T*T*T*T*T (SEC ID NO: 144) ; T*C*G*A*T*C*G*T*T*T-T-T-C-G-T*G*C*G*T*T*T*T*T (SEC ID NO: 144) ; T*C*G*A*T*C*G*T*T-T-T-T-C-G-T-G*C*G*T*T*T*T*T (SEC ID NO: 4); ID NO: 4); 168) ; 9); 0); 2); 3); 0); — — — — — T—C*G*T*G*C*G*rr*T*T'*’T*T (SEC A*T-G*A*C-G*T*T*T*T*T-G*A*C-G*T*T (SEQ ID NO: A*C-G*A*C-G*T*T*T*T*T-G*A*T-G*T*T (SEQ ID NO: A*C-G*A*C-G*T*T*T*T*C-G*A*C-G*T*T (SEQ ID NO:326); A*T-G*A*T-G*T*T*T*T*T-G*A*T-G*T*T (SEQ ID NO: A*T-G*A*C-G*T*T*T*T*G-A*T*G-T*T (SEQ ID NO:171); A*T-G*A*C-G*T*T*T*G*T-G*A*T-G*T*T (SEQ ID NO: T*T-G*A*C-G*T*T*T*T*T-G*A*T-G*T*T (SEQ ID NO: A*T-G*A*T-G*T*T*T*T*T-G*A*T-G*T*T (SEQ ID NO: - 78A*T-G*A*G-C*T*T*T*T*G-T*A*T-G*T*T (SEQ ID NO: 17 4); T*C*G*A*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G (SEQ ID NO: 175) ; T*C*C*T*G*A*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G (SEC ID NO:176); T*C*C*T*G*A*C*G*T*T*C*G*G*C*G*G*C*C*G*C*C*G (SEQ ID NO: 177) ; T*C*C*A*T*G*A*C*G*T*T*C*G*G*C*G*C*G*C*G*C*C*C (SEQ ID NO: 178); T*C*C*T*G*A*C*G*T*T*C*G*G*C*G*C*G*C*G*C*C (SEQ ID NO: 17 9); T*C*G*A*C*G*T*T*T-T-C-G-G-C*G*C*G*C*G*C*C*G (SEC ID NO:180); T*C*G*A*C*G*T*T*T-T-C-G-G-C*G*G*C*C*G*C*C*G (SEC ID NO: 175); T*C*G*A*C*G*T*C*G-A-C-G-T-T-A-G-G-G-T-T-A*G*G*G (SEQ ID NO:181); A*C*G*A*C*G*T*C*G-T-T-A-G-G-G-T-T-A*G*G*G (SEQ ID NO: 182); G*T*C-G*G*C-G*T*T-G*A*C (SEQ ID NO: 183); A-C-G-A-C-G-T-C-G-T-C-G-D-D-D-D-C-G-G-C-C-G-C-C-G (SEQ ID NO: 184); A-C-G-A-C-G-T-C-G-T-C-G-D-D-D-D*C*G*G*C*C*G*C*C*G QPCQnn / zznz / E / YiAi (SEQ ID NO:184); - 79T-C-G-T-C-G-A*C*G*A*C*G*T*C*G*T*C*G (SEO ID NO: 185); T-C-G-T-C-G-A-C-G-A-C-G-T-C-G-T-C-G-D-D-D-D (SEQ ID NO:18 6); A-C-G-A-C-G-T-C-G-T-T*T*T*T-A-C-G-A-C-G-T-C-G-Tteg (SEQ ID NO:187); A*C*G*A*C*G*T*C*G*T*D*D*D*D*A*C*G*A*C*G*T*C*G*T*D* D*D (SEQ ID NO: 162); d*d*d*a*c*g*a*c*g*t*c*g*t*d*d*d*d*a*c*g*a*c*g*t*c* g*t*d * D*D (SEQ ID NO:163); A-C-G-A-C-G-T-C-G-T-T*T*T*T-A-C-G-A-C-G-T-C-G-T-DD-D (SEQ ID NO:188); A-C-G-A-C-G-T-C-G-T-T*T*T*T-A-C-G-A-C-G-T-C-G-TT*T*T (SEQ ID NO:189); A*C-G-A-C-G-T-C-G-T-T*T*T*T-A-C-G-A-C-G-T-C-G-TT*T*T (SEQ ID NO:189); A*C-G-A-C-G-T-C-G-T-T*T*T*T-A-C-G-A-C-G-T-C-G*T (SEQ ID NO: 190); A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-L (SEQ ID NO:191); A-C-G-A-C-G-T-C-G-T-L-A-C-G-A-C-G-T-C-G-T-L (SEQ ID NO: 192); A-C-G-A-C-G-T-C-G-T-teg-teg-A-C-G-A-C-G-T-C-G-T QecQnn / zznz / E / YiAi - 80teg (SEQ ID NO: 193); C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-D-D-D (SEQ ID NO: 194); A-C-G-A-C-G-T-C-G-D-D-D-D-C-G-A-C-G-T-C-G-T-D-D-D (SEQ ID NO: 195); C-G-A-C-G-T-C-G-D-D-D-D-C-G-A-C-G-T-C-G-D-D-D (SEQ ID NO: 196); T-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-A-DD-D (SEQ ID NO:197); A-C-G-T-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-A-C-G-T-DD-D (SEQ ID NO:198); T-C-G-T-C-G-A-C-G-T-D-D-D-D-A-C-G-T-C-G-A-C-G-A-DD-D (SEQ ID NO:199); T-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-DD-D (SEQ ID NO:200); A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-T-C-G-T-C-G-T-DD-D (SEQ ID NO:201); A-C-G-A-C-G-T-T-D-D-D-D-A-A-C-G-T-C-G-T-D-D-D (SEQ ID NO:202); A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-D-D-D (SEQ ID NO:203); G-G-C-G-G-C-C-G-D-D-D-D-C-G-G-C-C-G-C-C-D-D-D (SEQ ID NO:204); G-C-G-G-C-C-G-G-D-D-D-D-C-C-G-G-C-C-G-C-D-D-D (SEC QPCQnn / zznz / E / YiAi ID NO:205) ; 81A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D(SEQ ID NO:206); D-A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-CD (SEC ID NO:207); -TQPCQnn / zznz / E / YiAi A*C-G-A-C-G-T-C-G-T-C-G-A-A-G-A-C-G-A-C-G-T-C-TD-D-T (SEQ ID NO:208); T*C-G-A-C-G-T-C-G-T-C-G-A-A-G-A-C-G-T-C-G-T-C-TD-D-T (SEQ ID NO: 209); C*C*A-C-G-A-C-G-T-C-G-T-C-G-A-A-G-A-C-G-A-C-G-cG-T*G*G (SEQ ID NO:150); T*q*q*A*D*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T (SEO ID NO:210); T*C*C*A*T*G*A*C*G*T*T*D*T*T*G*A*T*G*T*T (SEC ID NO:211); g * g * g*g^ j* g g * g * g* g* g * g * g *g; g* g* g * g (SEC ID NO:212); T*C*C*A*T*G*A*C*G*T*T*J*T*T*G*A*T*G*T*T (SEC ID NO:213); T*C*C*A*T*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T*Cy3 (SEC ID NO:214); J*J*J*J*J*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T (SEC ID NO:215); T*C*C*A*J*G*A*C*G*T*T*J*T*T*G*A*T*G*T*T (SEC ID NO:216) ; (SEC ID - 82ΝΟ:217 ) ; A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-DD-D-rU (SEQ ID NO:218); A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-DD-D-rG (SEQ ID NO:219); A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-DD-D-rA (SEQ ID NO:220); D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-CG-T-D-D-D-rU (SEQ ID NO:221); A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-DD-D-rA-rA-rA-rA (SEQ ID NO:222); T*C*G*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T (SEQ ID NO:2 2 3 ) ; T-T-T-A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-CG-T-D-D-D-rU (SEQ ID NO:224); (T*C-G-A-C-G-T-C-G-T-)(vitE-)double-teg; T*C*G*A*C-G*T*T*T*T*C-G*G*C*G*G*C*C-G*C*C*G (SEQ ID NO: 17 5); T*C*G*A*C-G*T*T*T*T*C-G*G*C*G*C*G*C-G*C*C*G(SEC ID NO: 180); T*C-G*C-G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G(SEC ID NO: 134); T*C*G*C-G*A*C*G*T*T*C-G*G*C*G*C*G*C*G*C*C*G(SEC ID NO: 134); T*c*G*C-G*A*C*G*T*T*C*G*G*C-G*C*G*C*G*C*C*G(SEC QPCQnn / zznz / E / YiAi - 83ID NO: 134); QecQnn / zznz / E / YiAi T*C*G*C-G*A*C*G*T*T*C*G*G*C*G*C~G*C*G*C*C*G (SEC ID NO: 134); T*C*G*C*G*A*C-G*T*T*C*G*G*C*G*C-G*C*G*C*C*G(SEC ID NO: 134); T*C*G*C*G*A*C-G*T*T*C*G*G*C-G*C*G*C*G*C*C*G(SEC ID NO: 134); T*C*G*C-G*A*C*G*T*T*C-G*G*C*G*C-G*C*G*C*C*G(SEC ID NO: 134); T*C*G*C*G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G(SEC ID NO: 134); T*C*G*C*G*A*C-G*T*T*C*G*C*G*C-G*C*G*C*G (SEQ ID NO:2 2 5 ) ; d*c*c*a*t*g*a*c*g*t*t*t*t*t*g*a*t*g*t*t (SEQ ID NO:2 2 6) ; t*d*c*a*t*g*a*c*g*t*t*t*t*t*g*a*t*g*t*t (SEQ ID NO:2 2 7 ) ; t*c*d*a*t*g*a*c*g*t*t*t*t*t*g*a*t*g*t*t (SEQ ID NO:2 2 8) ; T^C^C^D^T^G^A^C^G^T^T^T^T^T^G^A^T^G^T^T (SEQ ID NO:229); T*C*C*A*T*G*A*C*G*T*T*T*T*D*G*A*T*G*T*T (SEQ ID NO:2 30) ; T*C*C*A*T*G*A*C*G*T*T*T*D*T*G*A*T*G*T*T (SEC ID NO:231); - 84T*C*G*A*A*C-G*T*T*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID QPCQnn / zznz / E / YiAi NO:232); T*C*G*T*C*G*A*A*C-G*T*T*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO: 233); T*C*G*T*C*G*A*A*C-G*T*T*C*G*G*C*G*C*T*G*C*G*C*C*G (SEC ID NO:234); T*C*G*C*G*A*C-G*T*T*C*G*T*T*G*C*G*C*G*C*G*C*C*G (SEQ ID NO: 235); T*A*C*G*T*C-G*T*T*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO:2 3 6) ; T*T*C*G*C*G*A*C-G*T*T*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO:237) ; T*C*G*G*C*G*C*G*C*G*C*C-G*T*C*G*C*G*A*C*G*T (SEQ ID NO:238); p*A*G*C-G*T*G*C-G*T*T*T*T*G*A*C-G*T*T*T*T*T*T*T (SEQ ID NO:239); p*A*G*C-G*A*G*C-G*T*T*T*T*G*A*C“G*T*T*T*T*T*T*T (SEQ ID NO:240) ; — G*T*T*T*T*G*A*C—G*T*T*T*T*T*T*T (SEQ ID NO:241) ; A*^*g*C“G*T*G*C“G*T*T*T*T*G*A*C“G*T*T*T*T*T*T*T (SEC ID NO:242); p k p * * Q _ Q * p * Q * Q _ Q * p * rp * rp * rp * g * * Q _ Q * p * rp * rp * rp * rp * rp * rp (SEQ ID NO:243) ; - 85(SEQ ID NO:244); QPCQnn / zznz / E / YiAi ^t*g*c-g*p*a*c-g*t*t*t*t*g*a*c-g*t*t*t*t*t*t*t (SEC ID NO:245); p*p*Q*Q_ Q*p*Q*Q_J^*p*p*p*p±Q*J^*Q_Q*p*p*p*p*p*p*p (SEQ ID NO:246 ); rp*T*Q*Q_Q*g2*Q*c_Q*^*T*rr*T*G*A*C — G*T*T*T*T*T*T*T (SEQ ID NO:247); T*T*G*C-G*C*G*C-G*T*T*T*T*G*A*C-G*T*T*T*T*T*T*T (SEQ ID NO:248); + 2 + Q + (j _ q + q + p _ (j + (j + ψ + + ψ + q+99 + (j — g*t*T*T*T*T*T*T (SEQ ID NO:249); 24:0 + (2+(2-(2*Τ*(2*Ο — G*T*T*T*C*G*A*C — G*T*T*T*T*T*T* T (SEQ ID NO:250); T*C*G*T*C-G*A*A*C*G*T*T*C-G*G*C*G*C*T*G*C*G*C*C*G (SEQ ID NO: 2. 3. 4); T*c*G*T*C-G*A*A*C*G*T*T*C-G*G*C-G*C*T*G*C*G*C*C*G (SEQ ID NO:234) ; T*C*G*T*C-G*A*A*C*G*T*T*C-G*G*C*G*C*T*G*C-G*C*C*G (SEQ ID NO:234) ; T*C*G*T*C*G*A*A*C-G*T*T*C*G*G*C-G*C*T*G*C*G*C*C*G (SEQ ID NO: 2. 3. 4); T*C*G*T*C-G*G*A*C*G*T*T*C-G*G*C*G*C*T*G*C*G*C*C*G (SEQ ID NO: 251); T*C*G*C*G*A*C-G*T*T*C*G*T*T*G*C-G*C*G*C*G*C*C*G (SEQ ID NO:235) ; — q*^*C*G*T*T*C — G*T*T*G*C — G*C*G*C*G*C*C*G (SEO ID NO:252); T*Q-Q*C*Q*^*C*g*]j*T*C-G*T*T*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:235); T*C*G*C*G*A*C-G*T*T*T*T*G*C*G*C-G*C*G*C (SEQ ID NO:253); T*C*G*C*G*A*C-G*T*C*G*T*T*G*C-G*C*G*C*G*C*C*G (SEQ ID NO:254); T*C*G*C*G*A*C-G*T*T*C*G*A*A*G*C-G*C*G*C*G*C*C*G (SEQ ID NO:255) ; T*C*G*C*G*A*C-G*A*A*C*G*T*T*G*C-G*C*G*C*G*C*C*G (SEQ ID NO:256) ; T-C-G-A-C-G-T-C-G-T-D-D-D-D-T-C-G-A-C-G-T-C-G-T-DD-D (SEQ ID NO:257); ^*Q*Q*T*C*Q*T*T*A*G*C*T*C*G*T*T*A*G*C*T*C*G*T*T (SEC ID NO:258); T*C*G*T*C*G*T*T*A*C*G*T*A*A*T*T*A*C*G*T*C*G*T*T (SEC ID NO:259); T*C*G*T*C*G*T*T*A*C*G*T*C*G*T*T*A*C*G*T*A*A*T*T (SEC ID NO:260); T*C*G*T*C*G*T*T*A*C*G*T*A*A*T*T*A*C*G*T*A*A*T*T (SEC ID NO:261); T*C*G*A*C*G*T*C*G-A-C*G*T*G*A*C*G*G*G (SEQ ID NO:262); QPCQnn / zznz / E / YiAi (T-C-G-A-C-G-T-C-G-T-T-)2dob-but; - 87(T-C-G-A-C-G-T-C-G-T-T-)2dob-col; (T-C-G-A-C-G-T-C-G-T-T-T-)2dob~col; T-C-G-A-C-G-T-C-G-T-T-T-col-T-T-C-G-A-C-G-T-C-G-TT-but; T*C*G*C-G*A*C*G*T*T*C-G*G*C*G*C-G*C*T*G*C*C*G (SEQ ID NO:263); T*c*G*C-G*A*C*G*T*T*C-G*G*C*G*C-G*T*C*G*C*C*G (SEQ ID NO:264); T*C*G*C-G*A*C*G*T*T*C-G*G*C*G*G*C-T*C*G*C*C*G (SEQ ID NO:265); T*C*G*C*G-A*C*G*T*T*C-G*G*C*G*C-G*T*C*G*C*C*G (SEQ ID NO:264); T*C*G*C*G-A*C*G*T*T*C-G*G*C*G*G*C-T*C*G*C*C*G (SEQ ID NO:265); T*C*G-C*G*A*C*G*T*T*C-G*G*C*G*C-G*T*C*G*C*C*G (SEQ ID NO:264); T*C*G-C*G*A*C*G*T*T*C-G*G*C*G*G*C-T*C*G*C*C*G (SEQ ID NO:2 65); (T-C-G-A-C-G-T-C-G-T-) (vitE-) (SEQ ID NO:266); T*C-G*A*C-G*T*C-G*A*C*G*T*G*A*C*G*G*G (SEQ ID NO:262); T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*G*G (SEC ID NO:262); T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*C (SEC ID QPCQnn / zznz / E / YiAi NO:267); - 88T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G (SEQ ID NO:268); (T-C-G-A-C-G-T-C-G-A-)(vitE-) (SEQ ID NO:269); T*C*G*T*C*G*T*T*A*C*G*T*A*A*C*T*A*C*G*T*C*G*T*T QPCQnn / zznz / E / YiAi (SEQ ID NO:270); T*C*G*T*C*G*T*T*A*C*G*T*A*A*C*G*A*C*G*T*C*G*T*T (SEC ID NO:550); T*C*G*T*C*G*T*T*A*C*G*T*A*A*C*G*A*C*G*A*C*G*T*T (SEC ID NO:271); T*C*G*T*C*G*T*T*A*G*C*T*A*A*T*T*A*G*C*T*C*G*T*T (SEC ID NO:272); T*C*G*T*C*G*T*T*A*C*G*T*A*A*T*T*A*G*C*T*C*G*T*T (SEC ID NO:273); C*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T (SEC ID NO:2 7 4); Q*Q*Q*A*T*g*A*Q*g*T*T*Q*Q*T*Q*A*C*G*T*T (SEC ID NO:275); A*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T (SEC ID NO:2 7 6) ; rp*G*G*A*rJ*G*A*G*G*rp*rp*G*Q*rp*G*A*G*G*rJ*rp (SEC ID Γρ*Γρ*ψ*Α*Γρ*ρ*Α*0*(2*ψ*Γρ*0*(2*Γρ*ζ2*Α*(2*(2*Γρ*Γρ (SEC ID NO:278); T*A*A*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T (SEC ID NO:2 7 9); G*G*A*T*G*A*G*G*T*T*G*G*T*G*A*G*G*T*T(SEC ID - SONO^ 80) ; C * * T * Q * A * Q * Q * T * rp * Q * Q * rp * g * A * C * g*p*T(SEC ID NO:281); A*T*G*A*G*G*T*T*G*G*T*G*A*C*G*T*T(SEG IDNO:282); T*G*A*C*G*T*T*C*G*T*G*A*C*G*T*T(SEQ IDnq:283); T-C-G-A-C-G-T-C-G-A-D-D-D-D-T-C-G-A-C-G-T-C-G-Acol (SEQ ID NO:284); teg-iA-iG-iC-iT-iG-iC-iA-iG-iC-iT-D-D-D-D-T-C-G-AC-G-A-col (SEQ ID NO:285); T*C-G*C-G*A*C-G*T*T*C-G*G*G*C-G*C-G*C*C-G (SEQ ID NO:286); T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:2 8 7); QecQnn / zznz / E / YiAi T*C-G*G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:288); T*C-G*G*A*C-G*T*T*C-G*G*C*G*C*G*C*C*G (SEQ ID NO:2 8 9) ; T*C-G*C-G*A*C-G*T*T*C-G*G*C*G*C*G*C*C*G (SEQ ID NO:290); T*C-G*C-G*AC-G*T*T*C-G*C-G*C-G*C-G*C-G (SEQ ID NO:225); T*C-G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:291); T*C-G*A*C-G*T*T*C-G*G*C*G*C*G*C*C*G (SEC ID NO:292); T*C-G*C-G*A*C-G*T*T*C-G*G*C*G*C*C*G (SEQ ID NO:293); T*C-G*C-G*A*C-G*T*T*C-G*G*C*C*G (SEQ ID NO:294); T*C-G*A*C-G*T*T*C-G*G*C*G*C*C*G (SEQ ID NO:295); T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G-G*G*C*C*G (SEQ ID NO:296); T*C-G*T*C-G*A*C-G*T*T*C-G*G*G*C-G*C*C*G (SEQ ID NO:297); T*C-G*A*C-G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:2 9 8 ) ; T*C-G*A*C-G*T*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:299); T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*G*C*G-C*G*C*C*G (SEQ ID NO:10 9); T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:I09); T*C-G*T*C-G*A*C-G*T*T*C-G*C*C*G*C-G*C*G*G*C*G (SEQ ID NO:300); T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G*C*C-G*T*G*C*C*G (SEQ ID NO:301); T*C-G*T*C-G*A*C-G*T*T*C-G*A*C*T*C-G*A*G*T*C*G (SEQ ID NO:3 0 2) ; T*C-G*T*C-G*T*T*A*C-G*T*A*A*C-G*A*C*G*A*C-G*T*T (SEQ ID NO:271); QPCQnn / zznz / E / YiAiT*C*G*T*C-G*T*T*A*C-G*T*A*A*C-G*A*C*G*A*C*G*T*T - 91(SEQ ID NO:271); T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*T(SEQ ID NO:303); T*C*G*T*C*G*A*C*G*T*T*C*G*G*C*G*C*G*C*C*G (SEQ ID NO:304); T*C*G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO: 10 9) ; A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-DD-D-irU (SEQ ID NO:305); T*C-G*T*C-G*A*C-G*A*T*C-G*G*G*C*G*C*C-G*T*G*C*C*G (SEQ ID NO:306); T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G (SEQ ID NO:307); T*C-G*T*C-G*A*C-G*A*C-G*G*C*G*C*C-G*T*G*C*C*G (SEQ ID NO:308); T*C*G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*C*G*T*G*C*C*G (SEC ID NO:307); T*C*G*T*C-G*A*C-G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G (SEQ ID NO:307); T*C*G*T*C-G*A*C*G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G (SEQ ID NO:307); T*C*G*T*C*G*A*C*G*A-T-C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO:307) ; T*C*G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G (SEC QPCQnn / zznz / E / YiAi ID NO:10 9) ; - 9220 T*C*G*T*C-G*A*C*G*A*T*C-G*G*C*G*C-G*C*G*C*C*G (SEC ID NO:109); T*C*G*T*C*G*A*C*G*A-T-C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO:10 9); T*C*G*A*C*G*T*C*G-A-c*G*T*G*A*C*G*T*T (SEQ ID NO:303); T*C*G*A*C-G*T*C*G*A*C-G*T*G*A*C*G*T*T (SEQ ID NO:303); T*C*G*A*C-G*T*C*G*A*C*G*TG*A*C*G*T*T (SEQ ID NO:303); T*C*G*T*C-G*A*C*G*A*C-G*T*G*T*C*G*A*T (SEQ ID NO:3 0 9) ; T*C*G*A*C*G~T*C*G*A*C*G”T*G*A*C*G*T*T (SEQ ID NO:303); (SEC ID NO:303); T*C*G*T*C*G*A-C*G*A*T*C*G*G*C*G-C*C*G*T*G*C*C*G (SEQ ID NO:307) ; T*C*G*T*C*G*A-C*G*A*C*G*G*C*G*C-C*G*T*G*C*C*G*T (SEQ ID NO:310) ; T*C*G*T*C*G*A*C-G*A*C*G*G*C*G*C*C-G*T*G*C*C*G*T (SEQ ID NO:310) ; T*C*G*T*C-G*A*C-G*A*T*C-G*G*C*G*G*C-G*T*G*C*C*G*T (SEQ ID NO:311); T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G*C*C-G*T*G*C*C*G*T QPCQnn / zznz / E / YiAi - 93(SEQ ID NO:312); rp*Q_Q*rp*Q_Q*2^*G — G*T*C—G*G*C*G*C*C*—G*T*G*C*C*G*T QecQnn / zznz / E / YiAi (SEQ ID NO:313); T*C-G*T*C-G*A*C-G*C-G*G*C*G*C*C-G*T*G*C*C*G*T (SEC ID NO:314); T*C*G*T*C*G*A-C*G*C*G*G*C*G-C*C*G*T*G*C*C*G*T (SEC ID NO:314); T*C*G*T*C-G*A*C*G*A-A*G*T*C-G*A*C*G*A*T (SEC ID NO:315); T*C*G*T*C-G*A*C*G*A*G*A-A*T*C*G*T*C-G*A*C*G*A*T (SEQ ID NO:316); T*C*G*T*C-G*T*A*C-G*G*C*G*C*C-G*T*G*C*C*G*T (SEC ID NO:317); T*C*G*T*C*G*A*C-G*A*T*C*G*G*C-G*C*C*G*T*G*C*C*G (SEQ ID NO:307) ; T*C*G*T*C*G*A-C*G*A*T*C*G*G*C*G-C*C*G*T*G*C*C*G (SEQ ID NO:307) ; T*C*G*T*C*G*A-C*G*A*T*C*G-G*C*G*C-C*G*T*G*C*C*G (SEQ ID NO:307); T*C*G*T*C*G*A-C*G*A*C*G*G*C*G*C-C*G*T*G*C*C*G*T (SEQ ID NO:310) ; T*C*G*T*C-G*A*C-G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G*T (SEQ ID NO:318); T*C*G*T*C*G*A-C*G*A*T*C*G*G*C*G-C*C*G*T*G*C*C*G*T (SEQ ID NO: 318); - 94T*C*G*T*C*G*A*C-G*A*C*G*G*C*G*C-C*G*T*G*C*C*G*T (SEQ ID NO:310 ); T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G*C*C-G*T*G*C*C*G*T (SEQ ID NO:312); T*C-G*T*C-G*A*C-G*T*C-G*G*C*G*C*C-G*T*G*C*C*G*T (SEQ ID NO:313); T*c*G*T*C-G*A*C*G*A-A*G*T*C-G*A*C*G*A*T (SEQ ID NO:315); T*C*G*T*C-G*A*C*G*A*G*A-A*T*C*G*T*C-G*A*C*G*A*T (SEQ ID NO:316); T*C*G*T*C — G*A*C*G*A*C . G*T*G*T*C*G*A*T (SEC ID NO:319) ; T*C*G*A*C-G*T*C*G*A-A*G*A*C-G*T*C*G*A*T (SEQ ID NO:320); — —— G*T*C*G*A*T (SEQ ID NO:321); T*C*G*T*C-G*A*C-G*A*C*G*G*C*G-A*A*G*C*C*G (SEQ ID NO:3 2 2 ) ; T*C*G*T*C-G*A*C-G*A*C*G*G*C*G-A*A*G*C*C*G*T (SEQ ID NO:323); T*C*G*T*C*G-A*C*G*A*C*G-T*G*T*C*G*A*T (SEC ID NO:3 0 9) ; T*C*G*T*C*G*A*C*G*A*C*G*T*G*T*C*G*A*T (SEC ID NO:3 0 9); QecQnn / zznz / E / YiAi T*C*G*A*C-G*T*C*G*A*C-G*T*G*A*C*G-T*T*G*T (SEC ID - 95ΝΟ:324); T*C<G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G-but (SEQ ID NO:325); T*C-G*T*C<G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G-but (SEQ ID NO:325); T*C-G*T*C-G*A*C*G*A*T*C-G*G*C*G*C-G*C*G*C*C*C*G-iT (SEQ ID NO:327); iT-T*C-G*T*C-G*A*C*G*A*T*C-G*G*C*G*CG*C*G*C*C*C*G-iT (SEQ ID NO:328) ; T*C-G*T*C-G*A*C-G*A*T*C-G*A*C*G*C-G*C*G*T*C*G (SEQ ID NO:329); T*C-G*T*C-G*A*C-G*A*T*C-A*A*C*G*C-G*C*G*T*T*G (SEQ ID NO:330); T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*A*C-G*T*G*C*C*G (SEQ ID NO:331); T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*A*T-A*T*G*C*C*G (SEQ ID NO:332); T*C-G*T*C-G*A*C-G*A*T*G-C*C*G*C*G-C*G*C*G*G*C (SEQ ID NO:333); T*C*G*T*C*G*A*C*G*A*T*G*C*C*G*C*G*C*G*C*G*G*C (SEQ ID NO: 333); T*C-G*T*C*G*A*C*G*A*T*G*C*C*G*C*G*C*G*C*G*G*C (SEQ ID NO:333) ; T*C*G*T*C-G*A*C*G*A*T*G*C*C*G*C*G*C*G*C*G*G*C (SEQ ID NO:333) ; QecQnn / zznz / E / YiAi - 96Τ * C-g*T*C*G*A*C*G*A*T*G*C*C*G*C*G*C*T*G*C*G*G*C (SEQ ID NO :334); rp*Q_G*'J'*Q*G*'J'*A*G*G*A*'J'*G*G*G*G*G*G*Q*G*G*G*G* G(SEQ ID NO:335); T*C-G*T*C*G*T*A*C*G*A*T*G*C*C*G*C*G*C*T*G*C*G*G*C (SEC ID NO:336); T*C*G*T*C*G*A*C*G*A*T-G*C*C*G*C*G*C*G*C*G*G*C (SEQ ID NO:333) ; T*C*G*T*C*G*A*C*G*A*T-G-C*C*G*C*G*C*G*C*G*G*C (SEQ ID NO:333); t*c*g*t*c-g*a*c*g*a*t*c*g*g*c*g*c*g*c*g*c*c*g-item (SEQ ID NO: 337); T*C-G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G-iT (SEQ ID NO: 337); ^0^0 / 0^0-^0^^00^0^20^0-0^0^0^0^0^0^0^0^0^0^0-111(SEQ ID NO:337 ); T*C-G*T*G-C*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:338); T*Z-G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:339); T*C-G*T*Z-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:340); T*C-G*T*C-G*A*Z-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G (SEQ ID NO:341); T*C-G*T*C-G*A*C-G*A*T*Z-G*G*C*G*C-G*C*G*C*C*G (SEC QecQnn / zznz / E / YiAi - 97ID NO:342); T*C-G*A*C*G*T*C~G*A*C*G*T*C-G*A*C*G (SEQ ID NO:343); T-C-G-A-C-G-T-C-G-A-C-G-T-C-G-A-C-G (SEC ID NO:343); T*C*G*A*C*G*T*C*G*A*C*G*T*C*G*A*C*G (SEC ID NO:343); T*C-G*T*C*G*A*C*G*T*T*C*G*G*C*G*C*C*G*T*G*C*C*G-iT (SEC ID NO:344); T*C*G*T*C-G*A*C*G*T*T*C*G*G*C*G*C*C*G*T*G*C*C*G-iT (SEC ID NO:344); T*C*G*T*C*G*A*C*G*T*T-C-G*G*C*G*C*C*G*T*G*C*C*G-iT (SEQ ID NO: 344); G*C*C*G*C*G-C*G*C*G*G-C*iT*iA*iG-iC*iA*iGiC*iT*iG-iC*iT (SEQ ID NO:345); C*G*G*C*G*C-G*C*G*C*C-G*iT*iA*iG-iC*iA*iGiC*iT*iG-iC*iT (SEQ ID NO:346); G*C*C*G*C*G*C*G*C*G*G*C*iT*iA*iG*iC*iA*iGiC*iT*iG*iC*iT (SEQ ID NO:345) ; C*G*G*C*G*C*G*C*G*C*C*G*iT*iA*iG*iC*iA*iGiC*iT*iG*iC*iT (SEQ ID NO:346) ; C*G*G*C*G*C*C-G*T*G*C*C*G*iT*iT*iG*iC*iA*iGiC*iT*iG*iC*iT (SEQ ID NO:347) ; G*C*C*G*T*G-C*C*G*C*G*G-C*iT*iT*iG*iC*iA*iGQPCQnn / zznz / E / YiAi iC*iT*iG*iC*iT (SEC ID NO:348); - 98C*G*G*C*G*C*C*G*T*G*C*C*G*iT*iT*iG*iC*iA*iGiC*iT*iG*iC*iT (SEC ID NO :347); G*C*C*G*T*G*C*C*G*C*G*G*C*iT*iT*iG*iC*iA*iGiC*iT*iG*iC*iT (SEQ ID NO: 348); T*C*G*G*C*G*C-G*C*G*C*C-G*A*iT*iA*iG-iC*iA*iGiC*iT*iG-iC*iT (SEQ ID NO:349) ; T*C*G*G*C*G*C*G*C*G*C*C*G*A*iT*iA*iG*iC*iA*iGiC*iT*iG*iC*iT (SEC ID NO:349); T*C*G*G*C*G*C*C-G*T*G*C*C*G*iT*iT*iG*iC*iA*iG-iC*i T*iG*iC*i T (SEQ ID NO:350); T*C*G*G*C*G*C*C*G*T*G*C*C*G*iT*iT*iG*iC*iA*iGiC*iT*iG*iC*iT (SEC ID NO:350); CGGCGCXGCGCCG (SEQ ID NO:351); T-C _ G*T*C G*A*C _ G*T*T*C G*G*C*G*C G*C*G*C*C*G (SEQ ID NO:287); T*C*G*T*C*G*A*C*G*A*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO:352) ; T*C*G*T*C*G*A*C*G*A*J*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO: 353); T*C*G*T*C*G*A*C*G*A*L*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO: 354); T*C*G*T*C*G*A*C*G*A*D*C*G*G*C*G*C*G*C*G*C*C*G (SEC QPCQnn / zznz / E / YiAi _99ID NO:355); G*G*G-G-A-C-G-A-C-G-T-C-G-T-G-G*G*G*G*G*G (SEQ ID NO: 7 9) ; T*C-G-A-C-G-T-C-G-T-G-G*G*G*G (SEQ ID NO:356); T*C*C*A*G*G*A*C*T*T*C*T*C*T*C*A (SEQ ID NO:357); T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO:83) ; T*C*G*T*CmG*mA*C*mG*mA*T*C*mG*mG*C*mG*C*mG*C*mG*C*C*mG (SEQ ID NO:358) ; T*C*mG*T*C*mG*mA*C*mG*mA*T*C*mG*mG*C*mG*C*mG*C*mG*C*C*m G (SEQ ID NO :359); T*C*G*T*C-mG*mA*C-mG*mA*T*C-mG*mG*C*mG*CmG*C*mG*C*C*mG (SEQ ID NO:358) ; and T*C-mG*T*C-mG*mA*C-mG*mA*T*C-mG*mG*C*mG*CmG*C*mG*C*C*mG (SEQ ID NO:359 ), where: - represents a phosphodiester bond; * represents a stabilized internucleotide bond; biot represents biotin; but represents butyrate; cabbage represents cholesterol; Cy3 represents bis-hydroxypropyl-3,3,3',3''-tetramethyl-4,5benzindocarbocyanine chloride (Glen Research); D represents a spacer D (1'2'-dideoxyribose, Glen Reseach, Sterling, VA); dig represents digoxigenin; dob- represents duplicator; iN represents reverse nucleotide (orientation QecQnn / zznz / E / YiAi reverse: 3' and 5' switched); J represents 1,3-propanediol; l - 100 represents hexaethylene glycol; mN represents 2'-0QPCQnn / zznz / E / YiAi methylnucleoside; rN represents ribonucleoside; teg represents triethylene glycol; vitE represents vitamin E; and Z represents 5-methyl-deoxycytidine. Another newly discovered class of CpG ODN is class E, in which halogen-modified nucleotides are placed immediately 5' to the CpG motif as described in U.S. Pat. 8,580,268 and in the published application US 2014 / 0163213 the full content of both of which are incorporated herein by reference. This ODN also includes much higher levels of type I IFN in addition to the modest production of IL-10. Examples of class E ODN include: rp * Q * p p * Q _ Q * ψ * rp * ψ * ’J1* rp * rp * rp * ψ * rp * rp * 'p * rp * >p -A· rp * ψ (SEC ID NO:360); (SEC ID NO:361); rp-A-Q-A-pp-A-Q — Q-A-pp-A-'p'Ar'p'-Á-rpA-'p-A-'p-A-'p'-Á-'p-A-'p-A-'p-Á-rpA -rp-A'p'-A-p'-A-'p (SEC ID NO:362); (SEC ID NO:363); ^-A-Q-^^TAQ — Pp-A-rp-A'rp-^'p-A-'pA-'p'A-'J'Ar'p'-A-'p-A-'p-^rp-Á -'p'A-'p'Ar'pAr'p'-A-'p1(SEC ID NO:364); T * F F * C -G*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEC ID NO:3 65) ; - 101- pAgApAQ—gApAppApApApApApApApApApApApApAp (SEQ ID NO:3 6 6) ; pAgAgUA-g — gApApApApA-pApApApApApApA-pA-pApAp (SEQ ID NO:367); pAgApAQ — gAg^jApApApApApApApApApApApApApAp (SEQ ID NO:368); P*G*BU*C-g*BU*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEQ ID NO:369); p*g*£u*Q-G*T*T*T*T*T*T*T*T*T*rr*rr*T*fIl*T (SEQ ID NO:3 7 0 ) ; p*g*p*Q_gA-[2^ApApAp*p*p*pAp*pAp*pAp*p*pAp (SEQ ID NO:3 71) ; pAgA^u^Q— Q* *p*pAp*pApAp*p*p*pAp*pAp*p*p (SEQ ID NO:372); pA-gA^jArQ — gApApApApApArpApApApApApApA-pApAp (SEQ ID NO:373); pAgApArQ_gA]jApApApApArpApApApApApApArpApAp (SEQ ID NO:3 7 4 ) ; pAgAjjAQ_gAyApApApApApApApApApApApApAp (SEQ ID NO:375); 22^AgA-gA-pAQAgApApApA-pApAQAgAgApAgA-gA-pApApA T (SEQ ID NO:3 7 6) ; p*C*g*ru*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T* T (SEC ID NO:3 7 7 ) ; T*c*G*T*c*G*T*T*T*T*T*c*G*G*ru*c*G*T*T*T*T(SEC ID QPCQnn / zznz / E / YiAi 102ΝΟ:3 7 8) ; (SEC ID ID NO:379) (SEC NO:380) QPCQnn / zznz / E / YiAi T*C*G*T*C*G*T*T*T*T*T*C*G*G*ru*C*G*JU *T*T*T (SEC ID NO:381) ru*C-G*T*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G ( SEQ ID NO:382); T*C*G*ru*C-g*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO: 383); ψ*β*ψ*ς_β*2Ρ*ψ*^*ψ*ψ·*·^*'ρ*Τ*Τ*Τ*Τ*Τ*Τ*Τ*Τ (SEC ID NO:384); p^Q^JTU^C — Q^JTy^p^p^'p / Arp^p^p^p^p^'p^'p / Arp'A-p^p^p (SEC ID NO:385); ru*C-G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO:3 8 6); T*C*G*ru*C-G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO:387); ru*C-G*JÜ*C*G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO:3 8 8); ru*C-G-A-C-G-T-C-G-T-G-G*G*G*G T*C-G-A-C-G-ru-C-G-T-G-G*G*G*G T*C-G-A-C-G-ru-C-G-ru-G-G*G*G*G G*JU*C-G*T*T; (SEQ ID NO:389); (SEQ ID NO:390); (SEQ ID NO:391); - 103NO:392); NO:393); G*ru*C-G*ru*T; ^*0*g0*0_Q*fp*r^*T*I*T*T*T*T*T*T±T*T*I*T*T (SEC ID (SEC ID ru * C-G *JU * C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO:394); T*C-G*JU*C*G*JU*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO: 395); ψ 'Λ ( j :*- ψ 'Λ- ψ '·* 'JJ ψ ψ ψ Q J | J + f J — Q ψ ψ ψ Χ ψ ψ '.* ψ * (SEC ID NO:396); T*C*T*T*T*T*T*T*G*JU *C~G*£u*t*t*T*T*T*T*T*T*T (SEC ID NO:397); 2-'U*0*'J1-A-rp^rrp^T*T^T*G*T*C—G^T^T^T^T^T^T^T^T^T^T ( SEC ID NO:398); (SEC QPCQnn / zznz / E / YiAi ID NO:3 9 8) ; 0^0^0^0-^0^0^0^0^0^0^0-0^0^0^0^0^0^0^0^0^0^01(SEC ID NO:399); ru*C-G*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO:400) ; ru*C*G*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO: 400); ru*C-G*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G*T (SEQ ID NO: 401); - 104ru*C*Q*A*Q*g*T*C*Q*A*T*C*G*G*C*G*C*G*C*G*C*C*G*T (SEC ID EU*C-G*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO:4 02); QPCQnn / zznz / E / YiAi EU*C*G*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO:402); ru*C-G*T*C*G*A*C*G*A*T*C*G*G*C*G*G*C*C*G*C*C*G*T (SEC ID NO:4 0 3); £u*Q*g*T*Q*g*^*Q*g*^*]i*C*G*G*C*G*G*C*C*G*C*C*G*T ( SEC ID NO:403); EU*C-G*T*C*G*A*C*G*A*T*C*G*G*C*G*G*C*C*G*C*C*G (SEC ID NO:4 0 4); ru*C-G*T*C*G*A*C*G*A*T*C*G*G*C*G*G*C*C*G*C*C*G (SEC ID NO:405); ’p^Q-A-'p-ArQ — G*FU*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEC ID NO:406); (SEC ID (SEC ID NO:408); rp^G^T^G-6nb*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEC ID t*g*t*6nb-g*t*t*t*t*t*t*t*t*t*t*t*t*t*t*t (SEC ID NO:410); (SEC ID - IOSΒΓΓοηη / ζζηζ / Ε / γίΛΐ NO^ 10 ) ; (SEQ ID NO:411) ; — ^·*·τ*τ*τ*τ*τ*τ*τ*τ*τ*τ*τ*τ*τ*τ*τ (SEQ ID 5 NO:412); rp t( Q * ψ * Q _ Q t( ψ t( J and τ( ψ τ( ψ * ψ * rp -¼ rp * rp t( p t( ± 'J' * ψ ★ rp ★ rp * rp (SEC ID NO:413); NO:415); -p^g^'p'*Q_g*pi,p*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEC ID (SEQ ID NO:416) ; ^7(07(007(0-0:(^^-^7(^7(^7(^7(^7(^7(^^-^7(^7( ^7(^7(^7(^7(^ (SEQ ID 15 NO:392); P'(07(lJ|-((2_07(Qy7(p7(p7(rp7(p7(p7(p7(lp7( p7(p*p7(p7(lJl*p7(p (SEQ ID NO:417 ) ; T*G*CU*C-G*CU*T*T*T*T*T*T*T*T*T*T *T*T*T*T (SEQ ID NO:418); 20 NO:419) ; T*ru*C-G*T*T*T*T*T*T*T*T*T*T*T* T*T*T*T*T (SEC ID T*G*ru*C-G*T*T*T*T· T*G*ru*C-G*T*T*T*T*G*T*C-G* T*T (SEQ ID NO: 420) ; (T*G*JÜ*C-G*T*T*L*)2dob-3mG; 25 (ru*C*G*T*T*C*G*L*) 2dob-3mG; - 106rp * Τ * JJJ* Q_Q*rp*Q_Q*lp*lJ'*rp*Q_Q*rp*(p_Q*lJ'*rp (SEC ID QecQnn / zznz / E / YiAi NO:4 21) ; BU*C-G-A-C-G-T-C-G-T-G-G-G*G*G (SEQ ID NO:422); c*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEC ID (T*G*JU*C-G*T*T*L*)2doub-teg; (ru*C*G*T*T*C*G*L*)2doub-teg; ru*C-G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO:424) T*c*G*ru*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO:425) T*C*G*T*C*G*T*T*T*rU*C-G*G*C*G*C*G*C*G*C*C*G (SEC ID NO:426) j21j*q*g*rp*Q*Q*rp*rp*ip*ij'*rp*Q*g*Q*j-1j*(p*(g*rp*p'*rp* rp (SEC ID NO:427) T*c*G*ru*C*G*T*T*T*T*T*C*G*G*ru*C*G*T*T*T*T (SEC ID NO:428) T*G*iu*C_g*T*T*T*T*T*T*T*T*T* G* JU* C—G* T * T (SEC ID NO:4 2 9) ; (SEC ID NO:430); ru*C-G-A-C-G-T-C-G-T-G-G*E*G*G (SEQ ID NO:431); T*mG * JU *C-G*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEC ID NO:432); (SEC ID - 107ΝΟ:433); Τ *mG*JU*C-mG*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEQ ID NO:434); ru*Q_Q*ru*Q*Q*rp*rp*rp*rp*rp*Q*Q*Q*ij>*Q*Q*rp*g-i*rp*rp (SEC ID NO:3 7 9 ) ; — G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T (SEC QecQnn / zznz / E / YiAi ID NO:37 9) ; (SEQ ID NO:435); p*g*p*C-G*PU*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEQ ID NO:436); BU*C-G-A-C-G-T-C-G-T-G-G-*G*G*G (SEC ID NO T*G*ru*C-G*T*T*T*T*C*G*G*C*G*C*G*C*G*C* C*G : 422) ; (SEQ ID NO:437); T*ru*C-G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T (SEQ ID NO:438); T*EU*C- G*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEQ ID NO:4 3 9) ; rp^Q^PU^Q — Q^rp^rp^rp^^iAr^^rp^rp-A-'p-Á-'p-^'p-Tk-'J'-A-'J'- A-rp-Á-rp-A-rp (SEQ ID NO:4 4 0); ^ / rQ-g^p / rQ^g^p^pip / cp + T^C^G^G^T^C^G*'!*'!*'!1*! (SEQ ID NO:3 7 6) ; EU * C — g*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T (SEC ID NO:441); G*JU*C-G*T*T-hex; - 108G*JU*C-G*ru*T-hex; G*EU*C-G*EU*T-hex; EU*C-G*T*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G QPCQnn / zznz / E / YiAi (SEQ ID NO:442); T*C*G*EU*C-G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G (SEQ ID NO: 443); EU*C-G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G (SEQ ID NO:444) ; (SEC ID ^^^Q^fji^rjn^rjn^rjn^rjn^rp^rp^iji^Q^Q^rp^-rp^-rp^rp^-g-i^-rp^-rp^-rp^-rp ^-'j-i (SEC ID NO:4 4 6) ; (SEC ID NO:4 4 7); 22^9rQ^JΊ:*r,^^,JΊ9f,J29¢,J29¢Γp9¢ψ^2j^*Q^(3^T^T^T^T:*rΓIΊ:*rΓIΊ^T1'*'T '*',IΊ:J'''T (SEC ID NO:448); r u* Q _ Q * rp * Q * Q * rp * rp * rp * Q * Q * rp * Q * Q * ψ * rp * rp * rp * Q * rp * Q * Q * fj * ψ (SEC ID NO:449); T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G* JU * C — G*T*T (SEC ID NO:450); ru*C-G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*ru*C-G*T*T (SEQ ID NO:451) ; Γρ^θ^^υ^Ο — E*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEC ID NO:452); (SEC ID - ICO10 NOS 53) ; ΝΟ:454); NOT :4 5 5 ) ; NO :456) (SEC (SEC (SEC (SEC (SEC (SEC (SEC ID ID ID ID ID ID ID _(3 * Τ * Τ * Τ * Τ * Τ * Τ * Τ * Τ * Τ * Τ * Τ * Τ * Τ * Τ * Τ 'p-A-QAr'J'^Q — Q-A-'p-A-rp -Á-^'jjTV'J'A-'J'-A'J'TA'pAr'p-Á-'p-Á-'pA-rpA-'J'Ar'jTA'pAr'p rp-A-Q-A -'J'-ArQ — Q-A-'J'-A-'J'-Á-'pA· jpj * ψ * rp rp 0 -A- rp -A- rp * 'J' * ψ * rp * rp * ψ (SEC (SEC (SEC ru*C-G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T NO:4 5 7) ; eu*c-g*t*c*g*t*t*t*t*c*g*g*c*g*c*g*c*g*c*c*g*t NO:458); T*C-G*EU*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T NO:459); τ * c—g*t*c*g*t*t*t*ju *c*g*q*c*g*c*g*c*g*c*c*g*t NO:460); Γρ*ρ_2*Γρ*0*β*Γρ*Γρ*Γρ*2υ*0*ρ*β*ρ*(2*(2*2*0*ρ*0*ρ*β*Γρ NO:461); eu * c—g*T*C*G*T*T*T*EU*C*G*G*C*G*C*G*C*G*C*C*G*T NO:462); NO:463); ID ID ID QPCQnn / zznz / E / YiAiru*Q_g*g[j*Q*g*ij'*ij*i]i*lp*Q*g*g*Q*g*Q*g*Q*g*Q*Q *g*'j' (SEC ID NO:464); 22^A·Q_Q·ArΓp·A·QA·Q7lfΓp7lc,p7lΓ,p·A·'J'*Q·A·Γp*C:ArG,lrT*T*T*T*G*T*C,lcG* T*T (SEQ ID NO:465); - lioEU*C-G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*C*G*T*T (SEC QecQnn / zznz / E / YiAi ID NO:4 6 6) ; T*G* BVU * C_G* T * T * T *T *T * T* T* T * T * T *T* T* T * T * T NO:467); Γρ^ο^^^ο — o* BVU *T*T*T*T*T*T*T*T*T*T*T*T*T*T (SEC ID (SEC ID NO:468); ru*C*G*G*C*G*G*C*C*G*C*C*G (SEQ ID NO:469); ru*C*G*T*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*3mG (SEC ID NO:470); EU*C*G*T*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*3mG (SEC ID NO:471); EU*C*G*EU*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*3mG (SEC IDNO:4 7 2) ; EU*CG*EU*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*3mG (SEQ ID NO:4 7 2) ; EU*C*G*T*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G*iT ( SEQ ID NO:473); ru*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*3mG (SEQ ID NO:474) ; EU*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*3mG (SEQ ID NO:475) ; - 111EU*C-G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*3mG (SEQ ID NO:475); EU*C*G*EU*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*3mG (SEQ ID NO:476) ; EU*C-G*EU*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*3mG (SEQ ID NO:476); EU*C*G*T*C*G*T*T*T*EU*C*G*G*C*G*C*G*C*G*C*C*3mG (SEQ ID NO:477) ; ru*C*G*T*C*G*T*T*T*JU*C*G*G*C*G*C*G*C*G*C*C*3mG (SEQ ID NO:478) ; EU*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*iT (SEQ ID NO: 479); (SEQ ID NO:480); EU*C*G*T*C*G*A*C*G*T*T*C*G*G*C*G*C*C*G*T*G*C*C*3mG (SEC ID NO:481); ru*C*G*T*C*G*A*C*G*T*T*C*G*G*C*G*C*C*G*T*G*C*C*3mG (SEC ID NO:482); ru*C*G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*3mG (SEQ ID NO: 483); EU*C*G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*3mG (SEQ ID NO: 484); QecQnn / zznz / E / YiAi eu*c*g*t*c*g*a*c*g*t*t*c*g*g*c*g*c*c*g*t*g*c *c*g*item (SEQ ID NO:485); - 112EU*C*G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G*iT QPCQnn / zznz / E / YiAi (SEQ ID NO:486); (SEC ID NO:4 8 7 ) ; T*G*NP*C_g*t*t*t*t*t*T*T*T*T*T*T*T*T*T*T (SEC ID NO:488); (SEC ID NO:4 8 9) ; EU*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T (SEC ID NO:4 41) ; ru*C*G*T*C*G*A*C*G*A*T*G*G*C*G*G*C*G*C*C*G*C*C (SEQID NO:490 ); EU*C*G*T*C*G*A*C*G*A*T*G*G*C*G*G*C*G*C*C*G*C*C (SEQ ID NO: 491); rp * ·ρ * C—q*t*t*t*T*C*G*G*C*G*C*G*C*G*C*C*G*T (SEC ID NO:492); T*EU*C-G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T (SEC ID NO:493); ru*C-G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T (SEC ID NO:494); ru*ru*C-G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T (SEC ID NO:4 95) ; T*ru*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T (SEC ID NO:438); EU*C*G*T*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G*T - 113(SEQ ID NO:496); T*EU*C+G*T*T^T*T *A*C*G*G*C*G*C*C*G+T*G*C+C*G*T (SEO ID NO: 497); T*ru*C*G*T*T*T*T*A*C*G*G*C*G*C*C*G*T*G*C*C*G*T (SEQ ID NO: 498); ru*C*G*T*C*G*T*T*T*T*rG*rU*rU*rG*rü*rG*rU (SEC ID QPCQnn / zznz / E / YiAi EU*C-G*T*C*G*A*C*G*A*T*C*G*G*C*G*G*C*C*G*C*C*G*T (SEQ ID NO: 500); eu*c*g*t*c*g*a*c*g*a*t*c*g*g*c*g*g*c*c*g*c*c*g*t (SEC ID NO:500); eu-c-g*a*c*g*t*c*g*a*t*c*g*g*c*g*c*g*c*g*c*c*g (SEQ ID NO:402) ; EU-C*G*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G (SEC ID NO: 402); t*g*u*c*g*t*t*t*t*t*t*t*t*t*t*t*t*t*t*t(SEC ID NO:) (SEQ ID NO:373); and (SEQ ID NO:374), where: - represents a phosphodiester internucleotide bond; 'represents a phosphorothioate internucleotide bond; 2doub represents duplicator 2 (Chemgenes); 3mG represents 3'-O-methyl-rG; 6NB represents 6-nitrobenzimidazole; BU represents 5-bromo-2'-deoxyuridine; BVU represents 5-(d-bromo-vinyl)-uridine; CU represents 5-chloro2'-deoxyuridine; E represents 7-desaza-dG; EU represents - 1145-ethyl-2'-deoxyuridine; F represents 5-fluoro-dU; FF represents 2,4-difluorotoluene; FT represents a,a,a-trifluoro-dT; FU represents 5-fluoro-dU; hex represents hexadecylglyceryl; I represents inosine; iT represents reverse nucleotide (switched 3' and 5'); JU represents 5-iodo-2'-deoxyuridine; L represents spacer 18 (hexaethylene glycol phosphate); NI represents nitroindole; NP represents nitripyrrole; PU represents 5-proynyl-dU; teg represents separator 9 (triethylene glycol phosphate); U represents uridine and Z represents 5-methyl-dC. Methods for reducing the amount of B cell activation with CpG ODN and increasing or maintaining the amount of IFN-α induction are not well known to those skilled in the art but without committing to a particular mechanism of action underlying the invention. , it has now been discovered in accordance with the invention that B cell proliferation and IL-10 secretion appears to require a more sustained TLR9 signal compared to that required to induce plasmacytoid dendritic cells (pDCs). English) to secrete IFN-α. This sustained TLR9 signal is provided by the class B CpG ODN to a greater extent than other classes of CpG ODN mentioned above. Furthermore, the signal duration of TLR9 can be shortened by placing phosphodiester (PO) bonds at the CpG (semi-soft designs) and or at other positions. QPCQnn / zznz / E / YiAi - 115within the ODN. The mildest CpG ODN with the least sustained B cell activation are those with all-phosphodiester backbones, but these are degraded in vivo so rapidly that the IFN-α response is also impaired unless the ODN is circular (to protect against exonucleases) or is derived in a formulation such as virus-like particles (VLPs), nanoparticles (NPs), immunostimulatory complexes (ISCOMs) or the like, which They also protect against nucleases. Immunostimulatory oligonucleotide molecules may have a homogeneous backbone (e.g., fully phosphodiester (PO) or fully phosphorothioate (PS)) or a chimeric backbone. An exception to this is the design of class A (and class A / E) CpG in which the central portion of the ODN includes at least 8 nucleotides and preferably 10 or more nucleotides must be phosphodiester for optimal activity. For the purposes of the present invention, a chimeric backbone refers to a partially stabilized backbone, where at least one internucleotide bond is phosphodiester or phosphodiester type, and where at least one other internucleotide bond is a stabilized internucleotide bond, where at least QPCQnn / zznz / E / YiAi - 116a phosphodiester or phosphodiester type bond and at least one stabilized bond are different. One or more of the preferentially stabilized bonds are placed at the 5' and 3' ends of the oligonucleotide in order to protect the ends from exonucleases: the phosphodiester bonds are placed in the middle part and contribute to inducing an IFN-α response strongest that can be easily obtained with only HP. Since borane phosphonate bonds have been reported to be stabilized relative to phosphodiester bonds, for purposes of the chimeric nature of the backbone, borane phosphonate bonds can be classified as either phosphodiester type or stabilized, depending on the context. For example, a chimeric backbone according to the present invention, in one embodiment, may include at least one phosphodiester bond (phosphodiester or phosphodiester type) and at least one boranephosphonate bond (stabilized). In another embodiment, a chimeric backbone according to the present invention may include boranephosphonate (phosphodiester or phosphodiester type) and phosphorothiate (stabilized) linkages. A stabilized internucleotide bond will mean an internucleotide bond that is relatively resistant to degradation in vivo (for example, by an exonuclease or endonuclease) compared to a QecQnn / zznz / E / YiAi - 117internucleotide phosphodiester. Preferred stabilized internucleotide bonds include, without limitation, phosphorothioate, phosphorodithioate, methylphosphonate and methylphosphorothioate. Other stabilized internucleotide bonds include, without limitation, peptide, alkyl, dephospho-type bonds and others as described above. Modified backbones such as phosphorothioates can be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistry. Aryl and alkyl phosphonates can be made, for example, as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen portion is alkylated), for example, as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574, can be prepared by automated solid phase synthesis using commercially available reagents. Methods have been described for making other DNA backbone modifications and substitutions. Uhlmann E et al. (1990) Chem Rev 90:544; Goodchild J (1990) Bioconjugate Chem 1:165. Methods for preparing chimeric oligonucleotides are also known. For example, the patents issued to Uhlmann et al. have described these techniques and include, for example, U.S. Pat. Nos. 7,566,703; QPCQnn / zznz / E / YiAi - 1187,795,235; 8,283,328 and 8,304,396. The modified ODN on the mixed backbone can be synthesized using a commercially available DNA synthesizer and standard phosphoramidite chemistry. F. E. Eckstein, Oligonucleotides and Analogues--A Practical Approach, IRL Press, Oxford, UK, 1991; and M. D. Matteucci and Μ. H. Caruthers, Tetrahedron Lett. 21, 719 (1980). After coupling, phosphorothioate (PS) bonds are introduced by sulfurization using Beaucage's reagent (R. P. lyer, W. Egan, J. B. Regan and S. L. Beaucage, J. Am. Chem. Soc. 112, 1253 (1999)) (0.075 M in acetonitrile) or phenylacetyl disulfide (PADS) followed by capping with acetic anhydride, 2,6-lutidine in tetrahydrofuran (1:1:8; v:v:v), and N-methylimidazole (16 % in tetrahydrofuran). This capping step is performed after the sulfurization reaction to minimize the formation of unwanted phosphodiester (PO) bonds at positions where a phosphorothioate bond must be located. In the case of the introduction of a phosphodiester bond, for example in a CpG dinucleotide, the phosphoro-III intermediate is oxidized by treatment with a solution of iodine in water / pyridine. After cleavage from the solid support and final deprotection by treatment with concentrated ammonia (15 h at 50°C), the ODN is analyzed by HPLC on a Gen-Pak Fax column (Millipore QecQnn / zznz / E / YiAi - 119Waters) using a NaCl gradient (e.g., buffer A; 10 mM NaH2PÜ4 in acetonitrile / water = l:4 / v:v, pH 6.8; buffer B: 10 mM NaH2PO4, 1.5 M NaCl in acetonitrile / water = l :4 / v:v; 5 to 60% B in 30 minutes at 1 ml / min) or by capillary gel electrophoresis. The ODN can be purified by HPLC or by FPLC on a Source High Performance column (Amersham Pharmacia). The HPLC homogeneous fractions are combined and the salt is removed by means of a C18 column or by ultrafiltration. The ODN is analyzed by MALDI-TOF mass spectrometry to confirm the calculated mass. The oligonucleotides of the invention may also include other modifications. These include nonionic DNA analogs such as alkyl and aryl phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiesters, and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain diol, such as tetraethylene glycol or hexaethylene glycol in either or both terminal parts, have also been shown to be substantially resistant to nuclease degradation. In some embodiments, the oligonucleotides may be soft or semisoft oligonucleotides. A soft oligonucleotide is an oligonucleotide QPCQnn / zznz / E / YiAi - 120immunostimulator having a partially stabilized main structure in which internucleotide phosphodiester or phosphodiester-type bonds occur only within and immediately adjacent to at least one internal pyrimidine-purine dinucleotide (YZ). Preferably YZ is YG, a pyrimidineguanosine (YG) dinucleotide. The at least one internal YZ dinucleotide itself has a phosphodiester or phosphodiester type internuleotide bond. A phosphodiester or phosphodiester-type internucleotide bond occurs immediately adjacent to at least one internal YZ dinucleotide and may be 5', 3', or both 5' and 3' to at least one internal YZ dinucleotide. In particular, phosphodiester or phosphodiester-type internucleotide bonds involve internal dinucleotides. An internal dinucleotide will generally mean any pair of adjacent nucleotides connected by an internucleotide bond in which none of the nucleotides in the nucleotide pair is a terminal nucleotide, that is, no nucleotide in the nucleotide pair is an end-defining nucleotide. 5' or 3' of the oligonucleotide. Thus, a linear oligonucleotide that is n nucleotides long has a total of n-1 dinucleotides and only n-3 dinucleotides. Internal QecQnn / zznz / E / YiAi. Each internucleotide bond in a dinucleotide - 121internal is an internal internucleotide bond. Thus, a linear oligonucleotide having a length of n nucleotides has a total of n-1 internucleotide bonds and only n-3 internal internucleotide bonds. Strategically placed phosphodiester or phosphodiester-type internucleotide bonds, therefore, refer to phosphodiester or phosphodiester-type internucleotide bonds placed between any pair of nucleotides in the oligonucleotide sequence. In some embodiments, phosphodiester or phosphodiester-type internucleotide bonds are not placed between any pair of nucleotides closest to the 5' or 3' end. Preferably, a phosphodiester or phosphodiester-type internucleotide bond that is immediately adjacent to at least one internal YZ dinucleotide itself is an internal internucleotide bond. Thus, for a Ni YZ N2 sequence, where Ni and N2 are each, independently of each other, any single nucleotide, the YZ dinucleotide has a phosphodiester or phosphodiester type internucleotide bond, and further: a phosphodiester or phosphodiester type internucleotide bond when Ni is an internal nucleotide; (b) Z and N2 are linked by a phosphodiester or phosphodiester-type internucleotide bond when N2 is an internal nucleotide, or (c) QPCQnn / zznz / E / YiAi - 122Ni and Y are joined by a phosphodiester or phosphodiester type internucleotide bond when Ni is an internal nucleotide and Z and N2 are joined by a phosphodiester or phosphodiester type internucleotide bond when N2 is an internal nucleotide. Soft oligonucleotides according to the present invention are considered to be relatively susceptible to nuclease cleavage compared to fully stabilized oligonucleotides. Without claiming to be bound by any particular theory or mechanism, the soft oligonucleotides of the invention are considered to be susceptible to cleavage resulting in fragments with reduced or no immunostimulatory activity relative to full-length soft oligonucleotides. The incorporation of at least one nuclease-sensitive internucleotide linker, particularly near the middle portion of the oligonucleotide, is considered to provide an off switch which alters the pharmacokinetics and pharmacodynamics of the oligonucleotide such that it reduces the duration of the maximal immunostimulatory activity of the oligonucleotide. oligonucleotide. In particular, nuclease-sensitive binding may reduce the magnitude of NF-κB induction while increasing the magnitude of IRF3 and / or IRF7 induction. Activation of TLR9 can lead to strong activation of either or both of the NF-κΒ pathway (leading to QPCQnn / zznz / E / YiAi - 123expression of cytosines such as the expression of IL-6 and costimulatory molecules) as well as the IRF3 / 7 pathways, which generates secretion of IFN-α. Generally there seems to be some antagonism between these pathways. For example, CpG class B ODN predominantly activates the former while CpG class A ODN activates the latter. Strong induction of NF-κΒ is associated with class B CpG oligonucleotides and may lead to increased secretion of IL-10. Although this may be useful for systemic treatment with CpG oligonucleotides it is not desirable for intratumoral treatment. The increased induction of IRF3 / 7 provided by the nuclease-sensitive internucleotide linker generates a large production of IFN-α in the tumor microenvironment which improves the chances of a productive and therapeutic antitumor immune response after intratumoral therapy without increasing the production of IL-10 undesirable. This reduces the half-life of CpG oligonucleotides containing nuclease-sensitive linkers which may be of particular value in tissues and in clinical applications in which it is desirable to avoid damage related to chronic local inflammation or immunostimulation, for example, the kidney, since oligonucleotides are less likely to accumulate in tissue at high concentrations. A semisoft oligonucleotide is an oligonucleotide QecQnn / zznz / E / YiAi - 124immunostimulator that has a partially stabilized main structure in which phosphodiestern or phosphodiester type internucleotide bonds occur only within at least one internal pyrimidine-purine dinucleotide (YZ). Semi-soft oligonucleotides generally possess increased immunostimulatory potency relative to the corresponding fully stabilized immunostimulatory oligonucleotides. Due to the greater potency of semisoft oligonucleotides, semisoft oligonucleotides can be used, in some cases, at lower effective concentrations and have lower effective doses compared to potential fully stabilized immunostimulatory oligonucleotides in order to obtain a desired biological effect. It is considered that the above properties of semisoft oligonucleotides in general are increased by increasing the dose of phosphodiester or phosphodiester type internucleotide bonds by improving the internal YZ dinucleotides. This is considered, for example, that generally for a given oligonucleotide sequence with four internal YZ dinucleotides, an oligonucleotide with four internal YZ phosphodiester or phosphodiester type internucleotide bonds is more stimulatory than an oligonucleotide with three YZ internucleotide bonds. QPCQnn / zznz / E / YiAi - 125 phosphodiester or internal phosphodiester type which in turn is more immunostimulatory than an oligonucleotide with two YZ phosphodiester or internal phosphodiester type internucleotide bonds, which in turn is more immunostimulatory than an oligonucleotide with one YZ phosphodiester or internal phosphodiester type internucleotide bond. Importantly, the inclusion or even an internal YZ phosphodiester or phosphodiester type internucleotide bond can often be advantageous over no YZ phosphodiester or internal phosphodiester type internucleotide bond. In addition to the number of phosphodiester or phosphodiester-type internucleotide bonds, the position along with the length of the oligonucleotide can also affect the potency. Soft and semi-soft oligonucleotides will generally include, in addition to phosphodiester or phosphodiester-type internucleotide linkages at preferred internal positions, 5' and 3' ends that are resistant to degradation. These degradation-resistant ends may involve any suitable modification that results in increased resistance against exonuclease digestion over the corresponding unmodified ends. For example, the 5' and 3' ends can be stabilized by the inclusion here of at least one phosphate modification of the backbone. In a QPCQnn / zznz / E / YiAi - 126preferred embodiment, at least one phosphate modification of the backbone at each end is independently a phosphorothioate, phosphorodithioate, methylphosphonate or methylphosphorothioate linkage. In another embodiment, the degradation-resistant end includes one or more nucleotide units connected by peptide or amide bonds at the 3' end. A phosphodiester internucleotide bond is the type of bond characteristic of oligonucleotides found in nature. The phosphodiester internucleotide bond includes a phosphorus atom flanked by two oxygen atoms that form a bridge and also joined by two additional oxygen atoms, one charged and the other uncharged. The phosphodiester internucleotide linkage is particularly preferred when it is important to reduce the tissue half-life of the oligonucleotide or to obtain the strongest possible induction of type I IFN secretion from pDC. A phosphodiester-like internucleotide bond is a phosphorus-containing bridging group that is chemically and / or diestereoisomerically similar to phosphodiester. Measures of phosphodiester similarity include susceptibility to nuclease digestion and ability to activate ribonuclease H. Thus, for example, phosphodiester oligonucleotides but not phosphorothioate oligonucleotides are susceptible to nuclease digestion while both - 127 oligonucleotides, phosphodiester and phosphorothioate activate ribonuclease H. In a preferred embodiment, the phosphodiester type internucleotide bond is a boranophosphate bond (or equivalently, boranephosphonate). U.S. Patent NO. 5,177,198; U.S. patent No. 5,859,231; U.S. patent No. 6,160,109; U.S. patent No. 6,207,819; Sergueev et al., (1998) J, Am Chem Soc 120: 9417-27. In another preferred embodiment, the phosphodiester-type internucleotide bond is diastereoisomerically pure phosphorothioate Rp. Diastereomerically pure Rp phosphorothioate is considered to be more susceptible to nuclease digestion and is better at ribonuclease H activation than diastereoisomerically pure Sp phosphorothioate. CpG oligonucleotide stereoisomers are the subject of published PCT application PTC / US99 / 17100 (WO 00 / 06588). It should be noted that for the purposes of the present invention, the term phosphodiester type internucleotide bond specifically excludes phosphorodithioate and methylphosphonate internucleotide bonds. As described above, the soft and semisoft oligonucleotides of the invention may have phosphodiester-type bonds between C and G. An example of a phosphodiester-type bond is a phosphorothioate bond in an Rp conformation. The p-chirality of the oligonucleotide can apparently have opposite effects on the - 128immune activity of a CpG oligonucleotide, depending on the point in time at which the activity is measured. Krieg et al., Oligonucleotides 2003 13(6): 491-499. At an early time point of 40 minutes, the Rp stereoisomer but not Sp stereoisomer of CpG phosphorothioate oligonucleotide induces phosphorylation of JNK in mouse spleen cell. In contrast, when analyzed at a later time point of 44 h, the Sp stereoisomer but not the Rp is active in stimulating spleen cell proliferation. This difference in the kinetics and bioactivity of the Rp and Sp stereoisomers does not result from any difference in cellular uptake, but rather is most likely due to two opposing biological roles of p-chirality. First, the enhanced activity of the Rp stereoisomer compared to Sp in stimulating immune cells at early time points indicates that Rp may be more effective in interacting with the CpG receptor, TLR9, or inducing downstream signaling pathways. Furthermore, the more rapid degradation of PS Rp oligonucleotides compared to Sp results in a much shorter duration of signaling such that PS Sp oligonucleotides appear to be more biologically active when tested at later time points likely due to a increased nuclease resistance of the Sp bond, which provides a more sustained signal through TLR9 to QPCQnn / zznz / E / YiAi - 129proliferation of B lymphocytes. In this way, oligonucleotides can be heterogeneous in their backbone composition to thus contain any possible combination of polymer units linked together. The term oligonucleotide also encompasses oligonucleotides with substitutions or modifications such as sugars. For example, they include oligonucleotides having backbone sugars that are covalently linked to low molecular weight organic groups other than the hydroxyl group at the 2' position and other than the phosphate group or hydroxy group at the 5' position. Oligonucleotides modified in this manner may include a 2'-O-alkylated ribose group. Additionally, modified oligonucleotides may include sugars such as arabinose or 2'-fluoroarabinose instead of ribose. The immunostimulatory oligonucleotides of the present invention can encompass various chemical modifications and substitutions, compared to natural RNA and DNA, involving a phosphodiester internucleotide bridge or a 13-D-ribose unit. Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann E et al. (1990) Chem Rev 90:543; Protocols for Oligonucleotides and Analogs Synthesis and Properties & Synthesis and Analytical QPCQnn / zznz / E / YiAi - 130Techniques, S. Agrawal, Ed, Humana Press, Totowa, USA 1993; Crooke S T et al. (1996) Annu Rev Pharmacol Toxicol 36: 107129 and Hunziker J et al. (1995) MOd Synth Methods 7: 331417. An oligonucleotide according to the invention may have one or more modifications, where each modification is located on a particular phosphodiester internucleotide bridge and / or on a particular β-D-ribose unit compared with an oligonucleotide of the same sequence which is made up of natural DNA or RNA. For example, the invention relates to an oligonucleotide which may comprise one or more modifications and where each modification is selected independently of: a) the substitution of a phosphodiester internucleotide bridge located at the 3' and / or 5' end of a nucleotide by a modified internucleotide bridge; b) the replacement of the phosphodiester bridge located at the 3' and / or 5' end of a nucleotide with a dephospho bridge; c) the replacement of one sugar phosphate unit from the sugar phosphate backbone with another unit; and d) the replacement of a βD-ribose unit with a modified sugar unit. More detailed examples for chemical modification of an oligonucleotide are as follows: a phosphodiester internucleotide bridge located at the 3' and / or 5' end of a nucleotide can QPCQnn / zznz / E / YiAi - 131be replaced by a modified internucleotide bridge, wherein the modified internucleotide bridge is selected, for example, from phosphorothioate, phosphorodithioate, NR1R2-phosphoramidate, boranophosphate, a-hydroxybenzyl phosphonate, phosphate-(1 to 21 carbon atoms)-O -alkyl ester, phosphate-[aryl(6 to 12 carbon atoms)-(1 to 21 carbon atoms)-0-alkyl]ester, alkylphosphonate of 1 to 8 carbon atoms and / or arylphosphonate bridges of 6 to 12 atoms carbon, 7 to 12 carbon atoms-a-hydroxymethylaryl (for example, described in WO 95 / 01363) wherein aryl of 6 to 12 carbon atoms, aryl of 6 to 20 carbon atoms and aryl of 6 to 14 carbon atoms are optionally substituted by halogen, alkyl, alkoxy, nitro, cyano, and where R1 and R2 are, independently of each other, hydrogen, alkyl of 1 to 18 carbon atoms, aryl of 6 to 20 carbon atoms, aryl (6 to 14 carbon atoms-alkyl of 1 to 8 carbon atoms, preferably hydrogen, alkyl of 1 to 8 carbon atoms, preferably alkyl of 1 to 4 carbon atoms and methoxyethyl or R1 and R2 form, together with the atom of nitrogen that carries them, a 5- or 6-membered heterocyclic ring which may additionally contain an additional heteroatom from the group of O, S and N. The replacement of a phosphodiester bridge located at the 3' and / or 5' end of a nucleotide by a QPCQnn / zznz / E / YiAi - 132dephospho bridge (dephospho bridges are described, for example, in Ullmann E and Peyman A in Methods in Molecular Biology, Vol. 20, Protocols for Oligonucleotides and Analogs, S. A. Agrawal, Ed. Humana Press, Totowa 1993, Chapter 16, pp 355 ff), wherein the dephospho bridge is selected, for example, from the dephospho formacetal, 3'-thioformacetal, methylhydroxylamine, oxime, methylenedimethylhydrazo, dimethylethylsulfone and / or silyl groups. A sugar phosphate unit (i.e., a β-Dribose and a phosphodiester internucleotide bridge that together form a sugar phosphate unit) form a sugar phosphate backbone (i.e., a sugar phosphate backbone that is constituted of sugar phosphate units) can be replaced by another unit, where the other unit is suitable, for example, to construct an oligomer derived from morpholino (as described, for example, in Stirchak E P et al. (1989) Oligonucleotides Res 17: 6129-41), that is, for example, substitution by a morpholino derivative unit; or the accumulation of a polyamide oligonucleotide (PNA; as described, for example, in Nielsen P E et al. (1994) Bioconjug Chem 5: 3-7), that is, for example, the substitution of PNA backbone unit , for example, by 2-aminoethylglycine. QecQnn / zznz / E / YiAi - 133A 3-ribose unit or a β-Ο-2'deoxyribose unit may be replaced by a modified sugar unit wherein the modified sugar unit is selected, for example, from β-D-ribose, a-D-2 'deoxyribose, L-2'-deoxyribose, 2'-F-2'-deoxyribose, 2'-F-arabinose, 2'-O-alkyl of 1 to 6 carbon atoms of carbonoribose, preferably 2'-O-alkyl of 1 to 6 carbon atoms-ribose is 2'-O-methylribose, 2'-O- C2-6 alkenyl-ribose, 2'-[O-C1-6 alkyl-O-C1-6 alkyl]-ribose, 2'-NH22'deoxyribose, β-D -xylofuranose, α-arabinofuranose, 2,4dideoxy-β-D-erythro-hexo-pyranose and carbocyclic (described, for example, in Froehler J (1992) J Am Chem Soc 114: 8320) and / or chain sugar analogues open (described, for example, in Vandendriessche et al. (1993) Tetrahedron 49: 7223) and / or bicyclosugar analogues (described, for example, in Tarkov M et al. (1993) Helv Chim Acta 76: 481). In some embodiments, the sugar is 2'-Omethylribose, particularly for one or both nucleotides linked by a phosphodiester or phosphodiester type internucleotide bond. A set of modified bases is defined in particular sequences described herein. For example, the letter Y is used to refer to a QPCQnn / zznz / E / YiAi - 134nucleotide containing a cytosine or a modified cytosine. A modified cytosine, as used herein is a naturally occurring or non-naturally occurring pyrimidine base analogue of cytosine, which can substitute this base without impairing the immunostimulatory activity of the oligonucleotide. Modified cytosines include but are not limited to 5-substituted cytosines (e.g., 5-methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo-cytosine, 5-iodocytosine, 5-hydroxy-cytosine, -hydroxymethyl-cytosine, 5-difluoromethyl-cytosine and unsubstituted or substituted 5-alkynyl-cytosine), 6-substituted cytosines, N4-substituted cytosines (e.g. N4-ethyl-cytosine), 5-azacytosine, 2-mercapto- cytosine, isocytosine, pseudoisocytosine, cytosine analogs with fused ring systems (e.g. N,Ν'-propylene cytosine or phenoxazine) and uracil and its derivatives (e.g. 5fluoro-uracil, 5-bromo-uracil, 5-bromovinyl- uracil, 4thio-uracil, 5-hydroxy-uracil, 5-propynyl-uracil). Some of the preferred cytosines include 5-methyl-cytosine, 5-fluoro-cytosine, 5-hydroxy-cytosine, 5-hydroxymethyl-cytosine and N4-ethyl-cytosine. In another embodiment of the invention, the cytosine base is replaced by a universal base (e.g. 3-nitropyrrole, P base), an aromatic ring system (e.g. fluorobenzene or difluorobenzene) or QPCQnn / zznz / E / YiAi - 135a hydrogen atom (separator d). The letter Z is used to refer to guanine or a modified guanine base. A modified guanine, as used herein is a naturally occurring or non-naturally occurring purine base, a guanine analogue which can substitute this base without impairing the immunostimulatory activity of the oligonucleotide. Modified guanines include but are not limited to 7-deazaguanine, 7-deaza-7-substituted guanine (such as 7-deaza-7-alkynyl(2 to 6 carbon atoms)guanine), 7-deaza-8- substituted guanine, hypoxanthine, N2-substituted guanines (e.g. N2-methylguanine), 5-amino-3-methyl-3H,6H-thiaqzolo[4,5-d]pyrimidine2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, adenine, substituted adenine (e.g. N6-methyl-adenine, 8-oxo-adenine), 8-substituted guanine (e.g. 8-hydroxyguanine and 8-bromoguanine) and 6-thioguanine. In another embodiment of the invention, the guanine base is replaced by a universal base (for example, 4-methyl-indole, 5-nitroindole and base K), an aromatic ring system (for example, benzimidazole or dichloro-benzimidazole, amide of 1-methyl-1H-[1,2,4]triazolo-3-carboxylic acid) or a hydrogen atom (separator d). Oligonucleotides may have one or more accessible 5' ends. It is possible to create oligonucleotides QPCQnn / zznz / E / YiAi - 136modified that have two of these 5' ends. This can be obtained, for example, by joining two oligonucleotides through a 3'-3' linkage to generate an oligonucleotide having one or two accessible 5' ends. The 3'3' bond can be a phosphodiester, phosphorothioate or any other modified internucleotide bridge. Methods for carrying out these links are known in the art. For example, these links have been described in Seliger, H. et al., Oligonucleotide analogs with terminal 3'-3'- and 5'-5'-internucleotide linkages as antisense inhibitors of viral gene expression, Nucleosides & Nucleotides (1991) , 10(1-3), 469-77; and Jiang, et al., Pseudo-cyclic oligonucleotides: in vitro and in vivo properties, Bioorganic & Medicinal Chemistry (1999), 7(12), 2727-2735. Additionally, 3'3' linked oligonucleotides where the linker between the 3'-terminal nucleotides is not a phosphodiester, phosphorothioate or other modified bridge can be prepared using an additional spacer such as a tri- or tetra-ethylene glycol phosphate moiety ( Durand, M. et al, Triple-helix formation by an oligonucleotide containing one (dA)12 and two (dT)12 sequences bridged by two hexaethylene glycol chains, Biochemistry (1992), 31(38), 9197-204, U.S. Pat. No. 5,658,738 and U.S. Patent, No. 5,668,265). Alternatively, the QPCQnn / zznz / E / YiAi - The non-nucleotide linker can be derived from ethanediol, propanediol or from an abasic deoxyribose unit (separated d) (Fontanel, Marie Laurence et al., Sterical recognition by T4 polynucleotide kinase of non-nucleosidic moities 5'-attached to oligonucleotides; Oligonucleotides Research (1994), 22(11), 2022-7) using standard phosphoramidite chemistry. Non-nucleotide linkers can be incorporated once or multiple times, or can be combined together allowing any desirable distance between the 3' ends of two linked ODNs. Oligonucleotides may be partially resistant to degradation (e.g., they are stabilized). A stabilized oligonucleotide molecule will mean an oligonucleotide that is relatively resistant to degradation in vivo (for example by an exonuclease or endonuclease). Stabilization of oligonucleotides can be carried out through modifications of the backbone. Oligonucleotides having phosphorothioate linkages provide maximum protection for the oligonucleotide from degradation by intracellular exonucleases and endonucleases. Other modified oligonucleotides include phosphodiester modified oligonucleotides, combinations of phosphodiester and phosphorothioate oligonucleotides, QecQnn / zznz / E / YiAi - 138methylphosphonate, methylphosphorothioate, phosphorodithioate, p-ethoxy and combinations thereof. Oligonucleotides which contain diol, such as tetraethylene glycol or hexaethylene glycol in either or both terminal parts, have also been shown to be substantially resistant to nuclease degradation. The circular ODN is protected against exonuclease degradation. For example, the double stem-loop immunomodulator Mologen MGN1703 (formerly dSLIM-30Ll) is a 116-nucleotide, covalently closed, dumbbell-shaped CpG-containing phosphodiester backbone oligonucleotide having the sequence 5' AGGTGGTAACCCCTAGGGGTTACCACCTTCATTGGAAAACGTTCTTCGGGGCGTTCTT AGGTGGTAACCCCTAGGGGTTACCACC TTCATTGGAAAACGTTCTTCGGGGCGTTCTT3' (SEC ID NO: 501). Schmidt M et al., Allergy 2006 61: 5663; Kapp, K et al., Mol Ther Nucleic Acids 2014 3: el70. Immunostimulatory oligonucleotides may also contain one or more non-common linkages between the nucleotide and nucleotide analog moieties. The usual internucleoside bond is a 3'5' bond. All other bonds are considered to be rare internucleoside bonds such as 2'5'-, 5'5'-, 3'3'-, 2'2-, 2'3'- bonds. The nomenclature 2' to 5' is QPCQnn / zznz / E / YiAi selects according to the ribose carbon atom. - 139However, if non-natural sugar moieties are used such as ring-expanded sugar analogues (e.g. hexanose, cyclohexene or pyranose) or bicyclic or tricyclic sugar analogues, then this nomenclature changes according to the nomenclature of the monomer. In 3' deoxy-p-D-ribopyranose (also called p-DNA) analogues, the mononucleotides are connected, for example, by a 4'2' linkage. If the oligonucleotide contains a 3'3' linkage, then this oligonucleotide may have two unlinked 5' ends. Similarly, if the oligonucleotide contains a 5'5' linkage, then this oligonucleotide may have two unlinked 3' ends. The accessibility of unlinked ends of nucleotides may be better accessible by their receptors. Both types of rare bonds (3'3' and 5'5') have been described by Ramalho Ortigao et al. (Antísense Research and Development (1992) 2, 129-46), so oligonucleotides having a 3'3' linkage have been reported to show improved stability towards cleavage by nucleases. Different types of bonds can also combine in a molecule which can generate branching of the oligomer. If one part of the oligonucleotide is connected at the 3' end by a 3'3' link to a second oligonucleotide part and the 2' end by QPCQnn / zznz / E / YiAi - 140 means of a 2'3' linkage to a third part of the molecule, this results, for example, in a branched oligonucleotide with three 5' ends (3'3' and 2'3' branches). III. CHECKPOINT INHIBITORS A. PD-1 Programmed death receptor 1 (PD-1), also known as CD27 9, is a type 1 membrane protein expressed on activated T lymphocytes (which includes CD8+ T lymphocytes), B lymphocytes and macrophages. Its cognate ligands are PD-L1 and PD-L2 and the binding of PD-1 particularly by PD-L1 blocks signal 3 in T cells and potentially inhibits the effector arm of an adaptive immune response, for example by targeting death. of T lymphocytes that express PD-1. In humans, PD-1 is a 268 amino acid polypeptide that has an amino acid sequence published by GenBank, accession No. NP 005009. The protein includes an extracellular IgV domain, a transmembrane domain, and an intracellular domain that has two phosphorylation sites. The KD for interaction between PD-1 and PD-L1 is 770 nM. In preferred embodiments of the invention, the antibody inhibits binding between PD-1 and PD-L1. Preferably, the antibody can inhibit the binding of QPCQnn / zznz / E / YiAi - 141PD-L1 with an IC50 of approximately 100 nM or less; more preferably about 100 nM or less, for example, about 5 nM or less; even more preferably about 2 nM or less; or even more preferably, for example, about 1 nM or less. Furthermore, in another embodiment, the anti-PD-1 antibody has a binding affinity for PD-1 that is at least as strong as that for PD-L1. In certain embodiments, the anti-PD-1 antibody has a binding affinity for PD-1 that is at least 10 times as strong as that of PD-L1. In certain embodiments, the anti-PD-1 antibody has a binding affinity for PD-1 that is at least 100 times as strong as that of PD-L1. In certain embodiments, the anti-PD-1 antibody has a binding affinity for PD-1 that is at least 1000 times as strong as that of PD-L1. Anti-PD-1 antibodies are known in the art and include, for example, those described in U.S. Pat. No. 6,808,710 to Wood et al., U.S. Pat. No. 7,488,802 to Collins et al., and U.S. Pat. No. 8,728,474 to Honjo et al. Anti-PD-1 antibodies are commercially available as pembrolizumab (previously known as lambrolizumab and MK-3475, KEYTRUDAMR, Merck, Kd 29 pM) and nivoluman (OPDIVOMR, Bristol-Myers Squibb, Kd 2.6 nM). Additional anti-PD-1 antibodies currently under development include pidilizumab (CT-011, Cure Tech). QPCQnn / zznz / E / YiAi - 142- B.PD-L1 The programmed death ligand 1 (PD-L1) receptor, also known as CD274 and B7 homolog 1 (B7Hl), is a type 1 membrane protein expressed on activated T lymphocytes (which include CD8+ T lymphocytes and so-called infiltrating lymphocytes). of tumors (TIL cells), B lymphocytes, macrophages and dendritic cells as well as many types of tumor cells. Its cognate ligands are PD-1 and B7.1 (CD80), and binding of PD-1 by PD-L1 blocks signal 3 on T cells and can potently inhibit T cell effector functions that mediate an adaptive immune response. , for example, by directing T lymphocytes that express PD-1 to death. PD-L1 expression is upregulated on T lymphocytes, Nk cells, macrophages, myeloid dendritic cells, B lymphocytes, epithelial cells, and vascular endothelial cells in response to gamma interferon (INF.y). PD-L1 expression is also upregulated in tumors, for example renal cell carcinoma and ovarian cancer, in response to IFN-γ. In humans, PD-L1 is expressed in either of two isoforms, a longer a isoform or a shorter b isoform. Isoform a is a 290 amino acid polypeptide that has an amino acid sequence published as GenBank accession No. NP_054862; the mature peptide comprises QecQnn / zznz / E / YiAi - 143amino acid residues 19 to 290, where residues 239 to 259 represent the transmembrane domain. Isoform B is a 176 amino acid polypeptide that has an amino acid sequence published as GenBank NP_001254635; The mature peptide comprises amino acid residues 19 to 259. As mentioned above, the Kd for interaction between PD-1 and PD-L1 is 770 nM. In preferred embodiments of the invention, the antibody inhibits binding between PD-1 and PD-L1. Preferably, the antibody can inhibit binding to PD-1 with an IC50 of about 100 nM or less, more preferably about 10 nM or less, for example, about 5 nM or less; even more preferably about 2 nM or less; even more preferably, for example, about 1 nM or less. Furthermore, in another embodiment, the anti-PD-L1 antibody has a binding affinity for PD-L1 that is at least as strong as that of PD-1. In certain embodiments, the anti-PD-Ll antibody has a binding affinity for PDL1 that is at least 10 times as strong as that of PD-1. In certain embodiments, the anti-PD-Ll antibody has a binding affinity for PD-L1 that is at least 100 times as strong as that of PD-1. In certain embodiments, the anti-PD-L1 antibody has a binding affinity for PD-L1 that is at least 1000 times as strong as that of PD-1. QPCQnn / zznz / E / YiAi - 144 Anti-PD-Ll antibodies are known in the art and include, for example, those described in U.S. Patent No. 7,943,743 to Korman et al. Although anti-PD-Ll antibodies have not yet been approved by the FDA for marketing in the United States, several anti-PD-Ll antibodies are currently under development in human clinical trials including MPDL3280A (Genetech / Roche, KD0.4 nM ), BMS-936559 (Bristol-Myers Squibb) and MEDI-4736 (AstraZeneca). C. CTLA-4 Cytotoxic T lymphocyte-associated protein 4 (CTLA-4), also known as CTLA4 or CD152, is a membrane protein expressed on T lymphocytes and regulatory T lymphocytes (Treg). Its cognate ligands include B7-1 (CD80) and B7-2 (CD86) on antigen-presenting cells (APCs). Binding of B7-1 or B7-2 by CTLA-4 blocks signal 2 in T lymphocytes and inhibits the initiation of the adaptive immune response. In humans, CTLA-4 is encoded in various isoforms, including one with an amino acid sequence published as GenBank, accession No. NP 001032720. A preferred anti-CTLA-4 antibody is an antibody that specifically binds human CTLA-4. More particularly, the anti-CTLA-4 antibody binds QecQnn / zznz / E / YiAi - 145specifically to an epitope in the extracellular domain of human CTLA-4 and inhibits binding between CTLA-4 and one or both of its cognate ligands B7-1 and B7-2. A preferred anti-CTLA-4 antibody is a human antibody that specifically binds human CTLA-4. More particularly, the anti-human CTLA-4 antibody specifically binds to an epitope on the extracellular domain of human CTLA-4 and inhibits binding between CTLA-4 and one or both of its associated ligands B7-1 and B7-. 2. Exemplary anti-CTLA-4 antibodies are described in detail in International Application No. PCT / US99 / 30895, published June 29, 2000, as WO 00 / 37504; European patent application No. EP 1262193 Al, published on April 12, 2002; U.S. patent application Serial No. 09 / 472,087 now issued as U.S. Patent. No. 6,682,736 to Hanson et al.; U.S. patent application Serial No. 09 / 948,939, published as US 2002 / 0086014; U.S. patent application Serial No. 11 / 988,396, published as US 2009 / 0117132; and the U.S. patent application. Serial No. 13 / 168,206 published as US 2012 / 0003179, all disclosures of which are incorporated herein by reference. These antibodies include but are not limited to 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3. 1.1 and 12.9.1.1, as well as MDX-010. Human antibodies provide a QecQnn / zznz / E / YiAi - 146substantial advantage in the treatment methods of the present invention since they are expected to minimize the immunogenic and allergic responses that are associated with the use of non-human antibodies in human patients. Anti-CTLA-4 antibodies specifically include ipilimumab (YERVOYMR, Bristol-Myers Squibb). The characteristics of the useful anti-human CTLA-4 antibodies of the invention are described extensively in WO 00 / 37504, EP 1262193 and U.S. Pat. No. 6,682,736 as well as U.S. patent application publications. Nos. US2002 / 0086014 and US2003 / 0086930 and in the amino acid and nucleic acid sequences set forth herein which are incorporated by reference herein in their entirety. Briefly, antibodies of the invention include antibodies having amino acid sequences of an antibody such as, but not limited to, antibody 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1 .1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1 and 12.9.1.1, and MDX-010. The invention also relates to antibodies that have the amino acid sequences of the CDRs of the heavy and light chains of these antibodies as well as those that have changes in the CDR regions, as described in the applications and patents mentioned above. The invention also relates to antibodies having the variable regions of the heavy and light chains of QPCQnn / zznz / E / YiAi - 147these antibodies. In another embodiment, the antibody is selected from an antibody that has the full length, variable region or CDR, amino acid sequences of the heavy and light chains of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1 and 12.9.1.1, and MDX-010. Methods of administering anti-CTLA-4 antibodies are well known in the art. Most commonly, antibodies are provided by systemic administration, usually IV. In animal models, but not humans, intratumoral administration has also been explored as a way to reduce doses and toxicity (Transen ME et al., Oncoimmunology 2013 Nov 1; 2(11): e26493). In one embodiment, the invention comprises an antibody-therapeutic agent combination comprising an anti-human CTLA-4 antibody described in U.S. patent application No. Serial No. 09 / 948,939, published as U.S. Patent Application Publication. No. 2002 / 0086014 and No. 2003 / 0086930 and references mentioned in those documents including, but not limited to, MAb 10D1 (MDX-010, Medarex, Princeton, N.J.). Even more preferably, the anti-CTLA-4 antibody is MDX-010. Alternatively, the anti-CTLA-4 antibody is 11.2.1 QPCQnn / zznz / E / YiAi (Ticilimumab; CP-675,206). - 148In preferred embodiments of the invention, the antibody inhibits the binding between CTLA-4 and B7-1, B7-2 or both. Preferably, the antibody can inhibit binding to B7-1 with an IC50 of about 100 nM or less, more preferably about 10 nM or less, for example, about 5 nM or less, even more preferably about 2 nM or less. ; or even more preferably, for example, about 1 nM or less. Likewise, the antibody may inhibit binding to B7-2 with an IC50 of about 100 nM or less, more preferably, 10 nM or less, for example, even more preferably about 5 nM or less; even more preferably, about 2 nM or less; or even more preferably, about 1 nM or less. Furthermore, in another embodiment, the anti-CTLA-4 antibody has a binding affinity for CTLA-4 that is at least as strong as that of B7-1. In certain embodiments, the anti-CTLA-4 antibody has a binding affinity for CTLA-4 that is at least 10 times as strong as that of B7-1. In certain embodiments, the anti-CTLA-4 antibody has a binding affinity for CTLA-4 that is at least 100 times as strong as that of B7-1. In certain embodiments the anti-CTLA-4 antibody has a binding affinity for CTLA-4 that is at least 1000-fold. QPCQnn / zznz / E / YiAi - 149as strong as the B7-1. Furthermore, in another embodiment, the anti-CTLA-4 antibody has a binding affinity for CTLA-4 that is at least as strong as that of B7-2. In certain embodiments, the anti-CTLA-4 antibody has a binding affinity for CTLA-4 that is at least 10 times as strong as that of B7-2. In certain embodiments, the anti-CTLA-4 antibody has a binding affinity for CTLA-4 that is at least 100 times as strong as that of B7-2. In certain embodiments the anti-CTLA-4 antibody has a binding affinity for CTLA-4 that is at least 1000 times as strong as that of B7-2. Furthermore, in another embodiment, the anti-CTLA-4 antibody has a binding affinity for CTLA-4 of about ΙΟ-8M, or a higher affinity, more preferably about ΙΟ-9M or a higher affinity, more preferably about 10-10M or a higher affinity and even more preferably about 10-11M or a higher affinity. In certain embodiments, the anti-CTLA-4 antibody may compete for binding with an antibody having a heavy and light chain amino acid sequence of an antibody selected from the group consisting of 4.1.1, 6.1.1. 11.2.1, 4.13.1 and 4.14.3. Furthermore, in certain embodiments, the anti-CTLA-4 antibody can compete for the QPCQnn / zznz / E / YiAi - 150binding with an MDX-010 antibody. In another embodiment, the anti-CTLA-4 antibody preferably cross-competes with an antibody having a heavy and light chain sequence, a variable heavy and a variable light chain sequence, and / or antibody heavy and light CDR sequences. 4.1.1, 4.13.1, 4.14.3, 6.1.1 or 11.2.1. For example, the antibody may bind to an epitope to which the antibody having the heavy and light chain amino acid sequences, variable sequences and / or CDR sequences of an antibody that is selected from the group consisting of 4.1.1, 4.13.1, 4.14.3, 6.1.1 or 11.2.1 joins. In another embodiment, the anti-CTLA-4 antibody is cross-competitive with an antibody having heavy and light chain sequences, or MDX-010 antigen binding sequences. In another embodiment, the invention is practiced using an anti-CTLA-4 antibody comprising a heavy chain comprising the amino acid sequences of CDR1, CDR2 and CDR3, and a light chain comprising the amino acid sequences of CDR1. , CDR2 and CDR3 of an antibody that is selected from the group consisting of 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1 , 11.7.1, 12.3.1.1 and 12.9.1.1, or sequences that have changes from the CDR sequences that are selected from the group consisting of conservative changes, where QPCQnn / zznz / E / YiAi - 151conservative changes are selected from the group consisting of substitution of non-polar residues for other non-polar residues, substitution of non-polarly charged residues for non-polarly charged residues, substitution of polar-charged residues for other polar-charged residues, and substitution of structurally similar residues; non-conservative substitutions, wherein the non-conservative substitutions are selected from the group consisting of a substitution of a polar charged residue with non-polar charged residues and substitution of non-polar residues with polar residues, additions and deletions. In a further embodiment of the invention, the antibody contains less than 10, 7, 5 or 3 amino acid changes from the germline sequence in the infrastructure regions or CDRs. In another embodiment, the antibody contains less than 5 amino acid changes in the infrastructure regions and less than 10 changes in the CDR regions. In a preferred embodiment, the antibody contains less than 3 amino acid changes in the infrastructure regions and less than 7 changes in the CDR regions. In a preferred embodiment, changes in infrastructure regions are conservative and those in CDR regions are somatic mutations. In another embodiment, the antibody has at least 80%, more preferably at least 85%, - 152even more preferably at least 90%, even more preferably at least 95%, more preferably at least 99% sequence identity over the heavy and light chain CDR1, CDR2 and CDR3 sequences with antibody CDR sequences 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1 and 12.9.1.1. Even more preferably, the antibody shares 100% sequence identity over the heavy and light chain CDR1, CDR2 and CDR3 with the antibody sequence 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13. 1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1 and 12.9.1.1.. In yet another embodiment, the antibody has at least 80%, more preferably at least 85%, even more preferably at least 90%, even more preferably at least 95%, more preferably at least least 99% sequence identity over the heavy and light chain variable region sequences with the antibody variable region sequences 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3 , 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1 and 12.9.1.1. Even more preferably, the antibody shares 100% sequence identity over the heavy and light chain variable region sequences with antibody sequences 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1 , 4.14.3, 6.1.1, 11.2.1, 11.6.1, QPCQnn / zznz / E / YiAi - 153- 11.7.1, 12.3.1.1 and 12.9.1.1. D. Other checkpoint inhibitors In addition to those listed above, other checkpoints are known in the art and their inhibitors are included in the invention. For example, BTLA provides a negative signal in response to HVEM and TIM3 provides a negative signal in response to Gal9. Adenosine can activate suppressive effects through the adenosine A2a receptor and IDO and TDO are well-known immunosuppressive pathways although they are involved in antitumor immunity. LAG3 binds to CPH class II with a higher affinity than CD4. LAG3 negatively regulates cell proliferation, activation, and T cell homeostasis in a manner similar to CTLA-4 and PD-1 and has been reported to play a role in the suppressive function of Tregs. LAG3 also helps maintain CD8+ T cells in a tolerogenic state and, working with PD-1, helps maintain CD8 depletion during chronic viral infection. LAG3 is known to be involved in the maturation and activation of dendritic cells. Additional checkpoint inhibitors for use in the invention include, without limitation, antigen-binding antibodies and fragments thereof, capable of specifically binding to any one or more of BTLA. TIM3 and LAG3. Also contemplated by the invention are antibodies QecQnn / zznz / E / YiAi - 154bispecific and bispecific antigen binding fragments thereof which are capable of bispecifically binding to one or more of BTLA, TIM3 and LAG3. The invention contemplates combinations of a TLR9 agonist and a checkpoint inhibitor, wherein the checkpoint inhibitor may be a single CPI or any combination of two or more CPIs. Although it is likely that in clinical use only one or only a pair of CPIs will be used, the invention contemplates the use of any one, any two, any three or any four or more CPIs selected, for example, from CTLA-4 inhibitors. , PD-1, PD-L1, TIM3, LAG3 or BTLA. E. Origin of antibodies Although the anti-PD-1, anti-PD-Ll and anti-CTLA-4 antibodies previously described herein may be mentioned, a person skilled in the art, based on the description provided here, can appreciate that the invention It encompasses a wide variety of anti-PD-1, anti-PD-Ll and anti-CTLA-4 antibodies and is not limited to these particular antibodies. More particularly, although human antibodies are preferred for use in humans, the invention is not thus limited to human antibodies; rather, the invention encompasses antibodies useful regardless of species origin and include, but are not limited to, QecQnn / zznz / E / YiAi - 155 humanized and / or primatized chimeric antibodies. Furthermore, although certain antibodies exemplified herein are obtained using a transgenic mammal, for example a mouse that comprises a human immune repertoire, those skilled in the art will, based on the description provided herein, understand that the present invention is not limited to an antibody produced by this or any other particular method. Instead, the invention includes an anti-PD-1, anti-PD-Ll or anti-CTLA-4 antibody produced by any method including, but not limited to, a method known in the art (e.g. phage display library screening and the like) or that will be developed in the future to produce an anti-PD-1, anti-PD-Ll or anti-CTLA-4 antibody of the invention. Based on the extensive description provided herein and, for example, U.S. Pat. No. 6,682,736 to Bedian et al., and U.S. patent application No. 6,682,736 to Bedian et al. Publication No. 2002 / 0088014, a person skilled in the art can easily produce and identify an anti-PD-1, anti-PD-Ll or anti-CTLA-4 antibody useful for the treatment of cancer in combination with an ODN of CpG using the novel methods described here. The present invention encompasses human antibodies produced using a transgenic non-human mammal, for example XenoMouse™ (Abgenix, Inc., Fremont, Calif.) as QPCQnn / zznz / E / YiAi - 156is described in U.S. patent. No. 6,682,736 to Hanson et al. Another transgenic mouse system for the production of human antibodies is called HuMAb-Mouse™ (Medarex, Princeton, N.J.), which contains human immunoglobulin gene miniloci that encode non-rearranged human heavy chain immunoglobulin sequences ( mu and gamma) and light kappa along with targeted mutations that inactivate the endogenous mu and kappa chain loci (Lonberg et al. Nature 368: 856-859 (1994) and U.S. Patent No. 5,770,429). However, the invention uses human anti-PD-1, anti-PD-Ll or anti-CTLA-4 antibodies produced using any transgenic mammal such as, but not limited to, the Kirin TC Mouse™ (Kirin Beer Kabushiki Kaisha, Tokyo, Japan). as described in, for example, Tomizuka et al., Proc Nati Acad Sci US 97: 722 (2000); Kuroiwa et al., Nature Biotechnol 18: 1086 (2000); publication of U.S. patent application No. 2004 / 0120948, to Mikayama et al., and the HuMAb-Mouse™ (Medarex, Princeton, N. J.) and XenoMouse™ (Abgenix, Inc., Fremont, Calif.), supra. Thus, the invention encompasses using an anti-PD-1, anti-PD-Ll or anti-CTLA-4 antibody produced using any transgenic animal or other non-human animal. Furthermore, although the preferred method of production QPCQnn / zznz / E / YiAi - 157 of a human anti-PD-1, anti-PD-Ll or anti-CTLA-4 antibody comprises generating the antibodies using a non-human transgenic mammal that comprises a human immune repertoire, the present invention is in no way limited to this point of view. Rather, as those skilled in the art will appreciate upon knowledge of the description provided herein, the invention encompasses the use of any method for the production of a human antibody or any other antibody specific for PD-1, PD-L1 or CTLA-4 produced in accordance with any method known in the art or hereafter developed for the production of antibodies that specifically bind to an antigen of interest. Human antibodies can be developed by methods including, but not limited to, the use of phage display antibody libraries. For example, using these techniques, antibodies can be generated for cells expressing CTLA-4, CTLA-4 itself, forms of CTLA-4, epitopes or peptides thereof, and expression libraries therefor (see, for example, U.S. Patent No. 5,703,057) which may subsequently be analyzed to determine the activities described above. In another embodiment, the antibodies used in methods of the invention are not completely human but QecQnn / zznz / E / YiAi - 158humanized. In particular, murine antibodies or antibodies from other species can be humanized or primatized using techniques well known in the art. See, for example, Winter and Harris Immunol. Today 14: 43-46 (1993), Wright et al. Crit. Reviews in Immunol. 12: 125-168 (1992), and U.S. Pat. NO. 4,816,567 for Cabilly et al., and Mage and Lamoyi in Monoclonal Antibody Production Techniques and Applications pp. 79-97, Marcel Dekker, Inc., New York, N.Y. (1987). As will be appreciated based on the description provided herein, antibodies for use in the invention can be obtained from a transgenic non-human mammal and hybridomas derived therefrom, but can also be expressed in cell lines other than those. hybridomas. Mammalian cell lines available as hosts for expression are well known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC), including but not limited to Chinese hamster ovary (CHO) cells. ), NSO, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (CCS), and human hepatocellular carcinoma cells (e.g., Hep G2). Non-mammalian prokaryotic and eukaryotic cells can also be QPCQnn / zznz / E / YiAi - 159use including bacterial, yeast, insect and plant cells. Various expression systems may be used as are well known in the art such as, but not limited to, those described in, for example, Sambrook and Russell, Molecular Cloning, A Laboratory Approach, Coid Spring Harbor Press, Coid Spring Harbor, N.Y. ( 2001), and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, NY (2002). These expression systems include dihydrofolate reductase (DHFR)-based systems, among many others. The glutamine synthetase system for expression is described in whole or in part in connection with European Patent Nos. EP 216 846, EP 256 055 and EP 323 997 and European Patent Applications 89303964. In one embodiment, the antibody used is made in NS0 cells using the glutamine synthase (GS-NS0) system. In another embodiment, the antibody is made in CHO cells under a DHFR system. Both systems are well known in the field and are described, among others, in Barnes et al. Biotech & Bioengineering 73: 261-270 (2001) and the references mentioned in that document. Site-directed mutagenesis of the antibody CH2 domain to eliminate glycosylation may be preferred in order to avoid changes in either immunogenicity, pharmacokinetics and / or effector functions that result from QPCQnn / zznz / E / YiAi - 160non-human glycosylation. Furthermore, the antibody can be deglycosylated by enzymatic methods (see, for example, Thotakura et al. Meth. Enzymol. 138: 350 (1987)) and / or chemical methods (see, for example, Hakimuddin et al., Arch. Biochem Biophys. 259: 52 (1987). Furthermore, the invention encompasses using an anti-PD-1 antibody, anti-PD-Ll antibody or anti-CTLA-4 antibody that comprises an altered qlucosylation pattern. One skilled in the art will appreciate, based on the description provided herein, that an anti-PD-1 antibody, an anti-PD-Ll antibody or an anti-CTLA-4 antibody can be modified to comprise glycosylation sites. additional, minor or different compared to the corresponding unchanged antibody. These modifications are described, for example, in U.S. patent application publications. Nos. 2003 / 0207336 and 2003 / 0157108, and in international patent publications Nos. WO 01 / 81405 and 00 / 24893. Additionally, the invention comprises the use of an anti-PD-1 antibody, an anti-PD-Ll antibody or an anti-CTLA-4 antibody regardless of the glycoform, if any, present in the antibody. Furthermore, methods for extensive remodeling of the glycoform present in a glycoprotein are well known in the art and include, for example, those described in patent publications QPCQnn / zznz / E / YiAi - 161international Nos. WO 03 / 031464, WO 98 / 58964 and WO 99 / 22764 and in US patent application publications Nos. 2004 / 0063911, 2004 / 0132640, 2004 / 0142856, 2004 / 0072290, and U.S. patent. No. 6,602,684 to Umana et al. Furthermore, the invention encompasses the use of an anti-PD-1 antibody, an anti-PD-Ll antibody or an anti-CTLA-4 antibody with any covalent or non-covalent modification known in the field including, but not limited to to link the polypeptide to one of a variety of non-proteinaceous polymers, for example polyethylene glycol, polypropylene glycol or polyoxyalkylenes in the manner set forth, for example, in U.S. patent application publications. Nos. 2003 / 0207346 and 2004 / 0132640 and U.S. patents Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192; and 4,179,337. Additionally, the invention encompasses an anti-PD-1 antibody, an anti-PD-Ll antibody or an anti-CTLA-4 antibody, or an antigen-binding portion thereof, a chimeric protein comprising, for example , a human serum albumin polypeptide or a fragment thereof. If the chimeric protein is produced using recombinant methods, for example, by cloning a chimeric nucleic acid that encodes the chimeric protein or by chemically linking two peptide moieties, the person skilled in the art will understand that once assembled QecQnn / zznz / E / YiAi - 162With the teachings provided herein, these chimeric proteins are well known in the art and can confer desirable biological properties such as, but not limited to, increased stability and serum half-life for the antibody of the invention and that these molecules are therefore included herein. Antibodies that are generated for use in the invention do not initially need to present a particular desired isotype. Rather, the antibody as generated may possess any isotype and may be an isotype subsequently switched using conventional techniques. These include direct recombinant techniques (see, for example, U.S. Patent No. 4,816,397) and cell-cell fusion techniques (see, for example, U.S. Patent No. 5,916,771). The effector function of the antibodies of the invention can be changed by isotype change to an IgGl, IgG2, IgG3, IgG4, IgD, IgA, IgE or IgM for various therapeutic uses. Furthermore, dependence on complement for cell destruction can be avoided by using bispecific substances, immunotoxins or radiolabels, for example. Therefore, although preferred anti-CTLA-4 antibodies used in the invention are exemplified by antibodies having the amino acid sequences of - 163- 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1 and 12.9.1.1, and MDX -010 or, for example, the V region sequences or CDRs thereof, the present invention is in no way limited to using these, or any other particular anti-CTLA-4 antibody. Preferably, the antibody is 4.1.1, 4.13.1, 11.2.1 and / or MDX-010. However, any anti-CTLA-4 antibody, or antigen-binding portion thereof, as described elsewhere herein or as is known in the art or developed may be used in a method of the invention. in the future. More particularly, humanized chimeric antibodies, anti-CTLA-4 antibodies derived from any species (including single chain antibodies obtained from camelids as described, for example, in U.S. Patent Nos. 5,759,808 and 6,765,087 to Casterman and Hamers ), as well as any human antibody can be combined with a CpG ODN to implement the novel methods described here. The invention also encompasses these antibodies as described, for example, in International Patent Publications Nos. WO 00 / 37504 (published June 29, 2000); WO 01 / 14424 (published March 1, 2001); WO 93 / 00431 (published January 7, 1993); and WO 00 / 32231 (published June 8, 2000), among many QPCQnn / zznz / E / YiAi - 164others. In this way, a person skilled in the art, once aware of the teachings provided herein, will easily appreciate that the anti-CTLA-4 antibody-therapeutic agent combination of the invention can comprise a wide variety of antibodies. anti-CTLA-4. Furthermore, a person skilled in the art will, based on the description provided herein, understand that the invention is not limited to the administration of only a single antibody; rather, the invention encompasses the administration of at least one anti-CTLA-4 antibody, for example, 4.1.1, 4.13.1 and 11.2.1, in combination with a CpG ODN. Furthermore, the invention encompasses the administration of any combination of any known anti-CTLA-4 antibody including, but not limited to, administering a CpG ODN in combination with, for example, 4.1.1, 4.13.1, 11.2. 1 and MDX-010. Thus, any combination of anti-CTLA-4 antibodies can be combined with at least one therapeutic agent and the present invention encompasses any of these combinations and permutations thereof. IV. CpG DNA AND CHECKPOINT INHIBITOR COMBINATION IMMUNOTHERAPY The present invention relates to a QPCQnn / zznz / E / YiAi - 165combined antitumor immunotherapy comprising locally administering CpG ODN within or in proximity to a cancerous tumor and systemically administering a checkpoint inhibitor, such as an anti-PD-1 antibody, an anti-PD-Ll antibody or an antibody anti-CTLA-4 to treat cancer. A single human clinical trial has been reported in which patients were treated with a combination of CpG ODN (class B, dosed subcutaneously up to 0.15 mg / kg / week) and an anti-CTLA-4 antibody (Millward M et al. , Br: J. Cancer 2013 108(10): 1998-2004). This study established an MTD for a weekly combination of IV anti-CTLA-4 and subcutaneous CpG for 12 weeks of treatment in 21 patients with stage IV melanoma. Although the results of the study were not considered encouraging enough to warrant continued development of TLR9 agonists in oncology (all immune and oncology drug development by the sponsor was considered completed), several interesting findings from the study support the utility of the present invention. First, the combination of a TLR9 agonist and a checkpoint inhibitor is relatively well tolerated—no systemic autoimmune disease is observed and only three patients developed dose-limiting toxicities during the specified 6-week lead-in period, two of QPCQnn / zznz / E / YiAi - 166who were in the group with the highest dose of the anti-CTLA-4 antibody. Second, there is no induction of antibody response against the anti-CTLA-4 antibody from the combination regimen. Third, two patients achieved partial responses to treatment and several others had unusually stable prolonged disease. The combination of high IFN-inducing CpG ODN and anti-PD-1, anti-PD-Ll or anti-CTLA-4 is useful for the treatment of primary or secondary (i.e., metastatic) cancers. More specifically, among many potential treatment options, polytherapy with CpG ODN and anti-checkpoint can be used to treat cancer. In certain embodiments, the cancer to be treated is or includes a cancerous tumor. A cancerous tumor, as used herein, refers to an abnormal expansion or macroscopic collection of cells comprising abnormal cells characterized by their growth or proliferation without regulation by normal external signals. In certain embodiments, a cancerous tumor is a carcinoma, sarcoma or adenocarcinoma; They are sometimes called solid tumors. In certain embodiments, a cancerous tumor excludes hematological malignancies. In certain embodiments, a cancerous tumor includes certain hematological malignancies, QPCQnn / zznz / E / YiAi - 167for example, lymphomas. Representative cancers treatable by the methods of the invention specifically include, without limitation, cancers of the skin, upper respiratory and digestive tract, esophagus, stomach, liver, colon, rectum, pancreas, lung, breast, cervix, ovary, kidney, bladder. , prostate, thyroid, brain, muscle and bone. Also specifically included among other cancers treatable by the methods of the invention are melanoma, renal cell carcinoma, and small cell lung cancer (NSCLS). Also specifically included among the cancers treatable by the methods of the invention are lymphoma, bone marrow cancer, carcinoid tumor and neuroblastoma. Although in some embodiments the above cancers are preferred, the present invention relates to the treatment of a wide variety of malignant cell proliferative disorders including but not limited to Kaposi sarcoma, synovial sarcoma, mesothelioma, hepatobiliary tumor (liver and of the bile duct), primary or secondary brain tumor, lung cancer (small cell NSCLC and small cell or SCLC), bone cancer, skin cancer, cancer of the upper respiratory and digestive tracts, cutaneous or infraocular melanoma, cancer of the anal region , stomach (gastric) cancer, cancer QPCQnn / zznz / E / YiAi - 168gastrointestinal (gastric, colorectal and duodenal), colon cancers, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, cancer of the esophagus, cancer of the intestine thin, endocrine system cancer, thyroid gland cancer, parathyroid gland cancer, adrenal gland cancer, soft tissue sarcoma, urethral cancer, prostate cancer, penile cancer, testicular cancer, bladder cancer , cancer of the kidney or ureter, carcinoma of the renal pelvis, pancreatic cancers, neoplasms of the central nervous system (CNS) including primary or secondary CNS tumor, spinal axis tumors, brain stem glioma, glioblastoma, meringioma, myoblastoma, astrocytoma , pituitary adenoma, adrenocortical cancer, gallbladder cancer, cholangiocarcinoma, fibrosarcoma, neuroblastoma and retinoblastoma; as well as, in some modalities, non-Hodgkin lymphoma (NHL, which includes indolent and aggressive); Hodgkin lymphoma, cutaneous T cell lymphoma, lymphocytic lymphomas, primary CNS lymphoma, chronic or acute myeloid leukemia, chronic or acute lymphocytic leukemia, erythroblastoma and multiple myeloma; or a combination of two or more of the above cancers. The cancers to be treated may be QPCQnn / zznz / E / YiAi - 169 refractory cancers. A refractory cancer, as used herein, is a cancer that is resistant to the common standard of care prescribed. These cancers may initially appear in response to treatment (and then recur) or may be completely unresponsive to treatment. The usual standard of care will vary depending on the type of cancer and the degree of progression in the subject. It may be chemotherapy, immunotherapy, surgery, radiation, or a combination thereof. Those typically experts in the field are aware of these standards of care. Subjects who are being treated according to the invention for a refractory cancer may therefore have already been exposed to another treatment for their cancers. Alternatively, if the cancer is likely to be refractory (for example, given an analysis of the subject's cancer cells or history), then the subject may not have been exposed to another treatment beforehand. In certain embodiments, refractory cancers include cancers which are refractory to treatment with a checkpoint inhibitor. Cancers of this type are sometimes called cold. The methods of the present invention can be used to treat these cold cancers or tumors to convert them to hot ones, that is, cancers or tumors that respond to QecQnn / zznz / E / YiAi - 170treatment, including treatment with a checkpoint inhibitor, including the checkpoint inhibitor itself. Examples of refractory cancers include, but are not limited to, melanomas, renal cell carcinomas, colon cancer, liver (hepatic) cancers, pancreatic cancer, non-Hodgkin's lymphoma, lung cancer, and leukemias. The methods of the invention in certain instances may be useful for replacing existing surgical procedures or drug therapies, although in other instances the present invention is useful for improving the effectiveness of existing therapies for treating these conditions. Accordingly, polytherapy can be used to treat subjects who are undergoing or who will undergo cancer treatment. For example, the agents may be administered to a subject in combination with another antiproliferative therapy (e.g., an anticancer therapy). Suitable anticancer therapies include surgical procedures to remove the tumor mass, chemotherapy, or localized radiation. The other antiproliferative therapy may be administered before, concurrent with, or after treatment with the CpG / CPI ODN combination of the invention. There may also be a delay of several hours, days, and in some instances, weeks between QPCQnn / zznz / E / YiAi - lilla administration of the different treatments such that the CpG / CPI ODN combination can be administered before or after another treatment. The invention further contemplates the use of the CpG / CPI ODN combination in cancer subjects before and after surgery, radiation and chemotherapy. In one embodiment, the invention provides compositions and methods for producing or increasing an antitumor response using the CpG ODN / CPI combination, wherein CpG ODN increases the antitumor response by an amount of CPI that is otherwise suboptimal to induce the same amount of antitumor response when used alone. In certain embodiments, when the CpG ODN is not used in conjunction with a CPI to induce an antitumor response, the administration of only CpG ODN does not produce or increase the antitumor response. In alternative modalities, both CpG ODN and CPI can induce an antitumor response alone and / or when administered in combination. In one embodiment, the invention provides compositions and methods for producing or increasing the antitumor response using combination CpG ODN / CPI antibodies, wherein the CpG ODN increases the antitumor response by an amount of antibody which is otherwise suboptimal for induce the same amount QecQnn / zznz / E / YiAi - 172antitumor response when used alone. In certain embodiments, when the CpG ODN is not used in conjunction with a CPI antibody to induce an antitumor response, the CpG ODN administered alone does not produce or enhance the antitumor response. In alternative embodiments, both the CpG ODN and the CPI antibody can induce an antitumor response alone and / or when administered in combination. In certain embodiments, the CpG ODN can increase the effects of the CPI (or vice versa) in an additive manner. In a preferred embodiment, the CpG ODN increases the effects of the CPI (or vice versa) in a synergistic manner. In another embodiment, the CPI increases the effect of a CpG ODN in an additive manner. Preferably, the effects are increased in a synergistic manner. Thus, in certain embodiments, the invention encompasses methods of disease treatment or prevention that provide better therapeutic profiles than those expected based on the administration of only CpG ODN and only CPI. In certain embodiments, the CpG ODN can increase the effects of the CPI antibody (or vice versa) in an additive manner. In a preferred embodiment, the CpG ODN increases the effects of the CPI antibody (or vice versa) in a synergistic manner. In another embodiment, the antibody QPCQnn / zznz / E / YiAi - 173CPI increases the effect of a CpG ODN in an additive manner. Preferably, the effects are increased in a synergistic manner. Thus, in certain embodiments, the invention encompasses methods or treatment of disease or prevention that provide better therapeutic profiles than those expected based on the administration of only CpG ODN and only the CPI antibody. In certain embodiments, CpG ODN is administered with CPI (with or without other modalities such as radiotherapy) as part of a neoadjuvant therapeutic regimen to obtain an antitumor effect that will enable curative surgery. In certain embodiments, the CpG ODN is administered in conjunction with CPI (with or without other modalities such as radiotherapy) following surgical removal of a primary or metastatic tumor or in the establishment of minimal residual disease in order to prevent recurrence of tumor. The invention also encompasses polytherapies that have additive potency or an additive therapeutic effect and that at the same time reduce or avoid unwanted or adverse effects. The invention also covers synergistic combinations where the therapeutic efficacy is greater than the additive one, while the unwanted or adverse effects QecQnn / zznz / E / YiAi are reduced or avoided. In certain embodiments the methods - 174 of the invention allow the treatment or prevention of diseases and disorders where the treatment is improved by an improved antitumor response using lower and / or less frequent doses of CpG ODN and / or CPI to reduce the incidence of unwanted or adverse effects caused by the administration of CpG ODN alone and / or CPI alone, and at the same time maintain or increase the efficacy of the treatment, preferably by increasing patient compliance, improving therapy and / or reducing unwanted or adverse effects. METHODS OF THE INVENTION One aspect of the invention is a method of treating a cancerous tumor, comprising administering to a subject in need thereof an effective amount of a TLR9 agonist and a checkpoint inhibitor (CPI), wherein the TLR9 agonist is administered within or substantially adjacent to the tumor. In certain embodiments, the TLR9 agonist induces INF-α. In certain embodiments, the TLR9 agonist is CpG DNA. In certain embodiments, the TLR9 agonist is selected from the group consisting of class A CpG DNA, class C CpG DNA, class E CpG DNA, class P CpG DNA and any combination thereof. QecQnn / zznz / E / YiAi - 175In certain embodiments, the TLR9 agonist is a class A CpG DNA. In certain embodiments, the TLR9 agonist is a class C CpG DNA. In certain embodiments, the TLR9 agonist is a class E CpG DNA. In certain embodiments, the TLR9 agonist is a class A / E CpG DNA. In certain embodiments, the TLR9 agonist is a class P CpG DNA. In certain embodiments, the TLR9 agonist is a sequence that is provided as: 5'-GGGGGGGGGGGACGATCGTCGGGGGGGGGG-3' (SEQ ID NO: 82). In certain embodiments, the TLR9 agonist is a circular CpG DNA with a native backbone, for example, MGN1703. In certain embodiments, the TLR9 agonist is an unmodified native CpG DNA administered in a formulation comprising a nanoparticle, VLP, ISCOM or other nuclease-resistant delivery vehicle. In certain embodiments, the CPI is administered systemically. In certain embodiments, the CPI is an antibody or fragment thereof that binds antigen which binds QPCQnn / zznz / E / YiAi specifically to an antigen that is selected from the group - 176which consists of PD-1, PD-L1 and CTLA-4. In certain embodiments, the CPI is an antibody or a fragment thereof that binds to antigen which specifically binds to PD-1. In certain embodiments, the CPI is an antibody or antigen-binding fragment which specifically binds to PD-L1. In certain embodiments, the CPI is an antibody or fragment thereof that binds to antigen which specifically binds to CTLA-4. In certain embodiments, the CPI is not an antibody or fragment thereof that binds to antigen which specifically binds to PD-1. In certain embodiments, the CPI is not an antigen-binding antibody or fragment thereof which specifically binds to PD-L1. In certain embodiments, the CPI is not an antibody or fragment thereof that binds to antigen which specifically binds to CTLA-4. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to CTLA-4, and (ii) a second antigen-binding antibody or fragment thereof. which specifically binds to an antigen that is selected from the group consisting of PD-1 and PD-L1. QPCQnn / zznz / E / YiAi - 177In certain embodiments, the CPI comprises: (i) a first antibody or fragment thereof that binds to antigen which specifically binds to CTLA-4, and (ii) a second antibody or fragment thereof that binds to antigen which specifically binds to PD-1. In certain embodiments, the CPI comprises: (i) a first antibody or fragment thereof that binds antigen which specifically binds CTLA-4, and (ii) a second antibody or fragment thereof that binds antigen which specifically binds PD-L1. In certain embodiments, the CPI comprises: (i) a first antibody or fragment thereof that binds antigen which specifically binds CTLA-4, and (ii) a second antibody or fragment thereof that binds antigen which specifically binds TIM3. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to CTLA-4, and (ii) a second antigen-binding antibody or fragment thereof which specifically binds to LAG3. In certain embodiments, the CPI comprises: (i) a first antibody or antigen-binding fragment thereof which specifically binds to PD-1, and (ii) a second antibody or antigen-binding fragment thereof which which specifically binds to PD-L1. QPCQnn / zznz / E / YiAi - 178 In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds PD-1, and (ii) a second antigen-binding antibody or fragment thereof which specifically binds to TIM3. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to PD-1, and (ii) a second antigen-binding antibody or fragment thereof which is specifically binds LAG3. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to PD-1, and (ii) a second antigen-binding antibody or fragment thereof which is specifically binds TIM3. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to PD-1, and (ii) a second antigen-binding antibody or fragment thereof which is specifically binds LAG3. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to TIM3, and (ii) a second antigen-binding antibody or fragment thereof which is specifically binds LAG3. QPCQnn / zznz / E / YiAi - 179In certain embodiments, the CPI comprises a bispecific antibody or fragment thereof that binds to a bispecific antigen which specifically binds to CTLA4 and an antigen that is selected from the group consisting of PD-1 and PD-L1. In certain embodiments, the CPI comprises a bispecific antibody or a fragment thereof that binds to a bispecific antigen which specifically binds to CTLA-4 and PD-1. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to CTLA-4 and PD-L1. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to CTLA-4 and TIM3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to CTLA-4 and LAG3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to PD-1 and PD-L1. QecQnn / zznz / E / YiAi - 180 In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to PD-1 and TIM3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof, which specifically binds to PD-1 and LAG3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof, which specifically binds to PD-L1 and TIM3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof, which specifically binds to PD-L1 and LAG3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof, which specifically binds to TIM3 and LAG3. In certain embodiments, the TLR9 agonist is administered prior to administration of the CPI. In certain embodiments, the TLR9 agonist and the CPI are administered substantially at the same time. In certain embodiments, the cancerous tumor is a QPCQnn / zznz / E / YiAi - 181lymphoma or a cancerous tumor of a tissue that is selected from the group consisting of skin, upper respiratory and digestive tracts, esophagus, stomach, liver, colon, rectum, pancreas, lung, breast, cervix, ovary, kidney, bladder, prostate, thyroid, brain, muscle and bone. In certain embodiments, the cancerous tumor is melanoma. In certain embodiments, the cancerous tumor is lymphoma. In certain embodiments, the cancerous tumor is a cancer of the bone marrow. In certain embodiments, the cancerous tumor is a carcinoid tumor. In certain embodiments, the cancerous tumor is neuroblastoma. In certain embodiments, the subject is a human. One aspect of the invention is a method of treating a cancerous tumor, comprising administering to a subject in need thereof an effective amount of radiotherapy, a TLR9 aqonist, and a checkpoint inhibitor (CPI). wherein the radiotherapy is initiated prior to administration of the TLR9 agonist and the TLR9 agonist is administered within or substantially adjacent to the tumor. In certain modalities, radiation therapy is QPCQnn / zznz / E / YiAi 182radiotherapy. In certain modalities the radiotherapy is hypofractionated radiotherapy. In certain embodiments the agonist of TLR9 induces QPCQnn / zznz / E / YiAi IFN-a. of CpG. In In certain certain selects from the group of CpG class C, DNA modalities that of any combination of In certain cases the agonist of TLR9 is DNA DNA DNA DNA DNA DNA a of of of of of of consists CpG class A. In certain CpG class C. In certain CpG class E. In certain CpG class A / E. In certain CpG class P. In certain CpG DNA agonist CpG class TLR9 class A DNA CpG class se DNA the same. modalities modalities modalities modalities modalities modalities sequence provided as: the the the the the the agonist agonist agonist agonist agonist agonist 5'-GGGGGGGGGGGACGATCGTCGGGGGGGGGG-3' of of of of of of TLR9 TLR9 TLR9 TLR9 TLR9 TLR9 is is is is a a a a a (SEQ ID NO: - 183In certain embodiments, the TLR9 agonist is a circular CpG DNA with a native backbone, for example, MGN1703. In certain embodiments, the TLR9 agonist is an unmodified native CpG DNA administered in a formulation comprising a nanoparticle, VLP, ISCOM or other nuclease-resistant delivery vehicle. In certain embodiments, the CPI is administered systemically. In certain embodiments, the CPI is an antigen-binding antibody or fragment thereof which specifically binds to an antigen that is selected from the group consisting of PD-1, PD-L1 and CTLA-4. In certain embodiments, the CPI is an antibody or antigen-binding fragment thereof which specifically binds to PD-1. In certain embodiments, the CPI is an antibody or antigen-binding fragment which specifically binds to PD-L1. In certain embodiments, the CPI is an antigen-binding antibody or fragment thereof which specifically binds to CTLA-4. In certain embodiments, the CPI is not an antigen-binding antibody or fragment thereof which specifically binds to PD-1. QPCQnn / zznz / E / YiAi - 184In certain embodiments, the CPI is not an antibody or fragment thereof that binds to antigen which specifically binds to PD-L1. In certain embodiments, the CPI is not an antigen-binding antibody or fragment thereof which specifically binds to CTLA-4. In certain embodiments, the CPI comprises: (i) a first antibody or fragment thereof that binds to antigen which specifically binds to CTLA-4, and (ii) a second antibody or fragment thereof that binds to antigen. which specifically binds to an antigen that is selected from the group consisting of PD-1 and PD-L1. In certain embodiments, the CPI comprises: (i) a first antibody or fragment thereof that binds to antigen which specifically binds to CTLA-4, and (ii) a second antibody or fragment thereof that binds to antigen. which specifically binds to PD-1. In certain embodiments, the CPI comprises: (i) a first antibody or fragment thereof that binds to antigen which specifically binds to CTLA-4, and (ii) a second antibody or fragment thereof that binds to antigen. which specifically binds to PD-L1. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to CTLA-4, and (ii) a QPCQnn / zznz / E / YiAi - 185second antibody or fragment thereof that binds antigen which specifically binds to TIM3. In certain embodiments, the CPI comprises: (i) a first antibody or fragment thereof that binds antigen which specifically binds CTLA-4, and (ii) a second antibody or fragment thereof that binds antigen which specifically binds LAG3. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to PD-1, and (ii) a second antigen-binding antibody or fragment thereof which is specifically binds PD-L1. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to PD-1, and (ii) a second antigen-binding antibody or fragment thereof which is specifically binds TIM3. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to PD-1, and (ii) a second antigen-binding antibody or fragment thereof which is specifically binds LAG3. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to PD-L1, and (ii) a QecQnn / zznz / E / YiAi - 186second antibody or fragment thereof that binds antigen which specifically binds to TIM3. In certain embodiments, the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which specifically binds to PD-L1, and (ii) a second antigen-binding antibody or fragment thereof which is specifically binds LAG3. In certain embodiments, the CPI comprises: (i) a first antibody or fragment thereof that binds antigen which specifically binds to TIM3, and (ii) a second antibody or fragment thereof that binds antigen which binds specifically to LAG3. In certain embodiments, the CPI comprises a bispecific antibody or antigen-binding fragment thereof, which bispecific specifically binds to CTLA-4 and an antigen selected from the group consisting of PD-1 and PD-L1. In certain embodiments, the CPI comprises a bispecific antibody or antigen-binding fragment thereof, which bispecific specifically binds to CTLA-4 and PD-1. In certain embodiments, the CPI comprises a bispecific antibody or antigen-binding fragment thereof, which bispecific specifically binds to CTLA-4 and PD-L1. QecQnn / zznz / E / YiAi - 187In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to CTLA-4 and TIM3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to CTLA-4 and LAG3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to PD-1 and PD-L1. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to PD-1 and TIM3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to PD-1 and LAG3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof which specifically binds to PD-L1 and TIM3. QPCQnn / zznz / E / YiAi In certain embodiments, the CPI comprises a - 188bispecific antibody or a fragment thereof that binds to antigen, bispecific which specifically binds to PD-L1 and LAG3. In certain embodiments, the CPI comprises a bispecific antibody or a bispecific antigen-binding fragment thereof, which specifically binds to TIM3 and LAG3. In certain embodiments, the TLR9 agonist is administered prior to administration of the CPI. In certain embodiments, the TLR9 agonist and the CPI are administered substantially at the same time. In certain embodiments, the cancerous tumor is a lymphoma or a cancerous tumor of a tissue that is selected from the group consisting of skin, upper respiratory and digestive tract, esophagus, stomach, liver, colon, rectum, pancreas, lung, breast, neck uterus, ovary, kidney, bladder, prostate, thyroid, brain, muscle and bone. In certain embodiments, the cancerous tumor is melanoma. In certain embodiments, the cancerous tumor is lymphoma. In certain embodiments, the cancerous tumor is a cancer of the bone marrow. In certain embodiments, the cancerous tumor is a QPCQnn / zznz / E / YiAi carcinoid tumor. - 189In certain embodiments, the cancerous tumor is neuroblastoma. In certain embodiments, the subject is a human. One aspect of the invention is a method of treating a cancerous tumor, comprising administering to a subject in need thereof an effective amount of a TLR9 agonist, a first checkpoint inhibitor (CPI) and a second CPI, wherein the TLR9 agonist and the first CPI are administered within or substantially adjacent to the tumor, and the second CPI is administered systemically. In certain embodiments, the TLR9 agonist induces IFN-α. In certain embodiments, the TLR9 agonist is CpG DNA. In certain embodiments, the TLR9 agonist is selected from the group consisting of class A CpG DNA, class C CpG DNA, class E CpG DNA, class P CpG DNA and any combination thereof. In certain embodiments, the TLR9 agonist is a class A CpG DNA. In certain embodiments, the TLR9 agonist is a class C CpG DNA. In certain embodiments, the TLR9 agonist is a class E CpG DNA. QPCQnn / zznz / E / YiAi - 190 In certain embodiments, the TLR9 agonist is a class A / E CpG DNA. In certain embodiments, the TLR9 agonist is a class P CpG DNA. In certain embodiments, the TLR9 agonist has a sequence provided as: 5'-GGGGGGGGGGGACGATCGTCGGGGGGGGGG-3' (SEQ ID NO: 82). In certain embodiments, the TLR9 agonist is a circular CpG DNA with a native backbone, for example, MGN1703. In certain embodiments, the TLR9 agonist is an unmodified native CpG DNA administered in a formulation comprising a nanoparticle, VLP, ISCOM or other nuclease-resistant delivery vehicle. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to CTLA-4. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to CTLA-4; and the second CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-1. In certain embodiments, the first CPI is an antibody or fragment thereof that binds antigen which QPCQnn / zznz / E / YiAi - 191specifically binds to CTLA-4; and the second CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-L1. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to CTLA-4; and the second CPI is an antigen-binding antibody or fragment thereof which specifically binds to TIM3. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to CTLA-4; and the second CPI is an antigen-binding antibody or fragment thereof which specifically binds to LAG3. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-1. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-1; and the second CPI is an antigen-binding antibody or fragment thereof which specifically binds to CTLA-4. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-1; and the second CPI is an antibody or fragment thereof that binds to antigen the QecQnn / zznz / E / YiAi - 192which specifically binds to PD-L1. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-1; and the second CPI is an antigen-binding antibody or fragment thereof which specifically binds to TIM3. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-1; and the second CPI is an antigen-binding antibody or fragment thereof which specifically binds to LAG3. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-L1. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-L1; and the second CPI is an antigen-binding antibody or fragment thereof which specifically binds to CTLA-4. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-L1; and the second CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-1. In certain embodiments, the first CPI is a QPCQnn / zznz / E / YiAi - 193antibody or fragment thereof that binds antigen which specifically binds to PD-L1; and the second CPI is an antibody or fragment thereof that binds to antigen which specifically binds to TIM3. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to PD-L1; and the second CPI is an antibody or fragment thereof that binds to antigen which specifically binds to LAG3. In certain embodiments, the first CPI is an antibody or fragment thereof that binds antigen which specifically binds TIM3. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to TIM3; and the second CPI is an antibody or fragment thereof that binds to antigen which specifically binds to CTLA-4. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to TIM3; and the second CPI is an antibody or fragment thereof that binds to antigen which specifically binds to PD-1. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to TIM3; and the second CPI is a QecQnn / zznz / E / YiAi - 194antibody or fragment thereof that binds to antigen which specifically binds to PD-L1. In certain embodiments, the first CPI is an antibody or antigen-binding fragment thereof which specifically binds to TIM3; and the second CPI is an antibody or fragment thereof that binds to antigen which specifically binds to LAG3. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to LAG3. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to LAG3; and the second CPI is an antibody or fragment thereof that binds to antigen which specifically binds to CTLA-4. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to LAG3; and the second CPI is an antibody or fragment thereof that binds to antigen which specifically binds to PD-1. In certain embodiments, the first CPI is an antigen-binding antibody or fragment thereof which specifically binds to LAG3; and the second CPI is an antibody or fragment thereof that binds to antigen which specifically binds to PD-L1. QPCQnn / zznz / E / YiAi - 195In certain embodiments, the first CPI is an antibody or fragment thereof that binds antigen which specifically binds to LAG3; and the second CPI is an antibody or fragment thereof that binds to antigen which specifically binds to TIM3. In certain embodiments, the TLR9 agonist is administered prior to administration of the first CPI. In certain embodiments, the TLR9 agonist and the first CPI are administered substantially at the same time. In certain embodiments, the TLR9 agonist is administered after administration of the first CPI. In certain embodiments, the cancerous tumor is a lymphoma or a cancerous tumor of a tissue that is selected from the group consisting of skin, upper respiratory and digestive tract, esophagus, stomach, liver, colon, rectum, pancreas, lung, breast, neck uterus, ovary, kidney, bladder, prostate, thyroid, brain, muscle and bone. In certain embodiments, the cancerous tumor is melanoma. In certain embodiments, the cancerous tumor is lymphoma. In certain embodiments, the cancerous tumor is a cancer of the bone marrow. In certain embodiments, the cancerous tumor is a QPCQnn / zznz / E / YiAi carcinoid tumor. - 196In certain embodiments, the cancerous tumor is neuroblastoma. In certain embodiments, the subject is a human. In certain embodiments, the method includes administering to a subject in need thereof an effective amount of radiotherapy (XRT). Standard XRT doses range from 1.8 to 2.2 Gy / day, but recent research indicates that the immune effects of XRT on tumors can be increased by using XRT at doses of 3 to 20 Gy / d for 1 to 20 Gy / d. 3 days. Those skilled in the art will recognize that different tumors have varying levels of radiosensitivity and the amount of XRT intensity will be adjusted accordingly. In certain embodiments, radiation therapy is radiotherapy. In certain embodiments, the radiation therapy is hypofractionated radiation therapy. V. ADDITIONAL POLYTHERAPY The methods of the invention can be used in conjunction with other cancer treatments including chemotherapy, other immunotherapy, radiotherapy, hormonal therapy and the like. Conventional chemotherapeutics and targeted antineoplastic agents have been developed based on the simplistic notion that cancer is a genetic or epigenetic disease of QecQnn / zznz / E / YiAi - 197 autonomous cells. However, it is becoming clear that many of the available anticancer drugs have collectively salvaged millions of years of half-life therapeutic effects by inducing de novo immune responses or by reactivating preexisting tumor-specific immune responses. Increasing evidence indicates that the therapeutic efficacy of several antineoplastic agents is based on their ability to alter the tumor-host interaction, shifting the balance toward the activation of an immune response specific to malignant cells. For example, Table 1 lists certain FDA-approved anticancer agents whose effectiveness is reduced by immune deficiencies (Zitvogel L. et al., Immunity 2013 39(1):74-88). QPCQnn / zznz / E / YiAi TABLE 1 Agents Tumor Immune defects 5-fluorouracil lymphomas EL4 genotype Nu / Nu anthracyclines colorectal carcinomas CT26, fibrosarcomas MCA205, MCA-induced tumors genotype Nu / Nu, suppression of CD8+ or γ / δ T lymphocytes, CDllb blockade, neutralization of IL1, IL- 17 or IFN-y - 198- ATRA + arsenic trioxide APL murine SCID phenotype arsenic trioxide colorectal cancers CT26 Nu / Nu genotype cisplatin + digoxin fibrosarcomas MCA205 Nu / Nu genotype cyclophos famide mesotheliomas AB1- H1 Ifngr2~7~, Tnfsfl0~7~, suppression of CD8+ T lymphocytes or NK cells dasatinib mast cell tumors P815 suppression of CD4+ or CD8 + T lymphocytes gemcitabine AB12 mesotheliomas, EJ6-2 fibrosarcomas, EL4 lintomas, TC1 insulinomas Nu / Nu genotype imatinib AK7 mesotheliomas, B16 melanomas, RMA-S lintomas GIST developed in Kitv5587+ mice cell suppression NK Ragl~7~, suppression of CD8+ T lymphocytes mitomycin C + digoxin fibrosarcomas MCA205 genotype Nu / Nu QPCQnn / zznz / E / YiAi - 199- oxaliplatin colorectal carcinomas CT26, fibrosarcomas MCA205 Nu / Nu genotype paclitaxel Ret-driven melanomas CD8+ T cell suppression PLX4720 (BRAF inhibitor) SM1WT1 melanomas Ccr2~ / ~, Ifng'^, Prfl~d~ , CD8+ T cell suppression Table 1 Abbreviations: APL, Leukemia Acute promyelocytic QPCQnn / zznz / E / YiAi; ATRA, all-trans retinoic acid; BRAF, B-Raf; GIST, gastrointestinal stomal tumor, IFN, interferon; IL, interleukin; MCA, 3-methylchloranthrene; NK, natural cytolytic; SCID, severe combined immunodeficiency. SAW. DOSAGE REGIMES Dosing regimens can be adjusted to provide an optimal desired response. For example, a single bolus may be administered, several divided doses may be administered over time, or the dose may be reduced or increased proportionately as indicated by the demands of the therapeutic situation. It is essentially advantageous to formulate parenteral compositions in unit dosage form. - 200 for ease of administration and dosage uniformity. Unit dosage form, as used herein refers to physically discontinuous units suitable as unit dosages for mammalian subjects to be treated; Each unit contains a predetermined amount of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification of the unit dosage forms of the invention is indicated by and depends directly on: (a) the unique characteristics of the active compound and the particular therapeutic or prophylactic effect to be obtained, and (b) the inherent limitations in the scope of preparation of compounds such as an active compound for sensitivity treatment in individuals. Thus, a person skilled in the art will appreciate, based on the description provided herein, that the dose and dosage regimen are adjusted according to methods well known in the therapeutic field. That is, the maximum tolerable dose can be easily established and the effective amount that provides a detectable therapeutic benefit to a patient can also be determined as well as the temporal requirements for administration of each agent to provide a detectable therapeutic benefit to the patient. QPCQnn / zznz / E / YiAi - 201patient. Accordingly, although certain doses and administration regimens are exemplified herein, these examples in no way limit the dose or administration regimen that can be provided to a patient when practicing the present invention. Furthermore, a person skilled in the art will understand, given the teachings provided herein, that the therapeutic benefit such as, but not limited to, detectable decrease in tumor size and / or metastasis, and increased recurrence time, among many other parameters, can be determined by a wide variety of methods known in the art to determine the effectiveness of a cancer treatment and these methods are covered herein as well as methods that are developed in the future. It should be noted that dosage values may vary with the type and severity of the condition to be alleviated and may include single or multiple doses. It should further be understood that for any particular subject the specific dosage regimens should be adjusted with respect to time in accordance with the individual needs and professional judgment of the person administering or supervising the administration of the compositions and that the dosage intervals that set forth herein are exemplary only and are not QPCQnn / zznz / E / YiAi - 202are intended to limit the scope or practice of the claimed composition. For example, doses may be adjusted based on pharmacokinetic or pharmacodynamic parameters which may include clinical effects such as toxic effects and / or laboratory values. Thus, the present invention encompasses an intrapatient dose increase as determined by a person skilled in the art. The determination of appropriate dosages and regimens for administration of the active compound(s) is well known in the relevant art and will be understood to be within the scope of those skilled in the art once they have the teachings described herein. CpG ODN Dosage According to the methods of the present invention, the CpG ODN is administered locally to the cancerous tumor, that is, by intratumoral or peritumoral administration. Alternatively or additionally, in certain embodiments, the CpG ODN is administered locally to the cancerous tumor, for example, by intraperitoneal injection or infusion or by intravesicular instillation. Most of the prior art with CpG used subcutaneous delivery, not intratumoral or peritumoral. Intratumoral treatment in oncology is generally preferred only for the treatment of QPCQnn / zznz / E / YiAi - 203primary lesions, not in situations of metastatic diseases. The reason for this is that most intratumoral treatments have only a local effect. In some rare cases, intratumoral treatments can produce regression of distant tumor masses as a result of the induction of a specific immune response against tumor antigens present not only in the injected lesion but also in distant metastases. In the case of radiotherapy (XRT), this has been called an abscopic effect as described above. Some authors have observed cases in which abscopic effects have been induced by TLR agonists, including intratumoral TLR9 (Brody et al. J. Clin. Oncol. 2010 28(28):4324-4332; Kim et al., Blood 2012 119(2):355363), but responses have been rare and generally short-lived. The immunological effects of XRT provided prior to CpG ODN administration will disrupt the inhibitory mechanisms that normally limit the efficacy of a CpG-induced response increasing the potential for clinical response. Additionally, tumor production of IFN-α has been associated with and is required for an enhanced response to XRT (Burnette et al, Cancer Res. 2011 71:2488-2496), providing additional evidence for benefit from use of high CpG in intratumoral IFN QecQnn / zznz / E / YiAi - 204after XRT. In one form, the present invention comprises a method of enhancing the induction of abscopic responses from XRT by administering XRT, preferably hypofractionated XRT (as described in Prasanna et al.), to a cancer patient and then administering an ODN of high intratumoral or peritumoral IFN-inducing CpG in the same region of lymphatic drainage. Preferred peritumoral injections are into the same lymphatic drainage as the tumor, in order to facilitate the same APG and expose both the tumor Ag released after XRT to the tumor as well as the TLR ligand. Methods of intratumoral or peritumoral delivery of CpG ODN include not only direct injection but may also include topical delivery, intraperitoneal delivery for abdominal tumors such as ovarian, pancreatic, colon or gastric), infraocular for malignant cancers in the eye, oral for gastric and intestinal cancer, and intravesicular administration for bladder cancer. Also contemplated is intratumoral administration of CpG ODN and systemic delivery using tumor delivery vehicles such as tumor-targeting aptamers, antibody conjugates, nanoparticles, ISCOMS, VLPs, multilamellar vesicles, pH-sensitive peptides, and cationic peptides. QPCQnn / zznz / E / YiAi - 205For systemic therapy, CpG ODN can be dosed variably based on weight, body surface area, or using a fixed dose. For intratumoral or peritumoral administration, the dose of the CpG ODN is typically fixed. Doses of CpG ODN for parenteral delivery (including intratumoral and peritumoral) to induce an immune response when the CpG ODN is administered in combination with other therapeutic agents, such as the CPI of the invention, typically range from about 1 pg to 100 mg per administration, which depends on the application and can be administered daily, weekly or monthly and any other amount of time in between. In certain embodiments, the subject doses of CpG ODN for intratumoral and peritumoral administration typically range from about 10 pg to about 100 mg per administration, which depends on the application being provided on a daily, weekly or monthly basis and any other amounts of time between these. In certain embodiments, the subject doses of CpG ODN for intratumoral or peritumoral delivery typically range from about 100 pg to about 100 mg per administration, which depends on the application which may be provided on a daily, weekly or monthly basis and any other amounts. of time between these. In certain QPCQnn / zznz / E / YiAi - 206modalities, the target doses of CpG ODN for intratumoral and peritumoral delivery typically range from about 1 mg to about 100 mg per administration which depends on the application which can be provided on a daily, weekly or monthly basis and any other amount of time between these. In certain embodiments, the subject doses of CpG ODN for intratumoral or peritumoral delivery typically range from about 10 mg to about 100 mg per administration, which depends on the application being provided on a daily, weekly or monthly basis or otherwise. amount of time between these. In further embodiments, doses of CpG ODN for parenteral delivery (including intratumoral and peritumoral) to induce an immune response when administering CpG ODN in combination with other therapeutic agents, such as the CPI of the invention, typically vary from about 1 pg to about 50 mg per administration, which depends on the application which can be done daily, weekly or monthly and any other amount of time in between. In certain embodiments, the target doses of CpG ODN for intratumoral and peritumoral delivery typically range from about 10 pg to about 50 mg per administration, which depends on whether the application is to be QPCQnn / zznz / E / YiAi - 207perform daily, weekly or monthly or any other amount of time in between. In certain embodiments, the subject doses of CpG ODN for intratumoral and peritumoral delivery typically range from about 100 pg to about 50 mg per administration, which depends on whether the application can be delivered on a daily, weekly or monthly basis and any other amounts. time between these. In certain embodiments, the subject doses of CpG ODN for intratumoral and peritumoral delivery typically range from about 1 mg to about 50 mg per administration, which depends on whether the application is to be delivered on a daily, weekly or monthly basis and any other amount of time between these. In certain embodiments, the subject doses of CpG ODN for intratumoral and peritumoral delivery typically range from about 10 mg to about 50 mg per administration, which depends on whether the application can be delivered on a daily, weekly or monthly basis or any other amount. of time between these. In further embodiments, doses of CpG ODN for parenteral administration (including intratumoral and peritumoral) to induce an immune response when the CpG ODN is administered in combination with other therapeutic agents, such as the CPI of the invention, typically varies from approximately - 2081 pg at approximately 10 mg per administration, which, depending on the application, can be given daily, weekly or monthly or any other amount of time in between. In certain embodiments, the subject doses of CpG ODN for intratumoral and peritumoral administration typically range from about 10 pg to about 10 mg per administration, which depends on the application which may be delivered on a daily, weekly or monthly basis or any other amount. of time between these. In certain embodiments, the subject doses of CpG ODN for intratumoral and peritumoral administration typically range from about 100 pg to about 10 mg per administration, which depending on the application may be administered daily, weekly or monthly or any other amount. time between these. In certain embodiments, the subject doses of CpG ODN for intratumoral and peritumoral administration typically range from about 1 mg to about 10 mg per administration, which depending on the application may be provided daily, weekly or monthly or any other amount. time between these. In further embodiments, doses of CpG ODN for parenteral administration (including intratumoral and peritumoral) to induce a response QecQnn / zznz / E / YiAi - 209immunological response when the CpG ODN is administered in combination with other therapeutic agents, such as the CPI of the invention, typically ranges from approximately 1 pg to approximately 1 mg per administration, which depending on the application can be provided daily. , weekly or monthly and any other amount of time in between. In certain embodiments, the subject doses of CpG ODN for intratumoral and peritumoral administration typically range from about 10 pg to about 1 mg per administration, which depending on the application can be delivered daily, weekly or monthly or any other amount. time between these. In certain embodiments, the subject doses of CpG ODN for intratumoral and peritumoral administration typically range from about 100 pg to about 1 mg per administration, which depending on the application can be provided on a daily, weekly or monthly basis and any other amount of time between these. For each of the fixed doses described above, in certain embodiments the dose will be administered in a volume of less than or equal to about 1 ml. In certain embodiments, the dose will be administered in a volume of about 0.1 ml to about 1 ml. In other embodiments, the dose volume will be up to - 210approximately 4 ml, which is usually used for intratumoral injection of certain eneolytic viruses, such as talimogene laherparepvec (T-vec). In certain embodiments of the invention, a sustained release delivery system, including for example nanoparticles, ISCOMS, VLPs and dendrimers (reviewed, for example, in Gomes Dos Santos AL et al., Curr Pharm Biotechnol. 2005 6(1) :7-15; Joshi VB et al., AAPS J. 2013 15(1): 85-94; and Arima H et al., Curr Top Med Chem. 2014 14(4): 465-77), can be used to deliver a single intratumoral or peritumoral therapeutic dose of CpG ODN. In certain embodiments of the invention, a sustained release delivery system, including for example nanoparticles, ISCOMS, VLPs and dendrimers, can be used to deliver a single intratumoral or peritumoral therapeutic dose of the CpG ODN without requiring CpG ODN. additional. As is well known in the field, individual doses are increased when a sustained administration system of any of the types well described in the literature is used. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the target dose of CpG ODN for intratumoral and peritumoral delivery typically varies from QPCQnn / zznz / E / YiAi - 211approximately 0.1 mg to approximately 500 mg per administration and is provided within one week of XRT; within a week of a checkpoint inhibitor; or within a week of both XRT and checkpoint inhibitor. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the subject dose of CpG ODN for intratumoral and peritumoral administration typically ranges from about 1 mg to about 500 mg per administration and is delivered within one week of XRT; within a week of a checkpoint inhibitor; or within a week of both XRT and checkpoint inhibitor. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the subject dose of CpG ODN for intratumoral and peritumoral administration typically ranges from about 10 mg to about 500 mg per administration and is delivered within one week of XRT; within one week of a checkpoint inhibitor or within one week of both XRT and checkpoint inhibitor. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the target dose of CpG ODN for intratumoral and peritumoral administration typically ranges from about 100 mg to - 212approximately 500 mg per administration and is delivered within one week of XRT; within one week of a checkpoint inhibitor or within one week of both XRT and checkpoint inhibitor. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the subject doses of CpG ODN for intratumoral and peritumoral administration typically range from about 0.1 mg to about 250 mg per administration and are delivered within one week of XRT; within a week of a checkpoint inhibitor; or within a week of both XRT and checkpoint inhibitor. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the subject dose of CpG ODN for intratumoral and peritumoral administration typically ranges from about 1 mg to about 250 mg per administration and is provided within one week of XRT; within a week of a checkpoint inhibitor; or within a week of both XRT and a checkpoint inhibitor. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the target dose of CpG ODN for intratumoral and peritumoral administration typically ranges from about 10 mg to - 213approximately 250 mg per administration and is delivered within a week of XRT; within a week of a checkpoint inhibitor; or within a week of both XRT and checkpoint inhibitor. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the subject dose of CpG ODN for intratumoral and peritumoral administration typically ranges from about 100 mg to about 250 mg per administration and is delivered within one week of XRT; within one week of a checkpoint inhibitor or within one week of both XRT and a checkpoint inhibitor. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the subject doses of CpG ODN for intratumoral and peritumoral administration typically range from about 0.1 mg to about 100 mg per administration and are delivered within one week of XRT; within a week of a checkpoint inhibitor; or within a week of both XRT and a checkpoint inhibitor. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the target dose of CpG ODN for intratumoral and peritumoral administration typically ranges from about 1 mg to about - 214100 mg per administration and provided within one week of XRT; within a week of a checkpoint inhibitor; or within a week of both XRT and a checkpoint inhibitor. In certain embodiments using a single administration of a sustained release formulation of CpG ODN, the subject dose of CpG ODN for intratumoral and peritumoral administration typically ranges from about 10 mg to about 100 mg per administration and is provided within one week of XRT; within one week of a checkpoint inhibitor or within one week of both XRT and checkpoint inhibitor. The desired clinical effect of the administered dose of CpG ODN can easily be followed using standard analyzes and methods well known to those skilled in the art. For example, biomarker responses to TLR9 stimulation can be measured as described elsewhere herein. CPI Antibody Dosage Certain currently commercially available anti-PD-1 antibodies have been approved in the United States for intravenous infusion dosing at 2 mg / kg body weight once every three weeks. Other currently commercially available anti-PD-1 antibodies have been approved in the United States for dosing. QPCQnn / zznz / E / YiAi - 215intravenous infusion at 3 mg / kg body weight once every two weeks. Currently commercially available anti-CTLA-4 antibodies have been approved in the United States for intravenous infusion dosing at 3 mg / kg body weight once every three weeks. According to the methods of the present invention, in certain embodiments, the CPI antibody is administered, at least in part, systemically, for example intravenously. Exemplary non-limiting doses for a therapeutically effective amount of a systemically administered CPI antibody according to the invention are: at least about 0.1 mg / kg body weight, at least about 0.3 mg / kg body weight, at least about 0.5 mg / kg body weight, at least about 1 mg / kg body weight, at least about 2 mg / kg body weight, at least about 03 mg / kg body weight, at least about 4 mg / kg body weight, at least about 5 mg / kg body weight and at least about 6 mg / kg body weight. In certain embodiments, a therapeutically effective amount of the systemically administered CPI antibody can range from about 0.1 to about 30 mg / kg body weight, about - 2160.3 at approximately 25 mg / kg body weight, approximately 1 to approximately 20 mg / kg body weight, approximately 2 to approximately 20 mg / kg body weight, approximately 3 to approximately 20 mg / kg body weight, approximately 5 at about 20 mg / kg body weight, about 10 to about 20 mg / kg body weight, about 1 to about 15 mg / kg body weight, about 2 to about 15 mg / kg body weight, about 3 to about 15 mg / kg body weight, about 5 to about 15 mg / kg body weight, about 10 to about 15 mg / kg body weight, about 1 to about 10 mg / kg body weight, about 2 to about 10 mg / kg body weight, about 3 to about 10 mg / kg body weight or about 5 to about 10 mg / kg body weight. In certain embodiments, the CPI antibody is QecQnn / zznz / E / YiAi administered sistemically 5 i a dose of at least about 0.3 mg / kg body weight, at least about 1 mg / kg body weight, at least about 2 mg / kg body weight, at least about 3 mg / kg body weight, at least about 5 mg / kg body weight, at least - 217about 6 mg / kg body weight, at least 10 mg / kg body weight, at least about 15 mg / kg body weight or at least about 20 mg / kg body weight. In certain embodiments, the CPI antibody is administered by intravenous (i.v.) infusion in a dose ranging from about 0.1 to about 50 mg / kg body weight, from about 0.3 to about 20 mg / kg body weight, from about 1 to about 15 mg / kg body weight, about 2 to about 15 mg / kg body weight, about 3 to about 15 mg / kg body weight or about 6 to about 15 mg / kg body weight. In certain embodiments, the CPI antibody is administered in an intravenous formulation as a sterile aqueous solution containing about 5 to about 20 mg / ml of CPI antibody, in an appropriate buffer system. According to the methods of the present invention, in certain embodiments, the CPI antibody is administered, at least in part, locally to the cancerous tumor, that is, by intratumoral or peritumoral administration. In certain modalities, this local administration is by direct injection while in others - 218modalities this administration can be topical delivery, intraperitoneal delivery for abdominal tumors such as ovarian, pancreatic, intraocular delivery for malignant cancers in the eye, oral delivery for gastric and intestinal cancer and intravesicular administration for bladder cancer. Also contemplated for intratumoral administration of CPI antibody are systemic delivery using tumor delivery vehicles such as tumor-targeting aptamers, nanoparticles, ISCOMS, VLPs and cationic peptides. For local, i.e. intratumoral or peritumoral, administration, the CPI antibody can advantageously be administered at a dose about 10 times lower to about 20 times lower than the systemic doses just listed above. In accordance with the present invention, CPI antibody dosing will typically be less frequent than CpG ODN dosing. For example, the anti-PD-1 antibody may be administered about once every three weeks to about once every three months. Similarly, the anti-PD-Ll antibody can be administered about once every three weeks to about once every three months. Similarly, the anti-CTLA-4 antibody can be administered approximately once every three weeks to approximately QPCQnn / zznz / E / YiAi - 219once every three months. The invention specifically contemplates dosing of CPI antibody that is more frequent than about once every three weeks and less frequent than about once every three months. Intratumoral or peritumoral CpG and systemic CPI can be given on the same or different days. For example, intratumoral or peritumoral CPI and intravenous anti-PD-1 or anti-PD-Ll can be administered on the same day or on different days. Additionally, an exemplary dose escalation protocol with respect to CpG ODN, CPI antibody, or both CpG ODN and CPI antibody can be used to determine the maximum tolerated dose (MTD), to determine the dose-limiting toxicity (DLT), if present, associated with the administration of ODN-CpG-CPI antibody polytherapy. For example, with respect to increasing doses of CPI antibody to a given dose of CpG ODN, this protocol may comprise administering increasing doses, such as, but not limited to, about 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 10 mg / kg, 12 mg / kg,15 mg / kg, or any combination thereof, more preferably, successive doses of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 2 mg / kg, 3 QecQnn / zznz / E / YiAi - 220 mg / kg, 6 mg / kg, 10 mg / kg, 15 mg / kg or 20 mg / kg that are administered and the patient is analyzed to determine toxicity, if it exists, as well as for treatment efficacy, among other parameters. These studies to determine toxicity and efficacy of dosing regimens are well known in the field. See, for example, Millward M. et al., Br. J. Cancer 2013 108(10):1998-2004. VII. PHARMACEUTICAL COMPOSITIONS In certain embodiments, the CpG ODN is formulated with a marker, for example a radiopaque marker or dye that facilitates visualization of CpG ODN delivery within and / or adjacent to the tumor to be treated. Alternatively, the CpG ODN is covalently conjugated or otherwise labeled with a compound that allows detection of the delivery area. Examples of these labels are well known in the art and include fluorescent dyes, aptamers, fluorescent RNA such as from spinach and derivatives thereof, quantum dots, gold and other nanoparticles, antibodies, etc. The CpG ODN can be administered directly to the subject or can be administered together with a nucleic acid delivery complex. A nucleic acid delivery complex shall mean an associated nucleic acid molecule (e.g., ionically or covalently linked to; or QPCQnn / zznz / E / YiAi encapsulated within) with a directed medium (for example, a - 221molecule that results in greater affinity binding with the target cell). Examples of nucleic acid delivery complexes include oligonucleotides associated with sterol (e.g., cholesterol), a lipid (e.g., a cationic lipid, virosome or liposome), or a target cell-specific binding agent (e.g., a ligand recognized by the specific receptor of the target cell). Preferred complexes may be sufficiently stable in vivo to avoid significant uncoupling prior to internalization by the target cell. However, the complex may be susceptible to cleavage under appropriate conditions within the cell so that the nucleic acid is released in a functional form. The delivery of vehicles or the provision of devices for the delivery of oligonucleotides and / or antigens to surfaces has been described. The CpG ODN and / or antigen and / or other therapeutic substances may be administered alone (e.g., in saline or buffer) or using any of the delivery vehicles known in the art. For example, the following delivery vehicles have been described: cochleates; emulsomes; ISCOMs; liposomes; live bacterial vectors (e.g. Salmonella, Escherichia coli, Bacillus, Calmette-Guerin, Shigella, Lactobacillus); viral vectors QPCQnn / zznz / E / YiAi - live viruses (for example, vaccinia, adenovirus, herpes simplex); microspheres; oligonucleotide vaccines; polymers; polymer rings; proteasomes; sodium fluoride; transgenic plants, virosomes; virus-like particles and cationic lipids, peptides or other carriers that have a charge interaction with the polyanionic oligonucleotide. Other delivery vehicles are known in the art and some additional examples are provided below in the discussion of vectors. In one embodiment, the CPI is administered parenterally (e.g., intravenously) in an aqueous solution while the CpG ODN is administered by intratumoral or peritumoral injection. Preferred formulations and dosage forms of the CpG ODN are described in U.S. Patent Application Publication No. number US 2004 / 0198680, the description of which is incorporated herein by reference in its entirety. However, persons skilled in the art will understand, based on the description provided herein, that the invention is not limited to these or any other formulation, dosage, route of administration and the like. Thus, the following discussion describes various formulations for practicing the methods of the invention comprising the administration of any CPI antibody in combination with a CpG ODN but the invention is not limited - 223 to these formulations, but comprises any formulation as can be easily determined by a person skilled in the art once with knowledge of the teachings provided herein for use in the methods of the invention. The antibodies used in the invention can be incorporated into pharmaceutical compositions suitable for administration to a subject. Typically, the pharmaceutical composition comprises the antibody and a pharmaceutically acceptable carrier. As used herein, a pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like that are physiologically compatible. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate-buffered saline, dextrose, trehalose, glycerol, ethanol and the like as well as combinations thereof. In many cases, it will be preferable to include isotonic agents, for example sugars, polyalcohols such as mannitol, sorbitol or sodium chloride in the composition. Pharmaceutically acceptable substances such as humectants or minor amounts of auxiliary substances such as humectants or emulsifying agents, preservatives or buffers, QPCQnn / zznz / E / YiAi - 224which increase the shelf life or effectiveness of the antibody or antibody portion. Antibodies can be in a variety of forms. These include, for example, liquid, semi-solid and solid dosage forms such as liquid solutions (for example, injectable solutions and infusion solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories. The preferred form depends on the intended mode of administration and the therapeutic application. Typical preferred compositions are in the form of injectable or infusion solutions, such as compositions similar to those used for passive immunization in humans with other antibodies. The preferred mode of administration is parenteral (eg, intravenous, subcutaneous, intraperitoneal, intramuscular). In a preferred embodiment, the antibody is administered by intravenous infusion or injection. In another preferred embodiment, the antibody is administered by intramuscular or subcutaneous injection. Therapeutic compositions typically must be sterile and stable under manufacturing and storage conditions. The composition can be formulated as a solution, microemulsion, dispersion, liposome or other ordered structure suitable for high concentration of the drug. Sterile injectable solutions can be - 225prepare by incorporating the antibody in the required amount in an appropriate solvent with one or a combination of ingredients listed above, as required, followed by sterilization by filtration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the other required ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and lyophilization which provides a powder of the active ingredient plus any additional desired ingredient from a solution previously sterilized by filtration thereof. The proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersion and by the use of surfactants. Prolonged absorption of injectable compositions can be accomplished by including in the composition an agent that delays absorption, for example monostearate salts and gelatin. The CpG ODN can be administered by a variety of methods known in the art including, without limitation, local injection or infusion into and / or - 226adjacent to a tumor. As used herein, tumor or intratumoral means anywhere generally within the margins of a tumor. As used herein, adjacent to a tumor or peritumoral means anywhere generally within approximately a 2.5 cm thick zone surrounding the margins of a tumor. The invention also contemplates local injection or infusion of the CpG ODN into and / or adjacent to a tumor bed following surgical removal of a tumor. Needle-free injection can be used if desired. In certain embodiments, the CpG ODN can be administered locally to the lung by inhalation or bronchoalveolar lavage. As experts in the field will appreciate, the route and / or mode of administration will vary depending on the results desired. CPI can be administered by a variety of methods known in the art including, without limitation, oral, parenteral, mucosal, inhalation, topical, buccal, nasal and rectal. For certain therapeutic applications the preferred route / mode of administration is subcutaneous, intramuscular, intravenous or infusion. If desired, needle-free injection can be used. As will be appreciated by experts in the field, the route and / or mode of administration will vary depending on the results obtained. QPCQnn / zznz / E / YiAi wish. - 227Dosing regimens can be adjusted to provide the optimal desired response. For example, a single bolus may be administered, multiple doses may be administered divided over time, or the dose may be reduced or increased proportionally as indicated by the demands of the therapeutic situation. It is especially advantageous to formulate parenteral compositions in unit dosage form for ease of administration and dosage uniformity. Unit dosage form, as used herein, refers to physically separate units suitable as unit dosages for the mammalian subjects to be treated; Each unit contains a predetermined amount of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the unit dosage forms of the invention are determined by, and depend directly on: (a) the unique characteristics of the antibody and the particular therapeutic or prophylactic effect to be obtained, and (b) the inherent limitations in the field of compound preparation such as an active compound for the treatment of sensitivity in individuals. It is noted that dosage values may vary with the type and severity of the condition being treated. QPCQnn / zznz / E / YiAi - 228will provide relief and may include single or multiple doses. It should further be understood that for any particular subject, the specific dosage regimens may be adjusted with respect to time according to the individual needs and professional judgment of the person administering or supervising the administration of the compositions and that the dosage intervals The provisions set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition. In one embodiment the antibody is administered in an intravenous formulation as a sterile aqueous solution containing 5 to 10 mg / ml of antibody, with sodium acetate, polysorbate 80 and sodium chloride at a pH ranging from about 5 to 6. Preferably , the intravenous formulation is a sterile aqueous solution containing 5 to 10 mg / ml of antibody, with 20 mM sodium acetate, 0.2 mg / ml of polysorbate 80 and 140 mM sodium chloride at pH 5.5. In one embodiment, part of the dose is administered by an intravenous bolus and the remainder by infusion of the antibody formulation. For example, an intravenous injection of 0.01 mg / kg of the antibody can be delivered as a bolus and the remainder of a predetermined antibody dose can be administered by intravenous injection. A predetermined dose can be administered QecQnn / zznz / E / YiAi - 229of the antibody, for example, for a period of one and a half hours to two hours to five hours. The formulations of the pharmaceutical compositions described herein can be prepared by any method known or later developed in the field of pharmacology. Generally, these preparation methods include the steps of placing the active ingredient in association with a carrier or one or more additional accessory ingredients and then, if necessary or desirable, forming or packaging the product into a desired single or multiple dosage unit. . A pharmaceutical composition of the invention may be prepared, packaged or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a unit dose is a separate amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of this dosage such as, for example, one-half or one-third of this dosage. The relative amounts of the active ingredient, the pharmaceutically acceptable carrier and any additional ingredients in a pharmaceutical composition of the QPCQnn / zznz / E / YiAi - 230invention will vary, based on the identity, size and condition of the treated subject and also depending on the route by which the composition will be administered. By way of example, the composition may comprise between 0.1% and 100% (w / w) of active ingredient. In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more pharmaceutically active agents. Particularly contemplated are additional agents including anti-emetics, anti-diarrheals, chemotherapeutic agents, cytosines and the like. Controlled or sustained release formulations of a pharmaceutical composition of the invention can be prepared using conventional technology. As used herein, parenteral administration of a pharmaceutical composition includes any route of administration characterized by physical separation of a tissue from a subject and administration of the pharmaceutical composition through the gap in the tissue. Parenteral administration in this manner includes but is not limited to administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a non-surgical wound that penetrates fabric, and the like. QPCQnn / zznz / E / YiAi - 231In particular, parenteral administration is contemplated to include, but is not limited to, intravenous, intraperitoneal, intramuscular, subcutaneous, intracisternal and kidney dialysis infusion techniques. Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier such as sterile water or sterile isotonic saline. These formulations can be prepared, packaged or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged or sold in unit dosage form, such as in vials or multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable or biodeqradable sustained release formulations, as described below. These formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry form (e.g., powder or granular). - 232for reconstitution with a suitable vehicle (for example sterile pyrogen-free water) before parenteral administration of the reconstituted composition. A composition of the present invention can be administered by a variety of methods known in the art. The route and / or mode of administration varies based on the desired results. Active compounds can be prepared with carriers that protect the compound from rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid. Many methods for the preparation of these formulations are described, for example, in Sustained and Controlled Release Drug Delivery Systems, J. R. Robinson, ed., Marcel Dreker, Inc., New York (1978). The pharmaceutical compositions are preferably manufactured under GMP conditions. The pharmaceutical compositions may be prepared, packaged or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution can be formulated according to the known technique and can comprise, in addition to the active ingredient, - 233additional ingredients such as the dispersing agents, wetting agents or suspending agents described herein. These sterile injectable formulations can be prepared using a non-toxic parenterally acceptable diluent or solvent such as water or 1,3-butanediol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic monoglycerides or diglycerides. Other parenterally administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form, in a liposomal preparation or as a component of a biodegradable polymer system. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a poorly soluble polymer or a poorly soluble salt. The CpG ODN and CPI active ingredient of the components of the invention can be administered to an animal, preferably a mammal, more preferably a human. The precise dosage administered for each active ingredient will vary depending on various factors including but not limited to the type of QPCQnn / zznz / E / YiAi - 234animal and type of disease state being treated, the age of the animal and one or more of the routes of administration. The CpG and CPI ODN active ingredient of the components of the invention can be co-administered with any of numerous other compounds (antihormonal therapy agents, cytosines, anti-cytosine antibodies or anti-cytosine receptor antibodies, indoleamine 2 inhibitors ,3-dioxygenase (IDO) or tryptophan 2,3-dioxygenase (TDO), chemotherapeutics, antibiotics and / or antiviral agents, among many others). Alternatively, these other compounds may be administered one hour, one day, one week, one month, or even more, in advance of the CpG-CPI ODN combination or any permutation thereof. Furthermore, these other compounds can be administered one hour, one day, one week or even more after the administration of radiation, blastocyst transplantation or administration of any therapeutic agent (for example cytosine, chemotherapeutic compound and the like) or any permutation of the themselves. The frequency and regimen of administration will be readily apparent to those skilled in the art and will depend on any number of factors such as, but not limited to, the type and severity of the disease being treated, age and QPCQnn / zznz / E / YiAi - 235health status of the animal, the identity of the compound or compounds being administered and the route of administration of the various compounds and the like. Several instructive examples are provided demonstrating methods of co-delivering CpG-CPI ODN to treat cancer but the invention is in no way limited to these examples which merely serve to illustrate the methods encompassed by the invention. VIII. KITS The invention includes various kits for cancer treatment. The kits comprise a therapeutically effective amount of a CpG ODN and a therapeutically effective amount of a CPI along with instructional materials which describe the use of the combination to carry out the methods of the invention. In certain embodiments, the kits comprise a therapeutically effective amount of CpG ODN and a therapeutically effective amount of a CPI antibody, along with instructional materials which describe the use of the combination to carry out the methods of the invention. Although exemplary kits are described below, the contents of other useful kits will be apparent to those skilled in the art based on the present description. Each of these kits is included within the QPCQnn / zznz / E / YiAi invention. - 236In one embodiment, the invention encompasses a kit comprising any combination of CpG ODN and an anti-PD-1 antibody. Although this kit is preferred, the invention is not limited to this particular combination. Additionally, the kit may comprise a wide variety of additional agents for the treatment of cancer. These agents are set out above and include chemotherapeutic compounds, cancer vaccines, TLR agonists in addition to CpG ODNs, other CpG ODNs, receptor tyrosine kinase inhibitors (such as, but not limited to SU11248), agents useful for treating abnormal cell or cancer growth, antibodies or other ligands that inhibit tumor growth by binding to IgF-lR, a chemotherapeutic agent (taxane, vinca alkaloid, platinum compound, intercalating antibiotics, among many others) and cytosines, among many others as well as palliative agents to treat, for example, any toxicity that arises during such treatment, but not limited to antidiarrheals, an antiemetic and the like. In one embodiment, the invention encompasses a kit comprising any combination of CpG ODN and an anti-PD-Ll antibody. Although this kit is preferred, the invention is not limited to this particular combination. Additionally, the kit may comprise a wide variety of additional agents for the treatment of cancer. These QecQnn / zznz / E / YiAi - 237 agents are set out above and include chemotherapeutic compounds, cancer vaccines, TLR agonists other than a CpG ODN, other CpG ODNs, receptor tyrosine kinase inhibitors (such as, but not limited to SU11248), agents useful for treat abnormal cell growth or cancer, antibodies or other ligands that inhibit tumor growth by binding to IgF-lR, a chemotherapeutic agent (taxane, vinca alkaloid, platinum compound, intercalating antibiotics, among many others) and cytosines, among many others as well as palliative agents to treat, for example, any toxicity that arises during such treatment, but not limited to an antidiarrheal, an antiemetic and the like. In one embodiment, the invention encompasses a kit comprising any combination of CpG ODN and an anti-CTLA-4 antibody. In one embodiment, the kit is used for both agents to be administered together via an intratumoral or peritumoral route, weekly during the course of therapy. When the anti-CTLA-4 antibody is provided by intratumoral or peritumoral administration rather than systemically, the dose will be adjusted as is customary to those skilled in the art: preferred doses of intratumoral anti-CTLA-4 antibody are provided as a fixed dose, generally in the range of 0.1 mg to 10 mg, and more preferably in QecQnn / zznz / E / YiAi - 238the range from 1 mg to 5 mg. A course of therapy may vary in length as is standard in the field but will typically be at least 12 weeks in duration. As long as patients do not develop severe toxicity and continue to have measurable tumor, treatment can continue, even over a period of several years. During vacations and interruptions for treatment are also covered. Treatment breaks may be 1 week, 2 weeks, or longer and may be provided monthly, or less frequently, or may be provided depending on the patient's tolerability. Although the kit is preferred, the invention is not limited to this particular combination. Additionally, the kit may comprise a wide variety of additional agents for the treatment of cancer. These agents are set out above and include chemotherapeutic compounds, cancer vaccines, TLR agonists other than a CpG ODN, other CpG ODNs, receptor tyrosine kinase inhibitors (such as, but not limited to, SU11248), agents useful for treat abnormal cell growth or cancer, antibodies or other ligands that inhibit tumor growth by binding to IgF-lR, a chemotherapeutic agent (taxane, vinca alkaloid, platinum compound, intercalating antibiotics, among many others) and cytosines, among many others as well as QPCQnn / zznz / E / YiAi - 239palliative agents to treat, for example, any toxicity that arises during such treatment, but not limited to an antidiarrheal, an antiemetic and the like. Having now described the present invention in detail the same will be understood more clearly with reference to the following examples, which are included herein for purposes of illustration only and are not intended to be limiting of the invention. EXAMPLES EXAMPLE 1 In order to obtain optimal synergy for a combination of a CpG ODN and a checkpoint inhibitor (+ / - XRT), the CpG ODN should be designed to induce the maximum level of type I IFN possible, with the level lowest IL-10 possible. Of the CpG ODN classes described above, the closest to this ideal is class A. In order to improve the class A ODN, it can be understood in terms of two semi-independent components: (i) the parts 5' and 3' terminals of the CpG class A ODN, and (ii) the core palindrome. The purpose of the polyG domains in the 5' and 3' terminal parts is to form G tetrads that self-assemble into nanoparticles, positioning the palindromes in a favorable manner to activate TLR9 and provide very strong multimerization of TLR9 in early endosomes, which generates a strong activation of QecQnn / zznz / E / YiAi - 240IRF3 / 7 (and subsequent INF-α secretion) without activating a more sustained signal that can lead to B cell activation and strong IL-10 production. G tetrads formed by polyG domains may also help stabilize ODN extracellularly and enhance ODN uptake into dendritic cells (DOs) and other APCs by interacting with scavenger and other cell surface binding tetrads of G. PolyG domains frequently have one or a few PS linkages at the 5' and 3' ends, but this is not required for high-level stimulation of IFN-α secretion by PDC, especially if the dosage is increased or if the ODN is delivered using a stabilizing formulation, such as a nanoparticle, VLP, ISCOM or the like. The purpose of the palindrome is to form a duplex outside the cell, stabilize a structure that will be effectively taken up by the target DO into endosomes, and then activate TLR9 in a transient manner to induce IRF3 / 7 without strong NF-κB activation. Optimization of the 5' and 3' terminal parts of ODN class A 1. G Numbers. A class A ODN described in the prior art almost always contains 5 or more consecutive Gs at both ends, or at least at one end. However, this is not required for ODN activity and in fact including less G makes the ODN much more - 241easy to synthesize and does not necessarily have a noticeable impact on the amount of IFN-α induced. In accordance with the present invention, certain preferred class A ODNs have 4 G at one or both ends while other preferred class A ODNs have one or more of 6 G, 10 G or more than 10 G at the 5' and 3' or at least at the 3' end of the ODN. 2. Number of phosphorothioate (PS) bonds. Some class A ODNs described in the prior art do not contain any phosphorothioate bonds but usually have two phosphorothioate internucleotide bonds at the 5' end of the ODN and five at the 3' end. Although these phosphorothioate bonds do not stabilize ODN against nucleases and increase protein binding and cell surface uptake to some extent, they also introduce chiral centers and increase manufacturing complexity. A certain preferred class A ODN of the invention contains 0, 1 or 2 PS bonds at the 5' end, and 2, 3 or 4 PS bonds at the 3' end. In certain embodiments, the preferred class A ODN of the invention contains 1 or 2 PS bonds at the 5' end and 2, 3 or 4 PS bonds at the 3' end. 3. Chirality of phosphorothioate (PS) bonds. When the class A ODN described in the prior art has PS links, they have always been stereorandom. However, the two stereoisomers have very strong immune effects. - 242different on LTR9 signaling, as previously published (Krieg AM et al., Oligonucleotide 2003 13(6):491-9). The improved class A CpG may have an all-R, all-S, or R and S chirality specified at each position within the polyG domains. When the CpG ODN contains any PS linkage, preferably at least the 3' end of the CpG ODN has an Sp linkage due to its greater resistance to nuclease degradation. Class A CpG ODN Palindrome Optimization 1. Location of deoxyadenosine nucleotides. Preferred palindromes contain at least one and preferably two or more deoxyadenosines. These are preferably located in the 5' half of the palindrome, with the consequence that complementary thymidines are located in the 3' half of the preferred palindromes (except that when the thymidines are modified by a halogen, as described in point 3 below, preferred palindromes may have deoxyadenosine or thymidine in the 5' or 3' regions or both of the palindrome). 2. Location of CpG dinucleotides. Preferred palindromes contain at least one CpG dinucleotide that is preceded by a 5'T and / or at least one CpG dinucleotide preceded by a 5Ά. 3. Modification of thymidine nucleosides. QPCQnn / zznz / E / YiAi - 243We have defined in the current invention a new type of class A CpG ODN, which is now called class A / E CpG ODN that contains not only the novel design features listed above but also modifications to one or more Thymidine nucleosides previously described as class E CpG ODN, as described in U.S. Pat. number 8,580,268 and in the published application U.S. 2014 / 0163213. Specifically, the preferred class A / E CpG ODN of the invention contains a halogen-modified uracil instead of one or more thymidines in the palindrome. The halogen-modified uracil is most preferably 5-iodo-2'-deoxyuridine (I) but may also be 5-bromo-2'-deoxyuridine or 5-chloro-2'-deoxyuridine. Examples of preferred class A CpG ODNs are: QPCQnn / zznz / E / YiAi ggGGGACGAGCTCGTCggggggG (SEQ ID NO: 80) ; ggGGGACGATCGTCGgggggG (SEQ ID NO: 58) ; ggGGACGATCGAACGTggggggG (SEQ ID NO: 81) ; ggGGTCGACGTCGACGTCGAGgggggG (SEQ ID NO: 78) ; and ggGGACGACGTCGTGgggggG (SEQ ID NO: 79); wherein each lowercase letter represents a nucleotide linked to its 3' adjacent nucleotide by a phosphorothioate (PS) bond; and each uppercase letter represents a nucleotide linked to its adjacent 3' nucleotide (if present) by a phosphodiester (PO) bond, except that the 3'-terminal nucleotide is represented by a letter in - 244QPCQnn / zznz / E / YiAi capitalized since it does not have an adjacent 3' nucleotide. Examples of preferred novel class A CpG ODN sequences are: gGGGACGATCCGTCGgggG (SEQ ID NO: 502); 5 ggGGTCGACGTACGTCGAggggG (SEQ ID NO: 5 0 3); gGGGTCGTCGACGAggggG (SEQ ID NO: 5 0 4); ggGGACGAGCTCGTCggggggG (SEQ ID NO: 505) ; ggGGGACGAGCTCGTCggggG (SEQ ID NO: 5 0 6); gGGGACGAGCTCGTCggggG (SEQ ID NO: 5 0 7); 10 gGGGACGAGCTCGTCgggG (SEQ ID NO: 5 0 8); ggGGACGATCGTCCgggggG (SEQ ID NO: 77) ; ggGGGACGATCGTCGggggG (SEQ ID NO: 4 9) ; gGGGACGATCGTCGggggG (SEQ ID NO: 5 0 9); gGGGACGATCGTCGgggG (SEQ. ID NO: 502) ; 15 gGGGACGATCGAACGTgggggG (SEQ ID NO: 81) ; ggGGACGATCGAACGTggggG (SEQ ID NO: 510); gGGGACGATCGAACGTggggG (SEQ ID NO: 510); gGGGACGATCGAACGTgggG (SEQ ID NO: 511) ; gGGGTCGACGTCGACGTCGAGgggggG (SEQ ID NO: 78) ; 20 ggGGTCGACGTCGACGTCGAGggggG (SEQ ID NO: 512) ; gGGGTCGACGTCGACGTCGAGggggG (SEQ ID NO: 512) ; gGGGTCGACGTCGACGTCGAGgggG (SEQ ID NO: 513) ; gGGGACGACGTCGTGgggGG (SEQ ID NO: 514); gGGGACGACGTCGTGgggggG (SEQ. ID NO: 7 9) ; 25 ggGGACGACGTCGTGggggG (SEQ ID NO: 514); - 245gGGGACGACGTCGTGggggG (SEQ ID NO:514); gGGGACGACGTCGTGgggG (SEQ ID NO: 515); and ggGTCGTCGACGAggggG (SEQ ID NO:516), where again, each lowercase letter represents a nucleotide linked to its 3' adjacent nucleotide by a phosphorothioate (PS) bond; and each uppercase letter represents a nucleotide linked to its adjacent 3' nucleotide (if present) by a phosphodiester (PO) bond, except that the 3'-terminal nucleotide is represented by an uppercase letter since it does not have a nucleotide 3 ' adjacent. Examples of preferred novel class A / E CpG ODN sequences are: gGGGACGAICGTCGgggG (SEQ ID NO: 1); gGGGACGAIATCGTCggggG (SEQ ID NO: 2) ; gGGGACGAGCIGCTCggggG (SEQ ID NO: 3) ; ggGGICACCGGTGAggggG (SEQ ID NO: 4) ; ggGGICGACGTACGTCGAggggG (SEQ ID NO: 5) ; ggGGICGACGIACGTCGAggggG (SEQ ID NO: 6) ; ggGGICGACGTACGICGAggggG (SEQ ID NO: 7) ; ggGGICGACGIACGICGAggggG (SEQ ID NO: 8) ; ggGGACGICGACGTgggG (SEQ ID NO: 9) ; ggGGICGACGTCGACGTCGAGgggG (SEQ ID NO: 10) ; ggGGICGACGICGACGTCGAGggggG (SEQ ID NO: 11) ; ggGGICGACGTCGACGICGAggggG (SEQ ID NO: 12) ; - 246- ggGGICGACGICGACGICGAGggggG (SEQ ID NO: 13) ; gGGGACGACGICGIGgggGG (SEQ ID NO: 14) ; gGGGICGTCGACGAggggG (SEQ ID NO: 15) ; gGGGTCGICGACGAggggG (SEQ ID NO: 16) ; 5 gGGGICGICGACGAggggG (SEQ ID NO: 17) ; ggGGACGAGCICGTCggggggG (SEQ ID NO: 18) ; ggGGGACGAGCICGTCggggG (SEQ ID NO: 19) ; gGGGACGAGCICGTCggggG (SEQ ID NO: 20) ; gGGGACGAGCICGTgggG (SEQ ID NO: 21) ; 10 ggGGACGAICGTCGggggggG (SEQ ID NO: 22) ; ggGGGACGAICGTCGggggG (SEQ ID NO: 23) ; gGGGACGAICGTCGggggG (SEQ ID NO: 24) ; gGGGACGAICGTCGgggG (SEQ ID NO: 1) ; ggGGACGAICGTCGggggggG (SEQ ID NO: 25) ; 15 ggGGGACGAICGTCGggggG (SEQ ID NO: 26) ; gGGGACGAICGTCGggggG (SEQ ID NO: 27) ; gGGGACGAICGTCGgggG (SEQ ID NO: 28) ; gGGGACGAICGAACGTgggggG (SEQ ID NO: 29) ; ggGGACGAICGAACGTggggG (SEQ ID NO: 30) ; 20 gGGGACGAICGAACGTggggG (SEQ ID NO: 30) ; gGGGACGAICGAACGTgggG (SEQ ID NO: 31) ; gGGGACGAICGAACGTggggggG (SEQ ID NO: 32) ; ggGGACGAICGAACGTggggG (SEQ ID NO: 33) ; gGGGACGAICGAACGIggggG (SEQ ID NO: 33) ; 25 gGGGCGAICGAACGIgggG (SEQ ID NO: 34) ; QPCQnn / zznz / E / YiAi - 247- gGGGICGACGTCGACGTCGAGgggggG (SEQ ID NO: 35) ; ggGGICGACGTCGACGTCGAGggggG (SEQ ID NO: 10) ; gGGGICGACGTCGACGTCGAGggggG (SEQ ID NO: 10) ; gGGGICGACGTCGACGTCGAGgggG (SEQ ID NO: 36) ; gGGGICGACGTCGACGTCGAGgggggG (SEQ ID NO: 37) ; ggGGICGACGICGACGTCGAGggggG (SEQ ID NO: 11) ; gGGGICGACGICGACGTCGAGggggG (SEQ ID NO: 11) ; gGGGICGACGICGACGTCGAGgggG (SEQ ID NO: 38) ; gGGGICGACGTCGACGICGAGgggggG (SEQ ID NO: 39) ; ggGGICGACGTCGACGICGAGggggG (SEQ ID NO: 12) ; gGGGICGACGTCGACGICGAGggggG (SEQ ID NO: 12) ; gGGGICGACGTCGACGICGAGgggG (SEQ ID NO: 40) ; gGGGICGACGICGACGICGAGgggggG (SEQ ID NO: 41) ; ggGGICGACGICGACGICGAGggggG (SEQ ID NO: 13) ; gGGGICGACGICGACGICGAGggggG (SEQ ID NO: 13) ; And gGGGICGACGICGACGICGAGgggG (SEQ ID NO: 42), where I represents 5-iodo-2'-deoxyuridine; QPCQnn / zznz / E / YiAi each lowercase letter represents a nucleotide linked to its 3' adjacent nucleotide by a phosphorothioate (PS) bond; and each uppercase letter represents a nucleotide linked to its adjacent 3' nucleotide (if present) by a phosphodiester (PO) bond, except that the 3'-terminal nucleotide is represented by an uppercase letter since it does not have a nucleotide 3 ' adjacent. The CpG ODN of the present invention is - 248will be synthesized using standard methods well known in the field and described above. The activity of the ODN will be evaluated using in vitro dose-response analysis on human peripheral blood mononuclear cells (PBMCs) for secretion of IFN-α and IL-10 as described in the class A and class patents E (for example, U.S. Patent No. 8,580,268, Figure 27 for IFN-α and U.S. patent number 7,795,235, figure 27 for IL-10). Because humans show interindividual variation in the magnitude of the IFN-α response to TLR9 stimulation, PBMCs for a minimum of three different individuals were tested for all cytosine, chemokine, and IFN assays. Freshly collected PBMCs are strongly preferred for maximum responsiveness. After 24 h the magnitude of the in vitro response to TLR9 ligation will be significantly lower. A class A CpG ODN typically tested in human PBMCs at concentrations from approximately 0.1 μΜ to approximately 10 μΜ. Supernatants are collected after approximately 24, 48, and 72 h and tested by enzyme-linked immunosorbent assay (ELISA) or other standard assays for the amount of IFN-α (usually the assay measures only one or more of the many IFN isoforms). -α) and / or other chemokines and cytosines induced by IFN. - 249E1 preferred class A and class A / E CpG ODN of the invention will induce an average of more than 1000 pg / ml of IFN-α at the most effective concentration in the assay (potency is less important in this regard than efficacy peak), or more preferably greater than 3,000 pg / ml of IFN-α and more preferably greater than 10,000 pg / ml of IFN-α; In any case, the preferred ODN induces production of at least more than 10 times the IFN-α induced by a positive control class B CpG ODN. Supernatants from these same experiments are also tested for IL-10 secretion using similar ELISA assays. The preferred class A or A / E ODNs of the present invention will induce less than 1000 pg / ml, preferably less than 300 pg / ml and more preferably less than 100 pg / ml of IL-10 secretion under these assay conditions. . The most preferred CpG ODN selected from these in vitro analyzes will then be evaluated in mouse tumor models using standard systems well known in the art. Mouse analyzes are not used to select the most active ODN to be taken in human clinical trials since the ranking order of the ODN will differ, as a result of structural differences between mouse and human TLR9 and specific differences in species in cell types that express TLR9. For these reasons the primary selection QPCQnn / zznz / E / YiAi - 250 for a lead CpG ODN candidate to take in human clinical trials will be based on the results of in vitro analyzes using human cells. EXAMPLE 2 In vitro experiments were carried out to examine the effects of changes in palindrome sequence, number of 5' and 3' G, number of 5' and 3' phosphorothioate internucleotide bonds, and 5-iodo-2'-deoxyuridine substitution within palindromes on IFN-α secretion by human peripheral blood mononuclear cells (PBMCs). PBMCs from a normal human donor were cultured in the presence or absence of indicated ODN in triplicate and the results are plotted as mean + / - standard deviation (SD) in Figure 4 and Figure 5, for two different human donors. PBMCs were isolated on Histopaque-1077 (Sigma) and plated at 1.25 x 106 / ml, 220 μΐ / ροζο in RPMI 1640 (10% FBS, glutamine, Pen / Strep) in a bottom tissue culture plate. in U with 96 wells. ODN was added at a final concentration of 5, 1, or 0.2 pg / ml (Figure 4) or at the lowest concentration of 0.5 pg / ml (Figure 5) and cells were incubated for 48 hours. The cells were then pelleted by centrifugation and the supernatants were transferred to new plates and frozen at −20°C until use. QPCQnn / zznz / E / YiAi - 251The supernatants were subsequently rewarmed and used for IFN-α ELISA (PBL Verikine IFN-α human) following the manufacturer's instructions. 5 Table 2. Set of CpG-A oligonucleotides prepared and tested # ODN sequence IFN-a SEC. ID. NO: 10 1 tcgtcgttttgtcgttttgtcgtT 2006 ba j or 44 2 ggGGGACGATCGTCgggggG 2216 2 + 49 3 gGGGACGATCGTCGgggG 2216b 2 + 502 4 ggGGTCGACGTACGTCGAggggG 2301a + / - 503 5 gGGGTCGTCGACGAggggG 2329a 3 + 504 15 6 ggGGACGAGCTCGTCggggggG 2247a 2 + 505 7 ggGGGACGAGCTCGTCggggG 2247b 2 + 517 8 gGGGACGAGCTCGTCggggG 2247c 2 + 507 9 gGGGACGAGCTCGTCgggG 2247d + / - 508 10 ggGGACGATCGTCGggggG 2255a 2 + 77 20 11 ggGGGACGATCCGTCGggggG 2255b 2 + 49 12 gGGGACGATCCGTCGggggG 2 + 509 13 gGG GACGATCGTCGggG 2255d 2 + 502 14 gGGGTCGACGTCGACGTCGAGgggggG 2334a 2 + 78 15 ggGGTCGACGTCGACGTCGAGggggG 2334b 2 + 512 25 16 gGGGTCGACGTCGACGTCGAGggggG 2334c 2 + 512 - 252- 17 gGGGTCGACGTCGACGTCGAGgggG 2334d 1 + 513 18 gGGGACGACGTCGTGgggGG 2336a 3 + 514 19 gGGGACGACGTCGTGgggggG 2336b 3 + 79 20 g gGGAC GAC GT C GT Gg gggG 2336c 2 + 514 5 21 gGGGA CGACGTCGTGggggG 2336d 3 + 514 22 gGGGACGACGTCGTGgggG 2336e 3 + 515 23 ggGTCGTCGACGAggggG 2329e 2 + 516 24 gGGGACGAICGTCGggG 2216a 2 + 1 25 ggGGICGACGTACGTCGAggggG 2301b + / - 5 10 26 ggGGICGACGIACGTCGAggggG 2301c low 6 27 ggGGICGACGTACGTCGAggggG 2301d low 7 28 ggGGICGACGIACG ICGAggggG 2301e low 8 29 gGGGTCGTCGACGAggggG 2329a 3 + 504 30 gGGGICGTCGACGAggggG 2329b 3 + 15 15 31 gGGGTCGTCGACGAggggG 2329c 3 + 16 32 gGGGICGTCGACGAggggG 2329d 3 + 17 33 gGGGACGACGICGIGgggGG 2336b 3 + 518 34 tcgaacgttcgaacgttcgaacgttcgaat SD-101 1 + 519 #1 (ODN 2006) is CpG-B control #2 (ODN 2216) is CpG-A control #34 (ODN SD-101) is CpG-C control ##3-23 are novel class A oligonucleotides ##24-33 are CpG-A oligonucleotides that contain 5-iodo-2'-deoxyuridine (I) - 253space = PS link (the others are PO) The data from this set of experiments suggest that: more than four Gs at the 3' end of the oligonucleotide confer good activity: compare, for example, ODN 2247a-c (five or more 3'Gs) with ODN 2247d (with four 4G at the 3' end). Five Gs at the 3' end can be less than six Gs (compare ODN 2334d with 5G to ODN 2334a-c with six or more 3'Gs). It does not matter whether there are one or two PS links at the 5' end: compare ODN 2334b (2 PS) with OND 2334c (1 PS). One PS bond at the 5' end appears to be superior to two PS bonds at the 5' end in at least some cases: ODN 2336c is the only version of 2336 that has two 5' PS bonds and appears to be weaker for IFN induction -α than the other versions, which have a PS. To the extent that there are at least five Gs at the 3' end, three PS at the 3' end appear to be just as strong as four PS: compare ODN 2336a and 2336e (three PS at the 3' end) with ODN 2336b and 2336d with five or four PS, respectively. The palindrome present in ODN 2301 is weak (but still stronger than CpG-B) regardless of the other elements: therefore not all palindromes work QecQnn / zznz / E / YiAi - 254good. One or two halogen substitutions within the palindrome are well tolerated in CpG-A but do not increase the IFN-α inducing activity (for example, compare ODN 2329a to 2329b, c, d; or ODN 2336a to 2336b; or ODN 2216 a 2216a). EXAMPLE 3 In vitro experiments were performed to examine the effects of changes in palindrome sequence, the number of 5' and 3' phosphorothioate internucleotide bonds, formulation of the CpG-A ODN from native DNA into a virus-like particle (VLP). in English) and the substitution of 2-O-methyl sugars within the 3' end of the CpG-A ODN on the potency and peak secretion of IFN-α by human PBMCs. The experimental conditions were generally those of Example 2, except that in this case the indicated ODN was cultured with the PBMC in triplicate at concentrations of 5 pg / ml (concentration or conc A in Figure 6 and Figure 7); 1 pg / ml (conc B in figure 6 and figure 7) and 0.5 pg / ml (conc C) for the entire ODN except for two samples: 1. The fully G10 PO ODN (marked as CYT003 in Figure 6 and Figure 7) was cultured at ODN concentrations of 50 pg / ml (conc A in Figure 6 QecQnn / zznz / E / YiAi - 255y in figure 7), 10 pg / ml (conc B) and 2 pg / ml (cone C); AND 2. The samples labeled CytQbAb in Figure 6 and Figure 7 contain the G10 ODN packaged within a virus-like particle comprising the bacteriophage Qb protein as previously described and in clinical development sponsored by Cytos under the name CYT003 or QbGlO (Beeh et al., J Allergy Clin Immunol 2013;131:866-74) together with an anti-Qb antibody to facilitate VLB uptake into immune cells. The VLB in these samples is grown as G10 at 50 pg / ml (conc A) in Figure 6 and Figure 7), 10 pg / ml (conc B) and 2 pg / ml (conc C), but since the dose was based on the entire VLB, still only 20% of the mass of the VLB comprises G10, the actual mass of G10 in each well is closer to 10 pg / ml (conc A) in Figure 6 and Figure 7), 2 pg / ml (conc B) and 0.5 pg / ml (conc C). TABLE 3. SET 2 OF CpG-A OLIGONUCLEOTIDES PREPARED AND TESTED # ODN sequence IFN-α SEQ ID NO: QPCQnn / zznz / E / YiAi 1 ggGGGACGATCGTCgggggG 2216 2+ 49 2 gGGGACGACGTCGTGgggGG 2336a 3+ 514 3 gGGGACGACGTCGTGggggG 2336a1 3+ 514 4 GGGGACGACGTCGTGGGggG 2336a2 1 + 514 - 256- 5 GGGGACGACGTCGTGGGGGG 2336aPO 1 + 514 6 mGmGmGmGACGACGTCGTGmGmGmGmGmG 2336m1 weak 520 7 GGGGACGACGTCGTGGGGGmG 2336m2 negative 521 8 GGGGACGACGTCGTGGGGGgtT 2336ST 1 + 522 5 9 ggGGACGACGTCGTGggggG 2336c 2+ 514 10 gGGGACGACGTCGTGgggG 2336e 2+ 515 11 gGGGT CGT CG ACG AggggG 2329a 2+ 504 12 GGGGTCGTCGACGAGGggG 2329a1 weak 504 13 GGGGACGACGTCGTGGGGGGmUmU 2336mU negative 523 10 14 GGGGGGGGGGGACGATCGTCGGGGGGGGGG G10 3+ 82 15 #1 (ODN 2216) is CpG-A control ##2-13 are novel class A oligonucleotides lowercase = PS bond (the others are PO) mG = 2'-O -methyl G mT = 2'-O-methyl T The data from this set of experiments suggest the following: Less than three PS bonds at the 3' end and no PS bonds at the 5' end results in a noticeable reduction in the potency of CpG-A but no apparent reduction in peak QPCQnn / zznz / E / YiAi accessible by induction of IFN-α at the highest ODN concentration (compare the very strong induction of IFN-α by ODN 2336a and 2336al (with three or four PS bonds at the 3' end, respectively ) which is detectable even at only 0.5 pg / ml at the very similar peak level of induction of - 257IFN-α by ODN 2336a2, 2336PO and 2336ST with 2, 0 or one PS bond, respectively. There is no apparent power advantage in having more than one PS at the 5' end and three PS at the 3' end (compare the similar activity levels between ODN 2336c and 2336e, with a difference of one PS link at both ends). The palindrome in ODN 2329 (TCGTCGACGA) (SEQ ID NO: 524) appears to be less potent for induction of IFN-α than the palindromes in either ODN 2216 (GACGATCGTC) (SEQ ID NO: 525) or the ODN 2336 series (ACGACGTCGT ) (SEQ ID NO: 526). The CpG-A ODN based on a less powerful palindrome as in ODN 2329 may exhibit a correspondingly greater reduction in power if the number of PS bonds is reduced at the 5' and 3' ends (compare ODN 2329a to 2329al, with PS links produced). Substitution of one or more 2'-O-methyl bases at the 5' and / or 3' ends of the CpG-A ODN results in a marked reduction in the potency and available peak of IFNα induction (compare the substituted 2336ml ODN with 2-O-methyl, 2336m2, and 2336mU with the original unmethylated versions of ODN 2336). The highest peak IFN-α induction observed with any of the ODNs is from G10 (CYT003 in Figure 6) and from the VLP containing G10 (CytQbAb in QecQnn / zznz / E / YiAi - 258figure 6). Since G10 is native DNA without any PS modifications, this indicates that PS modification is not required for IFN-α induction to the extent that either the higher concentrations of CpG-A ODN are used, or the ODN is packaged or delivered in a way that protects against nucleases, such as in a VLP, as used in this experiment. VLP packaging appears to greatly increase the ODN potency of CpGA since the dose-response of naked G10 (CYT003) is very similar to G10 packaged with VLPs, although the latter contain only ~20% of the ODN mass. . In accordance with this invention, the induction of IL10 by the control ODN CpG-B (2006) and CpG-C (SD-101) is significantly greater than that of either of the CpG-A ODNs (Figure 7). This substantiates the use of intratumorally injected CpG-A ODN of the invention for cancer immunotherapy, where local induction of IL-10 (e.g., by CpG-B ODN) would be undesirable. EXAMPLE 4 In vitro experiments were carried out to examine the effects of changes in CpG-A ODN in the backbone with either phosphorodithioate (PS2) or phosphorothioate (PS) compared to native DNA (PO) on potency and secretion. IFN-α peak by human PBMC QecQnn / zznz / E / YiAi normal. - 259The experimental conditions were generally as in example 2, except that in this case the indicated ODN is cultured with the PBMCs in triplicate for 72 h at concentrations of 0.5 pg / ml or 5 pg / ml. TABLE 4. CpG-A OLIGONUCLEOTIDE SETS PREPARED AND TESTED QecQnn / zznz / E / YiAi # IFN-a ODN sequence SEQ NO: ID A G#G#GGGACGATCGTCGGGG#G#G AF185A strong 49 B G#G#GGGAGCATGCCTGGGG#G#G AF185B negative 527 C G#G#GGGAC#GATC#GTCGGGG#G#G AF185C weak 49 D G#G#GGGA#C#GAT#C#GTCGGGG#G#G AF185D negative 49 E G#G#GGG#ACGA#TCGTCGGGG#G#G AF185E weak 49 F G#G#GGGACGAT#CGT#CGGGG#G#G AF185F weak 49 G GGGGGACGATCGTCGGGGGG AF185G weak 49 H G#GGGGACGATCGTCGGGG#G#G AF185H strong 49 1 GGGGGAC#GATC#GTCGGGGGG AF185I weak 49 # = phosphorodithioate internucleotide bond (PS2) The data from this set of experiments suggest (figure 8): The CpG-A ODN contains one or two PS2 modifications at the 5' and 3' ends (e.g., ODN AF185A and H) that are approximately as effective as the PO (G10) or PS ends (ODN 2216 has PS linkages at the 5' and 3' ends). - 260Within PS2 the palindrome severely reduces activity compared to either without PS2 or PS2 on the ends within the polyG. It is possible that PS2 ends may demonstrate superiority to PO or PS in vivo due to increased protein binding and nuclease resistance. EXAMPLE 5 In vitro experiments were performed to examine the effects of reducing the number of Gs at the 5' and / or 3' end of CpG-Α G10 ODN or changing the palindrome while maintaining the native DNA of the backbone. The experimental conditions were generally those of Example 2 except that in this case the indicated ODN (Table 5) was cultured with PBMC in duplicate for 48 h at the concentration of 2.5 pg / ml. TABLE 5. SET 4 OF CpG-Α OLIGONUCLEOTIDES PREPARED AND TESTED QPCQnn / zznz / E / YiAi # IFN-a sequence SEQ NO: ID 1 GGGGGGGGACGATCGTCGGGGGGGGGG ++ 528 2 GGGGGGGGGGACGATCGTCGGGGGGG ++ 529 3 GGGGGGGGACGATCGTCGGGGGGG ++ 530 4 GGGGGGGGGGTCGTCGACGAGGGGGGGGGG - 531 5 GGGGGGGGGGACGAGCTCGTCGGGGGGGGGG + 532 6 GGGGGGGGGGACGATCGTCGGGGGGGGGG + 533 - 261- 7 GGGGGGGGGGTCGACGTCGACGTCGAGGGGGGGG 534 8 GGG GGGGGGGGGGACGACGTCGTGGGGGGGGGG - 535 9 GGGGGGGGGGGAACGACGTCGTTTGGGGGGGGGG - 536 10 GGGGGGGGGGACGACGACGATCGTCGTCGTGGGG - 537 11 GGGGGG GGGGGGGGGCACGACGTCGTGGGGGGGGGG - 538 12 GGGGGGGGGGAACGTTCGAACGTTGGGGGGGGG + 539 13 G GGGGGGGGGGAACGTTCGAACGTTCGAACGTTCG - 540 14 AACGTTGGGGGGGGGG GGGGGGGGGGTTCGAACGTTCGAAGGGGGGGG + 541 15 G GGGGGGGGGGACGTCGACGTCGGGGGGGGGG + 542 16 GGGGGGGGG GGTCGATCGACGGGGGGGGG + + 543 17 GGGGGGGGGGACGTCGACGTACGTCGACTGGGGG + 544 18 GGGGGG GGGGGGGGGGTACGATATCGTAGGGGGGGGG - 545 19 GGGGGGGGGGTACGTATACGTAGGGGGGGGG - 546 20 GGGGGGGGGGCAGCATGCTGGGGGGGGG - 542 21 GGGGGGGGGGCAGCATGCTGGGGGGGGGG — 547 #1 G10 variant: 5' end reduced in G #2 G10 variant: 3' end reduced in G #3 G10 variant: both ends reduced in G - 262- # 4 TCGGTC palindrome # 5 GACGAG palindrome # 6 GACGA palindrome # 7 TCGACGTC # 8 ACGAC # 9 AACGAC # 10 ACGACGACGA (SEQ ID NO: 548) # 11 CACGAC # 12 palindrome SD-101 # 13 SD-lOlb # 14 TTCGAAC #15 GACGTC #16 GTCGAC #17 ACGTCGACGT (SEQ ID NO: 549) #18 TACGAT low CG #19 TACGCT #...
Claims
1. A method for treating a cancerous tumor, characterized in that it comprises: administering to a subject in need thereof an effective amount of a TLR9 agonist and a checkpoint inhibitor (CPI), wherein the TLR9 agonist is administered within or substantially adjacent to the tumor.
2. The method according to claim 1, characterized in that the TLR9 agonist induces IFN-α.
3. The method according to claim 1 or 2, characterized in that the TLR9 agonist is CpG DNA.
4. The method according to any of the preceding claims, characterized in that the TLR9 agonist is selected from the group consisting of CpG class A DNA, CpG class C DNA, CpG class E DNA, CpG class A / E DNA, CpG class P DNA and any combination thereof.
5. The method according to any of claims 1 to 4, characterized in that the TLR9 agonist -268 is a CpG class A DNA.
6. The method according to claim 5, characterized in that the CpG class A DNA sequence is GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEC ID NO: 82).
7. The method according to claim 5 or 6, characterized in that the CpG class A DNA is formulated as a virus-like particle.
8. The method according to any of claims 1 to 4, characterized in that the TLR9 agonist is a CpG class C DNA.
9. The method in accordance with any of the preceding claims, characterized in that the CPI is administered systematically.
10. The method according to any of the preceding claims, characterized in that the CPI is an antigen-binding antibody or fragment thereof which binds specifically to an antigen selected from the group consisting of PD-1, PD-L1 and CTLA-4.
11. The method according to any of claims 1 to 10, characterized in that the CPI is an antibody or fragment thereof that binds to antigen which binds specifically to PD-1.
12. The method according to any of claims 1 to 10, characterized in that the CPI is QecQnn / zznz / E / YiAi - 269 an antibody or fragment thereof that binds to antigen which binds specifically to PD-L1.
13. The method according to any of claims 1 to 10, characterized in that the CPI is an antibody or fragment thereof that binds to antigen which binds specifically to CTLA-4.
14. The method according to any one of claims 1 to 10, characterized in that the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which binds specifically to CTLA4, and (ii) a second antigen-binding antibody or fragment thereof which binds specifically to an antigen selected from the group consisting of PD-1 and PD-L1.
15. The method according to any of claims 1 to 10, characterized in that the CPI comprises: (i) a first antibody or fragment thereof that binds to antigen which binds specifically to CTLA4, and (ii) a second antibody or fragment thereof that binds to antigen which binds specifically to PD-1.
16. The method according to any one of claims 1 to 10, characterized in that the CPI comprises: (i) a first antibody or fragment thereof that binds to an antigen specifically binding to CTLA4, and (ii) a second antibody or fragment thereof that binds to an antigen specifically binding to PD-L1. QPCQnn / zznz / E / YiAi - 270- 17. The method according to any of claims 1 to 10, characterized in that the CPI comprises: (i) a first antibody or fragment thereof that binds to antigen which binds specifically to PD-1, and (ii) a second antibody or fragment thereof that binds to antigen which binds specifically to PD-L1.
18. The method according to any of the preceding claims, characterized in that the TLR9 agonist is administered prior to the administration of the CPI.
19. The method according to any of claims 1 to 17, characterized in that the TLR9 agonist and the CPI are administered substantially at the same time.
20. The method according to any of the preceding claims, characterized in that the cancerous tumor is a lymphoma or a cancerous tumor of a tissue or organ selected from the group consisting of skin, upper respiratory and digestive tracts, esophagus, stomach, liver, colon, rectum, pancreas, lung, breast, cervix, ovary, kidney, bladder, prostate, thyroid, brain, muscle, and bone.
21. The method according to any of the preceding claims, characterized in that the cancerous tumor is melanoma. - 271- 22. The method according to claim 20, characterized in that the cancerous tumor is lymphoma.
23. The method according to any of the preceding claims, characterized in that the cancerous tumor is resistant to a treatment regimen comprising administration of the CPI without administration of the TLR9 agonist.
24. The method in accordance with any of the preceding claims, characterized in that the subject is a human.
25. A method for treating a cancerous tumor, characterized in that it comprises: administering to a subject in need thereof an effective amount of radiotherapy, a TLR9 agonist and a checkpoint inhibitor (CPI), wherein the radiotherapy is initiated prior to the administration of the TLR9 agonist and the TLR9 agonist is administered within or substantially adjacent to the tumor.
26. The method according to claim 25, characterized in that the TLR9 agonist induces IFN-α.
27. The method according to claim 25 or 26, characterized in that the TLR9 agonist is CpG DNA. QPCQnn / zznz / E / YiAi - 272- 28. The method according to any of claims 25 to 27, characterized in that the TLR9 agonist is selected from the group consisting of CpG class A DNA, CpG class C DNA, CpG class E DNA, CpG class A / E DNA, CpG class P DNA and any combination thereof.
29. The method according to any of claims 25 to 27, characterized in that the TLR9 agonist is a CpG class A DNA.
30. The method according to claim 29, characterized in that the CpG class A DNA sequence is GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEC ID NO: 82).
31. The method according to claim 29 or 30, characterized in that the CpG class A DNA is formulated as a virus-like particle.
32. The method according to any of claims 25 to 27, characterized in that the TLR9 agonist is a CpG class C DNA.
33. The method in accordance with any of claims 25 to 32, characterized in that the CPI is administered systemically.
34. The method according to any of claims 25 to 33, characterized in that the CPI is an antibody or fragment thereof that binds to antigen QecQnn / zznz / E / YiAi - 273 which binds specifically to an antigen selected from the group consisting of PD-1, PD-L1 and CTLA-4.
35. The method according to any of claims 25 to 34, characterized in that the CPI is an antibody or fragment thereof that binds to antigen which binds specifically to PD-1.
36. The method according to any of claims 25 to 34, characterized in that the CPI is an antibody or fragment thereof that binds to antigen which binds specifically to PD-L1.
37. The method according to any of claims 25 to 34, characterized in that the CPI is an antibody or fragment thereof that binds to antigen which binds specifically to CTLA-4.
38. The method according to any of claims 25 to 34, characterized in that the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which binds specifically to CTLA4, and (ii) a second antigen-binding antibody or fragment thereof which binds specifically to an antigen selected from the group consisting of PD-1 and PD-L1.
39. The method according to any of claims 25 to 34, characterized in that the CPI comprises: (i) a first antigen-binding antibody or fragment thereof which binds specifically to CTLA QecQnn / zznz / E / YiAi - 2744, and (ii) a second antigen-binding antibody or fragment thereof which binds specifically to PD-1.
40. The method according to any of claims 25 to 34, characterized in that the CPI comprises: (i) a first antibody or fragment thereof that binds to antigen which binds specifically to CTLA4, and (ii) a second antibody or fragment thereof that binds to antigen which binds specifically to PD-L1.
41. The method according to any of claims 25 to 34, characterized in that the CPI comprises: (i) a first antibody or fragment thereof that binds to antigen which binds specifically to PD-1, and (ii) a second antibody or fragment thereof that binds to antigen which binds specifically to PD-L1.
42. The method according to any of claims 25 to 41, characterized in that the TLR9 agonist is administered prior to the administration of the CPI.
43. The method according to any of claims 25 to 41, characterized in that the TLR9 agonist and the CPI are administered substantially at the same time.
44. The method according to any of claims 25 to 43, characterized in that the cancerous tumor is a lymphoma or a cancerous tumor of a tissue or organ selected from the group consisting of skin, upper respiratory and digestive tracts, esophagus, stomach, liver, colon, rectum, pancreas, lung, breast, cervix, ovary, kidney, bladder, prostate, thyroid, brain, muscle, and bone.
45. The method according to any of claims 25 to 44, characterized in that the cancerous tumor is melanoma.
46. The method according to claim 44, characterized in that the cancerous tumor is a lymphoma.
47. The method according to any of claims 25 to 46, characterized in that the cancerous tumor is resistant to a treatment regimen comprising administration of the CPI without administration of the TLR9 agonist.
48. The method in accordance with any of claims 25 to 47, characterized in that the subject is a human.
49. A method for treating a cancerous tumor, characterized in that it comprises: administering to a subject in need thereof an effective amount of a TLR9 agonist, a first checkpoint inhibitor (CPI), a second CPI, wherein the TLR9 agonist and the first CPI are administered within or substantially adjacent to the tumor and the second CPI is administered systemically.
50. The method according to claim 49, characterized in that the TLR9 agonist induces IFN-α.
51. The method according to claim 49 or 50, characterized in that the TLR9 agonist is CpG DNA.
52. The method according to any one of claims 49 to 51, characterized in that the TLR9 agonist is selected from the group consisting of CpG class A DNA, CpG class C DNA, CpG class E DNA, CpG class A / E DNA, CpG class P DNA and any combination thereof.
53. The method according to any of claims 49 to 51, characterized in that the TLR9 agonist is a CpG class A DNA.
54. The method according to claim 53, characterized in that the CpG class A DNA sequence is GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEC ID NO: 82).
55. The method according to claim 53 or 54, characterized in that the CpG class A DNA is formulated as a virus-like particle.
56. The method in accordance with any of QPCQnn / zznz / E / YiAi - 277 claims 49 to 51, characterized in that the TLR9 agonist is a CpG class C DNA.
57. The method according to any of claims 49 to 56, characterized in that the first CPI is an antigen-binding antibody or fragment thereof which binds specifically to CTLA-4.
58. The method according to any of claims 49 to 56, characterized in that the first CPI is an antibody or fragment thereof that binds to antigen which binds specifically to CTLA-4; and the second CPI is an antibody or fragment thereof that binds to antigen which binds specifically to PD-1.
59. The method according to any of claims 49 to 56, characterized in that the first CPI is an antibody or fragment thereof that binds to an antigen which binds specifically to CTLA-4; and the second CPI is an antibody or fragment thereof that binds to an antigen which binds specifically to PD-L1.
60. The method according to any of claims 49 to 56, characterized in that the first CPI comprises a first antibody or fragment thereof that binds to an antigen specifically binding to PD-1, and the second CPI comprises a second antibody or fragment thereof that binds to an antigen specifically binding to PD-L1. QPCQnn / zznz / E / YiAi - 278- 61. The method according to any of claims 49 to 56, characterized in that the first CPI comprises a first antibody or fragment thereof that binds to antigen which binds specifically to PD-L1, and the second CPI comprises a second antibody or fragment thereof that binds to antigen which binds specifically to PD-1.
62. The method according to any of claims 49 to 61, characterized in that the TLR9 agonist is administered prior to the administration of the first CPI.
63. The method according to any of claims 49 to 61, characterized in that the TLR9 agonist and the first CPI are administered substantially at the same time.
64. The method according to any of claims 49 to 61, characterized in that the TLR9 agonist is administered after the administration of the first CPI.
65. The method according to any of claims 49 to 64, characterized in that the cancerous tumor is a lymphoma or a cancerous tumor of a tissue or organ selected from the group consisting of skin, upper respiratory and digestive tracts, esophagus, stomach, liver, colon, rectum, pancreas, lung, breast, cervix, ovary, kidney, bladder, prostate, thyroid, brain, muscle, and bone.
66. The method according to any of claims 49 to 65, characterized in that the cancerous tumor is melanoma.
67. The method according to claim 65, characterized in that the cancerous tumor is a lymphoma.
68. The method according to any of claims 49 to 67, characterized in that the cancerous tumor is resistant to a treatment regimen comprising administration of the first CPI without administration of the TLR9 agonist.
69. The method according to any of claims 49 to 68, characterized in that the subject QPCQnn / zznz / E / YiAi is a human.