NEW PROMOTER AND METHOD FOR PRODUCING THE DESIRED SUBSTANCE USING THE SAME

Abstract

This application relates to a new promoter and a method for producing a desired substance using the same.

Description

NEW PROMOTER AND METHOD FOR PRODUCING THE DESIRED SUBSTANCE USING THE SAME TECHNICAL FIELD This disclosure relates to a novel promoter and a process for producing a target substance using the same. BACKGROUND OF THE INVENTION Coryneform microorganisms are industrial microorganisms that have been most widely and traditionally used to produce amino acids and nucleic acid-related substances. These Gram-positive bacteria are primarily used to produce chemicals with diverse applications in animal feed, pharmaceuticals, medicines, food, and related fields, including amino acids and various types of nucleic acids, and require biotin for their growth. These bacteria are characterized by their ability to bend at the correct angle during cell division (a "clicking" or "snap"), and one of their advantages is their low rate of degradation of the metabolites they produce. Among the products produced by coryneform microorganisms, L-amino acids are the basic structural units of proteins and are used as important raw materials for pharmaceuticals, food additives, animal feed, nutritional supplements, pesticides, disinfectants, and similar products. Therefore, the industrial production of amino acids has become an economically important industrial process. Various studies have been conducted for the efficient production of amino acids; for example, efforts have been made to develop microorganisms or fermentation process technologies for highly efficient amino acid production. Specifically, targeted strategies have been developed to target substances, such as increasing the expression of genes encoding enzymes involved in amino acid biosynthesis or eliminating genes unnecessary for amino acid biosynthesis in strains of the genus Corynebacterium (US patent 8030036 B2, etc.). In addition to these strategies, a procedure for eliminating genes not involved in amino acid production and a procedure for eliminating genes whose functions in producing amino acids are not specifically known have also been used.However, there is a growing need to study procedures for the efficient production of amino acids with high yield. To develop high-value strains of these coryneform microorganisms through genetic or metabolic engineering, the expression of genes involved in various metabolic pathways must be selectively regulated. For this regulation, it is important to control the activity of a promoter, which is a regulatory gene where transcription begins through the binding of RNA polymerase to the DNA molecule. BRIEF DESCRIPTION OF THE INVENTION The present inventors have made efforts to develop a promoter exhibiting intense activity-inducing expression and, as a result, the present inventors have modified the promoter of the ilvC gene on the Corynebacterium chromosome by nucleotide substitution and zcnccn / zznz / q / uli identified that the modified promoter can increase the expression of a gene operatively linked to it, thereby completing the present disclosure. This disclosure provides a polynucleotide having promoter activity, wherein at least one nucleotide is substituted by another nucleotide in the nucleotide sequence of SEQ ID NO: 1. This disclosure provides a promoter that includes the polynucleotide. This disclosure provides a vector that includes the promoter and a gene encoding a target protein. This disclosure provides a microorganism of the genus Corynebacterium, which includes the polynucleotide. This disclosure provides a procedure for producing a target substance, including the procedure for cultivating the microorganism of the genus Corynebacterium in a medium. This disclosure provides a procedure for enhancing the expression of a target gene, including the procedure of operationally linking the promoter to the target gene. This disclosure provides for the use, as a promoter, of a polynucleotide in which at least one nucleotide is substituted by nucleotide in the nucleotide sequence of SEQ ID NO: 1. The polynucleotides having novel promoter activity of the present disclosure can be used to increase the expression of a target gene bound to it and can therefore be conveniently used in the production of target substances. BRIEF DESCRIPTION OF THE FIGURES Figures 1 to 4 show the ilvC promoter regions of valine-producing strains. Figures 5 and 6 show the ilvC promoter regions of isoleucine-producing strains. Figures 7 and 8 show the ilvC promoter regions of leucine-producing strains. DETAILED DESCRIPTION OF THE INVENTION The present disclosure is described in detail below. Each description and embodiment of an aspect disclosed herein may be applied to a description and embodiment of another aspect with respect to overlapping content. Furthermore, all combinations of the various elements disclosed herein fall within the scope of the present invention. Moreover, the scope of this disclosure should not be limited to the specific description provided below. Furthermore, experts in the field will recognize or be able to determine, using only routine experimentation, many equivalents to the specific realizations of the disclosure described herein. It is intended that these equivalents be covered by this disclosure. According to one aspect of this disclosure, a polynucleotide is provided in which at least one nucleotide is substituted by another nucleotide zcnccn / zznz / q / uili in the nucleotide sequence of SEQ ID NO: 1 and which has a promoter activity. As used herein, the term polynucleotide refers to a polymer of nucleotides composed of nucleotide monomers covalently linked in a long chain, such as a strand of DNA that is of a predetermined length or longer. As used herein, the term "polynucleotide having promoter activity" refers to a region of DNA located in the vicinity of a site involved in the transcription of a target gene, including a site to which RNA polymerase, an enhancer, or the like binds for the expression of the target gene to be bound in the 3' direction. For the purposes of this disclosure, the polynucleotide may be used as a general-purpose enhanced promoter.The promoter may be configured to regulate the expression of a target gene operatively linked to it and the production and / or activity of a protein encoded by the target gene and may be configured to increase the production and / or activity of a target product (a biologically active substance, for example, at least one selected from the group consisting of amino acids, nucleic acids, vitamins, proteins, fatty acids, and organic acids), the production of which involves the protein, in cells, compared to, but not limited to, conventional promoters or endogenous cell promoters. In one embodiment, the polynucleotide having promoter activity described herein can be used as a promoter capable of enhancing the expression of acetohydroxyacid isomer reductase. The polynucleotide may be zcnccn / zznz / q / uli, a polynucleotide involved in increasing the production or amount of amino acids, including amino acids, specifically branched-chain amino acids, more specifically leucine, valine, and isoleucine, but not limited to the foregoing, and includes without limitation any polynucleotide sequences having promoter activity. In this disclosure, SEQ ID NO: 1 is a sequence with promoter activity, and the nucleotide sequence of SEQ ID NO: 1 can be identified in the well-known NCBI GenBank database and may be derived from Corynebacterium sp., although this is not the only possible source. Any sequence with the same activity as the nucleotide sequence may be included without limitation. Furthermore, SEQ ID NO: 1 may be a promoter for acetohydroxyacid isomer reductase. However, the sequence is not limited to the above. As used herein, the term acetohydroxyacid isomer reductase refers to an enzyme involved in the biosynthesis of a branched-chain amino acid. As for the branched-chain amino acid biosynthesis pathway, acetohydroxyacid synthase first catalyzes the decarboxylation of pyruvic acid and the condensation reaction of pyruvic acid with another molecule of pyruvic acid to produce acetolactic acid, a precursor of valine, or the decarboxylation of pyruvic acid and the condensation reaction of pyruvic acid with 2-ketobutyrate to produce acetohydroxybutyrate, a precursor of isoleucine. Acetoxyhydroxy acid isomer reductase advances the reaction to the next stage using the acetolactic acid or acetohydroxybutyrate produced in this way as a substrate, thereby producing L-valine, L-leucine, and L-isoleucine.Specifically, isomerization occurs through the reaction of acetolactic acid or acetohydroxybutyrate, produced by the reaction of acetohydroxyacid synthase, with acetohydroxyacid isomeroreductase, and then, through a reduction reaction, (2 / ?)-2,3-dihydroxy-3-isovalerate or (2 / ?,3R)-2,3-dihydroxy-3-methylvalerate is produced from each substrate. The (2R)-2,3-dihydroxy-3-isovalerate undergoes reactions catalyzed by dihydroxyacid dehydratase and transaminase B to produce L-valine, and sequentially undergoes reactions catalyzed by dihydroxyacid dehydratase, 2-isopropylmalate synthase, isopropylmalate isomerase, 3-isopropylmalate dehydrogenase, and transaminase B to produce L-leucine. (2R,3 / ?)-2,3-dihydroxy-3-methylvalerate undergoes dihydroxy acid dehydratase and transaminase B-catalyzed reactions to produce L-isoleucine.Therefore, acetohydroxy acid isomer reductase is an important enzyme in the biosynthesis pathway of a branched-chain L-amino acid. The polynucleotide having promoter activity of the present disclosure refers to one in which at least one nucleotide is substituted for another nucleotide in the nucleotide sequence of SEQ ID NO: 1 and / or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity with SEQ ID NO: 1. The nucleotide sequences that have homology or identity may be those included in the above range excluding the sequence that has 100% identity, or they may be sequences that have 100% identity. Specifically, the polynucleotide having promoter activity may include a polynucleotide having promoter activity in which at least one nucleotide is substituted by another nucleotide in the nucleotide sequence of SEQ ID NO: 1, or may be composed of a polynucleotide having promoter activity in which at least one nucleotide is substituted by another nucleotide in the nucleotide sequence of SEQ ID NO: 1. The polynucleotide that has promoter activity can be a polynucleotide represented by the general formula XYZ, in which i) X is CNGN; ii) Y is CTAATTN; and iii) Z is CATGTGTGTGGTANAAN; and iv) N is selected from adenine (A), thymine (T), guanine (G), or cytosine (C). In the polynucleotide sequence of the general formula, Z can be composed of SEQ ID NO: 2, Y can be composed of SEQ ID NO: 3, or X can be composed of SEQ ID NO: 4. Specifically, in the general formula, X may be represented by CN1GN2, Y may be represented by CTAATTN3, and Z may be represented by CATGTGTGTGGTATAAT, wherein Ni, each of N2 and N3 are selected from any of adenine (A), thymine (T), guanine (G) or cytosine (C). More specifically, in the general formula, i) Ni can be cytosine (C) or guanine (G), ii) N2 can be adenine (A) or thymine (T), iii) N3 can be adenine (A) or guanine (G), or iv) can be a combination of substitutions from i) to iii), although not limitingly. In one embodiment, in the polynucleotide sequence of the general formula, at Z, the 14th nucleotide N and the 17th nucleotide can be thymine (T) in the nucleotide sequence shown in SEQ ID NO: 2, wherein, at X, zcnccn / zznz / q / uili the 2nd nucleotide N can be cytosine (C) or guanine (G) and the 4th nucleotide N can be adenine (A) or thymine (T) in the nucleotide sequence shown in SEQ ID NO: 4 or X can be any one of SEQ ID NOS: 8 to 11; and in Y, the 7th nucleotide N can be adenine (A) or guanine (G) in the nucleotide sequence shown in SEQ ID NO: 3. Specifically, in Z, the 14th nucleotide N and the 17th nucleotide can be thymine (T) in the nucleotide sequence shown in SEQ ID NO: 2; X can be any one of SEQ ID NOS: 8 to 11; and Y can be SEQ ID NO: 6 or 7. In another additional embodiment, the polynucleotide may have any one of the polynucleotide sequences selected from SEQ ID NOS: 13 to 20. Although described herein using the expression polynucleotide having a nucleotide sequence shown with a particular sequence number or polynucleotide including a nucleotide sequence shown with a particular sequence number, it shall be evident that a polynucleotide having a polynucleotide sequence having a deletion, modification, substitution or addition in a portion thereof may also be used herein, provided that the polynucleotide has activity identical or corresponding to that of the polypeptide consisting of the nucleotide sequence with the corresponding sequence number.For example, it will be evident that such expressions do not exclude any addition of non-coding sequences in the 5' or 3' direction of the nucleotide sequence with the corresponding sequence number, a naturally occurring mutation or a silent mutation thereof, provided that the nucleotide has an activity identical or equivalent to that of the polynucleotide, and nucleotide sequences having such an addition or mutation of the sequence are also included within the scope of this disclosure. Homology or identity refers to a degree of relationship between two given nucleotide sequences and can be expressed as a percentage. The terms homology and identity can often be used interchangeably. The homology or identity of conserved polynucleotide sequences can be determined using a conventional alignment algorithm, and default gap penalties can be applied by the program being used. Substantially homologous or identical sequences can generally hybridize with each other, along with all or at least approximately 50%, 60%, 70%, 80%, or 90% of the full sequence lengths under moderate or very high restriction conditions. A polynucleotide containing a degenerate codon instead of a codon is also considered in the polynucleotides to be hybridized. It is possible to determine whether any two polynucleotide sequences have homology, similarity, or identity using a known computer algorithm, such as the FASTA program, using predetermined parameters as in Pearson et al. (1988) Proc. Nati. Acad. Sci. USA 85:2444. Alternatively, this can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), which is carried out in the Needleman program of the European Molecular Biology Open Software Suite (EMBOSS) software package (Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or later versions) (GCG software package (including the GCG software package (Devereux, J., et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J MOLEC BIOL 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and CARILLO et al. (1988) SIAM J Applied Math 48:1073).For example, homology, similarity, or identity can be determined using BLAST from the National Center for Biotechnology Information database, or ClustalW. The homology, similarity, or identity of polynucleotides can be determined by comparing sequence information using the GAP software program, for example, Needleman et al. (1970), J Mol Biol. 48:443, as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In summary, the GAP program defines homology, similarity, or identity as the value obtained by dividing the number of similarity-aligned symbols (i.e., nucleotides or amino acids) by the total number of symbols in the shorter of the two sequences. The default parameters of the GAP program may include: (1) a binary comparison matrix (containing a value of 1 for identity and a value of 0 for non-identity) and the weighted comparison matrix of Gribskov et al. (1986) Nuci. Acids Res. 14:6745 as revealed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979) (or EDNAFULL (EMBOSS NCBI NUC4 version.(4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a penalty of 10 for opening a gap and a penalty of 0.5 for extending a gap); and (3) no penalty for closing gaps. Therefore, the term homology or identity used herein refers to the relationship between sequences. Furthermore, any polynucleotide sequence that can hybridize with a probe prepared from a known gene—for example, a sequence complementary to part or all of the polynucleotide sequence described above—under restrictive conditions and exhibiting the same activity, may be included without limitation. The term "restrictive conditions" refers to conditions that permit specific hybridization between polynucleotides. Such conditions are specifically disclosed in the literature (e.g., J. Sambrook et al., cited above).For example, the conditions may include conditions under which genes that have a high degree of homology or identity, such as genes that have at least 40%, specifically at least 70%, at least 80%, at least 85%, or at least 90%, more specifically at least 95%, even more specifically at least 97%, and even more specifically at least 99% homology or identity, hybridize with each other, but genes that have less homology or identity than the above ranges do not hybridize with each other; or the typical washing conditions for Southern hybridization, i.e., washing is carried out once, specifically two or three times at a salt concentration and temperature corresponding to 60 °C, 1 χ SSC, and 0.1% SDS, specifically 60 °C, 0.1 χ SSC, and 0.1% SDS, and more specifically 68 °C, 0.1 χ SSC, and 0.1% SDS. Hybridization requires that two nucleic acids have complementary sequences, although incorrect base pairings may be possible depending on the hybridization constraints. The term complementary is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, this disclosure may include not only substantially similar nucleic acid sequences but also isolated nucleic acid fragments complementary to the full sequence. Specifically, polynucleotides with homology or identity can be detected at a Tm value of 55 °C using hybridization conditions that include a hybridization step and employ the conditions described above. Furthermore, the Tm value can be 60 °C, 63 °C, or 65 °C, but is not limited to these, and can be appropriately controlled by a person skilled in the art according to the objective. The appropriate restriction for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementarity of the same, and on the variables of the same that are well known in the technique (see Sambrook et al., cited above, 9,50-9,51, 11,7-11,8). Pursuant to another aspect of this disclosure, a promoter is provided that includes the polynucleotide of this disclosure. As used herein, the term promoter refers to an untranslated nucleotide sequence located in the 5' direction of the coding region, containing an RNA polymerase binding site, and having the activity to initiate transcription of a target gene to obtain mRNA; that is, a region of DNA to which RNA polymerase binds to initiate transcription of the gene. The promoter can be located in the 5' region of the transcription start site in the mRNA. The promoter described in this disclosure may have enhanced promoter activity compared to conventional promoters. That is, the promoter may increase the expression of a target gene as well as the expression and activity of a protein encoded by that target gene. For the purposes of this disclosure, the target gene for enhancing expression may be appropriately changed depending on the product to be produced, i.e., a target product, and the promoter may be used as a general-purpose promoter for enhancing the target gene. For the purposes of this disclosure, the term "target gene" refers to a gene whose expression is regulated by the promoter sequence described herein. The protein encoded by the target gene may be expressed as a target protein, and the gene encoding the target protein may be expressed as a target gene. For example, the promoter target gene may be a gene encoding acetohydroxyacid isomer reductase, i.e., it may be, but is not limited to, iVC. The polynucleotide encoding the target protein may have various modifications in its coding region within the range where the polynucleotide sequence itself remains unchanged, due to codon degeneracy or in consideration of the codons preferred by an organism in which the polynucleotide will be expressed. A description of the polynucleotide sequence is as previously described. According to another aspect of this disclosure, a vector including the promoter of this disclosure is provided. According to another aspect of this disclosure, a vector is provided that includes the promoter of this disclosure and a gene encoding a target protein. Specifically, the vector can be a vector in which the target protein is acetohydroxy acid isomer reductase, although not exclusively. As used herein, the term vector refers to a DNA construct containing a nucleotide sequence encoding a target polynucleotide, which is operatively linked to a suitable expression control region or expression control sequence to express the target polynucleotide in a suitable host. The expression control sequence may include a promoter capable of initiating transcription, any operator sequence to control such transcription, a sequence to encode a ribosome binding site of the suitable mRNA, and sequences to control transcription termination and translation. Specifically, the expression control sequence may include the promoter described in this disclosure. The vector, after transformation in a suitable host, may replicate or function independently of the host genome and may integrate into the host genome itself. For example, a target polynucleotide can be substituted into a chromosome using a chromosomal insertion vector. The polynucleotide can be inserted into the chromosome using any known technique, such as homologous recombination, but this is not the only method. The vector may include zcnccn / zznz / q / uli, as well as a selection marker to identify the chromosome insertion. A selection marker is used to select cells transformed with the vector, that is, to confirm whether the target nucleotide molecule has been inserted correctly. Markers can also be used to transmit selectable phenotypes, such as drug resistance, auxotrophy, cytotoxic drug resistance, and surface protein expression.In circumstances where selective agents are used, only cells capable of expressing the selection markers can survive or express other phenotypic traits, so that transformed cells can be selected. The vector used in this application is not particularly restricted, and any known vector may be used. Examples of commonly used vectors may include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, and similar vectors may be used as phage vectors or cosmid vectors, and vectors based on pBR, pUC, pBluescriptlI, pGEM, pTZ, pCL, and pET may be used as plasmid vectors. Specifically, pDZ, pACYCI 77, pACYCI84, pCL, pECCG117, pUC19, pBR322, pMW118, pCCIBAC, and similar vectors may be used. According to another aspect of this disclosure, a microorganism Corynebacterium sp. containing the polynucleotide having a promoter activity of this disclosure is provided. Pursuant to another aspect of this disclosure, a microorganism Corynebacterium sp. is provided containing the zcnccn / zznz / q / uili polynucleotide of this disclosure and a gene encoding the target protein. As used herein, the term microorganism encompasses naturally occurring microorganisms or microorganisms with a naturally occurring or artificially modified genetic component, and refers to a microorganism in which a specific mechanism is attenuated or enhanced due to the insertion of an exogenous gene or the enhancement or attenuation of the activity of an endogenous gene. The microorganism of this disclosure may include, without limitation, a microorganism into which the polynucleotide having promoter activity described in this disclosure is introduced or which includes the polynucleotide. Specifically, the microorganism is a microorganism prepared by transformation with a vector containing the polynucleotide having promoter activity described herein and a gene encoding a target protein, or a microorganism that includes the polynucleotide having promoter activity and a gene encoding a target protein, or that includes a vector containing such a protein. Specifically, the microorganism may be a microorganism that includes the polynucleotide having promoter activity and a gene encoding a target protein and, therefore, has the capacity to produce the target protein or a target product, the production of which involves, but is not limited to, the target protein.The microorganism can be a naturally occurring microorganism that has the ability to produce a target protein or a target product, or a microorganism obtained by transmitting the ability to produce a target protein or a target product to a precursor strain without the ability to produce a target protein or a target product, although not exclusively. As used herein, the expression microorganism zcnccn / zznz / zi / uili that produces a target protein or target product encompasses all natural microorganisms or microorganisms with a genetic modification of natural or artificial origin, and refers to a microorganism in which a particular mechanism is attenuated or enhanced due to the insertion of an endogenous gene or the enhancement or inactivation of the activity of an endogenous gene, in which the microorganism may have a genetic mutation for the production of a target protein or product.The corresponding microorganism can be: a microorganism genetically modified through any one of a target protein, a polynucleotide that encodes the same, and a vector that includes the polynucleotide; a microorganism modified to express the protein or a polynucleotide that encodes the same; a recombinant microorganism that expresses the target protein or a polynucleotide that encodes the same; or a recombinant microorganism that has the activity of the target protein, although not in a limiting manner. As used herein, the term transformation indicates that a polynucleotide or a vector containing the polynucleotide of this disclosure and a polynucleotide encoding a target protein is introduced into a host cell or microorganism to enable the target protein to be expressed in the host cell. Any host cell may be included as long as the target protein can be expressed in the host cell, regardless of whether the polynucleotide or vector inserted into the host cell or microorganism is inserted and localized on the host cell's chromosome or located outside the chromosome. The nucleotide may be introduced in any form as long as the polynucleotide zcnccn / zznz / q / uli can be introduced and expressed in the host cell.For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a gene construct containing all the factors required for self-expression. The expression cassette typically includes a promoter operatively linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The promoter may be a polynucleotide with the activity described herein. The expression cassette can act as an expression vector, enabling self-replication. Furthermore, the polynucleotide encoding the target protein may be operatively linked to the polynucleotide described herein and introduced into the host cell as such, although this is not the only possible method. As used herein, the term operationally linked refers to a functional link between a gene sequence and a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target protein. The promoter sequence may be the promoter provided in this disclosure. A transformation procedure using the vector described herein includes any procedure for introducing a nucleic acid into a cell, and any suitable conventional technique known to the art may be selected and performed depending on the host cell. Examples of the technique may include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl) precipitation, microinjection, a polyethylene glycol (PEG) procedure, a DEAE-dextran procedure, a cationic liposome procedure, a DMSO-lithium acetate procedure, and similar procedures. For the purposes of this disclosure, the microorganism is a target protein or target product producing microorganism, wherein the microorganism has an enhanced ability to produce a target protein or target product including the polynucleotide of this disclosure. In one embodiment, the microorganism that includes the polynucleotide of the present disclosure may be a microorganism that has enhanced activity of a target protein due to a substitution of at least one nucleotide for another nucleotide in the polynucleotide sequence of SEQ ID NO: 1, although not limitingly. Specifically, the microorganism is a microorganism that includes a polynucleotide having promoter activity due to a substitution of at least one nucleotide for another nucleotide in the polynucleotide sequence of SEQ ID NO: 1, wherein the nucleotide having promoter activity can be represented by the general formula XYZ, in which X is CNGN; Y is CTAATTN; Z is CATGTGTGTGGTANAAN; and N is selected from adenine (A), thymine (T), guanine (G), or cytosine (C). The polynucleotide is as described above. In one embodiment, the microorganism of the present disclosure may have enhanced activity of a target protein due to transformation with a vector that includes the polynucleotide of the present disclosure and a gene encoding the target protein. In this disclosure, the microorganism that produces a target protein or product may be a microorganism in which some of the genes involved in the biosynthesis pathway of the target protein or product are enhanced or attenuated, or some of the genes involved in the degradation pathway of the target protein or product are enhanced or attenuated. For example, when the target protein is a protein involved in the production of a branched-chain amino acid, the microorganism can be a naturally occurring microorganism that has the ability to produce the branched-chain amino acid, or a microorganism obtained by transmitting the ability to produce a branched-chain amino acid into a precursor strain without the ability to produce a branched-chain amino acid, although not exclusively. In one embodiment, when the target protein is acetohydroxyacid isomeroreductase, the microorganism may be a cell or a microorganism in which the polynucleotide of the present disclosure is operatively linked to a gene encoding acetohydroxyacid isomeroreductase to enhance the activity of the acetohydroxyacid isomeroreductase, and in such cases, the host cell or organism may be a microorganism capable of producing a branched-chain amino acid from the target protein. In this document, the microorganism capable of producing a branched-chain amino acid may be used interchangeably with the microorganism that produces a branched-chain amino acid and a microorganism that has the ability to produce a branched-chain amino acid. As used herein, the term branched-chain amino acid refers to an amino acid with a branched alkyl group in its side chain, including valine, leucine, and isoleucine. Specifically, in this disclosure, the branched-chain amino acid may be an L-branched-chain amino acid, and the L-branched-chain amino acid may be, but is not limited to, L-valine, L-isoleucine, or L-leucine. As used herein, the expression branched-chain amino acid producing microorganism encompasses all natural microorganisms or microorganisms with a genetic modification of natural or artificial origin, and refers to a microorganism in which a particular mechanism is attenuated or enhanced due to the insertion of an exogenous gene or the enhancement or inactivation of the activity of an endogenous gene, in which the microorganism may have a genetic mutation or enhanced activity for the production of a target branched-chain amino acid.For the purposes of this disclosure, the microorganism that produces a branched-chain amino acid may be a microorganism that has an enhanced capacity to produce a target branched-chain amino acid, including the polynucleotide that has the promoting activity described in this disclosure, and specifically, the microorganism may be a microorganism of the genus Corynebacterium. Specifically, the microorganism that produces a branched-chain amino acid, or the microorganism that has the capacity to produce a branched-chain amino acid, may be a microorganism in which some of the genes involved in the branched-chain amino acid biosynthesis pathway are enhanced or attenuated, or some of the genes involved in the branched-chain amino acid degradation pathway are enhanced or attenuated.For example, a microorganism that produces a branched-chain amino acid may have increased expression of iVC encoding acetohydroxy acid isomer reductase due to the inclusion of the polynucleotide having a promoter activity provided in this disclosure, although not in a limiting manner. As used herein, the expression “Corynebacterium microorganism that produces a branched-chain amino acid” may mean a microorganism of the genus Corynebacterium that has the ability to produce a branched-chain amino acid naturally or through modification. Specifically, the “Corynebacterium microorganism that produces a branched-chain amino acid” of this disclosure may mean a microorganism of the genus Corynebacterium that includes IvC, which encodes an acetohydroxyacid isomer reductase, and has an enhanced ability to produce a branched-chain amino acid through potentiation of the promoting activity of IvC.More specifically, the microorganism of the genus Corynebacterium that produces a branched-chain amino acid of the present disclosure may be a microorganism of the genus Corynebacterium that includes the polynucleotide having a promoter activity of the present disclosure or that has an enhanced ability to produce a branched-chain amino acid due to transformation with a vector containing the polynucleotide and a gene encoding the target protein. The microorganism of the genus Corynebacterium that has the ability to produce a branched-chain amino acid refers to a microorganism that has an increased ability to produce a branched-chain amino acid compared to a precursor strain prior to transformation from an unmodified microorganism. The unmodified microorganism refers to the natural strain itself, a microorganism that does not include a gene encoding acetohydroxy acid isomer reductase, or a microorganism that does not include the polynucleotide sequence of this disclosure or is not transformed with a vector containing the polynucleotide of this disclosure and a gene encoding a target protein. The precursor strain can be a microorganism of the genus Corynebacterium that produces a branched-chain amino acid. Specifically, the precursor strain can be a branched-chain amino acid-producing microorganism with a genetic modification of natural or artificial origin. For example, the precursor strain can be a strain that has an increased capacity to produce L-valine due to the introduction of a modification (ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Number 3, pp. 456-467) in a microorganism of the genus Corynebacterium, or a strain that has an increased capacity to produce lysoleucine due to the introduction of a lysC(L377K) variant and a hom(G378E) variant (Appl. Microbiol. Biotechnol.45, 612-620 (1996)) in a microorganism of the genus Corynebacterium and the introduction of an ilvA(V383A) modification (World J Microbiol Biotechnol (2015) 31:1369-1377) in a gene encoding L-threonine dehydratase. In addition, the precursor strain may be a strain that has an increased capacity to produce L-leucine zcnccn / zznz / q / uili due to the introduction of a modification (leuA(R558H, G561D); US document 2020-0032305 A1) in a microorganism of the genus Corynebacterium, although not exclusively. In the present disclosure, the microorganism of the genus Corynebacterium” may include all microorganisms of the genus Corynebacterium. Specifically, examples thereof may be Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, Corynebacterium stationis, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium singuiare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinorís, Corynebacterium flavescens and the like, but without limitation to the foregoing. De acuerdo con otro aspecto más de la presente divulgación, se proporcia un procedure para producir una sustancia diana, includante el procedrio cultivate el microorganismo del genero Corynebacterium en un medio. The target substance can be specifically an amino acid, and more specifically a branched-chain amino acid, although not exclusively. In this procedure, the microorganism may be cultured using the well-known bath culture, continuous feed culture, batch feed culture, or similar methods, although this is not the only requirement. The culture conditions may not be particularly restricted, but adjustment to a suitable pH (e.g., pH 5 to pH 9, specifically pH 6 and pH 8, and most specifically pH 6.8) can be achieved using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid), and an aerobic condition can be maintained by adding oxygen or an oxygen-containing gas mixture to the culture. The culture temperature can be maintained from 20°C to 45°C, and specifically from 25°C to 40°C, and the culture can be carried out for approximately 10 to 160 hours, but the conditions are not limited to the above.The amino acid produced by the culture can be released into the medium or it can remain in the cells without being released. In the culture medium to be used as a carbon source, sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose), oils and fats (e.g., soybean oil, sunflower oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), organic acids (e.g., acetic acid), and the like can be used alone or in combination, but the carbon source is not limited to the above.As a nitrogen source, an organic compound containing nitrogen (e.g., a peptone, yeast extract, meat extract, malt extract, fermented corn liquor, soy flour, and urea) or an inorganic compound (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate), and the like, may be used alone or in combination, but the nitrogen source is not limited to the above. zcnccn / zznz / q / uιλι As a phosphorus source, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, a corresponding sodium-containing salt, and similar substances can be used alone or in combination, but the phosphorus source is not limited to these. In addition, the medium may contain growth-promoting materials such as other metallic salts (e.g., magnesium sulfate or ferrous sulfate), amino acids, and vitamins. The process for producing a target substance of this disclosure may also include recovering the target substance from the environment. To recover the target substance produced during the culture stage, the target substance can be collected from the medium using a suitable procedure known in the art, in accordance with the culture procedure. For example, centrifugation, filtration, anion-exchange chromatography, crystallization, HPLC, and similar methods can be used, and the target substance can be recovered from the medium or the microorganism using a suitable procedure known in the art. Furthermore, the recovery step may include a purification procedure, which can be carried out using a suitable procedure known in the art. For example, when the target substance is an amino acid, the recovered amino acid may be in a purified form or it may be a fermentation broth from microorganisms containing an amino acid (Introduction to Biotechnology and Genetic Engineering, AJ Nair., 2008). Pursuant to another aspect of this disclosure, a procedure is provided for enhancing the expression of a target gene, including the procedure of operationally linking a promoter that includes the zcnccn / zznz / q / uili polynucleotide of this disclosure to the target gene. The polynucleotide, target gene, promoter, and the like are as described above. According to another aspect of this disclosure, the use, as a promoter, of a polynucleotide having a substitution of at least one nucleotide for another nucleotide in the nucleotide sequence of SEQ ID NO: 1 is provided. The polynucleotide is as described above. Method for carrying out the invention The following section of this document describes the present disclosure in greater detail with reference to examples of implementations. However, these examples are provided to specifically illustrate the present disclosure, and its scope is not limited to the foregoing. Example 1: Selection of a mutant strain with an increased capacity to produce valine through random mutation Example 1-1: Random mutagenesis by UV irradiation To select mutant strains with increased valine production capacity, Corynebacterium glutamicum KCCM11201P (US 8465962 B2), a valine-producing strain, was plated on nutrient medium containing agar and cultured at 30 °C for 36 hours. The hundreds of colonies obtained in this way were irradiated with UV light at room temperature to induce random mutagenesis in the strain's genome. <Medio nutriente (pH 7,2)> zcnccn / zznz / q / uili glucose 10 g, meat juice 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, and urea 2 g (based on 1 L of distilled water). Example 1-2: Fermentation titer assay in mutagenized strains and strain selection To select mutant strains with an increased capacity to produce L-valine compared to Corynebacterium glutamicum KCCM11201P used as a precursor strain, a fermentation titer assay was performed on the mutagenized strains. Each colony was subcultured on nutrient medium, and then each strain was inoculated into a 250 mL baffle flask containing 25 mL of production medium and cultured with shaking at 30 °C at 200 rpm for 72 hours. Subsequently, the L-valine concentration was analyzed using HPLC, and the analyzed L-valine concentrations are tabulated in Table 1. <Medio nutriente (pH 7,2)> glucose 10 g, meat juice 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, and urea 2 g (based on 1 L of distilled water).<Medio de producción (pH 7,0)> glucose 100 g, ammonium sulfate 40 g, soy protein 2.5 g, hydrolyzed corn solids 5 g, urea 3 g, potassium phosphate dibasic 1 g, magnesium sulfate heptahydrate 0.5 g, biotin 100 pg, thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotine amide 3 mg, calcium carbonate 30 g (based on 1 I of distilled water) TABLE 1 strain name L-Valine (g / l) Control KCCM11201P 2.7 Test group M1 3.0 M2 2.8 M3 2.5 M4 4.8 M5 3.5 M6 3.3 M7 2.9 M8 3.9 M9 3.5 M10 2.1 M11 1.1 M12 2.9 M13 2.5 M14 3.1 M15 4.7 M16 3.2 zcnccn / zznz / q / uιλι With reference to Table 1, strains M4 and M15 were selected, for which the amounts of valine production increased by 178% and 174%, respectively, compared to strain KCCM11201P as a control. Example 2: Investigation of modification by chemical sequencing The main genes of the valine biosynthesis pathway were sequenced in the M4 and 1M5 strains with increased valine production capacity, and compared with those of the KCCM11201P strain, and the natural Corynebacterium glutamicum strains ATCC14067, ATCC13032 and ATCC13869. The results identified that the M4 and M15 strains contained the same mutations at specific positions in the promoter region of ilvC, a gene that encodes the acetohydroxy acid isomer reductase (AHAIR) (FIG. 1). Specifically, in M4 and M15, the 14th nucleotide G and the 17th nucleotide C were substituted by T in the promoter region sequence including the sequence shown in SEQ ID NO: 5. The sequence shown in SEQ ID NO: 5 is a sequence that is commonly contained in the ilvC promoter region of natural Corynebacterium glutamicum strains (ATCC14067, ATCC13032 and ATCC13869).In the following examples, it was investigated whether mutations affected the amount of amino acid produced by microorganisms of the genus Corynebacterium. Example 3: Preparation of strains with introduced mutations and investigation of valine production capacity Example 3-1: Preparation of strains with introduction of mutations in Corynebacterium glutamicum KCCM11201P and evaluation of valine production capacity Example 3-3-1: Preparation of strains To replace the 14th and 17th nucleotides with T in the polynucleotide sequence shown in SEQ ID NO: 5, a vector containing target mutations was constructed to introduce the mutations into the valine-producing strain Corynebacterium glutamicum KCCM11201P. Specifically, genomic DNA was extracted from ATCC14067, a naturally occurring strain of Corynebacterium glutamicum, using a G-spin total DNA extraction minikit (Intron, Cat. No. 17045) according to the kit's provided protocol. Porting was performed using the genomic DNA as a template. To construct a vector for introducing mutations into the promoter region of the ilvC gene, DNA fragments (A and B) were obtained using a primer pair of Primer 1 (SEQ ID NO: 21) and Primer 2 (SEQ ID NO: 22) and a primer pair of Primer 3 (SEQ ID NO: 23) and Primer 4 (SEQ ID NO: 24), respectively. Overlapping PCR was performed using the two fragments zcnccn / zznz / g / uli as templates along with Primer 1 (SEQ ID NO: 21) and Primer 4 (SEQ ID NO: 24) to obtain a PCR product of approximately 1.4 kb (hereafter referred to as the introduced mutation fragment). The primers used are shown in Table 2. TABLE 2 zcnccn / zznz / q / υιλι Primer Nucleotide Sequence SEQ ID NO Primer 1 CTATTCTAGAGTGATGAATCTGCAGCAGAAGATC 21 Primer 2 GACAACTACATTATTATTATACCACACACATGCA 22 Primer 3 TGCATGTGTGTGGTATAATAATAATGTAGTTGTC 23 Primer 4 CTATTCTAGAGAAGAGGTCGGTGACGGTCTCAGC 24 The resulting fragments that induced mutations were treated with the restriction enzyme Xbal (New England Biolabs, Beverly, MA) and then ligated using the pDZ vector (WO 2008-033001 A1) treated with the same restriction enzyme and T4 ligase (New England Biolabs, Beverly, MA). The prepared gene was transformed into E. coli DH5a, which was then selected on LB medium containing kanamycin, and DNA was obtained using a DNA-spin plasmid DNA purification kit (NtRON) to construct the recombinant plasmid pDZ- / 7vC(Pm3)-14067. The same procedure was carried out using, instead of the genomic DNA of ATCC14067, that of ATCC13869 and ATCC13032, from natural Corynebacterium glutamicum, and thus the recombinant plasmids called pDZ- / 7vC(Pm3)-13869 and pDZ- / 7vC(Pm3)-13032 were constructed, respectively. Among the three recombinant plasmids constructed as described above, pDZ- / 7vC(Pm3)-14067 was transformed into Corynebacterium glutamicum KCCM11201P, an L-valine-producing strain, by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The strain into which the vector had been inserted on the chromosome by homologous sequence recombination was selected from a medium containing 25 mg / L of kanamycin. Subsequently, the transformed strain of Corynebacterium glutamicum for which secondary recombination had been completed was subjected to PCR using Primer 1 and Primer 4 to construct the KCCM11201P- / 7vC(Pm3) strain in which mutations were introduced in the ilvC promoter on the chromosome (Fig. 2).The recombinant strain was named Corynebacterium glutamicum CA08-1063, which was deposited internationally with the Korean Culture Center of Microorganisms (KCCM), an international depository, on August 21, 2019, under the stipulations of the Budapest Treaty, and received registration number KCCM12574P. Example 3-1-2: Evaluation of valine production capacity To compare the valine production capacity between the valine-producing strains Corynebacterium glutamicum KCCM 11201P and KCCM 11201 P- / 7vC(Pm3), a fermentation titer assessment was performed. Each strain was subcultured in nutrient medium, then inoculated into a 250 mL baffled flask containing 25 mL of production medium, and cultured with shaking at 30 °C at 200 rpm for 72 hours. Subsequently, L-valine concentrations were analyzed using HPLC, and the analyzed L-valine concentrations are tabulated in Table 3. zcnccn / zznz / q / υιλι<Medio nutriente (pH 7,2)> Glucose 10 g, meat juice 5 g, polypeptona 10 g, sodium chloride 2.5 g, lever extract 5 g, agar 20 g, and urea 2 g (based on 1 I destilled water).<Medio de producción (pH 7,0)> Glucose 100 g, ammonium sulphate 40 g, soy protein 2.5 g, hydrolysed corn solids 5 g, urea 3 g, dibasic potassium phosphate 1 g, heptahydrated magnesium sulphate 0.5 g, biotin 100 pg, thiamine HCI 1 mg, calcium pantothenate 2 mg, nicotine starch 3 mg, calcium carbonate 30 g (based on 1 I of destilted water) TABLE 3 L-Valine production capacity of KCCM11201P and KCCM11201P / 7vC(Pm3) zcnccn / zznz / q / υιλι Cepa L-Valine (g / i) Lote 1 Lote 2 Lote 3 Media Control KCCM11201P 2.8 2.6 2.7 2.7 Test Group KCCM11201P- HvC(Pm3) 3.2 2.9 2.9 3.0 As shown in the previous results, the L-valine production capacity of the KCCM11201P- / 7vC(Pm3) strain increased by 11% compared to the control. Consequently, L-valine production capacity would be enhanced by the mutation of the ilvC gene promoter. Example 3-2: Preparation of strains with introduction of mutations in Corynebacterium glutamicum CJ7V and evaluation of valine production capacity Example 3-2-1: Preparation of the valine-producing CJ7V strain To investigate whether the same effect as previously observed was also present in other L-Valine producing strains of Corynebacterium glutamicum, a species mutation (ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Number 3, pp. 456-467) was introduced into natural Corynebacterium glutamicum ATCC14067 to prepare strains that had increased L-Valine production capacity. Specifically, genomic DNA was extracted from the ATCC14067 strain, a natural Corynebacterium glutamicum, using a G-spin total DNA extraction minikit (Intron, Cat. No. 17045) according to the kit's provided protocol. Porting was performed using the genomic DNA as a template. To construct a vector to introduce the A42V mutation into the ilvC gene, gene fragments (A and B) were obtained using a primer pair of Primer 5 (SEQ ID NO: 25) and Primer 6 (SEQ ID NO: 26) and a primer pair of Primer 7 (SEQ ID NO: 27) and Primer 8 (SEQ ID NO: 28), respectively. The PCR conditions were as follows: denaturation at 94 °C for 5 minutes, 25 cycles of denaturation at 94 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 60 seconds, followed by polymerization at 72 °C for 7 minutes. The primers used are shown in Table 4. TABLE 4 zcnccn / zznz / q / υιλι Primer Nucleotide Sequence SEQ ID NO Primer 5 AATTTCTAGAGGCAGACCCTATTCTATGAAGG 25 Primer 6 AGTGTTTCGGTCTTTACAGACACGAGGGAC 26 Primer 7 GTCCCTCGTGTCTGTAAAGACCGAAACACT 27 Primer 8 AATTTCTAGACGTGGGAGTGTCACTCGCTTGG 28 As a result, 537 bp polynucleotides were obtained for fragments A and B. Overlapping PCR was performed using the two fragments as a template along with Primer 5 (SEQ ID NO: 25) and Primer 8 (SEQ ID NO: 28) to obtain a PCR product of approximately 1044 bp (hereafter referred to as the introduced mutation fragment). The resulting fragments that induced mutations were treated with the restriction enzyme Xbal (New England Biolabs, Beverly, MA) and then ligated using the pDZ vector treated with the same restriction enzyme and T4 ligase (New England Biolabs, Beverly, MA). The prepared gene was transformed into E. coli DH5a, which was then selected from LB medium containing kanamycin, and DNA was obtained using a DNA-spin plasmid DNA purification kit (NtRON). The vector designed to introduce A42V into the ilvN gene was named pDZ- / 7i / A / (A42V). Subsequently, the recombinant plasmid pDZ- / 7v7V(A42V) constructed as described above was transformed into natural Corynebacterium glutamicum ATCC14067 by homologous recombination on the chromosome (van der Resty et al., Appl Microbiol Biotechnol 52:541-545, 1999). The strain into which the vector had been inserted on the chromosome by homologous recombination was selected from a medium containing 25 mg / L of kanamycin. The transformed Corynebacterium glutamicum strain for which secondary recombination had been completed was then PCR-assayed using Primer 5 and Primer 8 to amplify the gene fragment, and the strain with the introduced zcnccn / zznz / q / uili mutation was subsequently identified by gene sequencing. The recombinant strain was named Corynebacterium glutamicum CJ7V. Example 3-2-2: Evaluation of valine production capacity The pDZ- / 7vC(Pm3)-14067 strain was transformed into Corynebacterium glutamicum CJ7V, which had the ability to produce L-valine prepared in Example 3-2-1, by the same procedure as in Example 3-1 to prepare a strain with a mutation in the promoter of the ilvC gene, which was designated CJ7V / 7vC(Pm3) (FIG. 3). To compare the ability to produce L-valine among the prepared strains, the strains were cultured and the L-valine concentration was analyzed by the same procedure as in Example 3-1, and the analyzed L-valine concentrations were tabulated in Table 5 below. TABLE 5 L-Valine production capacity of CJ7V and CJ7V- / 7vC(Pm3) zcnccn / zznz / q / υιλι Strain L-Valine g / D Lot 1 Lot 2 Lot 3 Medium Control CJ7V 3.4 3.5 3.5 3.5 Test group CJ7V- / 7vC(Pm3) 3.8 3.9 3.8 4.0 As shown in the previous results, the L-valine production capacity of the CJ7V- / 7vC(Pm3) strain increased by 14% compared to the control. This further confirms that L-valine production capacity is enhanced by mutation of the ilvC gene promoter. Example 3-3: Preparation of strains with introduction of mutations in Corynebacterium glutamicum CJ8V and evaluation of the L-valine production capacity Example 3-3-1: Preparation of the valine-producing CJ8V strain To investigate whether the same effect as above was also present in other L-valine-producing strains of Corynebacterium glutamicum, a species mutation ( / 7vA / (A42V)) was introduced into natural Corynebacterium glutamicum ATCC13869 to prepare strains that had the ability to produce L-valine by the same procedure as in Example 3-2, and the recombinant strain was named Corynebacterium glutamicum CJ8V. Example 3-3-2: Evaluation of valine production capacity The strains prepared in Example 3-3-1, in which the ilvC promoter mutation had been introduced into Corynebacterium glutamicum CJ8V, were capable of producing L-valine. Each of the recombinant vectors pDZ- / 7vC(Pm3)-14067 and pDZ- / 7vC(Pm3)-13869 prepared in Example 3-1-1 were transformed into CJ8V (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The strain in which the vector had been inserted into the chromosome by homologous sequence recombination was selected from a medium containing 25 mg / L of kanamycin. Subsequently, the transformed strain of Corynebacterium glutamicum for which secondary recombination had been completed was subjected to PCR using Primer 1 and Primer 4 to construct the strains CJ8V- / 7i / C(Pm3) and CJ8V- / 7vC(Pm3)-2, in which a mutation was introduced in the ilvC promoter of the chromosome (FIG. 4).Of the recombinant strains, CJ8V / 7i / C(Pm3)-2 was named Corynebacterium glutamicum CA08-2034, which was deposited internationally at the Korean Culture Center of Microorganisms (KCCM), an international depository, on August 21, 2019, under the stipulations of zcnccn / zznz / q / uli. Treaty of Budapest, and received the registration number KCCM12575P. To compare the ability of the prepared strains to produce L-valine, the strains were cultured and the L-valine concentration was analyzed by the same procedure as in Example 3-1 and the analyzed L-valine concentrations were tabulated in Table 6 below. TABLE 6 L-Valine producing capacity of CJ8V, CJ8V- / 7vC(Pm3) and CJ8V- / 7i / C(Pm3)2 zcnccn / zznz / q / υιλι Strain L-Valine (g / D Lot 1 Lot 2 Lot 3 Medium Control CJ8V 3.5 3.4 3.4 3.5 Test group CJ8V- / / vC(Pm3) 3.9 3.9 3.8 3.8 Test group CJ8V- / / vC(Pm3)-2 3.8 3.8 3.8 3.8 As shown in the previous results, the L-valine production capacity of each of the CJ8V- / 7vC(Pm3) and CJ8V- / 7vC(Pm3)-2 strains increased by 8.6% compared to the control. This again confirmed that L-valine production capacity is enhanced by mutation of the μIvC gene promoter. Example 4: Preparation of isoleucine-producing strains and evaluation of production capacity Example 4-1: Preparation of strains with mutations in the ilvC promoter introduced into the L-isoleucine-producing strain Corynebacterium glutamicum KCCM11248P The strains with the recombinant plasmids pDZ- / 7vC(Pm3)-14067 and pDZ / 7vC(Pm3)-13869 constructed in Example 3-1 were introduced into the L-isoleucine-producing strain, Corynebacterium glutamicum KCCM11248P (Korean patent no. 10-1335789), by homologous recombination on the chromosome, using the same procedure as in Example 3, and these strains were designated KCCM11248P:: / 7vC(Pm3) and KCCM11248P:: / 7vC(Pm3)-2, respectively (Fig. 5). The prepared strains were cultured using the following procedure, and their isoleucine-producing capacity was then compared. Each strain was inoculated into a 250 ml baffle flask containing 25 ml of inoculation medium and cultured with shaking at 200 rpm for 20 hours at 30 °C. Then, 1 ml of the inoculation culture was inoculated into a 250 ml baffle flask containing 24 ml of production medium and cultured with shaking at 200 rpm for 48 hours at 30 °C. The compositions of the inoculation medium and production medium were as follows. <Medio de producción (pH 7,0)> glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 100 pg, thiamine HCl 1000 pg, calcium pantothenate 2000 pg, nicotinamide 2000 pg (based on 1 I of water distilled)<Medio de producción (pH 7,0)> glucose 50 g, (NH4)2SO4 12.5 g, soy protein 2.5 g, hydrolyzed corn solids 5 g, urea 3 g, KH2PO4 1 g, MgSO4 7H2O 0.5 g, biotin 100 pg, thiamine hydrochloride 1000 pg, calcium pantothenate 2000 pg, nicotinamide 3000 pg, CaCO3 30 g (based on 1 L of distilled water) After the culture period ended, the lysoleucine production capacity was measured. Table 7 below shows the lysoleucine concentrations in the culture medium for each strain tested. TABLE 7 zcnccn / zznz / q / υιλι Strain L-lsoleucine (g / l) Lot 1 Lot 2 Lot 3 Medium Control KCCM11248P 1.3 1.5 1.2 1.33 Test group KCCM11248P- HvC(Pm3) 1.8 1.5 2.0 1.76 Test group KCCM11248P- HvC(Pm3)-2 1.7 1.6 1.8 1.70 As shown in Table 7 above, the lysoleucine concentrations produced by KCCM11248P:: / 7vC(Pm3) and KCCM11248:: / 7vC(Pm3)-2, into which the ilvC promoter enhancer mutation was introduced, increased by approximately 32.3% and 27.8%, respectively, compared to those of the L-isoleucine-producing strain KCCM11248P. Therefore, an increase in L-isoleucine production capacity was identified through the ilvC promoter mutation. These results demonstrate that introducing the ilvC promoter mutation into L-isoleucine-producing strains of the genus Corynebacterium is effective in increasing L-isoleucine production. Example 4-2: Preparation of an L-isoleucine-producing strain with an ilvC promoter mutation introduced into Corynebacterium glutamicum ATCC13032 and evaluation of L-isoleucine production capacity To investigate the effect of introducing the ilvC promoter mutation on L-isoleucine production capacity, strains were prepared by introducing the / ysC(L377K) variant (KR 10-2019-0003019 A) and the hom(G378E) variant (Appl. Microbiol. Biotechnol. 45, 612-620 (1996)) into Corynebacterium glutamicum ATCC13032 (hereafter referred to as WT), and the / 7vA(V383A) mutation (World J Microbiol. Biotechnol. (2015) 31:1369-1377) into the known gene encoding L-threonine dehydratase, and L-isoleucine production capacity was compared. The primers used are shown in Table 8. TABLE 8 zcnccn / zznz / q / υιλι Primer Nucleotide Sequence (5-3') SEQ ID NO 9 TCCTCTAGAGCTGCGCAGTGTTGAATACG 29 10 TGGAAATCJ_L II CGATGTTCACGTTGACAT 30 11 ACATCGAAAAGATTTCCACCTCTGAGATTC 31 12 GACTCTAGAGTTCACCTCAGAGACGATTA 32 Example 4-2-1: Introduction of the L377K mutation PCR was performed using the WT chromosome as a template along with either Primers 9 and 10 or Primers 11 and 12. The PCR conditions were: denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 30 seconds, followed by polymerization at 72 °C for 7 minutes. As a result, a 509 bp DNA fragment from the region in the 5' direction of the lysC gene mutation and a 520 bp DNA fragment from the region in the 3' direction of the same gene were obtained, respectively. PCR was performed using the two amplified DNA fragments as templates along with primers 9 and 12. The PCR conditions were: denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, polymerization at 72 °C for 60 seconds, and then polymerization at 72 °C for 7 minutes. As a result, a 1011 bp DNA fragment was amplified that included the mutation of the lysC gene encoding an aspartokinase variant in which leucine 377° was substituted with lysine. The pDZ vector, which cannot be replicated in Corynebacterium glutamicum, and the 1011 bp DNA fragment were treated with the restriction enzyme Xbal and ligated using DNA ligase, and then cloned to obtain a plasmid, which was named pDZ- / ysC(L377K). The pDZ- / ysC(L377K) vector obtained as described above was introduced into the WT strain using an electrical pulse procedure (Appl. Microbiol. Biotechnol. (1999), 52:541-545), and then transformed strains were obtained from a selective medium containing 25 mg / l of kanamycin. A strain was obtained in which a nucleotide mutation was introduced into the lysC gene by means of the DNA fragment inserted into the chromosome through a secondary recombinant process (backcrossing). Example 4-2-2: Introduction of the G378E mutation To construct a vector to introduce the / ?om(G378E) mutation, PCR was performed using WT genomic DNA as a template along with primers 13 and 14, and primers 15 and 16. The PCR conditions were: denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 30 seconds, followed by polymerization at 72 °C for 7 minutes. As a result, a 220 bp DNA fragment from the region in the 5' direction of the hom gene mutation and a 220 bp DNA fragment from the region in the 3' direction of the same region were obtained. The PCR was carried out using the two PCR products as a template along with the pair of Primers 13 and 16.The PCR conditions were: denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 30 seconds, followed by polymerization at 72 °C for 7 minutes. As a result, a 440 bp DNA fragment containing the hom gene mutation was amplified. The primers used are shown in Table 9. TABLE 9 zcnccn / zznz / q / υιλι Primer Nucleotide sequence (5-3') SEQ ID NO 13 TCCTCTAGACTGGTCGCCTGATGTTCTAC 33 14 GCCAAAACCTCCACGCGATC 34 15 ATCGCGTGGAGGTI II GGCT 35 16 GACTCTAGATTAGTCCCTTTCGAGGCGGA 36 The previously used pDZ vector and the 440 bp DNA fragment were treated with the restriction enzyme Xbal, ligated using DNA ligase, and then cloned to obtain a plasmid, which was named pDZhom(G378E). The resulting pDZ-hom(G378E) vector was introduced into the WT:: / ysC(L377K) strain prepared in Example 4-2-1 using the pulsed electric field procedure, and then transformed strains were obtained from a selective medium containing 25 mg / L of kanamycin. A WT:: / ysC(L377K)-nom(G378E) strain was obtained in which a nucleotide mutation was introduced into the hom gene using the DNA fragment inserted into the chromosome via a secondary recombinant process (backcrossing). Example 4-2-3: Introduction of the mutation in the promoter !IvC Using the same procedures as in the previous examples, the strains in which the recombinant plasmids pDZ- / 7vC(Pm3)-14067 and pDZ / 7vC(Pm3)-13032 prepared in Example 3-1 were introduced into the strain WT:: / ysC(L377K)- / ?om(G378E) prepared in Example 4-2-2 by homologous recombination on the chromosome, and these strains were named WT:: / ysC(L377K)-ñom(G378E)- / 7vC(Pm3) and WT:: / ysC(L377K)- / }om(G378E) / 7vC(Pm3)-3, respectively. Example 4-2-4: Introduction of the ilvA mutation To construct a vector into which the previously known / / VA(V383A) mutation (World J Microbio!Biotechnol (2015) 31:1369–1377) for the ilvA gene was introduced, a pair of primers (Primers 17 and 18) were designed to amplify the region in the 5' direction of the mutation position and a pair of primers (Primers 19 and 20) to amplify the region in the 3' direction of the same. The BamHI enzyme site (underlined) was inserted at one end of each of Primers 17 and 20, and a nucleotide substitution mutation (underlined) was positioned at a site designed for backcrossing in Primers 18 and 19. The primers used are shown in Table 10. TABLE 10 zcnccn / zznz / q / υιλι Primer Nucleotide Sequence (5-3') SEQ ID NO 17 ACGGATCCCAGACTCCAAAGCAAAAGCG 37 18 GCGCTTGAGGTACTCtgcCAGCGTGATGTC 38 19 GACATCACGCTGgcaGAGTACCTCAAGCGC 39 20 ACGGATCCAACCAAACTTGCTCACACTC 40 zcnccn / zznz / q / uιλι PCR was performed using the wild-type chromosome as a template along with primers 17 and 19, and primers 19 and 20. The PCR conditions were: denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, polymerization at 72 °C for 30 seconds, and then polymerization at 72 °C for 7 minutes. As a result, a 627 bp DNA fragment from the 5' direction of the ilvA gene mutation and a 608 bp DNA fragment from the 3' direction of the same region were obtained. PCR was performed using the two amplified DNA fragments as templates along with primers 17 and 20.The PCR conditions were: denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 60 seconds, followed by polymerization at 72 °C for 7 minutes. As a result, a 1217 bp DNA fragment was amplified that included the mutation of the ilvA gene encoding a variant of ilvA in which valine 383° was substituted with alanine. The pECCG117 vector (Korean patent no. 10-0057684) and the 1011 bp DNA fragment were treated with the BamHI restriction enzyme, ligated using DNA ligase, and then cloned to obtain a plasmid, which was named pECCGI 17- / M4 (V383A). Strains were prepared in which the pECCG117 / / vA(V383A) vector was introduced into ATCC13032::fiom(G378E)- / ysC(L377K)- / 7vC(Pm3) and ATCC13032:: / ?om(G378E)- / ysC(L377K)- / 7vC(Pm3)-3, respectively, and These strains were named ATCC13032:: / ?om(G378E)- / ysC(L377K) / 7vC(Pm3) / pECCG117- / 7vA(V383A) and ATCC13032::fiom(G378E)- / ysC(L377K) / 7vC(Pm3)-3 / pECCG117- / 7vA(V383A), respectively (FIG. 6). In addition, a strain in which only the / 7vA(V383A) mutation was introduced in ATCC13032::fiom(G378E)- / ysC(L377K) was also prepared as a control. Example 4-2-5: Evaluation of isoleucine production capacity The strains were cultured using the same procedure shown in Example 4-1, and the concentration of L-isoleucine in the culture was analyzed. TABLE 11 zcnccn / zznz / q / uili L-lsoleucine strain (q / l) Batch 1 Batch 2 Batch 3 Media Control ATCC13032::-7?om(G378E) / ysC(L377K) / pECCG117 / 7vA(V383A) 4.1 4.3 4.3 4.23 Assay group ATCC13032:: / 7om(G378E) / ysC(L377K)- / 7vC(Pm3) / pECCG117- / 7vA(V383A) 5.2 5.1 5.6 5.30 Assay group ATCC13032:: / )om(G378E) / ysC(L377K)- / / vC(Pm3)3 / pECCG117- / 7vA(V383A) 5.1 5.3 5.4 5.26 As shown in Table 11 above, Lysoleucine concentrations in ATCC13032:: / 7om(G378E)- / ysC(L377K)- / 7vC(Pm3) / pECCG117 / 7vA(V383A) and ATCC13032::hom(G378E)- / ysC(L377K)- / 7vC(Pm3)-3 / pECCG117 / 7vA(V383A) that each included the IvC mutation were increased by approximately 25% and 24%, respectively, compared with, in the wild-type strain. ATCC13032::- / ?om(G378E)- / ysC(L377K) / pECCG117- / / vA(V383A) natural. The above results show that the introduction of ¡IvC promoter mutation into L-isoleucine-producing strains of the genus Corynebacterium is effective in L-isoleucine production. Example 5: Preparation of leucine-producing strains and investigation of production capacity Example 5-1: Preparation of strains with introduction of the μIvC promoter mutations introduced in the L-isoleucine producing strains Corynebacterium glutamicum KCCM11661P and KCCM11662P and evaluation of leucine production capacity The recombinant plasmid pDZ- / 7vC(Pm3)-14067 constructed in Example 3-1 was used to transform Corynebacterium glutamicum KCCM11661P (US patent 10351859 B2) and KCCM11662P (US patent 10351859 B2), which are L-leucine-producing strains, by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The strain into which the vector had been inserted on the chromosome by homologous sequence recombination was selected from a medium containing 25 mg / L of kanamycin. Subsequently, the transformed strain of Corynebacterium glutamicum for which secondary recombination had been completed was subjected to POR using Primer 1 and Primer 4 to construct strains in which a mutation had been introduced in the 1IvC promoter of the chromosome. The recombinant strains were named Corynebacterium glutamicum KCCM11661P- / 7vC(Pm3) and KCCM11662P- / 7vC(Pm3), respectively (FIG. 7). zcnccn / zznz / q / uιλι To compare the leucine production capacity of the leucine-producing strains Corynebacterium glutamicum KCCM11661P- / 7vC(Pm3) and KCCM11662P / 7vC(Pm3), a fermentation titer assessment was performed. Each strain was subcultured in nutrient medium, then inoculated into a 250 mL baffled flask containing 25 mL of production medium and cultured with shaking at 30 °C at 200 rpm for 72 hours. Subsequently, L-leucine concentrations were analyzed using HPLC, and the analyzed L-valine concentrations are tabulated in Table 12 below.<Medio nutriente (pH 7,2)> glucose 10 g, meat juice 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, and urea 2 g (based on 1 L of distilled water).<Medio de producción (pH 7,0)> glucose 50 g, ammonium sulfate 20 g, hydrolyzed corn solids 20 g, dibasic potassium phosphate 1 g, magnesium sulfate heptahydrate 0.5 g, biotin 100 pg, thiamine-HCl 1 mg, calcium carbonate 15 g (based on 1 L of distilled water) TABLE 12 L-Leucine producing capacity of KCCM11661P, KCCM11661 P-ilvC(Pm3), KCCM11662P and KCCM11662P- / 7vC(Pm3) zcnccn / zznz / q / υιλι Strain L-Leucine (g / l) Lot 1 Lot 2 Lot 3 Medium Control KCCM 11661P 2.8 2.6 2.7 2.7 Test group KCCM 11661P / 7vC(Pm3) 3.1 2.9 2.9 3.0 Control KCCM11662P 3.0 3.1 2.9 3.0 test KCCM11662P- HvC(Pm3) 3.3 3.3 3.2 3.3 As shown in the previous results, the L-leucine production capacity of the KCCM11661P- / / vC(Pm3) and KCCM11662P- / 7vC(Pm3) strains increased by 11% and 10%, respectively, compared to the control. Therefore, it was identified that L-leucine production capacity could be improved by mutating the ilvC gene promoter. Example 5-2: Preparation of strains by introducing mutations into the leucine-producing strain Corynebacterium glutamicum CJL8001 and evaluation of L-leucine production capacity To investigate whether the same effect was also present in other strains of Corynebacterium glutamicum producing L-leucine, a species mutation (teuA(R558H, G561D); US document 20200032305 A1) was introduced into the natural strain of Corynebacterium glutamicum ATCC13032 to prepare strains that had improved L-leucine production capacity. Specifically, the recombinant plasmid pDZ-Lei / A(R558H, G561D) constructed in the prior patent was transformed into the natural Corynebacterium glutamicum ATCC130332 strain by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Subsequently, the transformed Corynebacterium glutamicum strain for which secondary recombination had been completed was subjected to gene sequencing to identify the strain in which the mutation had been introduced. The recombinant strain was named Corynebacterium glutamicum CJL8001. Finally, the vectors pDZ- / 7vC(Pm3)-14067 and pDZ- / 7vC(Pm3)-13032 were transformed into Corynebacterium glutamicum CJL8001, which had the capacity to produce L-leucine, by the same procedure as in Example 51 to prepare the strains CJL8001- / 7vC(Pm3) and CJL8001 / 7vC(Pm3)-3, in which the mutations in the ilvC gene had been introduced (FIG. 8), in which CJL8001- / 7vC(Pm3)-3 was named Corynebacterium glutamicum CA13-8101, which was deposited internationally in the Korean Culture Center of Microorganisms (KCCM), an international repository. August 21, 2019, under the stipulations of the Budapest Treaty, and received the registration number KCCM12576P. To compare the ability to produce L-leucine among the prepared strains, the strains were cultured and the L-valine concentration was analyzed by the same procedure as in Example 5-1 and the analyzed L-leucine concentrations were tabulated in Table 13 below. TABLE 13 L-Leucine producing capacity of CJL8001, CJL8001- / 7vC(Pm3) and CJL8001- / 7vC(Pm3)-3 zcnccn / zznz / q / υιλι Strain L-Leucine (g / l) Lot 1 Lot 2 Lot 3 Medium Control CJL8001 3.4 3.3 3.5 3.4 Test group CJL8001- / / 7i / C(Pm3) 3.8 3.9 4.0 3.9 Test group CJL8001- / / vC(Pm3)-3 3.9 3.9 3.9 3.9 As shown in the previous results, the L-leucine production capacity of each of the CJL8001 - / 7vC(Pm3) and CJL8001 - / 7vC(Pm3)3 strains increased by 15% compared to the control. This again demonstrates that L-leucine production capacity can be enhanced by mutation in the ilvC gene promoter of microorganisms from the genus Corynebacterium glutamicum. From the foregoing description, a person skilled in the art to which this disclosure pertains may understand that this disclosure can be made in other specific ways without abandoning its spirit or essential characteristics. Therefore, the embodiments described above should be considered illustrative and not limiting to this disclosure. The scope of this disclosure should be understood to include all changes and modifications arising from the definitions and scope of the claims and their equivalents.

Claims

1. A polynucleotide comprising a nucleotide sequence represented by the following General Formula 1: [General Formula 1] XYZ wherein, X is CN1GN2, Y is CTAATTN3, and Z is CATGTGTGTGGTATAAT, wherein each of Ni, N2 and N3 is selected from any one of adenine (A), thymine (T), guanine (G) or cytosine (C).

2. The polynucleotide according to claim 1, wherein Ni of X is cytosine (C) or guanine (G).

3. The polynucleotide according to claim 1, wherein N2 of X is adenine (A) or thymine (T).

4. The polynucleotide according to claim 1, wherein N3 of Y is adenine (A) or guanine (G).

5. The polynucleotide according to claim 3, wherein X is any one of SEQ ID NO: 8 to 11, and Y is SEQ ID NO: 6 or 7.

6. The polynucleotide according to claim 1, wherein the polynucleotide has any one of the polynucleotide sequences selected from SEQ ID NOS: 13 to 20.

7. A promoter comprising the polynucleotide of any one of claims 1 to 6. zcnccn / zznz / q / uili 8. A vector comprising the promoter of claim 7 and a gene encoding a target protein.

9. The vector according to claim 8, wherein the target protein is acetohydroxy acid isomer reductase.

10. A microorganism of the genus Corynebacterium, comprising the polynucleotide of any one of claims 1 to 6.

11. The microorganism according to claim 10, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

12. A process for producing a target substance, the process comprising: cultivating the microorganism of the genus Corynebacterium of claim 10 in a medium; and recovering the target substance from the medium.

13. The process according to claim 12, wherein the target substance is an amino acid.

14. The process according to claim 13, wherein the amino acid is a branched-chain L-amino acid.

15. A method for enhancing the expression of a target gene, zcnccn / zznz / q / uili, the method comprising operatively attaching a promoter comprising the polynucleotide of any one of claims 1 to 6 to the target gene.