HUMANIZED ANTI-C5 ANTIBODIES AND THEIR USES.

MX434936BActive Publication Date: 2026-06-12THE TRUSTEES OF THE UNIV OF PENNSYLVANIA +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
MX2021002710
Authority / Receiving Office
MX · MX
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-04-24
Filing Date
2021-03-05
Publication Date
2026-06-12
Estimated Expiration
2039-09-06

AI Technical Summary

Technical Problem

Current anti-C5 antibodies, such as eculizumab, have limitations including non-response in some patients due to human C5 gene polymorphism and require high doses and frequent administration, and there is a need for antibodies with longer half-life and different mechanisms to inhibit terminal complement activity effectively.

Method used

Development of pH-dependent humanized anti-C5 antibodies that exhibit strong binding to C5 at neutral pH (pH 7.4) and rapid dissociation at acidic pH (pH 5.8), utilizing specific CDR substitutions to enhance binding affinity and stability, and are administered to treat complement-mediated diseases.

Benefits of technology

The pH-dependent anti-C5 antibodies provide effective inhibition of C5a and MAC generation, offering improved therapeutic efficacy with reduced frequency and dosage requirements, suitable for treating a range of complement-mediated diseases.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

This invention relates to the inhibition of complement signaling using an anti-C5 antibody; specifically, the invention relates to methods for treating a complement-mediated disease or a complement-mediated disorder in an individual by exposing the individual to an anti-C5 antibody.
Need to check novelty before this filing date? Find Prior Art

Description

HUMANIZED ANTI-C5 ANTIBODIES AND THEIR USES CROSS REFERENCE WITH RELATED REQUESTS This application claims as priority U.S. Application No. 62 / 727,666, filed on September 6, 2018, and U.S. Provisional Application No. 62 / 837,833, filed on April 24, 2019, each one of which is incorporated herein by reference in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support in accordance with NIH AI085596 and AI117410 granted by the National Institutes of Health (NIH). The government has certain rights in the invention. BACKGROUND OF THE INVENTION The complement system is part of the innate immunity that plays a key role in host defense. However, activated complement also has the potential to cause significant tissue damage and destruction, and dysregulated complement activity has been found to be associated with a number of rare and common diseases, including paroxysmal nocturnal hemoglobinuria (PNH), syndrome atypical hemolytic uremic, rheumatoid arthritis, age-related macular degeneration, etc. Therefore, anticomplement therapy is a promising way to treat these human disorders. Complement C5 is a critical protein in the terminal pathway of complement activation and is the precursor protein for generating the potent proinflammatory mediator C5a, as well as the membrane attack cytolytic complex (MAC). Several human inflammatory and autoimmune diseases are mediated by C5a and / or MAC, and blocking C5 activation should prevent C5a and MAC generation and be of therapeutic value. A humanized mouse C5 anti-human mAb, eculizumab, has been used to treat two complement-mediated diseases, paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS). However, not all PNH patients respond to eculizumab treatments and one of the reasons for non-response is the human C5 gene polymorphism with loss of epitope binding to eculizumab. Besides, 77AQQn / L7n7 / q / YIAI Due to high plasma C5 concentration and rapid target-mediated clearance of antibodies, eculizumab should be administered to patients at high doses and high frequency. Thus, there is a need in the art for anti-human C5 mAbs with a longer half-life that can inhibit terminal complement activity through different mechanisms and contact sites on C5, and thus more effectively treat and suitable for complement-dependent pathologies. The present invention addresses and satisfies these and other needs. BRIEF DESCRIPTION OF THE INVENTION In one embodiment, the invention comprises an antibody that specifically binds to C5. In one embodiment, the C5 is a human C5. In one embodiment, the antibody is a monoclonal antibody. In one embodiment, the antibody is a humanized antibody. In one embodiment, the antibody is a chimeric antibody. In some embodiments, the antibody is a full length antibody. In some embodiments, the antibody is a fragment of the antibody, including, but not limited to, Fab, Fab', F(ab)2, F(ab')2, and scFv. In some embodiments, the antibody is part of a construct, eg, a fusion construct comprising the antibody and a targeting moiety or an effector moiety. In some embodiments, the antibody is part of a conjugate construct, such as an antibody-drug conjugate construct. In some embodiments, the anti-C5 antibody exhibits pH-dependent binding to C5. In some embodiments, the pH-dependent anti-C5 antibody binds more strongly to C5 at a more neutral pH (for example, about pH 7.4; as found in blood) than at a more acidic pH (for example, about pH 5.8; like that found in the endosome). In some embodiments, the pH-dependent anti-C5 antibody dissociates more rapidly from C5 at a more acidic pH (for example, about pH 5.8; as found in the endosome) than at neutral pH (for example, about pH 7.4; such as that found in the blood). In one embodiment, the pH-dependent antibody that specifically binds to human C5, wherein the pH-dependent antibody comprises at least one CDR selected from the group consisting of: a VH-CDR1 comprising a variant of SEQ ID NO: 3 , which has at least one substitution related to SEQ ID NO: 3; a VH-CDR2 comprising a variant of SEQ ID NO: 4, having at least one substitution related to SEQ ID NO: 4, a VH-CDR3 comprising a sequence of SEQ ID NO: 5, having at minus one substitution related to SEQ ID NO: 5; a VL-CDR1 comprising a variant of SEQ ID NO: 8, having at least one substitution related to SEQ ID NO: 8; a VL-CDR2 comprising a variant of SEQ ID NO: 9, having at least one substitution related to SEQ ID NO: 9; and a VL-CDR3 comprising a variant of SEQ ID NO: 10, having at least one substitution related to SEQ ID NO: 10. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:11, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:11, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 13 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2 and a light chain comprising the amino acid sequence of SEQ ID NO:13; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:14; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO: 14; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 16 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2 and a light chain comprising the amino acid sequence of SEQ ID NO:16; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 17; VH-CDR2: SEQ ID NO:4; VHCDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:17; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:19 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:7 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 7; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:20; VH-CDR2: SEQ ID NO:4; VHCDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:20; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:22 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:22 and a light chain comprising the amino acid sequence of SEQ ID NO:25; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:26; VHCDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:29, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:26; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:29, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:28 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:31 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:28 and a light chain comprising the amino acid sequence of SEQ ID NO:31; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:34; VHCDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NQ:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:34; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:36 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:7 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:36 and a light chain comprising the amino acid sequence of SEQ ID NO:7; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO:38; VHCDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO:38; VH-CDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41 and a light chain comprising the amino acid sequence of SEQ ID NO:25; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO: 43; VHCDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO: 43; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:46 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:46 and a light chain comprising the amino acid sequence of SEQ ID NO:25; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO: 48; VHCDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NQ:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO: 48; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:51 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:51 and a light chain comprising the amino acid sequence of SEQ ID NO:25; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO: 53; VHCDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO: 53; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:56 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:56 and a light chain comprising the amino acid sequence of SEQ ID NO:25; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO: 57; VHCDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO: 57; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:59 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:59 and a light chain comprising the amino acid sequence of SEQ ID NO:25; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO: 62; VHCDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: SEQ ID NO:37; VH-CDR2: SEQ ID NO: 62; VH-CDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:64 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:64 and a light chain comprising the amino acid sequence of SEQ ID NO:25; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO: 65; VHCDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: SEQ ID NO:42; VH-CDR2: SEQ ID NO: 65; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:67 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:67 and a light chain comprising the amino acid sequence of SEQ ID NO:25; or a variant or variants thereof. In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO: 68; VHCDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody comprises the CDRs: SEQ ID NO:52; VH-CDR2: SEQ ID NO: 68; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:70 or a variant thereof. In one embodiment, the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In one embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:70 and a light chain comprising the amino acid sequence of SEQ ID NO:25; or a variant or variants thereof. In various embodiments, any of the antibodies of the invention described herein, having any of the variable regions described herein, may comprise an Fe fragment or an Fe domain. For example, in some embodiments, an antibody described herein herein comprises an Fe fragment of an immunoglobulin. Exemplary immunoglobulins include, but are not limited to, IgG1, IgG2, IgG3, IgG4, IgM, IgA, IgE, and IgD. In one embodiment, the antibody comprises a human IgG4. In one embodiment, the antibody comprises a human IgG4 comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the antibody comprises a human IgG4 having a S108P mutation relative to SEQ ID NO: 32. In one One embodiment, the human IgG4 having an S108P mutation with respect to SEQ ID NO: 32 comprises the amino acid sequence of SEQ ID NO: 33. In one embodiment, the antibody comprises a human IgG4 Fe having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32. In one embodiment, the human IgG4 Fe having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32 comprises the amino acid sequence of SEQ ID NO: 61. In one embodiment, the antibody is at least one selected from the group consisting of L3-1, L1-2, H1-4, H1-8 / L1-9, and H2-6 / L3-5. In one embodiment, the antibody is a variation of mAb H1-8 / L1-9. In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a substitution of the proline residue at position #4 (ie, P4) in VH CDR2, with respect to SEQ ID NO:4. In various embodiments, the substitution in P4 is P4 —> F4 (i.e. P4F), P4 -> L4 (i.e. P4L), P4 —> M4 (i.e. P4M), P4 -> W4 (i.e. P4W), or P4 -> 14 (i.e. P4I). In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a substitution of the threonine residue at position #4 (ie, T9) in VH CDR.2, with respect to SEQ ID NO:4. In various embodiments, the substitution in T9 is T9^H9 (ie T9H), T9^F9 (ie T9F), T9^L9 (ie T9L), T9^M9 (ie T9M), T9 ^W9 (ie T9W), or T9^I9 (ie T9I). In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a substitution of the proline residue at position #4 (ie, P4) in VH CDR2, with respect to SEQ ID NO:4, and a substitution of the threonine residue at position #9 (ie, T9) in VH CDR2, with respect to SEQ ID NO:4. In various embodiments, the substitution at P4 is P4—>F4 (ie, P4F), P4—>L4 (ie, P4L), P4—>M4 (ie, P4M), P4—>W4 (ie, P4W), or P4—>14 (ie, P4I); and the substitution in T9 is T9^H9 (ie T9H), T9^F9 (ie T9F), T9^L9 (ie T9L), T9->M9 (ie T9M), T9—> W9 (ie T9W), or T9^I9 (ie T9I). In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a substitution of the valine residue at position #16 (ie, V16) in VH CDR3, with respect to SEQ ID NO:5. In various embodiments, the substitution in V16 is V16 -> F16 (ie V16F), V16 E16 (ie V16E), or V16 W16 (ie V16W). In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a leucine residue substitution at position #9 (ie, L9) in VH CDR1, with respect to SEQ ID NO:20. In various embodiments, the substitution in L9 is L9 —> W9 (ie, L9W), L9 -> 19 (ie, L9I), L9 -> V9 (ie, L9V), L9 -> Y9 (ie, L9Y), or L9 F9 (i.e. L9F). In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a substitution of two or more from the group consisting of proline 4 (P4) in VH CDR2, referring to SEQ ID NO:4, threonine 9 ( T9) in VH CDR2, relative to SEQ ID NO:4, valine 16 (V16) in VH CDR3, relative to SEQ ID NO:5, and leucine 9 (L9) in VH CDR1, relative to SEQ ID NO:20 . In various embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprising a substitution of two or more from the group consisting of proline 4 (ie, P4) and VH CDR2, with respect to SEQ ID NO: 4, valine 16 (ie, V16) in VH CDR3, relative to SEQ ID NO:5, and leucine 9 (ie, L9) in VH CDR1, relative to SEQ ID NO:20 comprises the two or more substitutions selected from the group consisting of L9I / P4M, L9I / P4W, L9I / P4F, L9F / P4M, L9F / P4W, L9F / P4F, L9I / P4M / V16W, L9I / P4W / V16W, L9I / P4F / V16W, L9F / P4M / V16W, L9F / P4W / V16W, L9F / P4F / V16W, L9I / P4M / V16E, L9I / P4W / V16E, L9I / P4F / V16E, L9F / P4M / V16E, L9F / P4W / V16E, L9F / P4F / V16E, L9I / P4M / T9H / V16W, L9I / P4W / T9H / V16W, L9I / P4F / T9H / V16W, L9F / P4M / T9H / V16W, L9F / P4W / T9H / V16W, L9F / P4F / T9H / V16W, L9I / P4M / T9H / V16E, L9I / P4W / T9H / V16E, L9I / P4F / T9H / V16E, L9F / P4M / T9H / V16E, L9F / P4W / T9H / V16E, and L9F / P4F / T9H / V16E. In one embodiment, the present invention relates to a method of treating a complement pathway-mediated disease or disorder in an individual, comprising the step of administering to said individual the claimed anti-C5 antibody. In one embodiment the disease or disorder is selected at least from the group consisting of: macular degeneration (DM), age-related macular degeneration (AMD), ischemia reperfusion injury, arthritis, rheumatoid arthritis, lupus, ulcerative colitis, stroke cerebrovascular disease, postoperative systemic inflammatory syndrome, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH) syndrome, myasthenia gravis, neuromyelitis optica (NMO), multiple sclerosis, delayed graft function, antibody-mediated rejection , atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with cardiopulmonary bypass surgery and renal dialysis), C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including, but not limited to, ANCA-mediated glomerulonephritis, lupus nephritis, and combinations thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS, and antiphospholipid antibody-induced pregnancy loss, or any combination thereof. In some modalities, the PA-mediated disease is C3 glomerulopathy. In some embodiments, the AP-mediated disease is macular degeneration, such as age-related macular degeneration. In one embodiment, administration of the anti-C5 antibody inhibits the generation of a C5a or C5b protein. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:11, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:14; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:17; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:20; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:26; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:29, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO:38; VH-CDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO: 43; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO: 48; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO: 53; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO: 57; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NQ:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO: 62; VH-CDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO: 65; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a method of reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual via a route of administration selected from the group consisting of enteral administration. , parenteral administration and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO: 68; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention is an antibody against human C5, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than any 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:2 or a variant thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a light chain (vL) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:7 or a variant thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 2, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 7. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a light chain (vL) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 13 or a variant thereof. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 2, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 13. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a light chain (vL) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 16. In one embodiment, the antibody is an antibody fragment selected from the group consisting of into Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 2, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 16. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 19. In one embodiment, the antibody is an antibody fragment selected from the group consisting of into Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a light chain (vL) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:7. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 19, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 7. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:22. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a light chain (vL) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:25. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 22, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:28. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a light chain (vL) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:31. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 28, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 31. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:41. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 41, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:46. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 46, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:51. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 51, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:56. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 56, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:59. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 59, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:64. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 64, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:67. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 67, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor D, wherein the antibody has a heavy chain (vH) variable region that has an amino acid sequence that is greater than 90% (such as greater than either 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:70. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the present invention relates to an antibody against human C5, where the antibody has a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is more than about 90% (such as more than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 70, and in which the vL region has an amino acid sequence that is greater than about 90% (such as greater than either 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor C5, wherein the antibody has an Fe fragment having an amino acid sequence that is about 90% (such as greater than any of 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:32. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor C5, wherein the antibody has an Fe fragment having an amino acid sequence that is about 90% (such as greater than any of 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:33. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In some embodiments, the invention is an antibody against human factor C5, wherein the antibody has an Fe fragment having an amino acid sequence that is about 90% (such as greater than any of 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:61. In one embodiment, the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof. In one embodiment, the present invention relates to a cell comprising at least one of the antibodies described elsewhere herein. In some embodiments, the cell produces the antibody to at least one of the antibodies described elsewhere herein. In one embodiment, the cell is a hybridoma. In one embodiment, the present invention is a cell line comprising at least one of the antibodies described elsewhere herein. In some embodiments, the cell line produces at least one of the antibodies described elsewhere herein. In some embodiments, the cell line is a hybridoma cell line. In one embodiment, the present invention relates to a genetically modified non-human animal. In one embodiment, the genetically modified non-human animal expresses human C5. In one embodiment, the genetically modified non-human animal is a rodent. In one embodiment, the genetically modified non-human animal is a mouse. In one embodiment, the genetically modified non-human animal is a NOD / SCID mouse. In one embodiment, the genetically modified non-human animal is an FcRn / SCID mouse. BRIEF DESCRIPTION OF THE DRAWINGS The foregoing explanation, as well as the following detailed description of exemplary embodiments of the invention, will be better understood when read in conjunction with the accompanying drawings. It is to be understood, however, that the invention is not limited to the precise arrangements and implements of the embodiments shown in the drawings. In the drawings: Figure 1 depicts nucleotide and amino acid sequences of a mAb 2G1 humanized variable heavy (VH) chain (humanized 2G1 VH-11801) and mAb 2G1 humanized variable light (VL) chain (humanized 2G1 VL-1901). Humanization was achieved by the CDR grid of murine VH mAb 2G1 in a germline-encoded human VH framework (11801) and the CDR grid of murine mAb 2G1 VL in a germline-encoded human VL framework (1901). The amino acid sequences of the signal peptides are underlined and those of CDR1, CDR2 and CDR3 are in bold and shaded. Figure 2 depicts nucleotide and amino acid sequences of mAb L3-1, humanized VH11801 and humanized VL-1901 with a Q H substitution in VL-CDR3. Figure 3 depicts nucleotide and amino acid sequences of mAb L1-2, humanized VH11801 and humanized VL-1901 with a TH substitution in VL-CDR1. Figure 4 depicts nucleotide and amino acid sequences of mAb Hl-4, humanized VH11801 and humanized VL-1901 with an I —> H substitution in VH-CDR1. Figure 5 depicts nucleotide and amino acid sequences of mAb H1-8 / L1-9, humanized VH-11801 and humanized VL-1901 with an N -> H substitution in VH-CDR1 and a YH substitution in VL-CDR1. Figure 6 depicts nucleotide and amino acid sequences of mAb H2-6 / L3-5, humanized VH-11801 and humanized VL-1901 with a Y H substitution in VH-CDR2 and an E H substitution in VL-CDR3. Figure 7 depicts an byte trace of C5 binding and dissociation of the parental humanized mAb 11801 (VH-11801 (SEQ ID NO: 2) and VL-1901 (SEQ ID NO: 7)) at pH 5.8 and pH 7.4. Figure 8 depicts an byte trace of C5 binding and dissociation of mAb L3-1 at pH 5.8 and pH 7.4. Figure 9 depicts an byte trace of C5 binding and dissociation from mAb L1-2 at pH 5.8 and pH 7.4. Figure 10 depicts an byte trace of C5 binding and dissociation from mAb Hl-4 at pH 5.8 and pH 7.4. Figure 11 depicts an byte trace of C5 binding and dissociation of mAb H2-6 / L3-5 at pH 5.8 and pH 7.4. Figure 12 depicts an byte trace of C5 binding and dissociation of mAb H1-8 / L1-9 at pH 5.8 and pH 7.4. Figure 13 depicts the results of a classical pathway complement-mediated sheep red blood cell lysis assay to assess the C5 inhibitory effect of parental humanized mAb 11801 (VH-11801 (SEQ ID NO:2) and VL-1901 (SEQ ID NO:7)) and its variants mAb L1-2, mAb L3-1 and mAb H2-6 / L3-5. Figure 14 depicts the results of a classical pathway complement-mediated sheep red blood cell lysis assay to assess the C5 inhibitory effect of parental humanized mAb 11801 (VH-11801 (SEQ ID NO:2) and VL-1901). (SEQ ID NO:7)) and variant mAb H1-8 / L1-9. Figure 15 depicts the results of a classical pathway complement-mediated sheep red blood cell lysis assay to assess the C5 inhibitory effect of parental humanized mAb 11801 (VH-11801 (SEQ ID NO:2) and VL-1901 (SEQ ID NO:7)) and variant mAb H1-4 / L3-1. Figure 16 depicts the results of an ELISA assay evaluating the level of human C5 in the plasma of NOD / SCID mice engineered to express human C5. MI, M3, M4 and M5 designate 4 representative mice. Figure 17 shows the results of an assay evaluating the level of human IgG4 in the plasma of NOD / SCID mice engineered to express human C5 after injection with mAbs Hl-4, H1-8 / L1-9, H2- 6 / L3-5, L3-1 or Ll-2. Figure 18 depicts the results of a classical pathway complement-mediated chicken red blood cell assay evaluating the pharmacodynamics of the parental humanized 2G1 mAb (VH-11801 (SEQ ID NO:2) and VL-1901 (SEQ ID NO: 7)) in NOD / SCID mice genetically modified to express human C5. Figure 19 shows the results of a classical pathway complement-mediated chicken red blood cell assay evaluating the pharmacodynamics of mAbs L3-1, Ll-2, Hl-4, H1-8 / L19 and H2-6 / L3. -5 in NOD / SCID mice genetically engineered to express human C5. Figure 20 depicts the results of the ELISA assay demonstrating enhanced binding at pH 7.4 to C5 of mAb Hl-8 / Ll-9 ScFV variants having at least one substitution at leucine 9 (i.e., L9). in VH CDR1, relative to SEQ ID NO:20, proline 4 (ie, P4) in VH CDR2, relative to SEQ ID NO:4, and / or valine 16 (ie, V16) in VH CDR3, with with respect to SEQ ID NO:5 (ie L9^W9 (ie L9W), L9^I9 (ie L9I), L9^V9 (ie L9V), L9^Y9 (ie L9Y) , L9^F9 (ie L9F), P4^F4 (ie P4F), P4^L4 (ie P4L), P4—>M4 (ie P4M), P4 >W4 (ie P4W ), P4 >14 (ie P4I), V16 >F16 (ie V16F), V16 >E16 (ie V16E), and V16 >W16 (ie V16W)). Binding of the H1-8 / L1-9 ScFV mAb variants is shown in column 3 (OD450) and 4 (OD450 confirmation) and that of the parental H1-8 / L1-9 ScFV mAb is shown in column 8 (WT / OD450). Figure 21 depicts the results of an octet assay evaluating the relative C5 binding affinity of mAb H1-8 / L1-9 variants expressed in Expi-CHO cells as human IgG4. Expi-CHO cells were transfected with H1-8 VH variants as specified and L1-9 VL (SEQ ID NO: 23) and the cell culture supernatant was evaluated 2 days after transfection. For a given cell culture supernatant, the ratio of C5 binding response to antibody binding response was calculated and used as a measure of C5 binding affinity. Shown in the figure are the ratios calculated from two separate octet assays of a transfection experiment with mAb H1-8 / L1-9 IgG4 variants that have at least one substitution at leucine 9 (ie, L9) in VH CDR1, relative to SEQ ID NO:20, proline 4 (ie, P4) in VH CDR2, relative to SEQ ID NO:4, and / or valine 16 (ie, V16) in VH CDR3, relative to SEQ ID NO:5 (ie L9—>W9 (ie L9W), L9^I9 (ie L9I), L9^V9 (ie L9V), L9->Y9 (ie L9Y), L9 —>F9 (ie L9F), P4—>F4 (ie P4F), P4^L4 (ie P4L), P4^M4 (ie P4M), P4^W4 (ie P4W) , P4^I4 (ie P4I), V16^F16 (ie V16F) , V16^E16 (ie V16E) and V16->W16 (ie V16W)). Figure 22 depicts the results of an Octet assay evaluating the rate of dissociation at pH 7.4 and pH 5.8, respectively, of variants C5 and mAb H1-8 / L1-9. The percent decrease for each mAb at pH 7.4 and pH 5.8 from the peak 05 binding response after transitioning from the association phase to the dissociation phase was calculated. Percentage decreases in two separate octet assays of a transfection experiment with mAb H1-8 / L1-9 IgG4 variants having at least one substitution at leucine 9 (ie, L9) in VH CDR1 are calculated in the figure. , relative to SEQ ID NO:20, proline 4 (ie, P4) in VH CDR2, relative to SEQ ID NO:4, and / or valine 16 (ie, V16) in VH CDR3, relative to SEQ ID NO:5 (ie L9—>W9 (ie L9W), L9—>19 (ie L9I), L9—>V9 (ie L9V), L9—>Y9 (ie L9Y ), L9—>F9 (ie L9F), P4—>F4 (ie P4F), P4—>L4 (ie P4L), P4—>M4 (ie P4M), P4—>W4 (ie P4W), P4^I4 (ie P4I), V16^F16 (ie V16F) , V16^E16 (ie V16E) and V16^W16 (ie V16W)). Figure 23 lists 18 combination replacement variants (i.e. L9I / P4M, L9I / P4W, L9I / P4F, L9F / P4M, L9F / P4W, L9F / P4F, L9I / P4M / V16W, L9I / P4W / V16W, L9I / P4F / V16W, L9F / P4M / V16W, L9F / P4W / V16W, L9F / P4F / V16W, L9I / P4M / V16E, L9I / P4W / V16E, L9I / P4F / V16E, L9F / P4M / V16E, L9F / P4W / V16E, and L9F / P4F / V16E). These combination variants were derived from 7 single variants of the H1-8 / L1-9 IgG4 mAb (ie, L9I, L9F, P4M, P4W, P4F, V16E, V16W) that showed improved C5 binding affinity over H1. -8 / L1- parental 9 mAb and, at the same time, maintained a differential pH of 7.4 and a dissociation rate of pH 5.8 (see Fig. 21 and 22). Figure 24 depicts the results of an Octet assay evaluating the relative C5 binding affinity of mAb H1-8 / L1-9 combination substitution variants expressed in Expi-CHO cells as human IgG4. Expi-CHO cells were transfected with Hl-8 VH combination substitution variants and cell culture supernatant was evaluated 2 days post-transfection. For a given cell culture supernatant, the ratio of C5 binding response to antibody binding response was calculated and used as a measure of C5 binding affinity. The figure shows the ratios calculated from a transfection experiment with H1-8 / L1-9 mAb combination substitution variants L9I / P4M, L9I / P4W, L9I / P4F, L9F / P4M, L9F / P4W, L9F / P4F, L9I / P4M / V16W, L9I / P4W / V16W, L9I / P4F / V16W, L9F / P4M / V16W, L9F / P4W / V16W, L9F / P4F / V16W, L9I / P4M / V16E, L9I / P4W / V16E, L9I / P4F / V16E, L9F / P4M / V16E, L9F / P4W / V16E, and L9F / P4F / V16E. Figure 25 depicts the results of an Octet assay evaluating the rate of dissociation at pH 7.4 and pH 5.8, respectively, of the combination substitution variants C5 and mAb H1-8 / L1-9. The percent decrease for each mAb at pH 7.4 and pH 5.8 from the C5 peak binding response after transitioning from the association phase to the dissociation phase was calculated. The figure shows the percent decreases calculated in a transfection experiment with mAb combination substitution variants H1-8 / L1-9 IgG4 L9I / P4M, L9I / P4W, L9I / P4F, L9F / P4M, L9F / P4W , L9F / P4F, L9I / P4M / V16W, L9I / P4W / V16W, L9I / P4F / V16W, L9F / P4M / V16W, L9F / P4W / V16W, L9F / P4F / V16W, L9I / P4M / V16E, L9I / P4W / V16E, L9I / P4F / V16E, L9F / P4M / V16E, L9F / P4W / V16E, and L9F / P4F / V16E. Figure 26 depicts the results of experiments evaluating the affinity binding of C5 at pH 7.4 of additional scFV mutants from the mAb 1819 affinity maturation experiment, including clone 14C6 corresponding to the T to H mutation in the position 9 of VH CDR2. Figure 27 depicts the results of experiments evaluating the differential affinity of C5 binding at pH 7.4 and pH 5.8 of additional scFV mutants from the mAb 1819 affinity maturation experiment, including clone 14C6 corresponding to the T mutation. to H at position 9 of VH CDR2. Figure 28 depicts the results of experiments sorting additional scFV mutants from the mAb 1819 affinity maturation experiment based on differential binding at pH 7.4 and pH 5.8, showing that clone 14C6 is the best sorted mutant among this group of mutants. Clone 14C6 corresponds to the T to H mutation at position 9 of VH CDR2. Figure 29 depicts the nucleotide and amino acid sequences of the IWW-VH variant of mAb H1-8 / L1-9 (top), humanized VH-11801 with N > H and L > I substitutions in VHCDR1, a P > W substitution. in VH -CDR2 and a V > W substitution in VH-CDR3; as well as nucleotide and amino acid sequences of mAb H1-8 / L1-9 variant IFW-VH (below), humanized VH-11801 with N > H and L > I substitutions in VH-CDR1, a P > F substitution in VH - CDR2 and a V —> W substitution in VH-CDR3. Figure 30 shows the nucleotide and amino acid sequences of mAb H1-8 / L19 variant FME-VH (top), humanized VH-11801 with N^HyL^F substitutions in VH-CDR1, a P —> M substitution in VH -CDR2. and a V E substitution in VH-CDR3; as well as nucleotide and amino acid sequences of the mAb H1-8 / L1-9 variant FMW-VH (below), humanized VH-11801 with N^HyL^F substitutions in VH-CDR1, a P -> M substitution in VH -CDR2 and a V W substitution in VH-CDR3. Figure 31 depicts the nucleotide and amino acid sequences of the mAb variant H1-8 / L1-9 FMEH-VH, humanized VH-11801 with N^HyL^Fen VH-CDR1 substitutions, P^MyT^HenVH -CDR2 substitutions and a V -> E substitution in VH-CDR3 Figure 32 depicts an byte trace of C5 binding and dissociation of mAb H1-8 / L1-9, FMW, IFW, FME and IWW at pH 5.8 and pH 7.4. Figure 33 depicts the % binding of cleaved C5 for mAb VH-11801, Hl8 / L1-9, FMW, IFW, FME and IWW at pH 7.4 and pH 5.8. Figure 34 depicts the results of a classical pathway complement-mediated sheep red blood cell lysis assay to assess the C5 inhibitory effect of the parental humanized mAb H1-8 / L1-9 (VH-11801 (SEQ ID NO: 22) and VL-1901 (SEQ ID NO:25)), and its variants IFW PLA (VH-11801 (SEQ ID NO:46) and VL-1901 (SEQ ID NO:25)), FME PLA (SEQ ID NO :51) and VL-1901 (SEQ ID NO:25)), IWW PLA (SEQ ID NO: 41) and VL-1901 (SEQ ID NO:25)), and FMW PLA (SEQ ID NO:56) and VL -1901 (SEQ ID NO:25)). Figure 35 depicts an byte trace of C5 binding and dissociation of mAb H1-8 / L1-9, FME, FMEH, FMW and IFW at pH 5.8 and pH 7.4. Figure 36 depicts the results of pH dependent binding with neat H1-8 / L19, FME, FMEH, FMW and IFW at pH 5.8 and pH 7.4. Figure 37 depicts the results of a classical pathway complement-mediated sheep red blood cell lysis assay to evaluate the C5 inhibitory effect of the parental humanized PLA mAb FME (SEQ ID NO:51) and VL-1901 (SEQ ID NO:25), FMEH PLA (SEQ ID NO:59) and VL1901 (SEQ ID NO:25)), FMW PLA (SEQ ID NO: 56) and VL-1901 (SEQ ID NO:25)), and IFW PLA (VH 11801 (SEQ ID NO:46) and VL-1901 (SEQ ID NO:25)). Figure 38 depicts nucleotide and amino acid sequences of humanized C5 mouse FcRn / SCID human IgG4 Fe domain mutations. Figure 39 depicts plasma C5 results in humanized C5 mice produced by hydrodynamic injection of human C5 cDNA. Figure 40 shows the results of an assay evaluating the level of total C5 in the plasma of FcRn / SCID mice engineered to express human C5 after injection with mAbs H1-8 / L1-9 IFW-PLA, H1-8. / L1-9 FMW-PLA or H1-8 / L1-9 FMEH-PLA. Figure 41 shows the results of an assay evaluating the level of total IgG4 in the plasma of FcRn / SCID mice engineered to express human C5 after injection with mAbs H1-8 / L1-9 IFW-PLA, H1-8. / L1-9 FMW-PLA or H1-8 / L1-9 FMEH-PLA. Figure 42 shows the results of a classical pathway complement-mediated chicken red blood cell assay evaluating the pharmacodynamics of mAbs H1-8 / L1-9 IFW-PLA, H18 / L1-9 FMW-PLA or H1-8. / L1 -9 FMEH-PLA in FcRn / SCID mice genetically engineered to express human C5. Figure 43 depicts the results of an assay evaluating the level of total hIgG4 in the plasma of FcRn / SCID mice engineered to express human C5 after injection with mAbs 11801 and FMEH-PLA. Figure 44 depicts the results of a classical pathway complement-mediated chicken red blood cell assay evaluating the pharmacodynamics of mAbs 11801 and FMEHPLA in FcRn / SCID mice engineered to express human C5. Figure 45 depicts the results of an assay evaluating the level of total C5 in the plasma of FcRn / SCID mice engineered to express human C5 after injection with mAbs 11801 and FMEH-PLA. DETAILED DESCRIPTION OF THE INVENTION This invention relates to the inhibition of complement signaling using an anti-C5 antibody. In some embodiments, the anti-C5 antibody exhibits pH-dependent binding to C5. In some embodiments, the pH-dependent anti-C5 antibody binds more strongly to C5 at a more neutral pH (for example, about pH 7.4; as found in blood) than at a more acidic pH (for example, about pH 5.8; like that found in the endosome). In various embodiments, the invention is directed to compositions and methods for treating a complement-mediated disease or complement-mediated disorder in an individual by contacting the individual with an anti-factor D antibody. Complement-mediated pathologies and conditions that can be treated with the compositions and methods of the invention include, for example, macular degeneration (DM), age-related macular degeneration (AMD), ischemia reperfusion injury, arthritis, rheumatoid arthritis, lupus, ulcerative colitis, stroke , postoperative systemic inflammatory syndrome, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH) syndrome, myasthenia gravis, neuromyelitis optica (NMO), multiple sclerosis, delayed graft function, antibody-mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including but not limited to inflammation associated with cardiopulmonary bypass surgery and renal dialysis), C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including, but not limited to, ANCA-mediated glomerulonephritis, lupus nephritis, and combinations thereof), vasculitis ANCA-mediated, Shiga toxin-induced HUS, and antiphospholipid antibody-induced pregnancy loss, or any combination thereof. Definitions Unless otherwise defined, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this invention pertains. Although any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, exemplary methods and materials are described. As used herein, each of the following terms has the meaning associated with it in this section. The articles un and una are used in this document to refer to one or more than one (ie, at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element. The terms "inhibit" and "inhibition" as used herein mean to reduce, abolish, decrease, or block an activity or function by at least about 10% relative to a control value. In some embodiments, activity is suppressed or blocked by at least about 50% compared to a control value. In some embodiments, activity is suppressed or blocked for at least about 75%. In some embodiments, activity is suppressed or blocked by at least about 95%. The terms "effective amount" and "pharmaceutically effective amount" refer to a sufficient amount of an agent to provide the desired biological result. That result can be reduction and / or alleviation of the signs, symptoms, or causes of a disease or disorder, or any other desired alteration of a biological system. An appropriate effective amount in any individual case can be determined by one of skill in the art using routine experimentation. The terms patient, subject, individual, and the like are used interchangeably herein and refer to any animal, in some embodiments a mammal, and in some embodiments a human, that has a complement system, including a human that requires a therapy for, or is amenable to, a condition or its sequelae. The individual can include, for example, dogs, cats, pigs, cows, sheep, goats, horses, rats, monkeys and mice, and humans. The term abnormal when used in the context of organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof that differ in at least one observable or detectable characteristic (for example , age, treatment, time of day, etc.) of those organisms, tissues, cells or components thereof that display the respective normal characteristic (expected / homeostatic). Characteristics that are normal or expected for one cell, tissue type, or subject, must be abnormal for a different cell or tissue type. A disease is a state of a subject's health where the subject is unable to maintain homeostasis, and where if the disease is not alleviated then the subject's health continues to deteriorate. In contrast, a disorder in a subject is a state of health in which the subject is able to maintain homeostasis, but in which the subject's state of health is less favorable than it would be in the absence of the disorder. If left untreated, a disorder does not necessarily cause a further decline in the subject's health status. A disease or disorder is alleviated if the severity of a sign or symptom of the disease or disorder, the frequency with which said sign or symptom is experienced by a patient, or both, are reduced. An effective amount or therapeutically effective amount of a compound is that amount of a compound that is sufficient to provide a beneficial effect to the subject to whom the compound is administered. As used herein, an instructional material includes a publication, record, diagram, or any other means of expression that can be used to communicate the utility of a compound, composition, vector, or delivery system of the invention in the kit to effect relief from the various diseases or disorders recited herein. Optionally, or alternatively, the instructional material may describe one or more methods of alleviating disease or disorders in a mammalian cell or tissue. The instructional material of the kit of the invention may, for example, be affixed to a container containing the identified compound, composition, vector, or delivery system of the invention or shipped together with the container containing the compound, composition, vector. , or administration system identified. Alternatively, the instructional material may be shipped separately from the container with the intent that the instructional material and the composite are used cooperatively by the recipient. "Operably linked" or "operably linked" as used herein can mean that the expression of a gene is under the control of a promoter to which it is partially connected. A promoter may be positioned 5' (upstream) or 3' (downstream) of a gene under its control. The distance between the promoter and a gene can be approximately the same as the distance between that promoter and the controlling gene in the gene from which the promoter is derived. As is known in the art, variation in this distance can be accommodated without loss of promoter function. A therapeutic treatment is a treatment administered to a subject exhibiting signs of a disease or disorder, for the purpose of diminishing or eliminating those signs. As used herein, to treat a disease or disorder means to reduce the frequency and / or severity of a sign and / or symptom of the disease or disorder that is experienced by a patient. The phrase biological sample, sample, or specimen as used herein is intended to include any sample comprising a cell, tissue, or body fluid in which expression of a nucleic acid or polypeptide can be detected. The biological sample may contain any biological material suitable for detecting the desired biomarkers, and may comprise cellular and / or non-cellular material obtained from the individual. Examples of such biological samples include, but are not limited to, blood, lymph, bone marrow, biopsies, and smears. Samples that are liquid in nature are referred to herein as body fluids. Biological samples can be obtained from a patient by a variety of techniques including, for example, scraping or cleaning an area or using a needle to obtain body fluids. Methods for collecting various body samples are well known in the art. The term "antibody" as used herein refers to an immunoglobulin molecule that is capable of specifically binding to a specific epitope of an antigen. The antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies in the present invention can exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, intracellular (intrabodies) antibodies, Fv, Fab, Fab', F(ab)2, and F(ab')2. , as well as single chain antibodies (scFv), heavy chain antibodies, such as camelid antibodies, and humanized antibodies (Harlow, et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al ., 1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York, Houston et al., 1988, Proc. Nati. Acad. Sci. USA 85:5879-5883, Bird et al., 1988, Science 242:423- 426). By the term "synthetic antibody" as used herein, it is meant an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage. The term is also to be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and said DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, in where the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequencing technology which is available and well known in the art. As used herein, the term "heavy chain antibody" or "heavy chain antibodies" encompasses immunoglobulin molecules derived from camelid species, either by immunization with a peptide and subsequent isolation from sera, or by cloning and expression of sequences. of nucleic acids encoding said antibodies. The term "heavy chain antibody" or "heavy chain antibodies" further encompasses immunoglobulin molecules isolated from a subject with a heavy chain disease or prepared by cloning and expressing the VH (variable immunoglobulin heavy chain) genes from a subject. A chimeric antibody refers to a type of engineered antibody that contains a naturally occurring variable region (light chain and heavy chains) derived from a donor antibody in association with heavy and light chain constant regions derived from an acceptor antibody. A humanized antibody refers to a type of engineered antibody that has its CDRs derived from a non-human donor immunoglobulin, the remaining immunoglobulin-derived portions of the molecule being derived from one (or more) human immunoglobulin(s). ). In addition, framework support residues can be altered to preserve binding affinity (see, for example, 1989, Queen et al., Proc. Nati. Acad Sci USA, 86:10029-10032; 1991, Hodgson et al., Bio / Technology, 9:421). A suitable human acceptor antibody may be one selected from a standard database, for example, the KABAT database, the Los Alamos database, and the Swiss Protein database, by homology to the nucleotide and amino acid sequences of the antibody. donor. A human antibody characterized by homology to the framework regions of the donor antibody (on an amino acid basis) may be suitable to provide a heavy chain constant region and / or a heavy chain variable framework region for insertion of the donor CDRs. . A suitable acceptor antibody capable of donating the light chain constant or variable framework regions can be selected in a similar manner. It should be noted that acceptor antibody heavy and light chains are not required to originate from the same acceptor antibody. The prior art describes various ways of producing such humanized antibodies (see, for example, EP-A-0239400 and EP-A-054951). The term "donor antibody" refers to an antibody (monoclonal, and / or recombinant) that contributes the amino acid sequences of its variable regions, CDRs, or other functional fragments or analogs thereof to a first immunoglobulin partner, to provide the altered immunoglobulin coding region and the resulting expressed altered antibody with the antigenic specificity and neutralizing activity characteristic of the donor antibody. The term "acceptor antibody" refers to an antibody (monoclonal and / or recombinant) heterologous to the donor antibody, which contributes all (or any portion, but in some embodiments all) of the amino acid sequences encoding its framework regions. heavy and / or light chain and / or their heavy and / or light chain constant regions for the first immunoglobulin partner. In certain embodiments a human antibody is the acceptor antibody. CDRs are defined as the amino acid sequences of the complementarity determining region of an antibody that are the hypervariable regions of immunoglobulin heavy and light chains. See, for example, Kabat et al., Sequences of Proteins of Immunological Interest, 4th Ed., U.S. Department of Health and Human Services, National Institutes of Health (1987). There are three heavy chain CDRs and three light chain CDRs (or CDR regions) in the variable portion of an immunoglobulin. Thus, CDRs as used herein refers to the three heavy chain CDRs, or the three light chain CDRs (or both the heavy and light chain CDRs, if applicable). The structure and folding of the antibody protein may mean that other residues are considered part of the antigen binding regions and would be understood by a person skilled in the art. See, for example, Chothia et al., (1989) Conformations of immunoglobulin hypervariable regions; Nature 342, p 877-883. As used herein, an "immunoassay" refers to any binding assay that uses an antibody capable of specifically binding to a target molecule to detect and quantify the target molecule. By the term "binds specifically," as used herein with respect to an antibody, is meant an antibody which recognizes and binds a specific target molecule, but does not substantially recognize or bind other molecules in a sample. In some cases, the terms "specific binding" or "bind specifically" are used to mean that recognition and binding depend on the presence of a particular structure (eg, an antigenic determinant or epitope) on the target molecule. If, for example, an antibody binds specifically to the A epitope, the presence of an untagged molecule containing the A epitope (or free, untagged A) in the reaction containing the tagged A and the antibody will reduce the amount of labeled A bound to the antibody. A coding region of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous to or complementary to, respectively, the coding region of an mRNA molecule which is Produced by gene transcription. A coding region of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anti-codon region of a transfer RNA molecule during translation of the mRNA molecule or which codes for a stop codon. The coding region may therefore include nucleotide residues that comprise codons for amino acid residues which are not present in the mature protein encoded by the mRNA molecule (for example, amino acid residues in a protein export signal sequence). . Differentially down-expressed or down-regulated refers to levels of the biomarker product that are at least 10% or greater, eg, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% less or less, and / or 2.0 times, 1.8 times, 1.6 times, 1.4 times, 1.2 times, 1.1 times or less, and any and all partial increases in between the same as a control. "Differentially upregulated expression" or "upregulation" refers to levels of the biomarker product that are at least 10% or greater, eg, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90%. % greater or more, and / or 1.1 times, 1.2 times, 1.4 times, 1.6 times, 1.8 times, 2.0 times greater or greater, and any and all partial or full increases in between the same as a control. "Complementarity" as used herein to refer to a nucleic acid, refers to the broad concept of sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that an adenine residue of a first region of nucleic acid is capable of forming specific hydrogen bonds (base pairs) with a residue of a second region of nucleic acid which is antiparallel to the first region if the residue is thymine. or uracil. Similarly, it is known that a cysteine ​​residue of a first strand nucleic acid is capable of base-pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine. A first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue from the first region is capable of base-pairing with a residue from the second region. In some embodiments, the first region comprises a first portion and the second region comprises a second portion such that, when the first and second portions are arranged in an antiparallel fashion, at least approximately 50%, or at least approximately 75% %, or at least about 90%, or at least about 95% of the nucleotide residues in the first portion are capable of base-pairing with nucleotide residues in the second portion. In some embodiments, all nucleotide residues in the first portion are capable of base-pairing with nucleotide residues in the second portion. The term DNA, as used herein, is defined as deoxy ribonucleic acid. Coding refers to the inherent property of specific nucleotide sequences in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for the synthesis of other polymers and macromolecules in biological processes that have either a sequence a defined nucleotide sequence (ie, rRNA, tRNA, and mRNA) or a defined sequence of amino acids and the biological properties that result therefrom. Thus, a gene codes for a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA. Unless otherwise specified, a nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence encoding a protein or RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron. Isolated means altered or removed from the natural state. For example, a naturally occurring nucleic acid or peptide in its normal context in a living subject is not isolated, but the same nucleic acid or peptide partially or completely separated from co-occurring materials in its natural context is isolated. An isolated nucleic acid or protein 77RQQH / 1 7Π7 / □ / ΥΙΛΙ may exist in a substantially purified form, or may exist in a non-native environment such as, for example, in a host cell. The term hybridoma, as used herein, refers to a cell that results from the fusion of a B-lymphocyte and a fusion partner such as a myeloma cell. A hybridoma can be cloned and maintained indefinitely in cell culture and is capable of producing monoclonal antibodies. A hybridoma can also be considered to be a hybrid cell. An isolated nucleic acid refers to a nucleic acid segment or fragment that has been separated from flanking sequences in a natural state, i.e., a DNA fragment that has been removed from sequences that are normally adjacent to the fragment, i.e. that is, the sequences adjacent to the fragment in a genome in which it occurs naturally. The term also applies to nucleic acids that have been substantially purified from other naturally occurring components of the nucleic acid, ie, RNA or DNA or proteins, which naturally occur in the cell. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or that exists as a separate molecule (i.e. , such as a cDNA or a cDNA or genomic fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA, which is part of a hybrid gene that encodes the additional polypeptide sequence. In the context of the present invention, the following abbreviations for commonly occurring nucleic acid bases are used. A refers to adenosine, C refers to cytosine, G refers to guanosine, T refers to thymidine, and U refers to uridine. The term polynucleotide, as used herein, is defined as a chain of polynucleotides. Additionally, nucleic acids are polymers of nucleotides. Therefore, nucleic acids and polynucleotides as used herein are interchangeable. One of ordinary skill in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into monomeric nucleotides. Monomeric nucleotides can be hydrolyzed to nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., cloning of nucleic acid sequences. from a recombinant library or a cellular genome, using ordinary cloning technology and PCR, and the like, and by synthetic means. As used herein, the terms peptide, polypeptide, and protein are used interchangeably, and refer to a compound comprising amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein or peptide sequence. Polypeptides include any peptide or protein that comprises two or more amino acids linked together by peptide bonds. As used herein, the term refers to both short chains, which are commonly referred to in the art as peptides, oligopeptides, and oligomers, for example, and longer chains, which are generally referred to in the art as proteins, of which which there are many types. Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variant polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof. The term "progeny" as used herein refers to a descendant or offspring and includes the offspring of a mammal, and also includes the defunct differentiated or undifferentiated cell derived from a parental cell. In one usage, the term "progeny" refers to a progeny cell that is genetically identical to the mother. In another usage, the term progeny refers to a progeny cell that is genetically and phenotypically identical to the mother. In yet another usage, the term progeny refers to a progeny cell that has differentiated from the parent cell. The term RNA, as used herein, is defined as ribonucleic acid. The term recombinant DNA as used herein is defined as DNA produced by joining pieces of DNA from different sources. The term recombinant polypeptide as used herein is defined as a polypeptide produced using recombinant DNA methods. As used herein, "conjugated" refers to the covalent attachment of one molecule to a second molecule. Variant, as the term is used herein, is a nucleic acid sequence or peptide sequence that differs in sequence from a reference nucleic acid sequence or peptide sequence respectively, but retains essential biological properties of the reference molecule. Changes in the sequence of a variant nucleic acid may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions, and truncations. Changes in the sequence of variant peptides are typically limited or conservative, such that the sequences of the reference peptide and the variant are closely similar globally and, in many regions, identical. A variant and reference peptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A variant of a nucleic acid or peptide may be a naturally occurring such as an allelic variant, or it may be a variant not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides can be prepared by mutagenesis techniques or by direct synthesis. In various embodiments, the variant sequence is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 89%, at least 88%, at least 87%, at least 86%, at least 85% identical to the reference sequence. The term "regular" as used herein can mean any method of altering the level or activity of a substrate. Non-limiting examples of regulation with respect to a protein include affecting expression (including transcription and / or translation), affecting folding, affecting protein degradation or turnover, and affecting the localization of a protein. Non-limiting examples of regulation with respect to an enzyme further include affecting enzyme activity. "Regulator" refers to a molecule whose activity includes affecting the level or activity of a substrate. A regulator can be direct or indirect. A regulator can puncture to activate or inhibit or otherwise modulate its substrate. A scan window, as used herein, refers to a segment of a number of contiguous positions where a sequence can be evaluated independently of any flanking sequences. A scan window is scrolled incrementally through a sequence to be evaluated with each new segment being evaluated independently. An incremental offset can be 1 or more than one position. Vector as used herein can mean a nucleic acid sequence that contains an origin of replication. A vector can be a plasmid, a bacteriophage, a bacterial artificial chromosome or a yeast artificial chromosome. A vector can be a DNA or RNA vector. A vector can be a self-replicating extrachromosomal vector or a vector that integrates into a host genome. Scales: Throughout this description, various aspects of the invention can be presented in a scale format. It is to be understood that the description in scaled format is merely for convenience and brevity, and should not be construed as an inflexible limitation on the scope of the invention. Therefore, the description of a scale should be considered as having specifically described all possible subscales as well as individual numerical values ​​within that scale. For example, the description of a scale, such as 1 to 6, should be considered to have the subscales specifically described, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6 etc., as well as individual numbers within that scale, for example, 1,2, 2.7, 3, 4, 5, 5.3 and 6. This applies regardless of the width of the scale. Description This invention relates to the inhibition of complement signaling and complement related disorders using an anti-C5 antibody. In some embodiments, the anti-C5 antibody exhibits pH-dependent binding to C5. In some embodiments, the pH-dependent anti-C5 antibody binds more strongly to C5 at a more neutral pH (for example, about pH 7.4; as found in blood) than at a more acidic pH (for example, about pH 5.8; like that found in the endosome). Such pH-dependent binding provides increased persistence of the administered antibody molecules, because immune complexes (i.e., C5-bound anti-C5 mAb) taken up by the cells will dissociate in the acidic environment of the endosome and allow the released antibody to release. it is recycled back out of the cell via the neonatal Fe receptor (FcRn) where it is available to bind to a new C5 molecule. In one embodiment, the invention is directed to inhibiting the complement signaling cascade by specifically targeting the complement component C5 protein, or a fragment of the C5a or C5b protein. In one embodiment, the invention is directed to methods of treating and preventing inflammation and autoimmune diseases mediated by unwanted, uncontrolled, and excessive complement activation of AP. In one embodiment the invention is directed towards the treatment of complement-mediated disease or complement-mediated disorder in an individual by contacting the individual with an anti-C5 antibody. In one embodiment, the invention is a method of treating a complement-mediated disease or disorder in an individual, comprising the step of administering to said individual an anti-C5 antibody, thereby inhibiting the generation of C5a or C5b protein. and the formation of MAC. Examples of complement-mediated pathologies that can be treated using the methods of the invention include, for example, macular degeneration (DM), age-related macular degeneration (AMD), ischemia reperfusion injury, arthritis, rheumatoid arthritis, lupus , ulcerative colitis, stroke, postoperative systemic inflammatory syndrome, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH) syndrome, myasthenia gravis, neuromyelitis optica (NMO), multiple sclerosis, delayed graft function , antibody-mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including includes, but is not limited to, inflammation associated with cardiopulmonary bypass surgery and renal dialysis), C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including, but not limited to, ANCA-mediated glomerulonephritis), Iupus nephritis, and combinations thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS, and antiphospholipid antibody-induced pregnancy loss, or any combination thereof. In some embodiments, the compositions and methods of the invention are useful for treating subjects, including subjects having PNH, who are unresponsive to treatment with eculizumab. By way of non-limiting example, some subjects may have a mutation in the C5 alpha chain that may render them resistant to eculizumab treatment (see C5 Genetic Variants and Poor Response to Eculizumab. Nishimura J, et al., N Engl J Med 2014 Feb 13;370(7):632-9). The ability of the immune system to discriminate between self and non-self antigens is vital for the functioning of the immune system as a specific defense against invading microorganisms. Non-self antigens are those antigens in substances entering or present in the body that are detectably different or foreign from the subject's own constituents, while self antigens are those that, in the healthy subject, are not detectably different or foreign from its own constituents. In various embodiments of the methods, the activation of the AP that is inhibited is that which is triggered by at least one of the group consisting of a microbial antigen, a foreign non-biological surface, an altered self-tissue, or combinations thereof. An example of a non-biological foreign surface is a blood tube such as that used in cardiopulmonary bypass surgery or kidney dialysis. Examples of altered self-tissues include apoptotic, necrotic, and ischemia-stressed tissues and cells without functional complement regulatory proteins or combinations thereof. In some embodiments, the anti-C5 antibodies of the invention inhibit the downstream effects of alternative complement pathway (AP) activation, but do not inhibit classical pathway (CP) and lectin pathway (LP) activation. ). CP is generally initiated by antigen-antibody complexes, LP is activated by lectin binding to sugar molecules on microbial surfaces, while AP is constitutively active at a low level but can be rapidly amplified. on bacterial, viral and parasitic cell surfaces due to the lack of regulatory proteins. Host cells are generally protected from complement activation by PA by means of regulatory proteins. But in some situations, such as when regulatory proteins are defective or missing, AP can also be activated in an uncontrolled manner in host cells, leading to complement-mediated disease or disorder. The CP consists of Cl, C2, C4 components and converges with the AP in the C3 activation step. LP consists of mannose-binding lectins (MBLs) and MBL-associated serine proteases (Masps) and shares components C4 and C2 with CP. AP consists of the C3 components and several factors, such as factor B, factor D, properdin, C5, and the fluid phase regulating factor H. Complement activation consists of three stages: (a) recognition, (b) enzyme activation, and (c) membrane attack leading to cell death. The first phase of complement activation of AP begins with Cl. Cl is made up of three different proteins: a recognition subunit Clq, and the serine protease subcomponents Clr and Cls, which bind together in a tetrameric complex dependent on AP. calcium Clr2 s2. An intact C1 complex is required for physiological Cl activation to result. Activation occurs when the intact C1 complex binds to immunoglobulin complexed with the antigen. This binding activates Cls which then cleaves both the C4 and C2 proteins to generate C4a and C4b, as well as C2a and C2b. The C4b and C2a fragments combine to form the C3 convertase, C4b2a, which in turn cleaves C3 to form C3a and C3b. Activation of LP is initiated by binding of MBL to certain sugars on the target surface and this triggers activation of MBL-associated serine proteases (MASP) which then cleaves C4 and C2 in a manner analogous to the activity of CP Cls, resulting in the generation of the C3 convertase, C4b2a. Thus, CP and LP are activated by different mechanisms but share the same C4 and C2 components and both pathways lead to the generation of the same C3 convertase, C4b2a. The cleavage of C3 via C4b2a into C3b and C3a is a central event of the complement pathway for two reasons. It initiates the AP amplification loop because C3b deposited on the surface is a central AP intermediate. Both C3a and C3b are biologically important. C3a is proinflammatory and together with C5a they are mentioned as anaphylatoxins. C3b and its additional cleavage products also bind to complement receptors on neutrophils, eosinophils, monocytes, and macrophages, facilitating phagocytosis and clearance of opsonized C3b particles. Finally, C3b can associate with C4b2a to form the C5 convertase of CP and LP to activate the terminal complement sequence, leading to the production of C5a, a potent proinflammatory mediator, and the assembly of the lytic membrane attack complex. (MAC), C5-C9. In one embodiment, the complement pathway activity that is inhibited using a method of the invention is a complement pathway activation induced by at least one of the group selected from a lipopolysaccharide (LPS), lipooligosaccharide (LOS), molecular patterns Pathogen-Associated Patterns (PAMPs) and Hazard-Associated Molecular Patterns (DAMPs). In another embodiment, the complement signaling activity that is inhibited using a method of the invention is the generation of the C5a protein. In another embodiment, the complement signaling activity that is inhibited using a method of the invention is the generation of the C5b protein. In another embodiment, the complement signaling activity that is inhibited using a method of the invention is MAC formation. In another embodiment, the complement pathway activity that is inhibited using a method of the invention is C5-dependent. In one embodiment, the invention is a method of inhibiting the initiation of terminal complement activation in an individual, comprising the step of administering to said individual an anti-C5 antibody, thereby inhibiting the initiation of terminal complement activation. terminal originating from CP, LP or AP in an individual. Examples of these modalities are patients with PNH suffering from complement-mediated hemolysis and individuals suffering from complement-mediated aHUS, asthma, ischemic / reperfusion injury, rheumatoid arthritis and ANCA-mediated renal diseases. In various embodiments of the invention, diseases and disorders that can be treated using the compositions and methods of the invention include, but are not limited to, complement-mediated hemolysis, complement-mediated aHUS, glomerulopathy, neuromyelitis optica, myasthenia gravis, asthma, ischemic / reperfusion injury, rheumatoid arthritis, and ANCA-mediated renal diseases or disorders. In various embodiments, methods are provided herein to identify a potential anti-C5 antibody that has inhibitory effects on terminal complement activation. One such method is the sheep red blood cell lysis assay as described below. Briefly, sheep red blood cells (1x107 cells per test sample prepared in PBS, Complement Technology Inc) were incubated at 37°C for 20 min with 50% normal human serum (NHS, from Complement Technology Inc) in veronal gelatin buffer ( GVB2+, Sigma, total assay volume: 100 I). Prior to addition to sheep red blood cells, NHS was pre-incubated with anti-C5 mAb for 1 hour at 4°C. The lysis reaction was stopped by the addition of ice-cold 40 mM EDTA in PBS. The incubation mixtures were centrifuged for 5 min at 1500 rpm and the supernatant was collected and the OD405 nm measured. Samples without NHS or with added EDTA were used as negative lysis controls, and a sample of fully used sheep red blood cells with distilled water was used as a positive control (100% lysis) against which % lysis was normalized in other samples. A separate method that can be used in confirmatory screening of anti-human C5 block mAbs includes the steps of: a) coating a plate with lipopolysaccharide (LPS); b) washing the plate to remove unbound LPS; c) adding bovine serum albumin (BSA) into phosphate buffered saline (PBS); d) washing the plate to remove unbound BSA; e) adding a mixture of an anti-factor D antibody candidate compound that has been previously incubated with serum and mixed into normal human serum; f) washing the plate; g) adding an HRP-conjugated anti-human C3 antibody; h) washing the plate to remove unbound antibody; i) adding HRP substrate reagent; j) adding sulfuric acid to stop the reaction; k) measuring the optical density at 450 nm; I) comparing the optical density of the plate containing the anti-factor D antibody candidate compound with the optical density of a positive comparison control and a negative comparison control; wherein when the optical density decreases compared to the positive comparison control, the anti-C5 antibody is identified. Anti-C5 antibodies In some embodiments, the invention includes compositions comprising an antibody that specifically binds to C5. In one embodiment, the anti-C5 antibody is a polyclonal antibody. In another embodiment, the anti-C5 antibody is a monoclonal antibody. In some embodiments, the anti-C5 antibody is a chimeric antibody. In additional embodiments, the anti-C5 antibody is a humanized antibody. In some embodiments, the antibody is a fragment of the antibody. In some modalities, the C5 is a human C5. In some embodiments, the anti-C5 antibody exhibits pH-dependent binding to C5. In some embodiments, the pH-dependent anti-C5 antibody binds more strongly to C5 at a more neutral pH (for example, about pH 7.4; as found in blood) than at a more acidic pH (for example, about pH 5.8; like that found in the endosome). In some embodiments, binding of the antibody or antibody fragment to human C5 with a reduction in C5a or C5b generation and MAC formation in the complement activation pathway in an intact organism. In some embodiments, the invention is a protein or polypeptide capable of binding to human C5. In some embodiments, the antibody or antibody fragment; the protein or a polypeptide binds to the relevant portion or fraction or epitope of human C5; and binding of the antibody or antibody fragment thereof, or protein or polypeptide to the relevant portion of human C5 is associated with a reduction in C5a or C5b generation and MAC formation in an intact organism. In some embodiments, the human anti-C5-binding antibody, or a C5-binding antibody fragment thereof, is conjugated to a protein, peptide, or other compound. In some embodiments, the anti-C5 binding antibody, or an antibody fragment thereof, is conjugated to a protein, peptide, or other compound. In some embodiments, the protein, peptide, or other compound to which the human anti-C5 antibody or antibody fragment thereof is conjugated is a targeting moiety (ie, the targeting moiety specifically binds to a molecule other than C5). human). In some embodiments, the protein, peptide, or other compound to which the human C5-binding antibody or antibody fragment thereof is conjugated is an effector molecule (eg, a cytotoxic molecule). In various embodiments, any of the antibodies of the invention described herein, having any of the variable regions described herein, can comprise an Fe fragment or an Fe domain. For example, in some embodiments, an antibody described herein herein comprises an Fe fragment of an immunoglobulin. Exemplary immunoglobulins include, but are not limited to, IgG1, IgG2, IgG3, IgG4, IgM, IgA, IgE, and IgD. In one embodiment, the antibody comprises a human IgG4 Fe. SEQ ID NO:32 is an exemplary amino acid sequence of a human IgG4 Fc fragment. In some embodiments, the antibody of the invention comprises a human IgG4 Fe fragment having an S108P mutation relative to SEQ ID NO: SEQ ID NO:33 is an exemplary amino acid sequence of a human IgG4 Fe fragment having an S108P mutation with respect to SEQ ID NO: 32. In some embodiments, the antibody of the invention comprises a human IgG4 Fe fragment having one or more of: an S108P mutation, an M308L mutation, and an N314A mutation, relative to with SEQ ID NO: 32. In some embodiments, the antibody of the invention comprises a human IgG4 Fe fragment having an S108P mutation, an M308L mutation and an N314A mutation, with respect to SEQ ID NO: 32 (also referred to in herein that has an Fe P1_A mutation). SEQ ID NO:61 is an exemplary amino acid sequence of a human IgG4 Fc fragment having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO:32. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:3 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; and VL-CDR1: SEQ ID NO:8. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; and VL-CDR3: SEQ ID NQ:10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:8; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:11, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 11, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:3 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; and VL-CDR1: SEQ ID NO:8. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:11, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; and VL-CDR3: SEQ ID NO:11. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 11, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 11. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:8; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 11. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 13 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb L3-1, or a variant thereof. The monoclonal anti-C5 antibody mAb L3-1 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2, or a light chain comprising the amino acid sequence of SEQ ID NO:13. In one embodiment, the antibody anti-C5 comprises an Fe fragment. In one embodiment, the anti-C5 antibody comprises an Fe fragment of human IgG4 or a variant thereof. In one embodiment, the anti-C5 antibody mAb L3-1 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 2; a light chain comprising the amino acid sequence of SEQ ID NO: 13; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having an S108P mutation relative to SEQ ID NO: 32, or its variants. In one embodiment, the anti-C5 antibody mAb L3-1 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2; a light chain comprising the amino acid sequence of SEQ ID NO: 13; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the anti-C5 antibody mAb L3-1 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2; a light chain comprising the amino acid sequence of SEQ ID NO: 13; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:14; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO: 14; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:3 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 14, or a variant thereof comprising up to about 3 (such as about any one of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; and VL-CDR1: SEQ ID NO:14. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4; and VL-CDR2: SEQ ID NO:9: In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; and VL-CDR3: SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 14, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 14, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 14; VL<DR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 16 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb L1-2, or a variant thereof. The monoclonal anti-C5 antibody mAb L1-2 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2, or a light chain comprising the amino acid sequence of SEQ ID NO:16. In one embodiment, the antibody anti-C5 comprises an Fe fragment. In one embodiment, the anti-C5 antibody comprises an Fe fragment of human IgG4 or a variant thereof. In one embodiment, the anti-C5 mAb L1-2 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 2; a light chain comprising the amino acid sequence of SEQ ID NO: 16; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the anti-C5 mAb L1-2 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2; a light chain comprising the amino acid sequence of SEQ ID NO: 16; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the anti-C5 mAb L1-2 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2; a light chain comprising the amino acid sequence of SEQ ID NO: 16; and a human IgG4 Fe fragment having a S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-antibody -C5 is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:17; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:17; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 17 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:17; and VL-CDR1: SEQ ID NO:8. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of 77RQQH / 1 7Π7 / □ / ΥΙΛΙ SEQ ID NO:4; and VL-CDR2: SEQ ID NO:9: In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; and VL-CDR3: SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 17, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 17, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 17; VHCDR2 comprising the amino acid sequence of SEQ ID NO:4; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:8; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:7 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb Hl-4, or a variant thereof. The monoclonal anti-C5 antibody mAb Hl-4 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:19, or a light chain comprising the amino acid sequence of SEQ ID NO:7. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the anti-C5 mAb Hl-4 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19; a light chain comprising the amino acid sequence of SEQ ID NO: 7; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the anti-C5 mAb Hl-4 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19; a light chain comprising the amino acid sequence of SEQ ID NO:7; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the anti-C5 mAb Hl-4 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19; a light chain comprising the amino acid sequence of SEQ ID NO:7; and a human IgG4 Fe fragment having a S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-antibody -C5 is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:20; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:20; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:20 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:20; and VL-CDR1: SEQ ID NO:23. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4; and VL-CDR2: SEQ ID NO:9: In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; and VL-CDR3: SEQ ID NO:10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 20, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR.1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 20, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:20; VHCDR2 comprising the amino acid sequence of SEQ ID NO:4; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:23; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:22 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb H1-8 / L1-9, or a variant thereof. The monoclonal anti-C5 antibody mAb H1-8 / L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:22, or a light chain comprising the amino acid sequence of SEQ ID NO:25. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 22; a light chain comprising the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:22; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:22; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:26; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:29, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:26; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:29, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:3 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:8, or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; and VL-CDR1: SEQ ID NO:8. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:26 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:26; and VL-CDR2: SEQ ID NO:9: In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:29, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; and VL-CDR3: SEQ ID NO:29. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 26, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 29, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 26, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 29. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:26; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:8; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO:29. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:28 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:31 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb H2-6 / L3-5, or a variant thereof. The monoclonal anti-C5 antibody mAb H2-6 / L3-5 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:28, or a light chain comprising the amino acid sequence of SEQ ID NO:31. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the anti-C5 antibody mAb H2-5 / L3-5 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 28; a light chain comprising the amino acid sequence of SEQ ID NO: 31; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the anti-C5 antibody mAb H2-6 / L3-5 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:28; a light chain comprising the amino acid sequence of SEQ ID NO:31; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the anti-C5 antibody mAb H2-6 / L3-5 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:28; a light chain comprising the amino acid sequence of SEQ ID NO:31; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:34; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:34; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:3 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; and VL-CDR1: SEQ ID NO:8. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:34 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:34; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; and VL-CDR3: SEQ ID NO:10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 34, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 34, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:34; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:8; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:36 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:7 or a variant thereof. In some embodiments, the monoclonal anti-C5 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:36, or a light chain comprising the amino acid sequence of SEQ ID NO:7. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the anti-C5 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:36; a light chain comprising the amino acid sequence of SEQ ID NO:7; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the anti-C5 antibody mAb L3-1 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:36; a light chain comprising the amino acid sequence of SEQ ID NO:7; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the anti-C5 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:36; a light chain comprising the amino acid sequence of SEQ ID NO:7; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO:38; VH-CDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VL CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO:38; VH-CDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:37 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:37; and VL-CDR1: SEQ ID NO:23. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:38 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:38; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:39 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:39; and VL-CDR3: SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 37, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 38, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 39, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 37, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 38, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 39; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:37; VHCDR2 comprising the amino acid sequence of SEQ ID NO:38; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:39; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:23; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb H1-8 / L1-9, or a variant thereof. In one embodiment, the monoclonal anti-C5 antibody mAb H1-8 / L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41, or a light chain comprising the amino acid sequence of SEQ ID NO:41. 25. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the IWW variant anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having an S108P mutation or a variant thereof. In one embodiment, the IWW variant anti-C5 H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41; a light chain comprising the amino acid sequence of SEQ ID NO:25; and an Fe fragment of human IgG4 having an S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an Fe fragment of Human IgG4 having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the IWW variant anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO: 43; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO: 43; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:42 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:42; and VL-CDR1: SEQ ID NO:23. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:43 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:43; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:44 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:44; and VL-CDR3: SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 42, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 43, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 44, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 42, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 43, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 44; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:42; VHCDR2 comprising the amino acid sequence of SEQ ID NO:43; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:44; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:23; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:46 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb H1-8 / L1-9, IFW variant or a variant thereof. In one embodiment, the IFW variant mAb H1-8 / L1-9 monoclonal anti-C5 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:46, or a light chain comprising the amino acid sequence of SEQ ID NO:46. NO:25. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the IFW variant anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:46; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the IFW variant anti-C5 H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:46; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the IFW variant anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:46; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO: 48; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO: 48; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:47 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:47; and VL-CDR1: SEQ ID NO:23. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:48 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:48; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:49 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:49; and VL-CDR3: SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 47, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 48, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 49, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 47, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 48, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 49; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:47; VH67 CDR2 comprising the amino acid sequence of SEQ ID NO:48; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:49; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:23; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:51 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb H1-8 / L1-9, FME variant, or a variant thereof. In one embodiment, the monoclonal anti-C5 antibody mAb H1-8 / L1-9 FME variant comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:51, or a light chain comprising the amino acid sequence of SEQ ID NO:25. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the FME variant anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:51; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the FME variant anti-C5 H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:51; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the FME variant anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:51; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO: 53; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO: 53; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:52 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:52; and VL-CDR1: SEQ ID NO:23. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:53 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:53; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:54 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:54; and VL-CDR3: SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 53, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 54, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR.1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 53, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 54; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:52; VHCDR2 comprising the amino acid sequence of SEQ ID NO:53; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:54; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:23; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:56 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb H1-8 / L1-9, FMW variant, or a variant thereof. In one embodiment, the monoclonal anti-C5 antibody mAb H1-8 / L1-9 variant FMW comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:56, or a light chain comprising the amino acid sequence of SEQ ID NO:56. NO:25. In one embodiment, the anti- C5 comprises an Fe fragment. In one embodiment, the anti-C5 antibody comprises an Fe fragment of human IgG4 or a variant thereof. In one embodiment, the FMW variant anti-C5 mAb H1-8 / L19 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:56; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the FMW variant anti-C5 H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:56; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the anti-C5 mAb H1-8 / L1-9 variant FMW antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:56; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO: 57; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO: 57; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:57 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:57; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 47, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 57, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 49, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 47, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 57, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 49; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:47; VHCDR2 comprising the amino acid sequence of SEQ ID NO:57; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:49; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:23; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:59 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb H1-8 / L1-9, FMEH variant, or a variant thereof. In one embodiment, the monoclonal anti-C5 antibody mAb H1-8 / L1-9 variant FMEH comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:59, or a light chain comprising the amino acid sequence of SEQ ID NO:59. NO:25. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the FMEH variant anti-C5 mAb H1-8 / L19 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:59; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the FMEH variant anti-C5 H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:59; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the FMEH variant anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:59; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO: 62; VH-CDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO: 62; VH-CDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:62 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:62; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 37, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 62, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 39, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 37, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 62, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 39; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. 77RQQH / 1 7Π7 / □ / ΥΙΛΙ In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:37; VHCDR2 comprising the amino acid sequence of SEQ ID NO:62; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:39; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:23; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:64 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb H1-8 / L1-9, IWWH variant or a variant thereof. In one embodiment, the monoclonal anti-C5 antibody mAb H1-8 / L1-9 variant IWWH comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:64, or a light chain comprising the amino acid sequence of SEQ ID NO:64. NO:25. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the IWWH variant anti-C5 mAb H1-8 / L19 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:64; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the IWWH variant anti-C5 H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:64; a light chain comprising the amino acid sequence of SEQ ID NO:25; and an Fe fragment of human IgG4 having an S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an Fe fragment of Human IgG4 having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the anti-C5 mAb H1-8 / L1-9 variant IWWH antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:64; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO: 65; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO: 65; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:65 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:65; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 42, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 65, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 44, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 42, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 65, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 44; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:42; VHCDR2 comprising the amino acid sequence of SEQ ID NO:65; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:44; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:23; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:67 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb H1-8 / L1-9, IFWH variant or a variant thereof. In one embodiment, the IFWH variant mAb H1-8 / L1-9 monoclonal anti-C5 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:67, or a light chain comprising the amino acid sequence of SEQ ID NO:67. NO:25. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the IFWH variant anti-C5 mAb H1-8 / L19 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:67; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the IFWH variant anti-C5 H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:67; a light chain comprising the amino acid sequence of SEQ ID NO:25; and an Fe fragment of human IgG4 having an S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an Fe fragment of Human IgG4 having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the IFWH variant anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:67; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In one embodiment, the anti-C5 antibody or an antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO: 68; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO:23; VLCDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO: 68; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:68 or a variant thereof comprising up to about 3 (such as about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:68; and VL-CDR2: SEQ ID NO:9. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 68, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 54, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1,2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof comprising up to about 3 (such as any one of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof comprising up to about 3 (such as about any of 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 68, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 54; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof comprising up to about 3 (such as about any 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:52; VHCDR2 comprising the amino acid sequence of SEQ ID NO:68; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:54; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:23; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the anti-C5 antibody or an antigen-binding fragment thereof comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:70 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb H1-8 / L1-9, FMWH variant, or a variant thereof. In one embodiment, the monoclonal anti-C5 antibody mAb H1-8 / L1-9 variant FMWH comprises a heavy chain comprising the amino acid sequence of SEQ ID NQ:70, or a light chain comprising the amino acid sequence of SEQ ID NO:25. In one embodiment, the anti-C5 antibody comprises a Fe fragment. In one embodiment, the anti-C5 antibody comprises a Fe fragment of human IgG4 or a variant thereof. In one embodiment, the FMWH variant anti-C5 mAb H1-8 / L19 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NQ:70; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fe fragment having a S108P mutation relative to SEQ ID NO: 32 , or its variants. In one embodiment, the FMWH variant anti-C5 H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:70; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 Fe fragment having a S108P mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises an IgG4 Fe fragment human having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO: 32, or variants thereof. In one embodiment, the FMWH variant anti-C5 mAb H1-8 / L1-9 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:70; a light chain comprising the amino acid sequence of SEQ ID NO:25; and a human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation with respect to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 antibody is humanized. In some embodiments the monoclonal anti-C5 antibody is a chimeric antibody. In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a proline substitution at position #4 (ie, P4) in VH CDR2, with respect to SEQ ID NO:4. In various embodiments, the substitution in P4 is P4 -> F4 (i.e. P4F), P4 -> L4 (i.e. P4L), P4 -> M4 (i.e. P4M), P4 -> W4 (i.e. P4W), or P4 -> 14 (i.e. P4I). In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a threonine substitution at position #9 (ie, T9) in VH CDR2, with respect to SEQ ID NO:4. In various embodiments, the substitution in T9 is T9—>H9 (ie T9H), T9 is T9^F9 (ie T9F), T9^L9 (ie T9L), T9^M9 (ie T9M ), T9^W9 (ie T9W), or T9^I9 (ie T9I). In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a proline substitution at position #4 (i.e., P4) in VH CDR2, with respect to SEQ ID NO:4, and a substitution of the threonine residue at position #9 (ie, T9) in VH CDR2, with respect to SEQ ID NO:4. In various embodiments, the substitution in P4 is P4—>F4 (ie, P4F), P4—>L4 (ie, P4L), P4^M4 (ie, P4M), P4—>W4 (ie, P4W ), or P4^I4 (ie, P4I); and the substitution in T9 is T9—>H9 (ie T9H), T9 is T9^F9 (ie T9F), T9^L9 (ie T9L), T9—>M9 (ie T9M), T9^W9 (ie T9W), or T9^I9 (ie T9I). In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a valine substitution at position #16 (ie, V16) on VH CDR3, with respect to SEQ ID NO:5. In various embodiments, the substitution in V4 is V16 —> F16 (ie V16F), V16 -> E16 (ie V16E), or V16 W16 (ie V16W). In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a substitution of the asparagine residue at position #8 (ie, N8) in VH CDR.1, with respect to SEQ ID NO:3. In various embodiments, the substitution at N8 is N8—>H8 (i.e., Ν8Η), N8^W8 (ie N8W), N8^I8 (ie N8I), N8^V8 (ie N8V), N8^Y8 (ie N8Y), or N8^F8 (ie , N8F). In some embodiments, the anti-C5 antibody or its antigen-binding fragment comprises a leucine residue substitution at position #9 (ie, L9) in VH CDR1, with respect to SEQ ID NO:20. In various embodiments, substitution in L9 is L9 -> W9 (ie L9W), L9 -> 19 (ie L9I), L9 -> V9 (ie L9V), L9 -> Y9 (ie L9Y), or L9 F9 (i.e. L9F). In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a substitution of two or more from the group consisting of proline 4 (P4) in VH CDR2, referring to SEQ ID NO:4, threonine 9 ( T9) in VH CDR.2, relative to SEQ ID NO:4, valida 16 (V16) in VH CDR3, relative to SEQ ID NO:5 and leucine 9 (L9) in VH CDR1, relative to SEQ ID NO:20. In various embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprising a substitution of two or more from the group consisting of proline 4 (ie, P4) and VH CDR2, with respect to SEQ ID NO: 4, threonine 9 (ie, T9) in VH CDR2 relative to SEQ ID NO:4, valine 16 (ie, vl6) in (VI6) in VH CDR3, relative to SEQ ID NO:5, and leucine 9 (ie, L9) in VH CDR1, with respect to SEQ ID NO:20 comprises the two or more substitutions selected from the group consisting of L9I / P4M, L9I / P4W, L9I / P4F, L9F / P4M, L9F / P4W, L9F / P4F, L9I / P4M / V16W, L9I / P4W / V16W, L9I / P4F / V16W, L9F / P4M / V16W, L9F / P4W / V16W, L9F / P4F / V16W, L9I / P4M / V16E, L9I / P4W / V16E, L9I / P4F / V16E, L9F / P4M / V16E, L9F / P4W / V16E, L9F / P4F / V16E, L9I / P4M / T9H / V16W, L9I / P4W / T9H / V16W, L9I / P4F / T9H / V16W, L9F / P4M / T9H / V16W, L9F / P4W / T9H / V16W, L9F / P4F / T9H / V16W, L9I / P4M / T9H / V16E, L9I / P4W / T9H / V16E, L9I / P4F / T9H / V16E, L9F / P4M / T9H / V16E, L9F / P4W / T9H / V16E, and L9F / P4F / T9H / V16E. In some embodiments the antibodies are chimeric antibodies. In some embodiments the anti-human C5 antibody may comprise human heavy chain and human light chain constant regions in combination with the variable region CDR sequences described elsewhere in the specification. One skilled in the art may be able to prepare and obtain a chimeric antibody using known techniques of exchanging domains relevant to specific antibodies of interest. Such an antibody is easily prepared by grafting the domains of the heterogeneous antibody, incorporating one or more CDR sequences described in this application. Using known recombinant technology, it is possible to obtain and prepare a recombinant antibody comprising heavy chain and light chain constant regions encoded by the human heavy chain and light chain constant region nucleic acid sequences; and the heavy chain and light chain variable regions comprising the CDRs encoded by the nucleic acid sequences corresponding to the CDR sequences set forth in the disclosure. One skilled in the art can prepare an anti-human C5 antibody comprising one or more of the CDR sequences described in this disclosure, wherein portions of the light chain alone or portions of the heavy chain alone are replaced with regions of a antibody belonging to another species, such as a human. An anti-human C5 antibody comprising variable regions having one or more CDR sequences selected from SEQ ID NO: 3-5, 8-11, 14, 17, 20, 23, 26, 29, 34, 37- 39, 42-44, 47-49, 52-54, 57, 62, 65, and 68 or a variant(s) thereof, in combination with murine or non-murine antibody structural elements outside of the CDR regions may be prepared by routine methods known in the art. In some embodiments, the antibodies or antibody fragments are further humanized using techniques known in the art. In some embodiments the anti-C5 antibody comprises an antibody that is at least about 85% (such as at least about any of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid identity with the CDR sequence described herein, listed in SEQ ID NO: 3-5 , 811, 14, 17, 20, 23, 26, 29, 34, 37-39, 42-44, 47-49, 52-54, 57, 62, 65, and 68. In one embodiment, the current disclosure encompasses an anti-C5 antibody having CDR sequences of at least about 85% (such as at least about any of 85%, 86%, 87%, 88%, 89%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with the CDR sequences described above. In one embodiment, the antibody to human C5 stains a heavy chain (vH) variable region and a light chain (vL) variable region, where the vH region has an amino acid sequence that is greater than about 90% (such as more than any one of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to one selected from SEQ ID NO 2, 19, 22, 28, 36, 41, 46, 51, 56, 59, 64, 67, and 70, and wherein the vL region has an amino acid sequence that is greater than about 90% (such as greater than any 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to one selected from SEQ ID NOs 7, 13, 16, 17, 25, and 31. In some embodiments the antibody or antibody fragment is modified. In some embodiments modifications include fusion of the antibody or antigen-binding fragment thereof with portions of another protein, or fragment of the protein. In some embodiments the antibody or antibody fragment thereof of the invention is modified to increase the circulating half-life thereof in vivo. For example, the antibody to the fragment can be fused to an FcRn molecule, which is also known to a neonatal Fe receptor to stabilize the antibody in vivo. (Nature Reviews Immunology 7:715-725). In some embodiments, the antibody or antigen-binding fragment thereof is conjugated (eg, fused) to an effector molecule and / or another targeting moiety (such as an antibody or antigen fragment that recognizes a different molecule, antigen different or a different epitope). One skilled in the art may be able to prepare a human C5-binding single chain variable fragment (scFv), comprising at least one CDR sequence selected from SEQ ID NO 3-5, 8-11, 14, 17, 20, 23, 26, 29, 34, 37-39, 42-44, 47-49, 52-54, 57, 62, 65, and 68 or a variant or variants thereof. An scFv may comprise heavy chain variable region sequences designated in SEQ ID NO 3-5, 17, 20, 26, 34, 37-39, 42-44, 47-49, 5254, 57, 62, 65, and 68. , or a variant or variants thereof and light chain variable regions designated in SEQ ID NO 8-11, 14, 23, and 29 or a variant or variants thereof. CDR sequences incorporated into scFvs that have at least about 85% amino acid sequence identity 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98%, or 99% with the CDR sequences described herein are encompassed within the scope of this description. In some embodiments, the isolated antibody binds to human C5, wherein the antibody binds to an epitope on human C5. In some embodiments, the human C5 antibody of the invention is one that binds to a specific epitope of human C5. In some embodiments, the epitope includes at least one amino acid in the a chain of C5. In some embodiments, the epitope includes at least one amino acid in the C5 β chain. Classification tests The present invention has application in various screening assays, including determining whether a candidate anti-C5 antibody can inhibit complement activity. In some embodiments, the level of complement activity in the presence of the candidate anti-C5 antibody is compared to the complement activity detected in a positive comparison control. The positive comparison control comprises complement activation in the absence of added test compound. In some embodiments, the candidate anti-C5 antibody is identified as a complement inhibitor when the complement activity in the presence of the candidate anti-C5 antibody is less than about 70% of the complement activity detected in a positive comparison control; this corresponds to greater than about 30% inhibition of complement activity in the presence of the test compound. In some embodiments, the candidate anti-C5 antibody is identified as a complement inhibitor when the complement activity in the presence of the candidate anti-C5 antibody is less than about 80% of the complement activity detected in a positive comparison control; this corresponds to greater than about 20% inhibition of complement activity in the presence of the test compound. In some embodiments, the candidate anti-C5 antibody is identified as a complement inhibitor when the complement activity in the presence of the candidate anti-C5 antibody is less than about 90% of the complement activity detected in a positive comparison control; this corresponds to greater than about 10% inhibition of complement activity in the presence of the test compound. In some embodiments, the level of complement inhibition by the candidate anti-C5 antibody is compared to the level of inhibition detected in a negative comparator control. A variety of immunoassay formats, including competitive and non-competitive immunoassay formats, antigen capture assays, two-antibody sandwich assays, and three-antibody sandwich assays are useful methods of the invention (Self et al. , 1996, Curr. Opin. Biotechnol. 7:60-65). The invention should not be construed as being limited to any type of assay known or hitherto unknown, provided that the assay is capable of detecting complement inhibition. Enzyme-linked immunosorbent assays (ELISAs) are useful in the methods of the invention. An enzyme such as, but not limited to, horseradish peroxidase (HRP), alkaline phosphatase, beta-galactosidase, or urease may be linked, for example, to an anti-C5 antibody or a secondary antibody for use in a method of the invention. A horseradish peroxidase detection system can be used, for example, with the chromogenic substrate tetramethylbenzidine (TMB), which produces a soluble product in the presence of hydrogen peroxide that is detectable at 450 nm. Other convenient enzyme-linked systems include, for example, the alkaline phosphatase detection system, which can be used with the chromogenic substrate p-nitrophenyl phosphate to produce a soluble product readily detectable at 405 nm. Similarly, a beta-galactosidase detection system can be used with the chromogenic substrate o-nitrophenyl-beta-D-galactopyranoside (ONPG) to produce a soluble product detectable at 410 nm. Alternatively, a urease detection system can be used with a substrate such as urea-bromocresol purple (Sigma Immunochemicals, St. Louis, MO). Useful enzyme-linked primary and secondary antibodies can be obtained from any number of commercial sources. Chemiluminescent detection is also useful for detecting inhibition of the terminal complement pathway. Chemiluminescent secondary antibodies can be obtained from any number of commercial sources. Fluorescent detection is also useful for detecting terminal complement inhibition. Useful fluorochromes include, but are not limited to, DAPI, fluorescein, Hoechst 33258, R-phycocyanin, B-phycoerythrin, R-phycoerythrin, rhodamine, Texas red, and lissamine- fluorescein or rhodamine labeled antibodies. Radioimmunoassays (RIAs) are also useful in the methods of the invention. Such assays are well known in the art and are described for example in Brophy et al. (1990, Biochem. Biophys. Res. Comm. 167:898-903) and Guechot et al. (1996, Clin. Chem. 42:558-563). Radioimmunoassays are performed, for example, using iodine-125 labeled primary or secondary antibody (Harlow et al., supra, 1999). A signal emitted from a detectable antibody is analyzed, for example, using a spectrophotometer to detect the color of a chromogenic substrate; a radiation counter for detecting radiation, such as a gamma counter for the detection of Iodine-125; or a fluorometer to detect fluorescence in the presence of light of a certain wavelength. When using an enzyme-linked assay, a quantitative analysis is performed using a spectrophotometer. It is understood that the assays of the invention can be performed manually or, if desired, automated and that the signal emitted from multiple samples can be detected simultaneously in many commercially available systems. The methods of the invention also encompass the use of capillary electrophoresis-based immunoassays (CEIA), which can be automated, if desired. Immunoassays can also be used in conjunction with laser-induced fluorescence as described, for example, in Schmalzing et al. (1997, Electrophoresis 18:2184-2193) and Bao (1997, 1 Chromatogr. B. Biomed. Sci. 699:463-480). Liposome immunoassays, such as flow injection liposome immunoassays and liposome immunosensors, can also be used in accordance with the methods of the invention (Rongen et al., 1997, 1 Immunol. Methods 204:105-133). Quantitative western blotting can also be used to determine the level of terminal complement inhibition in the methods of the invention. Western blots are quantified using well known methods such as scanning densitometry (Parra et al., 1998,1 Vasc. Surg. 28:669-675). Administration methods The methods of the invention comprise administering a therapeutically effective amount of at least one anti-C5 antibody or binding fragment thereof (such as any of the antibodies or fragments thereof described elsewhere herein) to a individual identified as having a complement-mediated disease or disorder. In one embodiment, the individual is a mammal that has a complement system. In one embodiment the individual is a human. In various embodiments, at least one anti-C5 antibody, or binding fragment thereof, is administered locally, regionally, or systemically. In various embodiments, the disease or disorder is selected at least from the group consisting of: macular degeneration (DM), age-related macular degeneration (AMD), ischemia reperfusion injury, arthritis, rheumatoid arthritis, lupus, ulcerative colitis, cerebrovascular accident, postoperative systemic inflammatory syndrome, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH) syndrome, myasthenia gravis, neuromyelitis optica (NMO), multiple sclerosis, delayed graft function, mediated rejection antibodies, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including but not limited to , inflammation associated with cardiopulmonary bypass surgery and renal dialysis), C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including, but not limited to, ANCA-mediated glomerulonephritis), lupus nephritis, and combinations thereof) , ANCA-mediated vasculitis, Shiga toxin-induced HUS, and antiphospholipid antibody-induced pregnancy loss, or any combination thereof. In some modalities, the complement-mediated disease is C3 glomerulopathy. In some embodiments, the complement-mediated disease is macular degeneration, such as age-related macular degeneration. In one embodiment, administration of the anti-C5 antibody inhibits the generation of a C5a or C5b protein. In some embodiments, the compositions and methods of the invention are useful for treating subjects, including subjects having PNH, who are unresponsive to treatment with eculizumab. By way of non-limiting example, some subjects may have a mutation in the C5 alpha chain that may render them resistant to treatment with eculizumab (see Genetic variants in C5 and poor response to eculizumab (Nishimura J, et al., N Engl J Med 2014 Feb 13;370(7):632-9). The methods of the invention may comprise the administration of at least one anti-C5 antibody or binding fragment thereof, but the present invention is in no way to be construed as being limited to the anti-C5 antibodies described herein, but rather as should be interpreted to encompass any anti-C5 antibody, both known and unknown, that downregulates and reduces complement activation. The method of the invention comprises administering a therapeutically effective amount of at least one anti-C5 antibody or binding fragment thereof, to an individual wherein a composition of the present invention comprises at least one anti-C5 antibody or binding fragment thereof. binding thereof, either alone or in combination with at least one other therapeutic agent. The invention can be used in combination with other treatment modalities, such as, for example, anti-inflammatory therapies, and the like. Examples of anti-inflammatory therapies that can be used in combination with the methods of the invention include, for example, therapies using steroidal drugs, as well as therapies using non-steroidal drugs. The method of the invention comprises administering a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment thereof, to a subject. In some embodiments, the invention encompasses a method of treating C5-related diseases involving dysregulation of complement signaling by administering a therapeutically effective amount of an antibody of the invention, or a therapeutically effective amount of an antibody fragment thereof. such as to effect a reduction of C5a or C5b or MAC formation in a subject. In some embodiments, the invention encompasses a method of treating C5-related diseases that involves dysregulation of complement signaling by administration of a therapeutically effective amount of an antibody or antibody fragment. In some embodiments, the invention encompasses a method of treating C5-related diseases involving dysregulation of complement signaling by administering to a subject an effective amount of an antibody, antibody fragment, polypeptide, peptide, a conjugated peptide, such that complement activation pathway activation is reduced in the subject. In some embodiments, the method of treatment encompasses administering to a subject a systemically effective dose of an antibody or antibody fragment, whereby systemic C5a or C5b reduction or MAC formation is effected in the subject. Pharmaceutical compositions useful in practicing the invention may be administered to deliver a dose of at least about 1 ng / kg, at least about 5 ng / kg, at least about 10 ng / kg, at least about 25 ng / kg, kg, at least approximately 50 ng / kg, at least approximately 100 ng / kg, at least approximately 500 ng / kg, at least approximately 1 g / kg, at least approximately 5 g / kg, at least about 10 g / kg, at least about 25 g / kg, at least about 50 g / kg, at least about 100 g / kg, at least about 500 g / kg, at least about 1 mg / kg , at least about 5 mg / kg, at least about 10 mg / kg, at least about 25 mg / kg, at least about 50 mg / kg, at least about 100 mg / kg, at least about 200 mg / kg, at least about 300 mg / kg, at least about 400 mg / kg, and at least about 500 mg / kg of the subject's body weight. In one embodiment, the invention administers a dose that results in a concentration of the anti-C5 antibody of the present invention of at least about 1 pM, at least about 10 pM, at least about 100 pM, at least about 1 nM, at least approximately 10 nM, at least approximately lOOnM, at least approximately 1 μΜ, at least approximately 2 μΜ, at least approximately 3 μΜ, at least approximately 4 μΜ, at least approximately 5 μΜ, at least about 6 μΜ, at least about 7 μΜ, at least about 8 μΜ, at least about 9 μΜ and at least about 10 μΜ in an individual. In another embodiment, the invention contemplates the administration of a dose that results in a concentration of the anti-C5 antibody of the present invention between at least about 1 pM, at least about 10 pM, at least about 100 pM, at least about least about 1 nM, at least about 10 nM, at least about lOOnM, at least about 1 μΜ, at least about 2 μΜ, at least about 3 μΜ, at least about 4 μΜ, at least about 5 μΜ, at least about 6 μΜ, at least about 7 μΜ, at least about 8 μΜ, at least about 9 μΜ and at least about 10 μΜ in the plasma of an individual. In some embodiments, pharmaceutical compositions useful in practicing the invention may be administered to deliver a dose of not more than about 1 ng / kg, not more than about 5 ng / kg, not more than about 10 ng / kg, not more than about 25 ng / kg, not more than about 50 ng / kg, not more than about 100 ng / kg, not more than about 500 ng / kg, not more than about 1 g / kg, not more than about 5 g / kg , not more than approximately 10 g / kg, not more than approximately 25 g / kg, not more than approximately 50 g / kg, not more than approximately 100 g / kg, not more than approximately 500 g / kg, not more than approximately 1 mg / kg, not more than about 5 mg / kg, not more than about 10 mg / kg, not more than about 25 mg / kg, not more than about 50 mg / kg, not more than about 100 mg / kg, no more than about 200 mg / kg, no more than about 300 mg / kg, no more than about 400 mg / kg, and no more than about 500 mg / kg of the subject's body weight. In one embodiment, the invention administers a dose that results in a concentration of the anti-C5 antibody of the present invention of not more than about 1 pM, not more than about 10 pM, not more than about 100 pM, not more than about 1 nM, not more than about 10 nM, not more than about lOOnM, not more than about 1 μΜ, not more than about 2 μΜ, not more than about 3 μΜ, not more than about 4 μΜ, not more than about 5 μΜ, not more than about 6 μΜ, not more than about 7 μΜ, not more than about 8 μΜ, not more than about 9 μΜ, and not more than about 10 μΜ in an individual. In another embodiment, the invention contemplates the administration of a dose that results in a concentration of the anti-C5 antibody of the present invention between no more than about 1 pM, no more than about 10 pM, no more than about 100 pM, no more not more than about 1 nM, not more than about 10 nM, not more than about lOOnM, not more than about 1 μΜ, not more than about 2 μΜ, not more than about 3 μΜ, not more than about 4 μΜ, not more than about 5 μΜ, not more than about 6 μΜ, not more than about 7 μΜ, not more than about 8 μΜ, not more than about 9 μΜ, and not more than about 10 μΜ in the plasma of an individual. Dose ranges between any of the doses described herein are also contemplated. Typically, dosages that may be administered in a method of the invention to a subject, in some embodiments a human, range in amount from 0.5 pg to about 50 mg per kilogram of the subject's body weight. However, the precise dose administered will vary depending on any number of factors, including, but not limited to, the type of subject and the type of disease state being treated, the age of the subject, and the route of administration. In some embodiments, the dosage of the compound will range from about 1 pg to about 10 mg per kilogram of subject's body weight. In other embodiments, the dosage will range from about 3 pg to about 1 mg per kilogram of subject's body weight. The antibody can be administered to a subject as often as several times a day, or can be administered less frequently, such as once a day, twice a day, three times a day, once a week, twice a week. , three times a week, once every two weeks, twice every two weeks, three times every two weeks, once a month, twice a month, three times a month, or even less frequently, such as once every several months or even once or several times a year or less. The frequency of the dose will be quite apparent to the person skilled in the art and will depend on various factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the subject, etc. Formulations of pharmaceutical compositions can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients and then, if necessary or desirable, shaping or packaging the product into a single or multi-dose product. desired units. Although the description of the pharmaceutical compositions provided herein is directed primarily to pharmaceutical compositions that are suitable for ethical administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to subjects of all types. . Modification of pharmaceutical compositions suitable for administration to humans, in order to make the compositions suitable for administration to various subjects, is well understood, and such modification can be designed and performed by the skilled veterinary pharmacologist, if at all, solely with normal experimentation. Individuals to which administration of the pharmaceutical compositions of the invention are contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as non-human primates, cattle, pigs, horses, sheep, cats and dogs. Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for ophthalmic, oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, intraocular, intravitreal, intramuscular routes of administration. , intradermal and intravenous. Other contemplated formulations include sprayed nanoparticles, liposomal preparations, filled erythrocytes containing the active ingredient, and immunologically based formulations. A pharmaceutical composition of the invention will be prepared, packaged or sold in bulk, as a single unit dose or as a plurality of single unit doses. A unit dose is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to an individual or a convenient fraction of such a dosage such as, for example, one-half or one-third of said dosage. The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary depending on the identity, size, and condition of the individual treated, and will further depend on the route by which the composition is administered. . By way of example, the composition may comprise between 0.1% and 100% (w / w) of active principle. In various embodiments, the composition comprises at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, of at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 11%, at least about 12%, at least about 13%, at least least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 21%, at least about 22%, at least about 23%, at least about 24%, at least about 25%, at least about 26%, at least about 27%, at least about 28%, at least about 29%, at least about 30%, at least about 31%, at least about 32%, at least about 33%, at least about 34%, at least about 35% %, at least about 36%, at least about 37%, at least about 38%, at least about 39%, at least about 40%, at least about 41%, at least about 42% , at least about 43%, at least about 44%, at least about 45%, at least about 46%, at least about 47%, at least about 48%, at least about 49%, at least approximately 50%, at least approximately 51%, at least approximately 52%, at least approximately 53%, at least approximately 54%, at least approximately 55%, at least approximately 56%, by at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85 %, at least approximately 86%, at least approximately 87%, at least approximately 88%, at least approximately 89%, at least approximately 90%, at least approximately 91%, at least approximately 92% , at least approximately 93%, at least approximately 94%, at least approximately 95%, at least approximately 96%, at least approximately 97%, at least approximately 98%, at least approximately 99%, or at least about 100% (w / w) of the active ingredient. In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents. Controlled or sustained release formulations of a pharmaceutical composition of the invention can be prepared using conventional technology. Parenteral administration of a pharmaceutical composition includes any route of administration characterized by physical perforation of an individual's tissue and administration of the pharmaceutical composition through the perforation into the tissue. Parental administration can be local, regional or systemic. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a non-surgical wound. tissue penetration, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, intravenous, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intradermal, intrasternal, and intratumoral injection. Formulations of a pharmaceutical composition suitable for administration 77RQQH / ί7Π7 / 3 / ΥΙΛΙ parenterals comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged or sold in a form suitable for bolus administration or continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dose form, such as in vials or multidose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable or biodegradable sustained release formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (for example, sterile pyrogen-free water) prior to parenteral administration of the composition. reconstituted. The pharmaceutical compositions may be prepared, packaged or sold in the form of a sterile injectable aqueous or oily solution or suspension. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as dispersing agents, wetting agents, or suspending agents. Such sterile injectable formulations can be prepared using a non-toxic parenterally acceptable diluent or solvent, such as water or 1,3-butanediol, for example. Other acceptable diluents and solvents include, for example, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or diglycerides. Other parenterally administrable formulations that are useful include those comprising the active ingredient in microcrystalline form in a liposomal preparation, or as a component of a biodegradable polymer system. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials, such as an emulsion, ion exchange resin, sparingly soluble polymer, or sparingly soluble salt. A pharmaceutical composition of the invention can be prepared, packaged and / or sold in a formulation suitable for pulmonary administration via the buccal cavity. Said formulation may be composed of dry particles comprising the active ingredient and having a diameter in the range of from about 0.5 to about 7 nanometers, and in some embodiments, from about 1 to about 6 nanometers. These compositions are conveniently in the form of dry powders for administration via a device consisting of a dry powder reservoir into which a stream of propellant can be directed to disperse the powder or use a self-pulse solvent / powder dispensing container as a device composed of the active ingredient dissolved or suspended in a low-boiling propellant in a sealed container. In some embodiments, such powders comprise particles where at least 98% of the particles by weight have a diameter greater than 0.5 nanometers and at least 95% of the particles by number have a diameter of less than 7 nanometers. In some embodiments, at least 95% of the particles by weight are greater than 1 nanometer in diameter and at least 90% of the particles by number are less than 6 nanometers in diameter. In some embodiments, dry powder compositions include a fine powder solid diluent such as sugar and are conveniently provided in unit dose form. Low boiling point propellants generally include liquid propellants whose boiling point is below 65°F at atmospheric pressure. Generally the propellant may constitute 50 to 99.9% (w / w) of the composition and the active ingredient may constitute 0.1 to 20% (w / w) of the composition. The propellant may further comprise other additional ingredients such as an anionic solid or liquid nonionic surfactant or solid diluent (in some embodiments with a particle size of the same order as the particles comprising the active ingredient). Pharmaceutical compositions of the invention formulated for pulmonary delivery may also provide the active ingredient in the form of droplets of a solution or suspension. Such formulations may be prepared, packaged or sold as aqueous or dilute alcoholic solutions or suspensions, optionally sterile, comprising the active ingredient and may conveniently be administered by any misting or atomizing device. Said formulations may further comprise one or more additional ingredients including, but not limited to, a flavoring agent such as sodium saccharin, a volatile oil, a pH regulating agent, a surface active agent, or a preservative such as methylhydroxybenzoate. In some embodiments, the droplets provided by this route of administration may have an average diameter in the range of about 0.1 to about 200 nanometers. The formulations are also useful for intranasal delivery of a pharmaceutical composition of the invention. Another formulation suitable for intranasal administration is a coarse powder consisting of the active ingredient and having an average particle size of about 0.2 to 500 microns. Said formulation is administered in a snuff-like manner, ie, by rapid inhalation through the nostrils from a powder container held close to the nostrils. Formulations suitable for nasal administration may, for example, comprise from as little as 0.1% (w / w) and up to 100% (w / w) active ingredient, and may further comprise one or more additional ingredients. A pharmaceutical composition of the invention can be prepared, packaged or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets or dragees manufactured using conventional methods, and may, for example, 0.1 to 20% (w / w) of the active ingredient, the balance comprising a composition that dissolves or degrades orally and , optionally, one or more of the additional ingredients. Alternatively, formulations suitable for buccal administration may comprise a powder or an aerosolized or sprayable solution or suspension comprising the active ingredient. In some embodiments, such powder or spray aerosol formulations, when dispersed, have an average particle or droplet size in the range of about 0.1 to about 200 nanometers, and may further comprise one or more additional ingredients. As used herein, additional ingredients include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; bonding agents; lubricating agents; sweetening agents; flavoring agents; coloring agents; conservatives; physiologically degradable compositions such as gelatin; aqueous and solvent vehicles; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; pH regulators; you go out; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials. Additional ingredients that may be included in the pharmaceutical compositions of the invention are known in the art and are described, for example, in Remington's Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co., Easton, PA), which is incorporated here for reference. Cells Producing Antibodies and Antigen-Binding Fragments Thereof In some embodiments, the invention is a cell or cell line (such as host cells) that produces at least one of anti-C5 antibodies or antigen-binding fragments, described herein. In one embodiment, the cell or cell line is a genetically modified cell that produces at least one of the anti-C5 antibodies or antigen-binding fragments thereof. In one embodiment, the cell or cell line is a hybridoma that produces at least one of the anti-C5 antibodies or antigen-binding fragments thereof. Hybrid cells (hybridomas) are generally produced from mass fusions between murine splenocytes, which are highly enriched for B lymphocytes, and myeloma fusion partner cells (Alberts et al., Molecular Biology of the Cell (Garland Publishing, Inc. 1994), Harlow et al., Antibodies, A Laboratory Manual (Coid Spring Harbor Laboratory, Cold Spring Harbor, 1988). Groups that test positive can be further subdivided until individual cell clones that produce antibodies of the desired specificity are identified, Antibodies produced by such clones are referred to as monoclonal antibodies. Nucleic acids encoding any of the antibodies, or antibody fragments, described herein, as well as vectors comprising the nucleic acids, are also provided. Thus, the antibodies and fragments of the invention can be generated by expressing the nucleic acid in a cell or cell line, such as cell lines commonly used for expression of recombinant or humanized immunoglobulins. Thus, the antibodies and fragments of the invention can also be generated by cloning the nucleic acids into one or more expression vectors, and transforming the vector into a cell line such as cell lines commonly used for recombinant immunoglobulin expression. or humanized. Genes encoding immunoglobulin heavy and light chains, or fragments thereof, can be designed according to methods, including but not limited to, polymerase chain reaction (PCR) known in the art (see, for example, , Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, N.Y., 1989; Berger & Kimmel, Methods in Enzymology, Vol. 152: Guide to Molecular Cloning Techniques, Academic Press, Inc., San Diego , Calif., 1987; Co et al., 1992, 1 ImmunoL 148:1149). For example, genes encoding heavy and light chains, or fragments thereof, can be cloned from the genomic DNA of an antibody-secreting cell, or the cDNA produced by reverse transcription of the cell's RNA. Cloning is accomplished by conventional techniques including the use of PCR primers that hybridize to the flanking or overlapping sequences of the genes, or gene segments, to be cloned. The nucleic acids encoding the antibody of the invention, or the heavy chain or the light chain or fragments thereof, can be obtained and used according to recombinant nucleic acid techniques for the production of the specific immunoglobulin, immunoglobulin chain , or a fragment or variant thereof, in a host cell variety or in an in vitro translation system. For example, nucleic acids encoding antibodies, or fragments thereof, can be placed into suitable prokaryotic or eukaryotic vectors, eg, expression vectors, and introduced into a suitable host cell by an appropriate method, eg, transformation, transfection. , electroporation, infection, such that the nucleic acid is operably linked to one or more expression control elements, eg, in the vector or integrated into the host cell genome. In some embodiments, the heavy and light chains, or fragments thereof, can be assembled into two different expression vectors that can be used to co-transfect a recipient cell. In some embodiments, each vector may contain two or more selectable genes, one for selection in a bacterial system and one for selection in a eukaryotic system. These vectors allow the production and amplification of the genes in a bacterial system, and subsequent co-transfection of eukaryotic cells and selection of the cotransfected cells. The selection procedure can be used to screen for expression of antibody nucleic acids introduced into two different DNA vectors in a eukaryotic cell. Alternatively, the nucleic acids encoding the heavy and light chains, or fragments thereof, can be expressed from a vector. Although the heavy and light chains are encoded by separate genes, they can be joined using recombinant methods. For example, the two polypeptides can be joined via a synthetic linker that allows them to be made as a single protein chain where the Vl and Vh regions pair up to form monovalent molecules (known as a single chain Fv (scFv); see (eg, Bird et al., 1988, Science 242: 423-426; and Huston et al., 1988, Proc. Nati. Acad. Sci. USA 85:5879-5883). The invention contemplates an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a heavy chain and / or a light chain, as well as fragments thereof. A nucleic acid molecule comprising both light chain and heavy chain encoding sequences, or fragments thereof, can be designed to contain a synthetic signal sequence for antibody secretion, or fragment, when produced in a cell. . In addition, the nucleic acid molecule may contain specific DNA linkers that allow the insertion of other antibody sequences and maintain the translational reading frame so as not to alter amino acids normally found in antibody sequences. In accordance with the present invention, the nucleic acid sequences encoding the antibody can be inserted into an appropriate expression vector. In various embodiments, the expression vector comprises the elements necessary for the transcription and translation of the inserted antibody-encoding nucleic acid to generate the recombinant DNA molecules that direct the expression of the antibody sequences for the formation of an antibody or a fragment of the antibody. same. Nucleic acids encoding antibodies, or fragments thereof, can be subjected to various recombinant nucleic acid techniques known to those skilled in the art, such as site-directed mutagenesis. A variety of methods can be used to express nucleic acids in a cell. Nucleic acids can be cloned into any number of different types of vectors. However, the present invention should not be construed to be limited to any particular vector. Rather, the present invention should be construed to encompass a wide variety of vectors which are readily available and / or known in the art. For example, the nucleic acid of the invention can be cloned into a vector including, but not limited to, a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, vectors that generate probes, and sequencing vectors. In specific embodiments, the expression vector is selected from the group consisting of a viral vector, a bacterial vector, and a mammalian cell vector. Many expression vector systems exist that comprise at least some or all of the compositions discussed above. Prokaryotic and / or eukaryotic based systems may be employed for use with the present invention to produce polynucleotides, or their cognate polypeptides. Many such systems are widely and commercially available. Viral vector technology is well known in the art and is described, for example, in Sambook et al., (2012); and in Ausubel et al., (1999), and in other manuals of virology and molecular biology. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In some embodiments, a murine stem cell virus (MSCV) vector is used to express a desired nucleic acid. MSCV vectors have been shown to efficiently express the desired nucleic acids in cells. However, the invention should not be limited to only using an MSCV vector, rather any method of retroviral expression is included in the invention. Other examples of viral vectors are those based on Moloney murine leukemia virus (MoMuLV) and HIV. In some embodiments, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. (See, for example, WO 01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326,193). Additional regulatory elements, eg enhancers, can be used to modulate the frequency of transcriptional initiation. A promoter can be one naturally associated with a gene or nucleic acid sequence, as can be obtained by isolating 5' non-coding sequences upstream of the coding segment and / or exon. Such a promoter may be referred to as endogenous. Similarly, an enhancer can be naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be had by placing the encoding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer also refers to an enhancer that is not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers from other genes, and promoters and enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers that do not occur naturally, for example, that contain different elements or different regions. regulatory transcription, and / or mutations that alter expression. In addition to producing promoter and enhancer nucleic acid sequences synthetically, the sequences can be produced using recombinant cloning technology and / or nucleic acid amplification, including PCR, in connection with the compositions described herein (U.S. Patent No. 4,683,202, U.S. Patent No. 5,928,906). Additionally, control sequences that direct the transcription and / or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like are contemplated and may also be employed. Of course, it will be important to employ a promoter and / or enhancer that effectively drives expression of the DNA segment in the cell type, organelle, and organism selected for expression. Those skilled in the art of molecular biology generally know how to use promoters, enhancers, and combinations of cell types for protein expression, for example, see Sambrook et al., (2012). The promoters employed may be constitutive, tissue-specific, inducible, and / or useful under the appropriate conditions to drive high-level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and their fragments. . An example of a promoter is the cytomegalovirus (CMV) early promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operably linked to it. However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40 (SV40) early promoter, the mouse mammary tumor virus (MMTV), the long terminal repeat promoter (LTR) from the human immunodeficiency virus (HIV), the Moloney virus promoter, the avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the muscle creatine promoter. Furthermore, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter in the invention provides a molecular switch capable of turning on expression of the polynucleotide sequence to which it is operatively linked when such expression is desired, or turning off expression when expression is not desired. Examples of inducible promoters include, but are not limited to, a metallothionein promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter. Furthermore, the invention includes the use of a tissue-specific promoter or cell type-specific promoter, which is a promoter that is active only in a desired tissue or cell. Tissue-specific promoters are well known in the art and include, but are not limited to, the HER.-2 promoter and PSA-associated promoter sequences. In order to assess the expression of the nucleic acids, the expression vector to be introduced into a cell may also contain either a selectable marker gene or a reporter gene or both to facilitate the identification and selection of expressing cells from the population of cells. cells that are sought are transfected or infected through viral vectors. In other embodiments, the selectable marker can be carried on a separate nucleic acid and used in a co-transfection procedure. Both selectable markers and reporter genes can be flanked with appropriate regulatory sequences to allow expression in host cells. Useful selectable markers are known in the art and include, for example, antidiotic resistance genes, such as neo and the like. Reporter genes are used to identify potentially transfected cells and to assess the functionality of regulatory sequences. Reporter genes encoding readily assayable proteins are known in the art. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that codes for a protein whose expression is manifested by some readily detectable property, eg, enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (see for example, Ui-Tei et al., 2000 FEBS Lett. 479:79-82 ). Suitable expression systems are well known and can be prepared using well known techniques or obtained commercially. In general, the construct with the minimal 5' flanking region showing the highest level of reporter gene expression is identified as the promoter. Such promoter regions can be linked to a reporter gene and can be used to test agents for the ability to modulate promoter-directed transcription. Methods for introducing and expressing nucleic acids in a cell are known in the art. In the context of an expression vector, the vector can be readily introduced into a host cell, eg, a mammalian, bacterial, yeast, or insect cell by any method in the art. For example, the expression vector can be transferred into a host cell by physical, chemical, or biological means. Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, laserporation, and the like. Methods for producing cells comprising vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al., (2012) and Ausubel et al. (1999). Biological methods for introducing a nucleic acid of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method of inserting genes into mammalian, eg, human cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, US Pat. Nos. 5,350,674 and 5,585,362. Chemical means for introducing a nucleic acid into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. A preferred colloidal system for use as an in vitro and in vivo delivery vehicle is a liposome (eg, an artificial membrane vesicle). The preparation and use of such systems is well known in the art. Regardless of the method used to introduce foreign nucleic acids into a host cell or otherwise expose a cell to the nucleic acid of the present invention, in order to confirm the presence of the recombinant DNA sequence in the host cell, a variety of assays can be carried out. Such assays include, for example, molecular biological assays well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR and PCR; biochemical assays, such as detecting the presence or absence of a particular peptide, for example, by immunological means (ELISA and Western blots) or by assays described herein to identify agents that fall within the scope of the invention. Non-human animals expressing human C5 The invention also includes a genetically modified non-human animal that expresses human C5. In some embodiments, the genetically modified non-human animal expressing human C5 also expresses animal non-human C5. In some embodiments, the genetically modified non-human animal expressing human C5 does not express animal non-human C5. In one embodiment, the invention is a genetically modified non-human animal that expresses human C5 from the endogenous regulatory elements of the non-human animal, but does not express non-human C5. In some embodiments, the non-human animal is a mammal. In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a rat or mouse. In some embodiments, the mouse is an immunodeficient mouse. In some embodiments, the mouse is a NOD / SCID mouse. In some embodiments, the mouse is an FcRn / SCID mouse. 100 To create a genetically modified non-human animal, a nucleic acid encoding the human C5 protein can be incorporated into a recombinant expression vector in a form suitable for expression of the human C5 protein in a host cell. The term "in a form suitable for expression of the fusion protein in a host cell" is intended to mean that the recombinant expression vector includes one or more regulatory sequences operably linked to the nucleic acid encoding the human C5 protein in a manner that allows integration into the non-human animal genome to result in stable and permanent transcription of the nucleic acid into mRNA and translation of the mRNA into human C5 protein. The term "regulatory sequence" is art-recognized and is intended to include promoters, enhancers, and other expression control elements (eg, PiggyBac polyadenylation signals and Sleeping Beauty transposon elements). Such regulatory sequences are known to those skilled in the art and are described in 1990, Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif and in Nakanishi H, Higuchi Y, Kawakami S, Yamashita F, Hashida M. MolTher. 2010 Apr;18(4):707-14. doi: 10.1038 / mt.2009.302. Epub 2010 Jan 26.; Hudecek M, Ivics Z. Curr Opin Genet Dev. 2018 Jun 22;52:100-108. doi: 10.1016 / j.gde.2018.06.003. [Epub ahead of print] Review. It should be understood that the design of the expression vector may depend on factors such as the choice of host cell and animals to be transfected and / or the amount of human C5 protein to be expressed. A genetically modified non-human animal can be created, for example, by introducing a nucleic acid encoding the human C5 protein (usually linked to appropriate regulatory elements, such as a tissue-specific or constitutive enhancer) into the oocyte, for example, by microinjection, and allowing the oocyte to develop in a female founder mouse. Such animals can also be generated by introducing a nucleic acid encoding the human C5 protein (usually linked to appropriate regulatory elements, such as a constitutive or tissue-specific enhancer and / or PiggyBac and Sleeping Beauty transposon elements) into the animals by hydrodynamic injection via tail vein as described in Suda T, Liu D. Mol Ther. 2007 Dec;15(12):2063-9. Epub 2007 Oct 2. Review. Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of transgene expression. Methods for generating genetically modified animals, such as mice, have become standard in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009 and 1986, Hogan et al., A Laboratory Manual, Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory. A genetically modified founder animal can be used to breed additional subjects carrying the transgene if the transgene is introduced into oocytes. Genetically modified animals carrying a transgene encoding the C5 protein generated by injection of oocytes of the invention can be further bred to other animals. 101 genetically modified mice carrying other transgenes, or to other knockout animals, for example, a knockout mouse that does not express the murine C5 gene. Genetically engineered animals carrying a transgene encoding the C5 protein generated by hydrodynamic tail vein injection can be readily produced using other genetically engineered or transgenic mice, eg, FcRn / SCID mice for experimental use. It will be understood that in addition to genetically modified animals, the system can be used to generate other subjects that express human C5. In one embodiment, a genetically modified non-human animal that expresses human C5 from the non-human animal's regulatory elements is generated using a system that replaces the non-human animal's C5 exon sequences (or exon and intron sequences). with human C5 exon sequences (or exon and intron sequences), but leaves one, more, or all of the native non-human animal regulatory elements unchanged (eg, promoter, enhancers, flanking regions, introns, etc.). Although any suitable system can be used, an exemplary system capable of producing a genetically modified non-human animal in this way is the CRISPr / Cas9 system. The CRISPR / Cas system refers to a general class of bacterial systems for defense against foreign nucleic acid. CRISPR / Cas systems are found in a wide range of eubacterial and archaeal organisms. CRISPR / Cas systems include subtypes I, II, and III. Wild-type CRISPR / Cas type II systems use the RNA-mediated nuclease, Cas9 in complex with guiding and activating RNA to recognize and cleave foreign nucleic acid. Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to, bacteria from the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae . An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologues are described in, for example, Chylinksi, et al., RNA Biol. 2013 May 1; 10(5): 726-737; Nat. Rev. Microbiol. 2011 June; 9(6): 467477; Hou, et al., Proc Nati Acad Sci USA. 2013 Sep 24;110(39):15644-9; Sampson et al., Nature. 2013 May 9;497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21 In one embodiment, the genetically modified non-human animal of the invention expresses human C5 from the endogenous promoter. Examples of promoters useful in the invention include, but are not limited to, the native mouse promoter, DNA pol II promoter, PGK promoter, ubiquitin promoter, albumin promoter, globin promoter, ovalbumin promoter, SV40 early promoter, Rous sarcoma virus (RSV) promoter, β-actin promoter, retroviral LTR and lentiviral LTR. Promoter and enhancer expression systems useful in the invention also include inducible and / or tissue-specific expression systems. In some embodiments, the genetically modified non-human animal of the 102 invention expressing human C5 is used to screen, assay, evaluate, or evaluate anti-C5 antibodies. In some embodiments, the genetically modified non-human animal of the invention expressing human C5 is used to screen, assay, evaluate, or evaluate anti-C5 antibody characteristics, properties, or activities. kits The invention also includes a kit comprising an anti-C5 antibody or combinations thereof of the invention and instructional material describing, for example, administering the anti-C5 antibody or combinations thereof, to an individual as a therapeutic treatment or use without treatment as described elsewhere herein. In one embodiment, this kit further comprises a pharmaceutically acceptable carrier (optionally sterile) suitable for dissolving or suspending the therapeutic composition, comprising an anti-C5 antibody or combinations thereof, of the invention, for example, prior to administering the antibody. to an individual. Optionally, the kit comprises an applicator for administering the antibody. sequences: 2G1 VH-11801 Humanized cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaa gcctggggcctcagtgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactacaatttggactgggtgcgacaggcccctggacaagggctt Í||l||® WVRQAPGQGL g|gg(SEQ ID NO: 3 ) gagtggatgggagatattagtcctaactatggttatactatctacaaccagaaattcaag EWMGDISPNYGYTIYNQKFK CDR2(SEQ ID NO : 4 ) gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc g RVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRSDDTAVYYCAR gggg(SEQ ID NO: 5) Aattcctacaaatggtacttcgatgtctggggccaagggacaatggtcaccgtctcttca (SEQ ID NO:1) NSXKWYFDVWGQGTMVTVS S (SEQ ID NO : 2 ) 103 2G1 VL-1901 humanized gtcagagccctggggaggaactgctcagttaggacccagagggaaccatggaagccccagct Μ E A P A cagcttctcttcctcctgctactctggctcccagataccaccggagacatccagttgacc QLLFLLLLWLPDTG D I Q L T cagtctccatccttcctgtctgcatctgtaggaga cagagtcaecateacttgcaggaca OSPSFLSASVGDRVTITC R T ORI (SEO ID NO: 8) agtaagagcataagcaaatatttagcctggtatcagcaaaaaccagggaaagcccctaag SKSISKYLAWYQQKPGKAPK ctcctgatctattctggatccacccttgcaatctggggtcccatcaaggttcagcggcagt LLIYSGSTLQSGVPSRFSGS β®ΞΕ0 ID NO: 9) ggatctgggacagaattcactctcacaatcagcagcctgcagcctgaagattttgcaact GSGTEFTLTISSLQPEDFAT tattactgtcaacaacataatgaatacccgtacacgtttggccagggagcaagctggag Y Y C FGQGTKLE Ígg3(SEQ ID NO: 10) Atcaaa (SEQ ID NO:6) IK (SEQ ID NO:7) Humanized variant of 2G1 VL-1901 (Q->H mutation in CDR3) gtcagagccctggggaggaactgctcagttaggacccagagggaaccatggaagccccagct Μ E A P A cagcttctcttcctcctgctactctggctcccagataccaccggagacatccagttgacc QLLFLLLLWLPDTTG D I Q L T cagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgcaggaca OSPSFLSASVGDRVTITC R T Oí® SEO ID NO: 8) agtaagagcataagcaaatatttagcctggtatcagcaaaaaccagggaaagcccctaag WYQQKPGKAPK ctcctgatctattctggatccacccttgcaatctggggtcccatcaaggttcagcggcagt L L I Y OlOlOliiO GVPSRFSGS β® (SEQ ID NO: 9) ggatctgggacagaattcactctcacaatcagcagcctgcagcctgaagattttgcaact GSGTEFTLTISSLQPEDFAT tattactgtcaccaacataatgaatacccgtacacgtttggccaggggaccaagctggag Y Y C FGOGTKLE ÚSR3(SEO ID NO: 11) Atcaaa (SEQ ID NO:12) IK (SEQ ID NO:13) Humanized variant of 2G1 VL-1901 (T->H mutation in CDR1) gtcagagccctggggaggaactgctcagttaggacccagagggaaccatggaagccccagct Μ E A P A cagcttctcttcctcctgctactctggctcccagataccaccggagacatccagttgacc QLLFLLLLWLPDTTG D I Q L T cagtctccatccttcctgtctgcatctgtaggagacagagtcaceatcacttgcaggcat OSPSFLSASVGDRVTITC 11® ®®SEQ ID NO: 14) agtaagagcataagcaaatatttagcctggtatcagcaaaaaccagggaaagcccctaag SKSISKTLA WYQQKPGKAPK ctcctgatctattctggatccacccttgcaatctggggtcccatcaaggttcagcggcagt L L I Y GVPSRFSGS ORI (SEO ID NO: 9) ggatctgggacagaattcactctcacaatcagcagcctgcagcctgaagattttgcaact GSGTEFTLTISSLQPEDFAT tattactgtcaacaacataatgaatacccgtacacgtttggccagggagcaagctggag Y Y C QQHNEyPYT FGQGTKLE Í®g(SEQ ID NO: 10) Atcaaa (SEQ ID NO:15) IK (SEQ ID NO:16) 104 humanized variant of 2G1 VH-11801 (I->H mutation in CDR1) cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacaca-:Aacagacta caatttggactgggtgcgacaggcccctggacaagggctt WVRQAPGQGL glO(SEQ ID NO: 17) gagtggatgggagatattagtcctaactatggttatactatctacaaccagaaattcaag E W M G ggO(SEQ ID NO: 4) gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc gíRVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRSDDTAVYYCAR ggSg(SEQ ID NO: 5) Aattcctacaaatggtacttcgatgtctggggccaagggacaatggtcaccgtctcttca (SEQ ID NO:18) NSYKWYFDVWGQGTMVTVS S (SEQ ID NO:19) 77RQQn / L7n7 / q / YIAI humanized variant of 2G1 VH-11801 (N->H mutation in CDR1) cagcatatgatcagtgtcctctccaaagtcccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactacc. í;t. ttggactgggtgcgacaggcccctggacaagggctt WVRQAPGQGL OSI(SEQ ID NO: 2 0) gagtggatgggagatattagtcctaactatggttatactatctacaaccagaaattcaag E W M G 1|Í||||Í||Í|||Í Í® (SEQ ID NO: 4) gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc ÍRVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRSDDTAVYYCAR Íggg(SEQ ID NO: 5) Aattcctacaaatggtacttcgatgtctggggccaagggacaatggtcaccgtctcttca (SEQ ID NO:21) NSYKWYFDVWGQGTMVTVS S (SEQ ID NO:22) Humanized variant of 2G1VL-1901 (Y->H mutation in CDR1) gtcagagccctggggaggaactgctcagttaggacccagagggaaccatggaagccccagct Μ E A P A cagcttctcttcctcctgctactctggctcccagataccaccggagacatccagttgacc QLLFLLLLWLPDTTG D I Q L T cagtctcca tccttcctgtctgcatctgtaggagacagagtcaceateacttgcaggaca QSPSFLSASVGDRVTITC R T ggÍf(SEQ ID NO:23) agtaagagcataagcaaac¿:tttagcctggtatcagcaaaaaccagggaaagcccctaag S K S I S K £ L A W Y Q Q K P G K A P K ctcctgatctattctggatccacccttgcaatctggggtcccatcaaggttcagcggcagt L L I Y GVPSRFSGS ggigg(SEQ ID NO: 9) ggatctgggacagaattcactctcacaatcagcagcctgcagcctgaagattttgcaact GSGTEFTLTISSLQPEDFAT tattactgtcaacaacataatgaatacccgtacacgtttggccagggagcaagctggag Y Y C FGQGTKLE gÍgg(SEQ ID NO: 10) Atcaaa (SEQ'TdI^............................... IK (SEQ ID NO:25) 105 Humanized variant of 2G1 VH-11801 (Y->H mutation in CDR2) cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactacaat ttggactgggtgcgacaggcccctggacaagggctt WVRQAPGQGL gO|(SEQ ID NO: 3) gagtggatgggagatattagtcctaaco¿Aggttatactatctacaaccagaaattcaag EWMGDISPN.^GYTIYN^KFK CDR2(SEQ ID NO: 26) gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc ÍRVTMTTDTSTSTAYMELRS cLgagaLcLgacgacacggccgLgLaLLacLgLgcgag aagggaca LLcgLLacLccggL LRSDDTAVYYCAR R D I R Y S G OR3(SEQ ID NO: 5) Aattcctacaaatggtacttcgatgtctggggccaagggacaatggtcaccgtctcttca (SEQ ID NO:27) NSYKWYFDVWGQGTMVTVS S (SEQ ID NO:28) Humanized variant of 2G1VL-1901 (E->H mutation in CDR3) gtcagagccctggggaggaactgctcagttaggacccagagggaaccatggaagccccagct Μ E A P A cagcttctcttcctcctgctactctggctcccagataccaccggagacatccagttgacc QLLFLLLLWLPDTTG D I Q L T cagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgcaggaca QSPSFLSASVGDRVTITC R T CDR1(SEQ agtaagagcataagcaaatatttagcctqgtatcagcaaaaaccagggaaagcccctaag SKSISKYLAWYQQKPGKAPK ctcctgatctattctggatccacccttgcaatctggggtcccatcaaggttcagcggcagt L L I Y GVPSRFSGS ®B2(SE0 ggatctgggacagaattcactctcacaatcagcagcctgcagcctgaagattttgcaact GSGTEFTLTISSLQPEDFAT tattactgtcaacaacataatca::tacccgtacacgtttggccaggggaccaagctggag YYCQQHNSYPYTFGQGTKLE ®B3(SEQ Atcaaa (SEQ ID NO:30) IK (SEQ ID NO:31) ID NO:8) ID NO:9) ID NO:29) humanized variant of 2G1 VH-11801 (T->H mutation in CDR2) cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactacaat ttggactgggtgcgacaggcccctggacaagggctt GYTITDYNLD WVRQAPGQGL Í|>ÍT(SEQ ID NO: 3) gagtggatgggagatattagtcctaactatggttat ca'c.atctacaaccagaaattcaag E W M G illlíSEQ ID NO: 34) gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc Srvtmttdtststaymelrs ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRSDDTAVYYCAR Íggg(SEQ ID NO: 5) Aattcctacaaatggtacttcgatgtctggggccaagggacaatggtcaccgtctcttca (SEQ ID NO:35) NSYKWYFDVWGQGTMVTVS 3 (SEQ ID NO:36) 106 Heavy chain sequence of mAb H1-8 / L1-9 variant IWW (L->I mutation in CDR1, P->W mutation in CDR2, V->W mutation in CDR3) zzRQon / Lznz / q / Yi IWW-VH cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg ΝΥΓίΓίΕΒνΤΑενΗΞ Q V Q L V cagt ctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactaccacatcgactgggtgcgacaggcccctggacaagggctt ¡illlilli / / WVRQAPGQGL Í|Ü(SEQ ID NO: 37) gagtggatgggagatattag ttggaactatggttatactatctacaaccagaaattcaag E W M G D I SWNYGYTIYNQKFK CDH.¿(SEQ ID NO: 3 8) gacagagtcaceatgaceacagacacatceacgagcacagcctacatggagctgaggagc gRVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaaggggacattcgttactccggt LRSDDTAVYYCARRDIRYSG CDR3JSEQ ID NO: 39) aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:4 0) NSYKWYFDWWGQGTMVTVS S (SEQ ID NO:41) Heavy chain sequence of the IFW variant of mAb H1-8 / L1-9 (L->I mutation in CDR1, P->F mutation in CDR2, V->W mutation in CDR3) IFW-VH cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg w y F i^F i^L s y T^A G y H!5 q v q l v cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS g gatacacaatcacagactaccatatcgactgggtgcgacaggcccctggacaagggctt OllilBI WVRQAPGQGL ||Í|(SEQ ID NO: 42) gagtggatgggagatattagt ttc aactatggttatactatctacaaccagaaattcaag E W M G ||||(SEQ ID NO: 4 3) gacagagtcaceatgaceacagacacatecacgagcacagcctacatggagctgaggagc 1RVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRSDDTAVYYCAR gg||(SEQ ID NO: 44) aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:45) NSYKWYFDWWGQGTMVTVS S (SEQ ID NO:46) Heavy chain sequence of the FME variant of mAb H1-8 / L1-9 (L->F mutation in CDR1, P->M mutation in CDR2, V->E mutation in CDR3) FME-VH 107 cagcatatgatcagtgtcctctccaaagtcccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaagcctggggcctcagtga aggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactaci’ótttcgactgggtgcgacaggcccctggacaagggctt WVRQAPGQGL O|(|(SEQ ID NO: 47) gagtggatgggagatattagtatgaaetatggttatactatctacaaccagaaattcaag E W M G ge (SEQ ID NO: 48) gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc JSRVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRSDDTAVYYCAR ΟΒβίίϊίίίίίβΙβ ®O(SEQ ID NO: 49) aattcctacaaatggtacttcgatgagtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:50) NSYKWYFDEWGQGTMVTVS S (SEQ ID N0:51) Heavy chain sequence of mAb H1-8 / L1-9 FMW variant (L->F mutation in CDR1, P->M mutation in CDR2, V->W mutation in CDR3) FMW-VH cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactace. a tttcgactgggtgcgacaggcccctggacaagggctt S|Og|YESIgÍ|e WVRQAPGQGL Og|(SEQ ID NO: 52) gagtggatgggagatattagtatgaactatggttatactatctacaaccagaaattcaag E W M G ®§Í(SEQ ID NO:53) gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc ÉÍRVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRSDDTAVYYCAR R D I R X S G ÍÍ®(SEQ ID NO: 54) aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:55) N S Y K W Y F DWWGQGTMVTVS S (SEQ ID NO: 56) Heavy chain sequence of the FMEH variant of mAb H1-8 / L1-9 (L->F mutation in CDR1, P->M and T->H mutations in CDR2, V->E mutation in CDR3) FMEH-VH cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaagcctggggcctcag tgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactacei;tttcgactgggtgcgacaggcccctggacaagggctt iiijglO WVRQAPGQGL gggg(SEQ ID NO: 47) gagtggatgggagatattagtatgaactatggttatcatatetacaaccagaaattcaag E W M G g||jÍ|||Í||M|®^^^^ gg|Í (SEQ ID NO: 57) 108 gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc gRVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRSDDTAVYYCAR ββΙϊϊξΟβ OOíSEQ ID NO: 49) aattcctacaaatggtacttcgatgagtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:58) NSYKWYFDEWGQGTMVTVS S (SEQ ID NO:59) 77RQQn / L7n7 / q / YIAI Heavy chain sequence of mAb H1-8 / L1-9 IWWH variant (L->I mutation in CDR1, P->W and T->H mutations in CDR2, V->W mutation in CDR3) IWWH-VH cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaagcctggggcctca gtgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactaccacatcgactgggtgcgacaggcccctggacaagggctt WVRQAPGQGL Mi|(SEQ ID NO: 37) gagtggatgggagatattagttggaactatggttatcatatetacaaccagaaattcaag EWMGDISWNYGYHIYNQKFK CPK2(SEQ ID NO: 62) gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc ÍRVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRSDDTAVYYCARRDIRYSG CDR3(SEQ ID NO: 39) aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:63) NSYKWYFDWWGQGTMVTVS S (SEQ ID NO:64) Heavy chain sequence of mAb H1-8 / L1-9 IFWH variant (L->I mutation in CDR1, P->F and T->H mutations in CDR2, V->W mutation in CDR3) IFWH-VH cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaagcctggggcctca gtgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactaceatatcgactgggtgcgacaggcccctggacaagggctt GYTITDYSID WVRQAPGQGL ÍgÍ|(SEQ ID NO: 42) gagtggatgggagatatttagtttcaactatggttatcatatctacaaccagaaattcaag E W T4 G D I S F N Y G Y Η I Y N Q K F K CDR2ÍSEQ ID NO: 65) gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc ÍRVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRSDDTAVYYCAR ÍgÍ|(SEQ ID NO: 4 4) aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:66) NSYKWYFDWWGQGTMVTVS 3 (SEQ ID NO:67) 109 Heavy chain sequence of mAb H1-8 / L1-9 FMWH variant (L->F mutation in CDR1, P->M and T->H mutations in CDR2, V->W mutation in CDR3) FMWH-VH cagcatatgatcagtgtcctctccaaagtccttgaacatagactctaaccatggactggacc M D W T tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg WVFLFLLSVTAGVHS Q V Q L V cagtctggagctgaggtgaagaagcctggggcctcag tgaaggtctcctgcaaggcttct QSGAEVKKPGASVKVSCKAS ggatacacaatcacagactaccatttcgactgggtgcgacaggcccctggacaagggctt WVRQAPGQGL OO(SEQ ID NO: 52) gagtggatgggagatattagtatgaactatggttatcatatctacaaccagaaattcaag EWMGDISMNYG YHIYNQKFK CDRC (SEQ ID NO: 68) gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc pRVTMTTDTSTSTAYMELRS ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt LRS DDTAVYYCARRDIRYSG CDR3(SEQ ID NO: 54) aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:69) NSYKWYFDWWGQGTMVTVS S (SEQ ID NO:70) Amino acid sequence of the constant heavy chain region of human IgG4 Wing Ser Thr Lys Gly Pro Ser Val 5 Phe Pro Leu Ala Pro Cys Ser Arg fifteen Ser Thr Ser Glu Ser Thr Wing Wing Leu Gly Cys Leu Val Lys Asp Tyr 25 30 Phe Pro Glu Pro Val Thr Val Ser 40 Trp Asn Ser Gly Ala Leu Thr Ser 45 Gly Val His Thr Phe Pro Ala Val 55 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 70 Ser Ser Ser Leu Gly Thr Lys Thr 80 Tyr Thr Cys Asn Val Asp His Lys 85 Pro Ser Asn Thr Lys Val Asp Lys 90 95 Arg Val Glu Ser Lys Tyr Gly Pro 100 Pro Cys Pro Ser Cys Pro Wing Pro 105 110 Glu Phe Leu Gly Gly Pro Ser Val 115 120 Phe Leu Phe Pro Pro Lys Pro Lys 125 110 77RQQn / L7n7 / q / YIA Asp Thr 130 Leu Met lie Ser Arg 135 Thr Pro Glu Val Thr 140 Cys Val Val Val 5 Asp 145 Val Ser Gln Glu Asp 150 Pro Glu Val Gln Phe 155 Asn Trp Tyr Val Asp 160 Gly Val Glu Val His 165 Asn Ala Lys Thr Lys 170 Pro Arg Glu Glu Gln 175 Phe 10 Asn Ser Thr Tyr 180 Arg Val Val Ser Val 185 Leu Thr Val Leu His 190 Gln Asp Trp Leu Asn 195 Gly Lys Glu Tyr Lys 200 Cys Lys Val Ser Asn 205 Lys Gly Leu 15 Pro Ser 210 Ser lie Glu Lys Thr 215 lie Ser Lys Ala Lys 220 Gly Gln Pro Arg Glu 225 Pro Gln Val Tyr Thr 230 Leu Pro Pro Ser Gln 235 Glu Glu Met Thr Lys 240 20 Asn Gln Val Ser Leu 245 Thr Cys Leu Val Lys 250 Gly Phe Tyr Pro Ser 255 Asp lie Ala Val Glu 260 Trp Glu Ser Asn Gly 265 Gln Pro Glu Asn Asn 270 Tyr Lys 25 Thr Thr Pro 275 Pro Val Leu Asp Ser 280 Asp Gly Ser Phe Phe 285 Leu Tyr Ser Arg Leu 290 Thr Val Asp Lys Ser 295 Arg Trp Gln Glu Gly 300 Asn Val Phe Ser 30 Cys 305 Ser Val Met His Glu 310 Ala Leu His Asn His 315 Tyr Thr Gln Lys Ser 320 Leu Ser Leu Ser Pro Gly Lys (SEQ ID NO:: 32) 325 111 Amino acid sequence of the constant heavy chain region of human IgG4 with S108P mutation (relative to SEQ ID NO: 32) Ala 1 Ser Thr Lys Gly 5 Pro Ser Val Phe Pro 10 Leu Ala Pro Cys Ser 15 Arg Ser Thr Ser Glu 20 Ser Thr Ala Ala Leu 25 Gly Cys Leu Val Lys 30 Asp Tyr Phe Pro Glu 35 Pro Val Thr Val Ser 40 Trp Asn Ser Gly Ala 45 Leu Thr Ser Gly Val 50 His Thr Phe Pro Ala 55 Val Leu Gln Ser Ser 60 Gly Leu Tyr Ser Leu 65 Ser Ser Val Val Thr 70 Val Pro Ser Ser Ser 75 Leu Gly Thr Lys Thr 80 Tyr Thr Cys Asn Val 85 Asp His Lys Pro Ser 90 Asn Thr Lys Val Asp 95 Lys Arg Val Glu Ser 100 Lys Tyr Gly Pro Pro 105 Cys Pro Pro Cys Pro 110 Ala Pro Glu Phe Leu 115 Gly Gly Pro Ser Val 120 Phe Leu Phe Pro Pro 125 Lys Pro Lys Asp Thr 130 Leu Met lie Ser Arg 135 Thr Pro Glu Val Thr 140 Cys Val Val Val Asp 145 Val Ser Gln Glu Asp 150 Pro Glu Val Gln Phe 155 Asn Trp Tyr Val Asp 160 Gly Val Glu Val His 165 Asn Ala Lys Thr Lys 170 Pro Arg Glu Glu Gln 175 Phe Asn Ser Thr Tyr 180 Arg Val Val Ser Val 185 Leu Thr Val Leu His 190 Gln Asp Trp Leu Asn 195 Gly Lys Glu Tyr Lys 200 Cys Lys Val Ser Asn 205 Lys Gly Leu 112 Pro Be 210 lie glu Lys Thr 215 lies Be Lys To the Lys 220 gly gln Pro arg glu 225 Pro gln Val tyr Thr 230 read Pro Pro Be gln 235 glu glu met Thr Lys 240 asn gln Val Be read 245 Thr Cys read Val Lys 250 gly Phe tyr Pro Be 255 Asp To the Val glu 260 trp glu Be asn gly 265 gln Pro glu asn asn 270 tyr Lys Thr Thr Pro 275 Pro Val read Asp Be 280 Asp gly Be Phe Phe 285 read tyr Be arg read 290 Thr Val Asp Lys Be 295 arg trp gln glu gly 300 asn Val Phe Be Cys 305 Be Val met his glu 310 To the read his asn his 315 tyr Thr gln Lys Be 320 read Be read Be Pro 325 gly Lys (SEQ ID NO:33) Human IgG4 Fe PLA domain mutation sequences 113 EXPERIMENTAL EXAMPLES The invention is now described with reference to the following examples. These examples are provided for purposes of illustration only and the invention is not to be construed in any way as limited to these examples, but rather is to be construed as encompassing any and all variations that become apparent as a result of the teachings provided herein. Without further description, it is believed that one skilled in the art can, using the above description and the following illustrative examples, prepare and use the compounds of the present invention and practice the claimed methods. Therefore, the following working examples should not be construed as limiting in any way the remainder of the description. EXAMPLE 1 Variants of humanized 2G1 (VH-11801 (SEQ ID NO: 2) and VL-1901 (SEQ ID NO: 7)) were generated (see Figure 1), with the aim of developing variants with enhanced binding to C5 at pH 7.4 and reduced binding to C5 at pH 5.8. The approach described herein is based on the understanding that a mAb's affinity and blocking efficacy measured in vitro do not necessarily correlate with its in vivo half-life, PK, or PD. This is, at least in part, because a soluble antigen that is present in high concentration in the blood, such as C5, forms an immune complex (ie, antigen-bound mAb) that is targeted for elimination from the body. Therefore, generally, high concentrations of antibodies in the blood are required to block the activity of such soluble antigens in 114 alive. The approach described herein is based on the understanding that the in vivo efficacy of a therapeutic antibody can be enhanced by increasing the recycling or half-life of the antibody (and thus the PK) and by accelerated intracellular degradation of antigen by the generation of mAbs possessing pH-dependent binding. properties. The desirable property in this regard is that the therapeutic mAb would bind antigen (eg C5) well at near neutral pH (~pH 7.4) which is the pH of blood. In this way, it effectively blocks the activity of the antigen (eg, C5). The immune complex is then taken up by cells where it is moved to the endosome for proteolytic degradation. The pH of the early endosome is acidic (~pH 6.0). Therefore, when a therapeutic mAb is poorly bound to its antigen at acidic pH, the mAb will dissociate from the immune complex and can then be taken up by the neonatal Fe receptor (FcRn) and returned to the plasma. In this way, only the antigen (eg, C5) is degraded via the endosome proteolytic pathway, whereas recycling of the mAb via FcRn contributes to its prolonged persistence in plasma. Due to their propensity for protonation at acidic pH (H+), mAbs containing hisitdine residues in their CDRs may have weakened binding affinity upon protonation at acidic pH. The approach described herein made use of histidine scanning of all CDR residues (ie, replacement of each CDR residue with histidine). The Octet instrument (Pall ForteBio) was then used to measure mAb and C5 dissociation at pH 7.4 and pH 5.8 to identify histidine substitution variants that had relatively faster dissociation at pH 5.8 and relatively slower dissociation at pH 7.4. The parental humanized mAb 2G1 (VH-11801 (SEQ ID NO:2) and VL-1901 (SEQ ID NO:7)), appeared to have better affinity for C5 at pH 5.8 (see Figure 7). Single substitution variants having one histidine substitution at each residue in each of the six mAb CDRs (VH-11801 (SEQ ID NO:2) and VL-1609 (SEQ ID NO:7)) were generated and evaluated. to determine its pH. bound binding property. For each variant, a VH and VL plasmid was constructed and then transiently transfected into HEK cells. Cell culture supernatant was assayed for mAb binding at pH 5.8 and pH 7.4. Of these single substitution variants, three (mAb L3-1, Ll-2 and Hl-4) showed some enhancement in pH-dependent binding. The sequences of L3-1 are shown in Figure 2 (SEQ ID NO: 1-5, 8.9, and 11-13). The sequences of L1-2 are shown in Figure 3 (SEQ ID NO: 1-5, 9, 10, and 14-16). The Hl-4 sequences are shown in Figure 4 (SEQ ID NO: 4, 5, 6-10, and 17-19). In addition to generating single substitution variants, single substitution heavy and light chains were combined to generate double substitution variants. Of these double substitution variants, two (mAb H1-8 / L1-9 and H2-6 / L3-5) showed some improvement in dependent binding. pH 115. The H1-8 / L1-9 sequences are shown in Figure 5 (SEQ ID NO: 4, 5, 9, 10, and 20-25). The H2-6 / L3-5 sequences are shown in Figure 6 (SEQ ID NO: 3, 5, 8, 9, and 26-31). The C5 binding and dissociation octet traces of the parental humanized 2G1 mAb with VH-11801 SEQ ID NO:2 and VL-1901 SEQ ID NO:7, and the various single and double histidine mutants are shown in Figure 7a. Figure 12. Their relative activities in blocking C5 function are compared to the original humanized 2G1 mAb (VH-11801 / VL-1901) and are shown in Figure 13 and Figure 14, using a lysis assay. sheep red blood cells. Except for mAb L3-1 which showed equal or improved activity over the parental humanized mAb 2G1, all other mutants showed reduced activity. In the case of the two double substitution variants, their activity is greatly reduced with H1-8 / L1-9 essentially losing all C5 blocking activity. This is not surprising because, although we observed faster desirable dissociation at pH 5.8 for mAb H1-8 / L1-9 and H2-6 / L3-5, their dissociation at pH 7.4 is also dramatically accelerated (accounting for the loss of activity). . Although the above histidine-substituted variants become less active in vitro, their half-life in vivo could be improved and thus their PK / PD properties could be improved over the origin...

Claims

1. A pH-dependent antibody that specifically binds to human C5, wherein the pH-dependent antibody comprises at least one CDR selected from the group consisting of: a VH-CDR1 comprising a variant of SEQ ID NO: 3, having at least one substitution related to SEQ ID NO: 3; a VH-CDR2 comprising a variant of SEQ ID NO: 4, having at least one substitution related to SEQ ID NO: 4; a VH-CDR3 comprising a sequence of SEQ ID NO: 5, having at least one substitution related to SEQ ID NO: 5; a VL-CDR1 comprising a variant of SEQ ID NO: 8, having at least one substitution related to SEQ ID NO: 8; a VL-CDR2 comprising a variant of SEQ ID NO: 9, having at least one substitution related to SEQ ID NO: 9; and a VL-CDR3 comprising a variant of SEQ ID NO: 10, having at least one substitution related to SEQ ID NO:

10.

2. The antibody according to claim 1, further characterized in that the binding of the antibody is pH dependent, wherein the antibody binds more strongly to C5 at a neutral pH than at an acidic pH.

3. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDR: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO:57; VH-CDR3: SEQ ID NO:49; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof.

4. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:59 or a variant thereof.

5. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:59 and a light chain comprising the amino acid sequence of SEQ ID NO: 25; or a variant or variants thereof.

6. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDR: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:11, or a variant or variants thereof.

7. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the 124 amino acid sequence of SEQ ID NO:2 or a variant thereof.

8. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 13 or a variant thereof.

9. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2 and a light chain comprising the amino acid sequence of SEQ ID NO: 13; or a variant or variants thereof.

10. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:14; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof.

11. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2 or a variant thereof.

12. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 16 or a variant thereof.

13. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2 and a light chain comprising the amino acid sequence of SEQ ID NO: 16; or a variant or variants thereof.

14. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDR: VH-CDR1: SEQ ID NO: 17; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof.

15. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 or a variant thereof.

16. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:7 or a variant thereof.

17. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 7; or a variant or variants thereof.

18. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:20; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof.

19. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:22 or a variant thereof.

20. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof.

21. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:22 and a light chain comprising the amino acid sequence of SEQ ID NO: 25; or a variant or variants thereof.

22. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:26; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:29, or a variant or variants thereof.

23. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:28 or a variant thereof.

24. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:31 or a variant thereof.

25. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:28 and a light chain comprising the amino acid sequence of SEQ ID NO: 31; or a variant or variants thereof.

26. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDR: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:34; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof.

27. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the 126 amino acid sequence of SEQ ID NO:36 or a variant thereof.

28. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:36 and a light chain comprising the amino acid sequence of SEQ ID NO: 7; or a variant or variants thereof.

29. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDR: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO:38; VH-CDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof.

30. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41 or a variant thereof.

31. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41 and a light chain comprising the amino acid sequence of SEQ ID NO: 25; or a variant or variants thereof.

32. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDR: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO:43; VH-CDR3: SEQ ID NO:44; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof.

33. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:46 or a variant thereof.

34. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:46 and a light chain comprising the amino acid sequence of SEQ ID NO: 25; or a variant or variants thereof.

35. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDR: VH-CDR1: SEQ ID NO:47; VH-CDR2: SEQ ID NO:48; VH-CDR3: SEQ ID NO:49; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof.

36. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:51 or a variant thereof.

37. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:51 and a light chain comprising the amino acid sequence of SEQ ID NO: 25; or a variant or variants thereof.

38. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO:53; VH-CDR3: SEQ ID NO:54; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof.

39. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:56 or a variant thereof.

40. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:56 and a light chain comprising the amino acid sequence of SEQ ID NO: 25; or a variant or variants thereof.

41. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDR: VH-CDR1: SEQ ID NO:37; VH-CDR2: SEQ ID NO:62; VH-CDR3: SEQ ID NO:39; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof.

42. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:64 or a variant thereof.

43. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:64 and a light chain comprising the amino acid sequence of SEQ ID NO: 25; or a variant or variants thereof.

44. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDR: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO:65; VH-CDR3: SEQ ID NO:44; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof.

45. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:67 or a variant thereof.

46. ​​The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:67 and a light chain comprising the amino acid sequence of SEQ ID NO: 25; or a variant or variants thereof.

47. The antibody according to claim 1 or 2, further characterized in that the antibody comprises the CDRs: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO:68; VH-CDR3: SEQ ID NO:54; VL-CDR1: SEQ ID NO:23; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof.

48. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:70 or a variant thereof.

49. The antibody according to claim 1 or 2, further characterized in that the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:70 and a light chain comprising the amino acid sequence of SEQ ID NO: 25; or a variant or variants thereof.

50. The antibody according to claims 3, 7, 11, 15, 19, 23, 26, 29, 32, 35, 38, 41, 44 or 47, further characterized in that the antibody comprises a substitution in proline 4 (P4) in VH CDR2, with respect to SEQ ID NO:

4.

51. The antibody according to claim 50, further characterized in that the substitution at proline 4 (P4) is a substitution selected from the group consisting of P4^F4 (P4F), P4->L4 (P4L), P4->M4 (P4M), P4^W4 (P4W), and P4->I4 (P4I).

52. The antibody according to claim 51, further characterized in that the antibody comprises a proline 4 (P4) substitution in VH CDR2, with respect to SEQ ID NO:4, and a threonine 9 substitution in VH CDR2, with respect to SEQ ID NO:

4.

53. The antibody according to claim 52, further characterized in that the substitution at proline 4 (P4) is a substitution selected from the group consisting of P4^F4 (P4F), P4—>L4 (P4L), P4->M4 (P4M), P4^W4 (P4W), and P4^I4 (P4I); and the substitution at threonine 9 (T9) is a substitution selected from the group consisting of T9 -> H9 (T9H), T9 -> F9 (T9F), T9 L9 (T9L), T9 M9 (T9M), T9 W9 (T9W), and T9 19 (T9I).

54. The antibody according to claims 3, 7, 11, 15, 19, 23, 26, 29, 32, 35, 38, 41, 44, or 47, further characterized in that the antibody comprises a substitution at valine 16 (V16) in VH CDR3, with respect to SEQ ID NO:

5.

55. The antibody according to claim 54, further characterized in that the substitution at valine 16 (V16) is a substitution selected from the group consisting of V16^F16 (V16F), V16^E16 (V16E) and V16^W16 (V16W).

56. The antibody according to claims 15, 19, 23, 26, 29, 32, 35, 38, 41, 44, or 47, further characterized in that the antibody comprises a substitution at leucine 9 (L9) in VH CDR1, with respect to SEQ ID NQ:

20. 129 57. The antibody according to claim 56, further characterized in that the substitution at leucine 9 (L9) is a substitution selected from the group consisting of L9^W9 (L9W), L9^I9 (L9I), L9^V9 (L9V), L9^Y9 (L9Y), and L9^F9 (L9F).

58. The antibody according to claims 3, 7, 11, 15, 19, 23, 26, 29, 32, 35, 38, 41, 44 or 47, further characterized in that the antibody comprises a substitution of two or more substitutions selected from the group consisting of proline 4 (P4) in VH CDR2, with respect to SEQ ID NO:4, threonine 9 (T9) in VH CDR2, with respect to SEQ ID NO:4, valine 16 (V16) in VH CDR3, with respect to SEQ ID NO:5 and leucine 9 (L9) in VH CDR1, with respect to SEQ ID NO:

20.

59. The antibody according to claim 58, further characterized in that the antibody comprises two or more substitutions selected from the group consisting of L9I / P4M, L9I / P4W, L9I / P4F, L9F / P4M, L9F / P4W, L9F / P4F, L9I / P4M / V16W, L9I / P4W / V16W, L9I / P4F / V16W, L9F / P4M / V16W, L9F / P4W / V16W, L9F / P4F / V16W, L9I / P4M / V16E, L9I / P4W / V16E, L9I / P4F / V16E, L9F / P4M / V16E, L9F / P4W / V16E, L9F / P4F / V16E, , L9I / P4M / T9H / V16W, L9I / P4W / T9H / V16W, L9I / P4F / T9H / V16W, L9F / P4M / T9H / V16W, L9F / P4W / T9H / V16W, L9F / P4F / T9H / V16W, L9I / P4M / T9H / V16E, L9I / P4W / T9H / V16E, L9I / P4F / T9H / V16E, L9F / P4M / T9H / V16E, L9F / P4W / T9H / V16E, and L9F / P4F / T9H / V16E.

60. The antibody according to claim 1 or 2, further characterized in that the antibody comprises an Fe fragment.

61. The antibody according to claim 60, further characterized in that the antibody comprises a human IgG4 Fe fragment comprising the amino acid sequence of SEQ ID NO:

32.

62. The antibody according to claim 60, further characterized in that the antibody comprises a human IgG4 Fe fragment having an S108P mutation related to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO:

33.

63. The antibody according to claim 60, further characterized in that the antibody comprises a human IgG4 Fe fragment having an S108P mutation, an M308L mutation and an N314A mutation with respect to SEQ ID NO:32, comprising the amino acid sequence of SEQ ID NO:

61.

64. A method for treating a complement pathway-mediated disease or disorder in an individual, comprising the step of administering to said individual the anti-C5 antibody of any of claims 1 to 63.

65. The method according to claim 64, further characterized in that the disease or disorder is selected from at least the group consisting of: macular degeneration (DM), age-related macular degeneration (AMD), ischemic reperfusion injury, arthritis, rheumatoid arthritis, lupus, ulcerative colitis, stroke, postoperative systemic inflammatory syndrome, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH) syndrome, myasthenia gravis, neuromyelitis optica (NMO), multiple sclerosis, delayed graft function, antibody-mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (GRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with cardiopulmonary bypass surgery and dialysis). renal),C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including, but not limited to, antineutrophil cytoplasmic antibody (ANCA)-mediated glomerulonephritis, lupus nephritis and combinations thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS and antiphospholipid antibody-induced pregnancy loss, or any combination thereof.

66. A method for reducing the activity of an individual's complement system, wherein the method comprises administering an antibody to the individual by means of a route of administration selected from the group consisting of enteral administration, parenteral administration and a combination thereof, and wherein the antibody is the antibody of any one of claims 1 to 63.

67. The method according to claim 66, further characterized in that the antibody is a fragment of the antibody selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

68. A cell comprising the antibody of at least one of claims 1 to 63.

69. The cell according to claim 68, further characterized in that the cell produces the antibody of at least one of claims 1 to 63.

70. The cell according to claim 69, further characterized in that the cell is a hybridoma.

71. A genetically modified non-human animal that expresses human C5.

72. The genetically modified non-human animal according to claim 71, further characterized in that the non-human animal is a rodent.

73. The genetically modified non-human animal according to claim 72, further characterized in that the non-human animal is a mouse.

74. The genetically modified non-human animal according to claim 72, further characterized in that the non-human animal is a NOD / SCID mouse.

75. The genetically modified non-human animal according to claim 72, further characterized in that the non-human animal is an FcRn / SCID mouse.