BACTERIA-BASED PROTEIN SUPPLY

MX435363BActive Publication Date: 2026-06-12T3 PHARM AG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
MX2023004760
Authority / Receiving Office
MX · MX
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-10-27
Filing Date
2023-04-24
Publication Date
2026-06-12
Estimated Expiration
2041-10-26

AI Technical Summary

Technical Problem

Current methods for delivering therapeutic proteins to eukaryotic cells, particularly cancer cells, face challenges such as low efficiency, degradation in lysosomes, and the conflict between cargo stability in the human body and targeted release within cells, with existing bacterial strains lacking flexibility for cloning diverse proteins and maintaining tumor colonization capacity.

Method used

Development of recombinant gram-negative bacterial strains that express and secrete multiple heterologous proteins efficiently, using a specific nucleotide sequence arrangement to ensure high activity and tumor colonization, with proteins like cGAS and RIG-I CARD2 delivered via the type III secretion system.

Benefits of technology

The recombinant strains achieve high maximum activity of heterologous proteins in eukaryotic cells while maintaining bacterial strain stability and tumor colonization, enabling effective cancer treatment.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to recombinant gram-negative bacterial strains and their use in a method for treating cancer in a subject.
Need to check novelty before this filing date? Find Prior Art

Description

BACTERIA-BASED PROTEIN SUPPLY FIELD OF INVENTION The present invention relates to recombinant gram-negative bacterial strains and their use in a method of treating cancer in a subject. BACKGROUND OF THE INVENTION Bacteria have developed different mechanisms to inject proteins directly into target cells.' The type III secretion system (T3SS) used by bacteria such as Yersinia, Shigella and Salmonella2 works like a nanosyringe that injects so-called bacterial effector proteins into host cells. The T3SS has been exploited to deliver hybrid peptides and proteins to target cells. Heterologous effectors of the bacterial T3SS have been supplied in cases where the bacteria under study are difficult to access by genetic methods (such as Chlamydia trachomatis). Reporter proteins have frequently been fused to potential T3SS secretion signals to study the requirements for T3SS-dependent protein delivery, such as Bordetella pertussis adenylate cyclase, murine DHFR, or a phosphorylatable tag. The delivery of peptides was carried out mainly for the purpose of vaccination. This includes viral epitopes, bacterial epitopes (listeriolysin O) as well as peptides representing human cancer cell epitopes. In some cases, functional eukaryotic proteins have been provided to modulate the host cell, as was done with nanobodies3, nuclear proteins (Cre recombinase, MyoD)45o 1110 and ILlra6. None of the systems mentioned above allows the delivery of individual proteins since in each case one or multiple endogenous effector proteins are still encoded. Furthermore, the vectors used have not been designed in a way that allows simple cloning of other DNA fragments encoding proteins of choice, which precludes widespread application of the system. Approaches that enable targeted drug delivery are of great interest. For example, antibodies are used that recognize structures on the surface of tumor cells and, in an optimal case, that bind selectively to tumor cells. To improve the mechanism of such antibodies, they can be conjugated to therapeutic agents or to lipid vesicles packaged with drugs. One of the difficulties with such vesicles is the correct release of the active reactant. Even more complex is the delivery of therapeutic proteins or peptides, especially when targeting intracellular mechanisms. Many alternative ways have been attempted to solve the problem of delivering therapeutic proteins to eukaryotic cells, including cell-penetrating peptides (CPP) or similar technologies as well as various nanoparticle-based methodologies. . All of these technologies have the drawback of their low efficiency and that the cargo captured by the cell through endocytosis probably ends up being degraded in the lysosomes. Furthermore, the conflict between the need for stability of the cargo carrier in the human body and the requirement for destabilization and release within the target cell constitutes an intrinsic problem of such technologies. Various bacteria have been shown to replicate within malignant solid tumors when administered from a distal site, including Escherichia coli, Vibrio cholerae, Sahnonella enterica, Listeria monocytogenes, Pseudomonas aeruginosa, and Bifidobacteria. Currently, only bacillus Calmette-Guérin (BCG, derived from Mycobacterium bovis) is used in clinical practice. BCG is administered to treat superficial bladder cancer, while the underlying molecular mechanism is still largely unknown. The development of bacterial strains that are capable, for example, of delivering the cargo produced inside the bacteria to its site of action inside cells such as cancer cells, that is, outside the bacteria, is still a major challenge. BRIEF DESCRIPTION OF THE INVENTION The present invention relates to recombinant gram-negative bacterial strains and their use in a method of treating cancer in a subject. In some embodiments, the present invention provides recombinant gram-negative bacterial strains and the use of these to treat cancer in a subject wherein the recombinant gram-negative bacterial strains allow the translocation of various type III effectors, but also type IV effectors, of viral proteins. and most importantly from functional eukaryotic proteins to cancer cells, for example, to cells of a malignant solid tumor. The present invention provides a recombinant gram-negative bacterial strain capable of expressing and secreting at least two different heterologous proteins, each in high maximum amounts, where surprisingly, the maximum activity for each of the heterologous proteins is preserved after delivery to eukaryotic cells. , for example, to cancer cells, while maintaining the complete tumor colonization capacity of the bacterial strain and optimizing genetic stability. In a first aspect, the present invention relates to a recombinant gram-negative bacterial strain comprising i) a first polynucleotide molecule comprising a nojbnn / cznz / B / Yi nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the nucleotide sequence encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; ii) a second polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; iii) a third polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; and iv) a fourth polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein nucleotide sequence encoding the delivery signal of a bacterial effector protein is operably linked to a promoter, wherein said first and said second polynucleotide molecules are located in a vector comprised of said gram-negative bacterial strain and said third and said fourth polynucleotide molecules are located in a chromosome of said gram-negative bacterial strain or in an extrachromosomal genetic element comprised by said gram-negative bacterial strain, with the condition that the extrachromosomal genetic element is not the vector on which said first and said second polynucleotide molecules are located. In another aspect, the present invention relates to a recombinant gram-negative bacterial strain comprising i) a first polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; ncnbnn / cznz / B / Yi ii) a second polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a protein bacterial effector, wherein the nucleotide sequence encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; iii) a third polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; and iv) a fourth polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein nucleotide sequence encoding the delivery signal of a bacterial effector protein is operably linked to a promoter, wherein said first and said second polynucleotide molecules are located in a vector comprised of said gram-negative bacterial strain and said third and said fourth polynucleotide molecules are located in a chromosome of said gram-negative bacterial strain or in an extrachromosomal genetic element comprised by said gram-negative bacterial strain, with the condition that the extrachromosomal genetic element is not the vector on which said first and said second polynucleotide molecules are located, for their use as a medicine. In another aspect, the present invention relates to a recombinant gram-negative bacterial strain comprising i) a first polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; ii) a second polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; iii) a third polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; and iv) a fourth polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein nucleotide sequence encoding the delivery signal of a bacterial effector protein is operably linked to a promoter, wherein said first and said second polynucleotide molecules are located in a vector comprised of said gram-negative bacterial strain and said third and said fourth polynucleotide molecules are located in a chromosome of said gram-negative bacterial strain or in an extrachromosomal genetic element comprised by said gram-negative bacterial strain, with the condition that the extrachromosomal genetic element is not the vector in which said first and said second polynucleotide molecules are located, for their use in a method of treating cancer in a subject, the method comprises administering to the subject said recombinant gram-negative bacterial strain, wherein the recombinant gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject. Likewise, the present invention relates to a method of treating cancer in a subject, comprising administering to the subject the recombinant gram-negative bacterial strain described above, wherein the recombinant gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject. . Likewise, the present invention relates to the use of the recombinant gram-negative bacterial strain described above for the manufacture of a medicament to treat cancer in a subject. BRIEF DESCRIPTION OF THE FIGURES Figure 1: The virulence plasmid of Yersinia enterocolitica W227, pYV. The 69,673-bp Yersinia virulence plasmid (pYV) of strain W227 drawn to scale. The T3SS elector proteins, the origin of replication and arsenic resistance (encoded by the genes arsC, B, R and Η) are indicated: I: origin of replication, II: yopO, III: yopP, IV: yopQ, V : yopT, VI: sycT, VII: yopM, VIII: yopD, IX: yopB, , R and H. Figure 2: The modified Yersinia enterocolitica W227 virulence plasmid, pYV-051, encoding human YopEi-i3s-cGASi6i-522 and human YopEi-ias-RIG-I CARD2 encoded in the endogenous pYV plasmid at the endogenous yopH and yopE sites , respectively. The 73,073 bp pYV-051 drawn to scale. I: origin of replication (53...203), II: YopO interrupted (7409...8116), III: YopP interrupted (8597...8949), IV: YopQ (10692...11240), V: YopT interrupted (11761...12301), VI: sycT (12301...12693), VII: YopM interrupted (16270...17375), VIII: YopD (18629...19549), IX: YopB (19568. ..20773), X: sycD (20751...21257), 46970...47395), XIV: sycE (49006...49398), ..61636), XVIII: arsC (65122...65547), XIX: arsB (65560...66849), XX: arsR (66861...67215), XXI: arsH (67301...67999). Figures 3A-3B: Description of the pBad_Si2 vector. (3A) Vector map of the cloning plasmid pBad_Si2 used to generate the fusion constructs with YopEi-138. The SycE chaperone and the fusion with YopEi-i38 are located under the native promoter of Y. enterocolitica. (3B) Multiple cloning site directly after the yopEi-us fragment in plasmid pBad_Si2. Figure 4: Description of the pT3P-715 vector. Vector map of the medium copy number cloning plasmid pT3P-715 used to generate fusion constructs with YopEi-i.3s. The SycE chaperone and the fusion with YopEi-i38 are located under the native promoter of Y. enterocolitica. I: araBAD promoter region (4...279), II: PBAD promoter (250...277), III: MCS I (317...331), IV: SycE (339...731), V: YopEi.138 (924...1337), VI: MCS II (1338...1361), VII: c-Myc tag (1368...1397), VIII: 6His tag (1413...1430), IX : Stop codon (1431...1433), X: Chloramphenicol resistance (2110...2766), XI: pBR322 origin (2924...3552). Figure 5: Description of the pT3P-716 vector. Vector map of the high-copy number cloning plasmid pT3P-716 used to generate fusion constructs with YopEi-138. The SycE chaperone and the fusion with YopEi-138 are under the native Y. enterocolitica promoter. I: araBAD promoter region (4...279), II: PBAD promoter (250...277), III: MCS I (317...331), IV: SycE (339...731), V: YopEi-i38 (924...1337), VI: MCS II (1338...1361), VII: c-Myc tag (1368...1397), VIII: 6His tag (1413...1430), IX : Stop codon (1431...1433), X: ncnbnn / cznz / B / Yi Resistance to chloramphenicol (2110...2766), XI: Origin ColEl (2924...3552). Figure 6: Description of the pT3P-717 vector. Vector map of the low-copy number cloning plasmid pT3P-717 used to generate fusion constructs with YopEi-i38. The SycE chaperone and the fusion with YopEi-ijs are under the native promoter of Y. enterocolitica. I: araBAD promoter region (4. ..279), II: PBAD promoter (250.. .277), III: MCS I (317...331), IV: SycE (339...731), V: YopEi-i38 (924...1337), VI: MCS II (1338...1361), VII: c-Myc tag (1368...1397), VIII: 6His tag (1413...1430), IX : Stop codon (1431...1433), X: Chloramphenicol resistance (2110...2766), XI: Origin pBR322 (2924...3552), Figure 7: Description of the pT3P-751 vector that encodes human YopE|.i38-cGASi6i-522 and YopEi. 138-RIG-I CARD2 human. Vector map of the average copy number vector pT3P-751 encoding human ΥορΕΐ-138-cGASi6i-522 and human YopE].i38-RIG-I CARD2 in an operon under the control of the yopE promoter. I: araBAD promoter region (4...279), II: PBAD promoter (250...277), III: MCS I (317...331), IV: SycE (339...731), V: YopE,.,3s(924... 1337), VI: RiglCard2humana (1350...2087), VII: YopEi-ns (altered codons) (2101...2514), VIII: cGas humanoi6i-522 (2527. ..3614), IX: c-Myc tag (3626...3655), X: 6His tag (3671...3688), XI: Chloramphenicol resistance (4368...5024), ...5810). Figure 8: Delivery of type I IFN-inducing protein encoded in a vector or in an endogenous virulence plasmid. B16F1 IFN reporter cells were infected with Y. enterocolitica ΔγορΗΟΡΕΜΤ, either a control strain that does not supply a cargo (III), or encoding on the endogenous pYV plasmid IV: human YopEi.i38-RIG-I CARD2 (RIG- I1.245), V: human YopEi-i3s-RlG-I CARD2 and human ΥορΕι-138-cGASi6i-522 or in a medium copy number vector VI: human YopEi.138-RIG-I CARD2. A titration of the bacteria added to the cells was performed for each strain, indicated in I as multiplicity of infection (MOI). Type I IFN induction was measured as optical density at 650 nm (II). Figure 9: Delivery of type I IFN-inducing protein encoded in a vector or in an endogenous virulence plasmid. IFN reporter cells from RAW macrophages were infected with Y. enterocolitica ΔγορΗΟΡΕΜΤeither a control strain that does not supply a cargo (III), or encoding a medium copy number vector encoding human YopEi-i38-cGAS-522 (IV). or that encodes the endogenous pYV plasmid YopE|.|3s-cGAS humanoi6i-522 (V). A titration of the bacteria added to the cells was performed for each strain, indicated in I as multiplicity of infection (MOI). Type I IFN induction was measured as optical density at 650 nm (II). Figure 10: Delivery of type I IFN-inducing protein encoded in a vector or in an endogenous virulence plasmid. B16F1 melanocyte IFN reporter cells were infected with Y. enterocolitica ΔγορΗΟΡΕΜΤ, either a control strain that does not supply a cargo (III), or encoding murine YopEj.iss-RIG-I CARD2 in a medium copy number vector. (RIG-Ii-246) (IV) or encoding the endogenous pYV plasmid YopEi.i38-RIG-I murine CARD2 (V) or encoding both a medium copy number vector and the endogenous pYV plasmid YopEi- murine issRIG-I CARD2 (VI). A titration of the bacteria added to the cells was performed for each strain, indicated in I as multiplicity of infection (MOI). Type I IFN induction was measured as optical density at 650 nm (II). Figure 11: Delivery of type I IFN-inducing protein encoded in a vector or in an endogenous virulence plasmid. B16F1 melanocyte IFN reporter cells were infected with Y. enterocolitica ΔγορΗΟΡΕΜΤeither a control strain that does not supply a cargo (III), or that encodes the endogenous pYV plasmid encoding human YopEi-i38-cGASi6i-522 and human RIG-1 CARD2. (RIG-I1-245) and additionally in a medium copy number vector YopE|.i38-RIG-I human CAREL (IV), or encoding both the endogenous pYV plasmid and additionally in a medium copy number vector YopEj.Bs-cGAS humani6i-522 and human RIG-I CARD2 (V). A titration of the bacteria added to the cells was performed for each strain, indicated in I as multiplicity of infection (MOI). Type I IFN induction was measured as optical density at 650 nm (II). Figures 12A-12C: Delivery of type I IFN-inducing protein encoded in a vector or in an endogenous virulence plasmid. IFN reporter cells from B16F1 melanocytes (12A), RAW macrophages (12B), or THP-1 macrophages (12C) were infected with Y. enterocolitica ΔγορΗΟΡΕΜΤ, either a control strain that does not supply a cargo (III), or that encodes in the endogenous pYV plasmid ΥορΕΐ-138-human cGAS 161-522 and human RIG-I CARD2 (RIG-I1-245) (IV) or encoding in the endogenous pYV plasmid ΥορΕι-138-human cGAS 101-522 and RIG- human I CARD2 and additionally in a medium copy number vector YopE|.i3s-human cGAS 161-522 (V), or encoding in the endogenous pYV plasmid human YopEi.us-cGAS 151-522 and human RIG-I CARD2 and additionally in a medium copy number vector ΥορΕι-138-RIG-I human CAREL (VI), or encoding both in the endogenous pYV plasmid and additionally in a vector YopE|-i38-cGAS human iñi-522 and RIG- I CARD? human (VII). A titration of the bacteria added to the cells was performed for each strain, indicated in I as multiplicity of infection (MOI). Type I IFN induction was measured as optical density at 650 nm (II). Figure 13: Colonization of the tumor with strains that encode the type I IFN-inducing protein in a vector or in an endogenous virulence plasmid. Delivery of human cGASi6i-522 and RIG-I CARD2 (RIG-I1-245) and vector copy number does not alter bacterial loads in solid tumors in the 4T1 breast cancer model. Mice carrying 4T1 subcutaneous breast tumors were injected intravenously with 5xl06CFU of Y. enterocolitica AyopHOPEMT, either a control strain that does not supply a cargo (II), or encoding the endogenous pYV plasmid YopEi-iss-cGAS human 161-522 and human RIG-I CARD2 (III) or encoding both the endogenous pYV plasmid and a medium copy number vector ΥορΕΐ-138-cGAS human 161-522 and human RIG-I CARD2 (IV), or encoding both the endogenous pYV plasmid and a high copy number vector human ΥορΕΐ-138-cGAS 161-522 and human RIG-I CARD2 (V), or encoding both the endogenous pYV plasmid and a vector low copy number human YopEι-138-cGAS 161-522 and human RIG-I CARD2 (VI). The bacterial load was determined as the colony-forming units CFU per gram of tumor (CFU / g) (I). Figure 14: Expression and secretion of type I IFN-inducing proteins encoded in low / medium / high copy number vectors. Expression and secretion of human RIG-I CARD2 (RIG-I1-245) in relation to vector copy number. Expression in bacteria (I) or secretion into the supernatant (II) was assessed for Y. enterocolitica ΔγορΗΟΡΕΜΤ, either a control strain that does not supply a cargo (III), or encoding a YopE medium copy number vector. ]j38-RlG-I CARD2 human (IV), or which encodes in a high copy number vector YopEj-i3s-RIG-I CARD? human (V), or encoding a low copy number vector YopE M38-RIG-I CARD2 human (VI). Figure 15: Delivery of type I IFN-inducing proteins encoded in an endogenous virulence plasmid and in a low / medium / high copy number vector. B16F1 IFN reporter cells were infected with Y. enterocolitica AyopHOPEMT, either a control strain that does not supply a cargo (III), or encoding the endogenous pYV plasmid ΥορΕι-138-cGAS humani6i-522 and human RIG-I CARD2 (RIG-I1-245) and additionally in a vector of medium (IV), high (V) or low (VI) number of human ΥορΕι-138-RIG-I CARD2 copies. A titration of the bacteria added to the cells was performed for each strain, indicated in I as multiplicity of infection (MOI). Type I IFN induction was measured as optical density at 650 nm (II). Figures 16A-16C: Delivery of type I IFN-inducing proteins encoded in an endogenous virulence plasmid and in a low / medium / high copy number vector. IFN reporter cells from B16F1 melanocytes (16A), RAW macrophages (16B), or THP-1 macrophages (16C) were infected with Y. enterocolitica AyopHOPEMT, either a control strain that does not supply a cargo (III), or that encodes in the endogenous pYV plasmid YopEi.us-cGAS humanoi6i-522 and RIG-I CARD2 human (RIG-I1-245) (IV) or encoding in the endogenous pYV plasmid ΥορΕι-138-cGAS humanoi6i-522 and RIG-I CARD2 human and additionally in a vector of medium (V), high (VI) or low (Vil) number of copies ΥορΕΐ-138-cGAS human 61-522 and RIG-I CARD2. A titration of the bacteria added to the cells was performed for each strain, indicated in I as multiplicity of infection (MOI). Type I IFN induction was measured as optical density at 650 nm (II). Figure 17: Strain for optimal delivery of the type I IFN-inducing protein encoded in an endogenous virulence plasmid and in a vector. Delivery of human YopEii38-cGASi6i-522 and YopE1-138-RIG-I CARD2(RIG-I 1,245) encoded in the endogenous pYV plasmid at the endogenous yopH and yopE sites, respectively, and additionally in a medium copy number vector , where YopEi-138-human cGASi6i-522 and YopEi-138-RIG-I CARD2 are encoded in an operon under the control of the yopE promoter. Figures 18A-18D: Delivery of type I IFN-inducing proteins cGAS and RIG-I CARD2 and their effect on different cell types. Delivery of human cGAS i6i-522 and RIG-I CARD 2 (RIGI1.245) leads to differential induction of type I IFN signaling in B16F1 melanocytes (18A), human LN-229 glioblastoma (18B), murine RAW macrophages ( 18C) or human THP-1 macrophages (18D). B16F1, RAW or THP-1 IFN reporter cells and LN-229 human glioblastoma cells were infected with Y. enterocolitica AyopHOPEMT, either a control strain that does not supply a cargo (III), or encoding in a vector of number medium copy murine ΥορΕι-138-RIG-I CARD2 (IV) or encoding a human ΥορΕι-138-cGAS medium copy number vectori6i-522 (V). A titration of the bacteria added to the cells was performed for each strain, indicated in I as multiplicity of infection (MOI). Type I IFN induction was measured as optical density at 650 nm (II) in 18A, 18C and 18D, and by ELISA in IFNb for 18B indicated as pg / ml. Figures 19A-19B: Delivery of type I IFN-inducing proteins encoded in an endogenous virulence plasmid and in a medium copy number vector. Delivery of human CGAS161-522 and RIG-I CARD2 (RIG-I 1-245) leads to differential induction of type I IFN signaling in A20 B-cell (19A) or Jurkat T-cell (19B) lymphoma cells. . 19A) A20 murine lymphoma cells were infected with Y. enterocolitica AyopHOPEMT, either a control strain that does not deliver a cargo (III), or encoding murine YopEι-138-RIG-I CARD2 in a medium copy number vector (IV), or encoding in a mean copy number vector ncnbnn / cznz / B / Yi ΥορΕι-138-RIG-I CARD? murine and human ΥορΕι-Bs-cGAS i6i-522(V), or encoding pYV and a medium copy number vector YopEi.i38-RIG-I murine CARD2 and human YopE|.i3s-cGASi6i-522( SAW). 19B) Human Jurkat T cells were infected with Y. enterocolitica AyopHOPEMT, either a control strain that does not deliver a cargo (III), or encoding human YopEi.i38-RIG-I CARD2 in a medium copy number vector and YopEi.i38-cGAS humaniói522 (IV), or encoding in the pYV and in a medium copy number vector ΥορΕι-138-RIG-I CARD2 human and ΥορΕΐ-138-cGAS humani6i-522 (V). A titration of the bacteria added to the cells was performed for each strain, indicated in I as multiplicity of infection (MOI). Type I IFN induction was measured by ELISA in IFNb for B indicated as pg / ml (II). Figure 20: Genetic stability of tumor-colonizing bacterial strains encoding type I IFN-inducing proteins on an endogenous virulence plasmid. Encoding human cGASi6i-522 and RIG-I CARD2 (RIG-I 1-245) is genetically stable when encoded on an endogenous pYV virulence plasmid in vivo in the B16F10 melanoma model. Mice carrying subcutaneous B16F10 tumors were intravenously injected with IxlO6UFC from Y. enterocolitica AyopHOPEMT encoding the endogenous pYV plasmid human ΥορΕι-138-cGAS6i-522 and human RIG-I CARD2. Bacteria were isolated on day 2 after administration (animals 1 and 2) or day 4 after administration (animals 3 - 10), and replicates were collected on selective medium to evaluate the presence in % of the pYV plasmid ( I), or absence of the pYV plasmid (II). Figure 21: Genetic stability of tumor colonizing bacterial strains encoding type I IFN-inducing proteins in a vector and in an endogenous virulence plasmid. It appears that encoding human cGASi6i-522 and RIG-I CARD2 (RIG-I1-245) in a medium copy number vector and on an endogenous virulence plasmid is genetically more stable than encoding on an endogenous pYV virulence plasmid. or in a vector alone in vivo in the EMT-6 breast cancer model. Mice bearing subcutaneous EMT-6 tumors were injected i.t. 7.5x107CFU of Y. enterocolitica AyopHOPEMT encoding both the endogenous pYV plasmid and a medium copy number vector YopEi-i38-cGAS humani6i-522 and human RIG-I CARD2. Bacteria were isolated on day 1 after administration (animals 1 and 2) or day 2 after administration (animals 4 - 6), and replicates were collected on selective medium to evaluate the presence in % of both the pYV plasmid such as medium copy number vector (VI), presence of pYV plasmid only (V), presence of medium copy number vector only (IV) or absence of both pYV plasmid and medium copy number vector (III) . Figure 22: Tumor progression in wild-type C57BL / 6 mice with s.c. allograft. of B16F10 melanoma cells. C57BL / 6 wild-type mice with s.c. allograft. of B16F10 melanoma cells were injected intratumorally with III: PBS, or 7.5*107CFU of IV: Y. enterocolitica dHOPEMT, or V: Y. enterocolitica dHOPEMT encoding human YopEi-i38-cGASi6i-522 and YopEi-Bs-RIG -I human CARD2 (RIG-I1.245), while both proteins are encoded in the endogenous pYV plasmid (at the endogenous yopH and yopE sites, respectively), and additionally in a medium copy number vector (where YopEi -138cGAS humani6i-522 and YopEiiss-RlG-I CARD2 are encoded in an operon under the control of the yopE promoter). Intratumoral injection was started once the tumor had reached a size of 61 (+ / -22) mm3. The day of the first intratumoral injection of bacteria was defined as day 0, treatments were performed on dO, di, d2, d3, d6 and d9. Tumor volume was measured over the following days (II: days) with calipers. The mean tumor volume is indicated (I) as mm3. Figure 23: Tumor progression in wild-type C57BL / 6 mice with s.c. allograft. of B16F10 melanoma cells. C57BL / 6 wild-type mice with s.c. allograft. of B16F10 melanoma cells were injected intratumorally with PBS. Intratumoral injection was started once the tumor had reached a size of 61 (+ / -22) mm3. The day of the first intratumoral injection was defined as day 0, treatments were performed on dO, di, d2, d3, d6 and d9. Tumor volume was measured over the following days (II: days) with calipers. The tumor volume of individual animals (n=15) is indicated (I) as mm3. Figure 24: Tumor progression in wild-type C57BL / 6 mice with s.c. allograft. of B16F10 melanoma cells. C57BL / 6 wild-type mice with s.c. allograft. of B16F10 melanoma cells were injected intratumorally with 7.5*107CFU of Y. enterocolitica dHOPEMT. Intratumoral injection was started once the tumor had reached a size of 61 (+ / -22) mm3. The day of the first intratumoral injection was defined as day 0, treatments were performed on dO, di, d2, d3, d6 and d9. Tumor volume was measured over the following days (II: days) with calipers. The tumor volume of individual animals (n=15) is indicated (I) as mm3. Figure 25: Tumor progression in wild-type C57BL / 6 mice with s.c. allograft. of B16F10 melanoma cells. C57BL / 6 wild-type mice with s.c. allograft. of B16F10 melanoma cells were injected intratumorally with 7.5xl07CFU of Y. enterocolitica ncnbnn / cznz / B / Yi dHOPEMT encoding human YopEi-ias-cGASi6i-522 and human YopEi-ns-RIG-I CARD2 (RIG11.245). , while both proteins are encoded in the endogenous pYV plasmid (in the endogenous yopH and yopE sites, respectively), and additionally in a medium copy number vector (where YopEi.ns-cGAS humani6i-522 and YopEj.Bs -RIG-I CARD2 are encoded in an operon under the control of the yopE promoter). Intratumoral injection was started once the tumor had reached a size of 61 (+ / -22) mm3. The day of the first intratumoral injection was defined as day 0, treatments were performed on dO, di, d2, d3, d6 and d9. Tumor volume was measured over the following days (II: days) with calipers. The tumor volume of individual animals (n= 15) is indicated (I) as mm3. Figure 26: Delivery of proteins that induce type I interferon response through the bacterial T3SS RIG1. Delivery of CARD domain variants of human and murine RIG1 led to the induction of type I IFN in a RAW IFN reporter cell line. RAW reporter cells were infected with I: Y. enterocolitica ΔΗ0ΡΕΜΤ, or Y. ente rocoli tica ΔΗΟΡΕΜΤ encoding a plasmid derived from pBad_Si2 II: YopE|-i3x-CARD domains of human RIG1-245, III: YopEi-ns- CARD domains of RIG1 murinai-246, IV: YopEi-i.rs-CARD domains of RIG1 murinai-229, V: YopEi-i.y-CARD domains of RIG1 murinai-218. A titration of the bacteria added to the cells (VI: indicated as MOI) was performed for each strain, and the IFN stimulation was evaluated based on the activity of the secreted alkaline phosphatase (VII: OD650) which is under the control of the LISG54 promoter comprising the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE. Figures 27A-27E: list of strains used in this application. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to recombinant gram-negative bacterial strains and their use in a method of treating cancer, for example, a malignant solid tumor in a subject. For the purposes of interpreting this description, the following definitions shall apply and, where appropriate, terms used in the singular shall also include the plural and vice versa. It should be understood that the terminology used in the present description is for the sole purpose of describing the particular embodiments and is not intended to be limiting. The term “gram-negative bacterial strain as used herein includes the following bacteria: Aeromonas salmonicida, Aeromonas hydrophila, Aeromonas veronii, Anaeromyxobacter dehalogenans, Bordetella bronchiseptica, Bordetella parapertussis, Bordetella ncnbnn / cznz / B / Yi pertussis, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia cepacia, Burkholderia mallei, Burkholderia pseudomallei, Chlamydia muridarum, Chlamydia trachmoatis, Chlamydophila abortas, Chlamydophila pneumoniae, Chromobacterium violaceum, Citrobacter rodentium, Desulfovibrio vulgaris, Edwardsiella Tarda, Endozoicomonas elysicola, Erwinia amylovora, Escherichia albertii, coli, Lawsonia intracellularis, Mesorhizobium loti, Myxococeus xanthus, Pantoea agglomerans, Photobacterium damselae, Photorhabdus luminescens, Photorabdus températe, Pseudoalteromonas spongiae, Pseudomonas aeruginosa, Pseudomonas plecoglossicida, Pseudomonas syringae, Ralstonia solanacearum, Rhizobium sp, Salmonella enté rica and other Salmonella sp, Shigella flexneri and other Shigella sp, Sodalis glossinidius, Vibrio alginolyticus, Vibrio azureus, Vibrio campellii. Vibrio caribbenthicus, Vibrio harvey, Vibrio parahaemolyticus, Vibrio tasmaniensis, Vibrio tubiashii, Xanthomonas axonopodis, The preferred gram-negative bacterial strains of the invention are gram-negative bacterial strains comprised in the family of Enterobacteriaceae and Pseudomonadaceae. The gram-negative bacterial strain of the present invention is typically used for the delivery of heterologous proteins by the bacterial T3SS to eukaryotic cells in vitro and / or in vivo, preferably in vivo. The term “recombinant gram-negative bacterial strain” as used herein refers to a recombinant gram-negative bacterial strain genetically transformed with a polynucleotide construct as a vector. The virulence of such a recombinant gram-negative bacterial strain is usually attenuated by deletion of bacterial elector proteins that have virulence activity that are carried by one or more bacterial proteins, which are part of a machinery of the secretion system. Such effector proteins are delivered by a secretion system machinery to host cells where they exert their virulence activity towards various host proteins and cellular machineries. Many different effector proteins are known, transported by various types of secretion systems and displaying a large repertoire of biochemical activities that modulate the functions of host regulatory molecules. The virulence of the recombinant gram-negative bacterial strain used herein may be further attenuated by the lack of a siderophore normally or occasionally produced by the gram-negative bacterial strain such that the strain does not produce the siderophore, for example it is deficient in siderophore production. Therefore, in a preferred embodiment a recombinant gram-negative bacterial strain is used that lacks a ncnbnn / cznz / B / Yi siderophore normally or occasionally produced by the gram-negative bacterial strain so that the strain does not produce the siderophore, e.g. deficient in the production of a siderophore, more preferably a Yersinia strain is used, in particular Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ, Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ, Τ AHorquillal-virF or Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ \asd pYV-asd lacking a siderophore normally or occasionally produced by the gram-negative bacterial strain so that the strain does not produce the siderophore, for For example, it is deficient in the production of a siderophore, in particular it is deficient in the production of yersiniabactin. Most preferably, a Yersinia strain is used, in particular Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ that lacks a siderophore normally or occasionally produced by the gram-negative bacterial strain, so that the strain does not produces the siderophore, for example, it is deficient in the production of a siderophore, in particular it is deficient in the production of yersiniabactin. The Y.enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ which is deficient in the production of yersiniabactin has been described in document WO02077249 and was deposited on September 24, 2001, in accordance with the Budapest Treaty on the International Recognition of Deposit of Microorganisms for the Purposes of Patent Procedure with the Belgian Coordinated Collections of Microorganisms (BCCM) and was assigned the accession number LMG P-21013. The recombinant gram-negative bacterial strain preferably does not produce a siderophore, for example, it is deficient in the production of a siderophore. The term 'siderophore,' iron siderophore or iron chelator used interchangeably herein refers to compounds with high affinity for iron, for example, small compounds with high affinity for iron. Siderophores of gram-negative bacteria are, for example, enterobactin and dihydroxybenzoylserine synthesized by Sahnonella, Escherichia, Klebsiella, Shigella, Serratia (but used by all Enterobacteriaceae), pyoverdines synthesized by Pseudomonas, vibriobactin synthesized by Vibrio, acinetobactin and acinetoferrin by Acinetobacter, yersiniabactin and aerobactin synthesized by Yersinia, ornibactin synthesized by Burkholderia, salmochelin synthesized by Sahnonella, aerobactin synthesized by Escherichia, Shigella, Sahnonella, and Yersinia, alcaligin synthesized by Bordetella, bisucaberin synthesized by Vibrio. Siderophores include hydroxamate, catecholate, and mixed ligand siderophores. Several siderophores have been approved to date for use in humans, primarily with the goal of treating iron overload. Preferred siderophores are Deferoxamine (also known as desferrioxamine B, desferoxamine B, DFO-B, DFOA, DFB or desferal), ncnbnn / cznz / B / Yi Desferrioxamine E, Deferasirox (Exjade, Desirox, Defrijet, Desifer) and Deferiprone (Ferriprox). The term “an endogenous protein essential for growth” used herein refers to proteins of the recombinant gram-negative bacterial strain without which the gram-negative bacterial strain cannot grow. Endogenous proteins essential for growth are, for example, an enzyme essential for the production of amino acids, an enzyme involved in peptidoglycan biosynthesis, an enzyme involved in LPS biosynthesis, an enzyme involved in nucleotide synthesis or a factor initiation of translation. The term an enzyme essential for the production of amino acids used in the present description refers to enzymes that are related to the production of amino acids of the recombinant gram-negative bacterial strain and without which the gram-negative bacterial strain cannot grow. Enzymes essential for the production of amino acids are, for example, aspartate-betasemialdehyde dehydrogenase (asd), glutamine synthetase (glnA), tryptophanyl tRNA synthetase (trpS) or serine hydroxymethyl transferase (glyA), or transketolase 1 (tktA), transketolase 2 (tktB), ribulose phosphate 3-epimerase (rpe), ribose-5-phosphate isomerase A (rpiA), transaldolase A (talA), transaldolase B (talB), phosphoribosylpyrophosphate synthase (prs), ATP phosphoribosyltransferase (hisG), bifunctional protein histidine biosynthesis HisIE (hisl), l-(5-phosphoribosyl)-5-[(5phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase (hisA), imidazole glycerol phosphate synthase subunit HisH (hisH), imidazole glycerol phosphate subunit HisF synthase (hisF), bifunctional histidine biosynthesis protein HisB (hisB), histidinol-phosphate aminotransferase (hisC), histidinol dehydrogenase (hisD), 3-dehydroquinate synthase (aroB), 3-dehydroquinate dehydratase (aroD), Shikimate dehydrogenase (NADP( +)) (aroE), Shikimate kinase 2 (aroL), Shikimate kinase 1 (aroK), 3-phosphoshikimate 1-carboxyvinyltransferase (aroA), chorismate synthase (aroC), P protein (pheA), T protein (tyrA), amino acid aromatic aminotransferase (tyrB), phospho-2-dehydro-3-deoxyheptonate aldolase (aroG), phospho-2-dehydro-3deoxyheptonate aldolase (aroH), phospho-2-dehydro-3-deoxyheptonate aldolase (aroF), quinate / shikimate dehydrogenase (ydiB), ATP-dependent 6-phosphofructokinase isoenzyme 1 (pfkA), ATP-dependent 6-phosphofructokinase isoenzyme 2 (pfkB), class 2 fructose-bisphosphate aldolase (fbaA), class 1 fructose-bisphosphate aldolase (fbaB ), triosephosphate isomerase (tpiA), pyruvate kinase I (pykF), pyruvate kinase II (pykA), glyceraldehyde-3-phosphate dehydrogenase A (gapA), phosphoglycerate kinase (pgk), 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase (gpmA), 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (gpmM / yibO), probable phosphoglycerate mutase (ytjC / gpmB), enolase (ene), D-3-phosphoglycerate ncnbnn / cznz / B / Yi dehydrogenas a (serA), phosphoserine aminotransferase ( serC), phosphoserine phosphatase (serB), L-serine dehydratase 1 (sdaA), L-serine dehydratase 2 (sdaB), catabolic L-threonine dehydratase (tdcB), biosynthetic L-threonine dehydratase (ilvA), L-serine dehydratase ( tdcG), Serine acetyltransferase (cysE), cysteine ​​synthase A (cysK), cysteine ​​synthase B (cysM), beta-cystathionase (malY), cystathionine beta-lyase (metC), 5-methyltetrahydropteroyltriglutamate-homocysteine ​​methyltransferase (metE), methionine synthase (metH), S-adenosylmethionine synthase (metK), cystathionine gamma-synthase (metB), homoserine O-succinyltransferase (metA), 5'-methylthioadenosine / S-adenosylhomocysteine ​​nucleosidase (mtnN), S-ribosylhomocysteine ​​lyase (luxS), cystathionine beta lyase, cystathione gamma lyase, serine hydroxymethyltransferase (glyA), glycine hydroxymethyltransferase (itaE), 3-isopropylmalate dehydratase small subunit (leuD), 3-isopropylmalate dehydratase large subunit (leuC), 3-isopropylmalate dehydrogenase (leuB), biosynthetic L-threonine dehydratase (ilvA), acetolactate synthase isozyme 3 large subunit (ilvl), acetolactate synthase isozyme 3 small subunit (ilvH), acetolactate synthase isozyme 1 small subunit (ilvN), isozyme 2 small subunit acetolactate synthase (ilvM), ketolacid reductoisomerase (NADP(+)) (ilvC), dihydroxy acid dehydratase (ilvD), branched-chain amino acid aminotransferase (ilvE), bifunctional aspartokinase / homoserine dehydrogenase 1 (thrA), bifunctional aspartokinase / homoserine dehydrogenase 2 (metL), 2-isopropylmalate synthase (leuA), glutamate-pyruvate aminotransferase (alaA), aspartate aminotransferase (aspC), aspartokinase / homoserine dehydrogenase bifunctional 1 (thrA), aspartokinase / homoserine dehydrogenase bifunctional 2 (metL), aspartokinase 3 sensitive lysine (lysC), aspartatosemialdehyde dehydrogenase (asd), 2-keto-3-deoxy-galactonate aldolase (yagE), 4-hydroxytetrahydrodipicolinate synthase (dapA), 4-hydroxy-tetrahydrodipicolinate reductase (dapB), 2,3,4, 5tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase (dapD),succinyl-diaminopimelate desuccinylase (dapE), diaminopimelate epimerase (dapF), putative lyase (yjhH), acetylornithine / succinyldiaminopimelate aminotransferase (argD), citrate synthase (gltA), aconitate hydratase B (acnB), aconitate hydratase A (acnA), aconitate hydratase putative uncharacterized (ybhJ), isocitrate dehydrogenase (icd), aspartate aminotransferase (aspC), glutamate-pyruvate aminotransferase (alaA), long-chain glutamate synthase [NADPH] (gltB), small-chain glutamate synthase [NADPH] (gltD) , glutamine synthetase (glnA), amino acid acetyltransferase (argA), acetylglutamate kinase (argB), N-acetyl-gamma-glutamyl-phosphate reductase (argC), acetylornithine / succinyldiaminopimelate aminotransferase (argD), Acetylornithine deacetylase (argE), F chain ornithine carbamoyltransferase (argF), ornithine carbamoyltransferase chain 1 (argl), argininosuccinate synthase (argG), argininosuccinate lyase (argH), glutamate 5-kinase (proB), gamma-glutamyl phosphate reductase (proA), pyrroline-5-carboxylate reductase (proC), ornithine cyclodeaminase, leucine-tRNA ligase (leuS), glutamine-tRNA ligase (glnS), serine-tRNA ligase (serS), glycine-tRNA ligase beta subunit (glyS), glycine-tRNA ligase alpha subunit ( glyQ), tyrosine-tRNA ligase (tyrS), threonine-tRNA ligase (thrS), alpha subunit of phenylalanine tRNA ligase (pheS), beta subunit of phenylalanine-tRNA ligase (pheT), arginine-tRNA ligase (argS), histidine-tRNA ligase (hisS), valine-tRNA ligase (valS), alanine-tRNA ligase (alaS), isoleucine-tRNA ligase (ileS), proline-tRNA ligase (proS), cysteine-tRNA ligase (cysS), asparagine-tRNA ligase ( asnS), aspartate-tRNA ligase (aspS), glutamate-tRNA ligase (gltX), tryptophan-tRNA ligase (trpS), glycine-tRNA ligase beta subunit (glyS), methionine-tRNA ligase (metG), lysine-tRNA ligase (lysS). The preferred essential enzymes for amino acid production are tktA, rpe, prs, aroK, tyrB, aroH, fbaA, gapA, pgk, eno, tdcG, cysE, metK, glyA, asd, dapA / B / D / E / F, argC, proC, leuS, glnS, serS, glyS / Q, tyrS, thrS, pheS / T, argS, hisS, valS, alaS, ileS, proS, cysS, asnS, aspS, gltX, trpS, glyS, metG, lysS, the most preferred are asd, glyA, leuS, glnS, serS, glyS / Q, tyrS, thrS, pheS / T, argS, hisS, valS, alaS, ileS, proS, cysS, asnS, aspS, gltX, trpS, glyS , metG, lysS, the most preferred is asd., The terms 'gram-negative bacterial strain deficient in the production of an essential amino acid for growth' and 'Auxotrophic enhancer' are used interchangeably herein and refer to gram-negative bacterial strains that cannot grow in the absence of at least one essential amino acid provided in a manner exogenous or a precursor thereof. The amino acid that the strain is deficient in producing is, for example, aspartate, / ??c<SY?-2,6-diaminopimelic acid, aromatic amino acids or leucine-arginine. Such a strain can be generated, for example, by deletion of the aspartate-beta-semialdehyde dehydrogenase (Aasd) gene. Such an auxotrophic mulant cannot grow in the absence of exogenous meso-2,6-diaminopimelic acid. Mutation, for example, deletion of the aspartate-beta-semialdehyde dehydrogenase gene is preferred herein for a gram-negative bacterial strain deficient in the production of an amino acid essential for growth of the present invention. The term "gram-negative bacterial strain deficient in the production of adhesion proteins that bind to the cell surface or to the eukaryotic extracellular matrix" refers to mutant gram-negative bacterial strains that do not express at least one adhesion protein compared to the adhesion proteins expressed by the corresponding wild-type strain. Adhesion proteins may include, for example, extended polymeric adhesion molecules such as ncnbnn / cznz / B / Yi pili / fimbriae or nonfimbrial adhesins. Fimbrial adhesins include type-1 pili (such as E. coli Fim-pili with the adhesin FimH), P-pili (such as Pap-pili with the E. coli PapG adhesin), type 4 pili (such as the pilin from for example P. aeruginosa) or curli (Csg proteins with the adhesin CsgA from S. enterica). Non-fimbrial adhesions include trimeric autotransporter adhesins such as YadA from Y. enterocolitica, BpaA (B. pseudomallei), Hia (H. influenzae), BadA (B. henselae), NadA (N. meningiddis) or UspAl (M. catarrhalis). as well as other autotransporter adhesins such as ALDA-1 (E. coli) as well as other adhesins / invasins such as InvA from Y. enterocolitica or Intimina (E. coli) or members of the Dr family or the Afa family (E. coli ). The terms YadA and InvA as used herein refer to proteins from Y. enterocolitica. The autotransporter YadA7 binds to different forms of collagen as well as fibronectin, while the invasin InvA8 binds to β-integrins in the eukaryotic cell membrane. If the gram-negative bacterial strain is a Y. enterocolitica strain the strain is preferentially deficient in InvA and / or YadA. As used herein, the term “Enterobacteriaceae family comprises a family of gram-negative, rod-shaped, facultative anaerobic bacteria found in soil, water, plants, and animals, which frequently occur as pathogens in vertebrates. Bacteria in this family share similar physiology and demonstrate conservation within functional elements and genes of the respective genomes. As well as being oxidase negative, all members of this family are glucose reducers and most reduce nitrates. The Enterobacteriaceae bacteria of the invention may be any of the bacteria of that family, and specifically includes, but is not limited to, bacteria of the following genera: Escherichia, Shigella, Edwardsiella, Sabnonella, Citrobacter, Klebsiella, Enterobacter, Serrada, Proteus, Erwinia, Morganella, Providencia, or Yersinia. In more specific embodiments, the bacteria is of the species Escherichia coli, Escherichia blattae, Escherichia fergusonii, Escherichia hermanii, Escherichia vuneris, Sabnonella enterica, Sabnonella bongori, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella sonnei, Enterobacter aerogenes, Enterobacter gergoviae, Enterobacter Sakazakii, Enterobacter Cloacae, Enterobacter Aggloniens, Klebsiella Pneumoniae, Klebsiella Oxytoca, Serrada Marcescens, Yersinia Pseudotuberculosis, Yersinia Pestis, Yersinia Enterocolitica, Erwinia Amylovora, Proteus Mirabilis, Proteus mirab Hauseri, Providencia Alcalifaciens or Morganella Morganii. Preferably, the gram-negative bacterial strain is selected from the group consisting of the genera Yersinia, Escherichia, Salmonella, Shigella, Psendomonas, Chlamydia, Erwinia, Pantoea, Vibrio, Burkholderia, Ralstonia, Xanthomonas, Chromobacterium, Sodalis, Citrobacter, Edwardsiella, Rhizobiae, Aeromonas, Photorhabdus, Bordetella and Desulfovibrio, most preferably, from the group consisting of the genera Yersinia, Escherichia, Salmonella, and Psendomonas, most preferably, from the group consisting of the genera Yersinia and Salmonella, in particular Yersinia. The term “Yersinia as used herein includes all species of Yersinia, including Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis. Yersinia enterocolitica is preferred. The term “Síz / z?z<we / / íz” as used herein includes all Salmonella species, including Salmonella enterica and S. bongori. Salmonella enterica is preferred. Promoter” as used herein refers to a nucleic acid sequence that regulates the expression of a transcriptional unit. A "promoter region" is a regulatory region capable of binding to RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. Within the promoter region will be a transcription initiation site (conveniently defined by SI nuclease mapping) as well as protein binding domains (consensus sequences) responsible for RNA polymerase binding such as the - region. 35 putative and the Pribnow box. The term 'operationally linked' when describing the relationship between two regions of nucleotides for example DNA simply means that they are functionally related to each other and that they are located in the same nucleic acid fragment. A promoter is operably linked to a structural gene if it controls transcription of the gene and is located on the same nucleic acid fragment as the gene. Usually the promoter is functional in said gram-negative bacterial strain, that is, the promoter is capable of expressing the fusion protein of the present invention, that is, the promoter is capable of expressing the fusion protein of the present invention without additional genetic modification or expression of additional proteins. Furthermore, a functional promoter should not be naturally regulated opposite to the bacterial T3SS. The term "extrachromosomal genetic element" used in the present description refers to a genetic element other than a chromosome that is endogenously harbored in the gram-negative bacterial strain of the present invention such as a virulence plasmid or that is an exogenous genetic element with which the gram-negative bacterial strain is transformed and which integrates transiently or stably into the chromosome or into a genetic element other than a chromosome that is endogenously harbored, such as an endogenous virulence plasmid. An endogenous virulence plasmid is the preferred extrachromosomal genetic element of the present invention. Such an extrachromosomal genetic element can be generated by the integration of a vector such as an expression vector, a vector for homologous recombination or other integration into the chromosome or into a genetic element other than a chromosome that is endogenously harbored such as a virulence plasmid, by the integration of DNA fragments for homologous recombination or other integration into the chromosome or into a genetic element other than a chromosome that is endogenously harbored such as a virulence plasmid or by means of a virulence element RNA that guides site-specific insertion into the chromosome or into a genetic element other than a chromosome that is endogenously harbored such as a virulence plasmid, such as CRISPR / Cas9 and related guide RNA. The terms "polynucleic acid molecule" and "polynucleotide molecule" are used interchangeably in the present description and have the same meaning, and refer to both DNA and RNA molecules, which may be single-stranded or double-stranded, and which may be partial or fully transcribed and translated (DNA), or partially or fully translated (RNA), into a gene product. The terms nucleic acid sequence, nucleotide sequence" and 'nucleotide acid sequence' are used interchangeably in the present description and have the same meaning in the present description, and preferably refer to DNA or RNA. The terms "nucleic acid sequence," "nucleotide sequence" and "nucleotide acid sequence" are preferably used synonymously with the term "polynucleotide sequence." The term "operon" used herein refers to two or more genes transcribed under the control of a single promoter. Therefore, these genes are typically transcribed together and form a messenger RNA, where this single mRNA encodes more than one protein (polycistronic mRNA). In addition to a promoter and two or more genes, an operator element that controls transcription may also be present. The term “delivery” used herein refers to the transport of a protein from a recombinant gram-negative bacterial strain to a eukaryotic cell, which includes the steps of expressing the heterologous protein in the recombinant gram-negative bacterial strain, secreting the protein(s) expressed from said recombinant gram-negative bacterial strain and translocate the protein(s) secreted by said recombinant gram-negative bacterial strain to the cytosol of the eukaryotic cell. Accordingly, the terms "delivery signal" or "secretion signal" used interchangeably in the present description refer to a polypeptide sequence ncnbnn / cznz / B / Yi that can be recognized by the secretion and translocation system of the gram-negative bacterial strain and directs the delivery of a protein from the gram-negative bacterial strain to eukaryotic cells. The term "bacterial effector protein delivery signal" used in the present description refers to a functional bacterial effector protein delivery signal in the recombinant gram-negative bacterial strain, that is, allowing the secretion of a heterologous protein expressed in the recombinant gram-negative bacterial strain of said recombinant gram-negative bacterial strain by a secretion system such as the type III, type IV or type VI secretion system or the translocation by said recombinant gram-negative bacterial strain to the cytosol of a eukaryotic cell by a secretion system such as the type III, type IV or type VI secretion system. The term "bacterial effector protein delivery signal" used in the present description further comprises a fragment of a bacterial effector protein delivery signal i.e. shorter versions of a delivery signal, for example, a delivery signal comprising up to 10, preferably up to 20, more preferably up to 50, even more preferably up to 100, in particular up to 140 amino acids of a delivery signal, for example, of a delivery signal of natural origin. Therefore, a nucleotide sequence such as, for example, a DNA sequence encoding a delivery signal of a bacterial effector protein may encode a full-length delivery signal or a fragment thereof, where the fragment usually comprises up to 30, preferably up to 60, more preferably up to 150, even more preferably up to 300, in particular up to 420 nucleic acids. As used herein, "secretion" of a protein refers to the transport of a heterologous protein out through the cell membrane of a recombinant gram-negative bacterial strain. The “translocation” of a protein refers to the transport of a heterologous protein from a recombinant gram-negative bacterial strain across the plasma membrane of a eukaryotic cell into the cytosol of said eukaryotic cell. The term “bacterial protein, which is part of the machinery of a secretion system, as used in the present description, refers to bacterial proteins that constitute essential components of the type 3 secretion system (T3SS), the type 3 secretion system. 4 (T4SS) and the bacterial type 6 secretion system (T6SS), preferably T3SS. Without such proteins, the respective secretion system is not functional in the translocation of proteins to host cells, even if the rest of the components of the secretion system and the bacterial effector protein to be translocated are encoded and produced. The term "bacterial effector protein" as used herein refers to bacterial proteins transported by secretion systems, for example, by bacterial proteins, which are part of a host cell secretion system machinery. Such effector proteins are delivered through a secretion system to a host cell where they exert, for example, virulence activity towards various proteins and cellular machineries of the host. Many different effector proteins are known, transported by various types of secretion systems and displaying a large repertoire of biochemical activities that modulate the functions of host regulatory molecules. Secretion systems include the type 3 secretion system (T3SS), type 4 secretion system (T4SS), and type 6 secretion system (T6SS). Some effector proteins (such as IpaC from Slugella flexnerí) also belong to the bacterial protein class, which are part of a machinery of the secretion system and allow protein translocation. The recombinant gram-negative bacterial strain used in the present description usually comprises bacterial proteins that constitute essential components of the bacterial type 3 secretion system (T3SS), type 4 secretion system (T4SS) and / or type 6 secretion system (T6SS). , preferably, from the type 3 secretion system (T3SS). The term "bacterial proteins that constitute essential components of the bacterial T3SS as used in the present description refers to proteins, which naturally form the injectisome, for example, the injection needle or are otherwise essential for its function in translocation of proteins to eukaryotic cells. Proteins that form the injectisome or are otherwise essential for its function in protein translocation to eukaryotic cells include, but are not limited to: SctC, YscC, MxiD, InvG, SsaC, EscC, HrcC, HrcC (Secretin), SctD, YscD, MxiG, Prg, SsaD, EscD, HrpQ, HrpW, FliG (Outer MS Ring Protein), SctJ, YscJ, MxiJ , PrgK, SsaJ, EscJ, HrcJ, HrcJ, FliF (Inner MS Ring Protein), SctR, YscR, Spa24, SpaP, SpaP, SsaR, EscR, HrcR, HrcR, FliP (Minor Export Apparatus Protein), SctS , YscS, Spa9 (SpaQ), SpaQ, SsaS, EscS, HrcS, HrcS, FliQ (Minor export apparatus protein), SctT, YscT, Spa29 (SpaR), SpaR, SsaT, EscT, HrcT, HrcT, FliR (Protein minor export apparatus), SctU, YscU, Spa40, SpaS, SpaS, SsaU, EscU, HrcU, HrcU, FlhB (Export apparatus exchange protein), SctV, YscV, MxiA, InvA, SsaV, EscV, HrcV, HrcV, FlhA (Major export apparatus protein), SctK, YscK, MxiK, OrgA, HrpD (Cytosolic auxiliary protein), SctQ, YscQ, Spa33, SpaO, SpaO, SsaQ, EscQ, HrcQA+B, HrcQ, FliM + FliN (C-ring protein), SctL, YscL, MxiN, OrgB, SsaK, EscL, Orf5, HrpE, HrpF, FliH (Stator), SctN, YscN, Spa47, SpaL, InvC, SsaN, EscN, HrcN, HrcN, Flil ( ATPase), SctO, YscO, Spal3, SpaM, Invl, SsaO, Orfl5, 23 ncnbnn / cznz / B / Yi HrpO, HrpD, FliJ (Stacking), SctF, YscF, MxiH, PrgI, SsaG, EscF, HrpA, HrpY (Needle filament protein), SctI, YscI, Mxil, PrgJ, Ssal, EscI, rOrf8, HrpB, HrpJ , (Inner stem protein), SctP, YscP, Spa32, SpaN, InvJ, SsaP, EscP, Orfló, HrpP, HpaP, FliK (Needle length regulator), LcrV, IpaD, SipD (Hydrophilic translocator, protein needle tip), YopB, IpaB, SipB, SseC, EspD, HrpK, PopFl, PopF2 (Hydrophobic translocator, pore protein), YopD, IpaC, SipC, SseD, EspB (Hydrophobic translocator, pore protein), YscW , MxiM, InvH (Pilotina), SctW, YopN, MxiC, InvE, SsaL, SepL, HrpJ, HpaA (Guardiana). The term T6SS effector protein or bacterial T6SS effector protein as used herein refers to proteins that are naturally injected by T6S systems into the cytosol of eukaryotic cells or bacteria and to proteins naturally secreted by T6S systems that could, for example, form translocation pores to the eukaryotic membrane. The term "T4SS effector protein" or bacterial T4SS effector protein" as used herein refers to proteins that are naturally injected by T4S systems into the cytosol of eukaryotic cells and to proteins naturally secreted by T4S systems that could, for example, form the translocation pore to the eukaryotic membrane. The term "T3SS effector protein" or "bacterial T3SS effector protein" as used herein refers to proteins that are naturally injected by T3S systems into the cytosol of eukaryotic cells and to proteins naturally secreted by T3S systems that could, e.g. , form the translocation pore to the eukaryotic membrane (including pore-forming translocators (such as YopB and YopD from Yersiniá) and spike proteins such as LcrV from Yersinia). Preferably, proteins that are naturally injected by T3S systems into the cytosol of eukaryotic cells are used. These virulence factors will paralyze or reprogram the eukaryotic cell for the benefit of the pathogen. T3S effectors display a large repertoire of biochemical activities and modulate the function of crucial host regulatory molecules and include, but are not limited to, AvrA, AvrB, AvrBs2, AvrBS3, AvrBsT, AvrD, AvrDl, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, AvrRpml, AvrRpt2, AvrXv3, CigR, EspF, EspG, EspH, EspZ, ExoS, ExoT, GogB, GtgA, GtgE, GALA family of proteins, HopAB2, HopAOl, Hopll, HopMl, HopNl, HopPtoD2, HopPtoE , HopPtoF, HopPtoN, HopUl, HsvB, IcsB, IpaA, IpaB, IpaC, IpaH, IpaH7.8, IpaH9.8, IpgBl, IpgB2, IpgD, LcrV, Map, OspCl, OspE2, OspF, OspG, OspI, PipB, PipB2 , PopB, PopP2, PthXol, PthXoó, PthXo7, SifA, SifB, SipA / SspA, SipB, SipC / SspC, SipD / SspD, SlrP, SopA, SopB / SigD, SopD, SopE, SopE2, SpiC / SsaB, SptP, SpvB , SpvC, SrfH, SrfJ, Sse, SseB, SseC, SseD, SseF, SseG, Ssel / SrfH, SseJ, SseKl, SseK2, SseK3, nojbnn / cznz / B / Yi SseL, SspHl, SspH2, SteA, SteB, SteC, SteD, SteE, TccP2, Tir, VirA, VirPphA, VopF, XopD, YopB, YopD YopE, YopH, YopJ, YopM, YopO, YopP, YopT, YpkA. The term “recombinant gram-negative bacterial strain that accumulates in a malignant solid tumor” or “recombinant gram-negative bacterial strain accumulates in a malignant solid tumor” as used herein refers to a recombinant gram-negative bacterial strain that replicates within of a malignant solid tumor thereby increasing the bacterial count of this recombinant gram-negative bacterial strain within the malignant solid tumor. Surprisingly, it has been found that the recombinant gram-negative bacterial strain after administration to the subject accumulates specifically in the malignant solid tumor, that is, it accumulates specifically in the organ where the malignant tumor is present, wherein the bacterial counts of the bacterial strain Recombinant gram-negative cells in organs where the malignant solid tumor is not present are low or undetectable. In the case of extracellularly residing bacteria such as Yersinia, the bacteria accumulate primarily within the intercellular space formed between tumor cells or cells of the tumor microenvironment. Intracellularly growing bacteria such as Salmonella will primarily invade tumor cells or cells of the tumor microenvironment and reside within such cells, although extracellular accumulations may still occur. Bacterial counts of the recombinant gram-negative bacterial strain accumulated within the malignant solid tumor may be, for example, in the range of 104 to 109 bacteria per gram of tumor tissue. The term "cancer" used in the present description refers to a disease in which abnormal cells divide uncontrollably and can invade nearby tissues. Cancer cells can also spread to other parts of the body through the vascular and lymphatic systems. There are several main types of cancer. Carcinoma is a cancer that begins in the skin or in tissues that line or cover internal organs. Sarcoma is a cancer that begins in bone, cartilage, fat, muscle, blood vessels, or other connective or supporting tissue. Leukemia is a cancer that begins in blood-forming tissue, such as the bone marrow, and causes large numbers of abnormal blood cells to be produced and enter the blood. Lymphoma and multiple myeloma are cancers that start in the cells of the immune system. Cancers of the central nervous system are cancers that begin in the tissues of the brain and spinal cord. The term "cancer" used in the present description comprises solid tumors, that is, malignant solid tumors, such as, for example, sarcomas, carcinomas, and lymphomas, and non-solid tumors, such as, for example, leukemias (blood cancers). Malignant solid tumors are preferred. The term solid tumor, sign of malignant solid tumor, malignant solid tumor, or sign of malignant solid tumor, used herein refers to an abnormal mass of tissue that usually does not contain cysts or fluid areas. Solid tumors can be benign (non-cancerous) or malignant (cancer). Malignant solid tumors are treated with the methods of the present invention. The different types of malignant solid tumors are named by the type of cells that form them. Examples of malignant solid tumors are sarcomas, carcinomas, and lymphomas. Leukemias (blood cancers) generally do not form malignant solid tumors (definition according to the National Cancer Institute of the NIH). Malignant solid tumors include, but are not limited to, abnormal mass of cells that can originate from different types of tissue such as liver, colon, colorectal, skin, breast, pancreas, cervix, body of the uterus, bladder, gallbladder. , kidney, larynx, lip, oral cavity, esophagus, ovary, prostate, stomach, testicle, thyroid gland or lung and therefore include malignant solid tumors of the liver, colon, colorectum, skin, breast, pancreas, cervix, body of the uterus, bladder, gallbladder, kidney, larynx, lip, oral cavity, esophagus, ovary, prostate, stomach, testicle, thyroid gland or lung. Preferred malignant solid tumors that can be treated with the methods of the present invention are malignant solid tumors that originate from skin, breast, liver, pancreas, bladder, prostate and colon and therefore include malignant solid tumors of skin, breast , liver, pancreas, bladder, prostate and colon. Equally preferred malignant solid tumors that can be treated with the methods of the present invention are malignant solid tumors associated with liver cancer, such as hepatocellular carcinoma. The term 'objective response rate' (ORR) as used herein refers to the proportion of patients with a reduction in tumor size of a predefined amount and for a minimum period of time. Duration of response is usually measured from the time of initial response to documented tumor progression. Generally, the FDA has defined ORR as the sum of partial responses plus complete responses. When defined in this way, ORR is a direct measure of the antitumor activity of the drug, which can be evaluated in a single-arm study. The ORR refers to the sum of the complete response (CR) and the partial response (PR). The definition of ORR, CR and PR for humans is provided in the RECIST guidelines (RECIST 1.169) and adapted guidelines for the evaluation of immunotherapeutic compounds (iRECIST70). In preclinical studies with tumor-bearing mice, the definition of tumor response is adapted compared to the RECIST definition for humans: absence of tumor ncnbnn / cznz / B / Yi regression is defined as an increase in tumor volumes by more than 35% compared to their respective volume on day 0; stable disease is defined as a change in tumor volume between a 50% decrease and a 35% increase in tumor volume compared to day 0; partial regression is defined as a decrease in tumor volume between 50% and 95% of the volume compared to day 0; and complete regression or complete response was defined as a decrease in tumor volume of >95% compared to day 0. The terms complete response, complete tumor regression, and complete regression are used interchangeably herein and have the same meaning. The term “complete response” (CR) in relation to target lesions refers to the disappearance of all target lesions. Any pathological lymph node (whether target or non-target) should have short axis reduction to <10 mm. The term complete response (CR) as used herein in relation to non-target lesions refers to the disappearance of all non-target lesions and normalization of the tumor marker level. All lymph nodes must be of non-pathological size (short axis <10 mm). The term “partial response” (PR) as used herein in relation to target lesions refers to a decrease of at least 30% in the sum of the diameters of the target lesions, when referring to the sum of the initial diameters. The term “progressive disease (PD) as used herein in relation to the target lesions refers to at least a 20% increase in the sum of the diameters of the target lesions, taking the smallest sum as a reference. in the study (this includes the initial sum if that is the smallest in the study). In addition to a relative increase of 20%, the sum must also demonstrate an absolute increase of at least 5 mm. The appearance of one or more new lesions are also considered progressions. The term progressive disease (PD) as used herein in relation to non-target lesions refers to the appearance of one or more new lesions and / or the unequivocal progression of existing non-target lesions. Unequivocal progression should not normally prevail over the status of the target lesion. It should be representative of the overall change in disease status, not an increase in a single lesion. The term “stable disease” (SD) as used herein in relation to the target lesions does not refer to a reduction sufficient to qualify for PR nor an increase sufficient to qualify for PD, when referring to the sum of the smallest diameters ncnbnn / cznz / B / Yi during the study. The term “progression-free survival (PFS) as used herein refers to the duration of time from the start of treatment to the time of progression or death, whichever occurs first. The term “bacterial effector protein that is virulent towards eukaryotic cells” as used herein refers to bacterial effector proteins, which are transported by secretion systems to host cells where they exert their virulence activity towards various proteins and cellular machineries of the host. . Many different effector proteins are known, transported by various types of secretion systems and displaying a large repertoire of biochemical activities that modulate the functions of host regulatory molecules. Secretion systems include the type 3 secretion system (T3SS), type 4 secretion system (T4SS), and type 6 secretion system (T6SS). More importantly, some effector proteins that are virulent toward eukaryotic cells (such as IpaC from Shigella flexneri) also belong to the class of bacterial proteins, which are part of a machinery of the secretion system. If the bacterial effector protein that is virulent towards eukaryotic cells is also essential for the function of the secretory machinery, said protein is excluded from this definition. The T3SS effector proteins that are virulent towards eukaryotic cells refer to proteins such as YopE, YopH, YopJ, YopM, YopO, YopP, YopT from Y. enterocolitica or OspF, IpgD, IpgBl from Shigella flexnerí or SopE, SopB, SptP from Salmonella enterica or ExoS, ExoT, ExoU, ExoY from P. aeruginosa or Tir, Map, EspF, EspG, EspH, EspZ from E. coli. The T4SS effector proteins that are virulent towards eukaryotic cells refer to proteins such as LidA, SidC, SidG, SidH, SdhA, SidJ, SdjA, SdeA, SdeA, SdeC, LepA, LepB, WipA, WipB, YlfA, YlfB, VipA, VipF, VipD, VpdA, VpdB, DrrA, LegL3, LegL5, LegL7, LegLC4, LegLC8, LegC5, LegG2, Ceglü, Ceg23, Ceg29 from Legionella pneumophila or BepA, BepB, BepC, BepD, BepE, BepF BepG from Bartonella henselae or VirD2 , VirE2, VirE3, VirF from Agrohacterium tumefaciens or CagA from H. pylori or the pertussis toxin from Bordetella pertussis. T6SS effector proteins that are virulent toward eukaryotic cells refer to proteins such as the VgrG proteins of Vibrio cholerae (such as VgrGl). The term “T3SS effector protein that is virulent toward eukaryotic cells” or “bacterial T3SS effector protein that is virulent toward eukaryotic cells” as used herein refers to proteins that are naturally injected by T3S systems into the cytosol of eukaryotic cells and proteins naturally secreted by T3S systems that could, for example, form the translocation pore to the eukaryotic membrane, which are virulence factors towards eukaryotic cells, that is, proteins that paralyze or reprogram the eukaryotic cell for the benefit of the pathogen. Effectors display a large repertoire of biochemical activities and modulate the function of crucial host regulatory mechanisms such as, for example, phagocytosis and the actin cytoskeleton, inflammatory signaling, apoptosis, endocytosis or secretory pathways2,9e and include , but not limited to, AvrA, AvrB, AvrBs2, AvrBS3, AvrBsT, AvrD, AvrDl, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, AvrRpml, AvrRpt2, AvrXv3, CigR, EspF, EspG, EspH, EspZ, ExoS , ExoT, GogB, GtgA, GtgE, GALA family of proteins, HopAB2, HopAOl, Hopll, HopMl, HopNl, HopPtoD2, HopPtoE, HopPtoF, HopPtoN, HopUl, HsvB, IcsB, IpaA, IpaH, IpaH7.8, IpaH9.8, IpgBl, IpgB2, IpgD, LcrV, Map, OspCl, OspE2, OspF, OspG, OspI, PipB, PipB2, PopB, PopP2, PthXol, PthXoó, PthXo7, SifA, SifB, SipA / SspA„ SlrP, SopA, SopB / SigD, SopD, SopE, SopE2, SpiC / SsaB, SptP, SpvB, SpvC, SrfH, SrfJ, Sse, SseB, SseC, SseD, SseF, SseG, SscI / SrfH, SseJ, SseKl, SseK2, SseK3, SseL, SspHl, SspH2, SteA, SteB, SteC, SteD, SteE, TccP2, Tir, VirA, VirPphA, VopF, XopD, YopE, YopH, YopJ, YopM, YopO, YopP, YopT, YpkA. The Yersinia T3SS effector genes that are virulent to a eukaryotic cell and can be deleted / mutated from for example Y. enterocolitica are YopE, YopH, YopM, YopO, YopP (also called YopJ), and YopT10. The respective effector genes that are virulent to a eukaryotic cell can be deleted / mutated from Shigella flexneri (e.g. OspF, IpgD, IpgBl), Sahnonella enterica (e.g. SopE, SopB, SptP), P. aernginosa (e.g. ExoS, ExoT , ExoU, ExoY) or E. coli (e.g. Tir, Map, EspF, EspG, EspH, EspZ). The nucleic acid sequences of these genes are available to those skilled in the art, for example, in the Genebank database (yopH, yopO, yopE, yopP, yopM, yopT from NC_002120 GI: 10955536; 5. flexneri elector proteins from AF386526.1 GF18462515; 583796 and E. coli effector proteins of NC_011601.1 GL215485161). For the purpose of the present invention, genes are denoted by lowercase italic letters to distinguish them from proteins. If genes (denoted by lowercase italic letters) appear after the name of a bacterial species (such as E. coli), they refer to a mutation of the corresponding gene in the corresponding bacterial species. For example, YopE refers to the effector protein encoded by the yopE gene. Y. enterocolitica yopE ncnbnn / cznz / B / Yi represents a K enterocolitica that has a mutation in the yopE gene. As used herein, the terms "polypeptide", "peptide", "protein", "polypeptide" and "peptide" are used interchangeably to designate a series of amino acid residues connected to each other by peptide bonds between the alpha-groups. amino and carboxy of adjacent residues. Preferred are proteins having an amino acid sequence comprising at least 10 amino acids, more preferably at least 20 amino acids. According to the present invention, “a heterologous protein or a fragment thereof” includes naturally occurring proteins or a fragment thereof and also includes artificially produced proteins or a fragment thereof. As used herein, the term “heterologous protein or fragment thereof” refers to a protein or fragment thereof other than the T3SS effector protein or N-terminal fragment thereof to which it may be fused. . In particular, the heterologous protein or a fragment thereof as used in the present description refers to a protein or a fragment thereof, which does not belong to the proteome, i.e. the full complement of natural proteins of the specific recombinant gram-negative bacterial strain provided. and used by the invention, for example, that does not belong to the proteome, that is, the complete complement of natural proteins of a specific bacterial strain of the genera Yersinia, Escherichia, Salmonella or Pseudomonas. Usually the heterologous protein or a fragment of it is of animal origin, which includes human origin. Preferably the heterologous protein or a fragment thereof is a human protein or a fragment thereof. More preferably the heterologous protein or a fragment thereof is selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis, cell cycle regulators. , ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR-associated proteins, nanobody and nanobody fusion constructs, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins, or a fragment of these. Preferably in particular, the heterologous protein or a fragment thereof is selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis, cycle regulators cell, ankyrin repeat proteins, reporter proteins, small GTPases, GPCR-associated proteins, nanobody fusion constructs, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins, or a fragment thereof. Other particularly preferred heterologous proteins or a fragment thereof are selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis, cell cycle regulators, ankyrin repeat proteins, cell signaling proteins, nanobody fusion constructs and nanobodies. Even more particularly preferred are heterologous proteins or a fragment thereof selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis, cell cycle regulators. , and proteins with ankyrin repeats, or a fragment of these. Other even more particularly preferred heterologous proteins or a fragment thereof are selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis, proteins with repeats of ankyrin, cell signaling proteins, nanobody fusion constructs and nanobodies. Other even more particularly preferred heterologous proteins or a fragment thereof are selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis, proteins with repeats of ankyrin, nanobody and nanobody fusion constructs. Other even more particularly preferred heterologous proteins or a fragment thereof are selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis and signaling proteins. cell phone.Other even more particularly preferred heterologous proteins or a fragment thereof are selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis, fusion constructs of nanobodies and nanobodies. Other even more particularly preferred heterologous proteins or a fragment thereof are selected from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis and fusion constructs. of nanobodies. Most preferably, proteins or a fragment thereof involved in apoptosis or the regulation of apoptosis or proteins or a fragment thereof involved in the induction or regulation of an interferon (IFN) response, in particular proteins or a fragment thereof. are involved in the induction or regulation of an interferon (IFN) response, such as heterologous animal proteins, preferably human or a fragment of these involved in apoptosis or the regulation of apoptosis or human proteins or a fragment of these involved in the induction or regulation of an interferon (IFN) response. The proteins involved in the induction or regulation of an interferon (IFN) response or a fragment thereof are preferably proteins involved in the induction or regulation of a type I interferon (IFN) response or a fragment thereof, more preferably proteins human proteins or a fragment thereof involved in the induction or regulation of a type I interferon (IFN) response. In some embodiments, the gram-negative bacterial strain of the present invention comprises two nucleotide sequences that encode identical or two different heterologous proteins fused together. independently of each other in frame at the 3' end of a nucleotide sequence that encodes a delivery signal of a bacterial elector protein. In some embodiments, the gram-negative bacterial strain of the present invention comprises three identical or three different nucleotide sequences encoding heterologous proteins independently fused together in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a protein. bacterial electorate. In some embodiments, the gram-negative bacterial strain of the present invention comprises four nucleotide sequences encoding identical or four different heterologous proteins independently fused together in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a protein. bacterial effector. The heterologous protein expressed by the recombinant gram-negative bacterial strain usually has a molecular weight of between 1 and 150 kD, preferably between 1 and 120 kD, more preferably between 1 and 100 kDa, most preferably between 10 and 80 kDa. A fragment of a heterologous protein usually contains between 10 and 1500 amino acids, preferably between 10 and 800 amino acids, more preferably between 100 and 800 amino acids, in particular between 100 and 500 amino acids. A fragment of a heterologous protein as defined herein usually has the same functional properties as the heterologous protein from which it is derived. The term "heterologous protein from which it is derived" in relation to a fragment refers to the full-length heterologous protein from which the fragment is derived. The term “the same functional properties as the heterologous protein from which it is derived” refers to the molecular function (or one of the molecular functions) of the full-length protein from which the fragment is derived, which may, for example, be an enzymatic activity, a function in protein-protein interaction and / or act as a scaffolding protein. With respect to a fragment of proteins involved in the induction or regulation of an interferon (IFN) response, human cGAS and human RIG-I may serve as an example. Human full-length cGAS 32 is a nucleotidyltransferase that catalyzes the formation of cyclic GMP-AMP (cGAMP) from ATP and guanosine triphosphate (GTP).A fragment of human cGAS that has “the same functional properties”; It must be able to carry out the same enzymatic activity (synthesis of cGAMP from GTP and ATP in the case of cGAS). Likewise for human RIG-I, a cytoplasmic sensor for short double-stranded RNA consisting of an RNA helicase domain, a C-terminal domain, and an N-terminal domain (Brisse and Ly, 2019). The helicase domain is responsible for the recognition of double-stranded RNA; the C-terminal domain includes a repressor domain; and the N-terminal domain includes two caspase recruitment domains (CARDs) that activate downstream signaling pathways. Therefore, a fragment of human RIG-I that has “the same functional properties will be able to perform the same activity as one of the molecular functions of full-length RIG-I, in the case of the N-terminal CARD domain, activating the corresponding downstream activation signaling pathways. In some embodiments, a fragment of a heterologous protein comprises a domain of a heterologous protein. Therefore in some embodiments the gram-negative bacterial strain of the present invention comprises a nucleotide sequence that encodes a domain of a heterologous protein. Preferably, the gram-negative bacterial strain of the present invention comprises a nucleotide sequence encoding one or two domains of a heterologous protein, more preferably two domains of a heterologous protein. In some embodiments, the gram-negative bacterial strain of the present invention comprises a nucleotide sequence encoding repeat domains of a heterologous protein or two or more domains of different heterologous proteins fused in frame to the 3' end of a nucleotide sequence encoding a signal. of delivery of a bacterial elector protein. The term heterologous proteins belonging to the same functional class of proteins as used in the present description refers to heterologous proteins that have the same function, for example, heterologous proteins that have enzymatic activity, heterologous proteins that act in the same pathway such such as, for example, cell cycle regulation, or they share a common specific characteristic, for example, they belong to the same class of bacterial effector proteins. Functional classes of proteins are for example proteins involved in apoptosis or the regulation of apoptosis, proteins that act as regulators of the cell cycle, proteins with ankyrin repeats, cell signaling proteins, proteins involved in the induction or regulation of a response of interferon (IFN), reporter proteins, transcription factors, proteases, small GTPases, GPCR-associated proteins, 33 nanobody and nanobody fusion constructs, effectors of the bacterial T3SS, electors of the bacterial T4SS or viral proteins that act together in the biological process of establishing virulence in eukaryotic cells. According to the present invention, a "heterologous protein domain" includes domains of naturally occurring proteins and further includes domains of artificially produced proteins. As used herein, the term "heterologous protein domain" refers to a domain of a heterologous protein other than a domain of a T3SS elector protein or a domain other than a domain comprising the N-terminal fragment. terminal of this to which it can be fused to achieve a fusion protein. In particular, the domain of a heterologous protein as used in the present description refers to a domain of a heterologous protein, which does not belong to the proteome, that is, the full complement of natural proteins of the specific recombinant gram-negative bacterial strain provided and used by the invention, for example, that does not belong to the proteome, that is, the complete complement of natural proteins of a specific bacterial strain of the genera Yersinia, Escherichia, Salmonella or Pseudomonas. Usually the domain of the heterologous protein is of animal origin that includes human origin. Preferably the domain of the heterologous protein is a domain of a human protein. More preferably the heterologous protein domain is a domain of a protein selected from the group consisting of proteins involved in apoptosis or the regulation of apoptosis, proteins involved in the induction or regulation of an interferon (IFN) response, regulators cell cycle, ankyrin repeat proteins, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR-associated proteins, nanobody and nanobody fusion constructs, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins. Preferably in particular the heterologous protein domain is a domain of a protein selected from the group consisting of proteins involved in apoptosis or the regulation of apoptosis, proteins involved in the induction or regulation of an interferon (IFN) response, regulators cycle, ankyrin repeat proteins, reporter proteins, small GTPases, GPCR-associated proteins, nanobody fusion constructs, bacterial T3SS effectors, bacterial T4SS effectors and viral proteins. Even more particularly preferred are heterologous protein domains selected from the group consisting of proteins involved in apoptosis or the regulation of apoptosis, proteins involved in the induction or regulation of an interferon (IFN) response, cell cycle regulators, and 34 ncnbnn / cznz / B / Yi proteins with ankyrin repeats. The most preferred are the domains of proteins involved in the induction or regulation of an interferon (IFN) response, such as proteins of animal origin involved in the induction or regulation of an interferon (IFN) response, preferably domains of human heterologous proteins. involved in the induction or regulation of an interferon (IFN) response, in particular domains of human heterologous proteins involved in the induction or regulation of a type 1 interferon (IFN) response. The domain of a heterologous protein expressed by the recombinant gram-negative bacterial strain usually has a molecular weight of between 1-50 kDa, preferably between 1-30 kDa, more preferably between 1-20 kDa, most preferably between 1-15 kDa. . According to the present invention proteins involved in the induction or regulation of an IFN'? response include, but are not limited to, cGAS. STING, TRIF, TBK1, IKKepsilon, IRF3, TREX1, VPS34, ATG9a, DDX3, LC3, DDX41, IF116, MRE11, DNA-PK, RIG1 (DDX58), MDA5, LGP2, IPS-l / MAVS / Cardif / VISA, Trim25 , Trim32, Trim56, Riplet, TRAF2, TRAF3, TRAF5, ΤΑΝΚ, IRF3, IRF7, IRF9, STAT1, STAT2, PKR, TLR3, TLR7, TLR9, DA1, IFI16, IFIX, MRE11, DDX41, LSml4A, LRRFIP1, DHX9, DHX36 , DHX29, DHX15, Ku70, IFNAR1, IFNAR2, TYK2, JAK1, ISGF3, IL10R2, IFNLR1, IFNGR1, IFNGR2, JAK2, STAT4, enzymes that generate cyclic dinucleotides (cyclic di-AMP, cyclic di-GMP, and di-GAMP cyclases cyclic) such as WspR, DncV, DisA and similar to DisA, CdaA, CdaS and cGAS or a fragment of these. Preferred proteins involved in the induction or regulation of an IFN response are selected from the group consisting of cGAS, STING, TRIF, TBK1, IKKepsilon, IRF3, TREX1, VPS34, ATG9a, DDX3, LC3, DDX41, IFI16, MRE11, DNA -PK, RIG1 (DDX58), MDA5, LGP2, IPS-l / MAVS / Cardif / VISA, Trim25, Trim32, Trim56, Riplet, TRAF2, TRAF3, TRAF5, ΤΑΝΚ, IRF3, IRF7, IRF9, STAT1, STAT2, PKR, TLR3, TLR7, TLR9, DAI, IFI16, IFIX, MRE11, DDX41, LSml4A, LRRFIP1, DHX9, DHX36, DHX29, DHX15, Ku70, IFNAR1, IFNAR2, TYK2, JAK1, ISGF3, IL10R2, IFNLR1, IFNGR1, IFNGR2, JAK2, STAT4, enzymes that generate cyclic dinucleotides (di-cyclic AMP, cyclic di-GMP and cyclic di-GAMP cyclases) such as WspR, DncV, DisA and similar to DisA, CdaA, CdaS and cGAS or a fragment of these. According to the present invention proteins involved in the induction or regulation of a Γ' type IFN response include, but are not limited to, cGAS, STING, TRIF, TBK1, IKKepsilon, IRF3, TREX1, VPS34, ATG9a, DDX3, LC3, DDX41, IFI16, MRE11, DNA-PK, RIG1, MDA5, LGP2, IPS-l / MAVS / Cardif / VISA, Trim25, Trim32, Trim56, Riplet, TRAF2, TRAF3, TRAF5, ΤΑΝΚ, IRF3, IRF7, IRF9, STAT1, STAT2, PKR, TLR3, TLR7, TLR9, DAI, IFI16, IFIX, MRE11, DDX41, LSml4A, LRRFIP1, DHX9, DHX36, DHX29, DHX15, Ku70, enzymes that generate cyclic dinucleotides (cyclic di-AMP, cyclic di-GMP and cyclic diGAMP cyclases) such as WspR, DncV, DisA and similar to DisA, CdaA, CdaS and cGAS or a fragment of these. Preferred proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of cGAS, STING, TRIF, TBK1, IKKepsilon, IRF3, TREX1, VPS34, ATG9a, DDX3, LC3, DDX41, IFI16, MRE11 , DNA-PK, RIG1, MDA5, LGP2, IPS1 / MAVS / Cardif / VISA, Trim25, Trim32, Trim56, Riplet, TRAF2, TRAF3, TRAF5, ΤΑΝΚ, IRF3, IRF7, IRF9, STAT1, STAT2, PKR, LSml4A, LRRFIP1 , DHX29, DHX15, and enzymes that generate cyclic dinucleotides such as di-cyclic AMP, cyclic di-GMP, and cyclic di-GAMP cyclases selected from the group consisting of WspR, DncV, DisA and DisA-like, CdaA, CdaS, and cGAS or a fragment of these. The most preferred proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of cGAS (as Uniprot. Q8N884 for the human protein), RIG1 (as Uniprot. 095786 for the human protein), MDA5 ( as Uniprot. Q9BYX4 for human protein), IPS-l / MAVS (as Uniprot. Q7Z434 for human protein), IRF3 (as Uniprot. Q14653 for human protein), IRF7 (as Uniprot. Q92985 for human protein), IRF9 (as Uniprot. Q00978 for the human protein) and enzymes that generate cyclic dinucleotides such as di-cyclic AMP, cyclic di-GMP and cyclic di-GAMP cyclases selected from the group consisting of WspR (as Uniprot. Q9HXT9 for the human protein of P. aeruginosa), DncV (as Uniprot. Q9KVG7 for the V. cholerae protein), DisA and DisA-like (as Uniprot. Q812L9 for the B. cereus protein), CdaA (as Uniprot. Q8Y5E4 for the L. monocytogenes), CdaS (as Uniprot. 031854 or constitutive active L44F mutation for B. subtilis protein) and cGAS (as Uniprot. Q8N884 for human protein) or a fragment of these proteins. IPS-l / MAVS / Cardif / VISA refer to the eukaryotic mitochondrial antiviral signaling protein containing an N-terminal CARD domain and with the Uniprot (www.uniprot.org) identifier for the human sequence “Q7Z434 and “Q8VCF0” for the murine sequence. The terms "IPS-l / MAVS", "MAVS / IPS-1" and "MAVS" are used interchangeably in the present description and refer to the eukaryotic mitochondrial antiviral signaling protein that contains an N-terminal CARD domain and with the Uniprot identifier (www.uniprot.org) for the human sequence Q7Z434 and “Q8VCF0” for the murine sequence. ncnbnn / cznz / B / Yi In some embodiments, heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of proteins containing a CARD domain or a fragment thereof and enzymes that generate cyclic dinucleotides such as di-cyclases. Cyclic AMP, cyclic di-GMP and cyclic di-GAMP or a fragment of these. Heterologous CARD domain-containing proteins involved in the induction or regulation of a type I IFN response are, for example, RIG1, which typically contains two CARD domains, MDA5, which typically contains two CARD domains, and MAVS, which typically contains one CARD domain. . A fragment of a heterologous protein involved in the induction or regulation of an IFN response or a type I IFN response usually contains between 25 and 1000 amino acids, preferably between 50 and 600 amino acids, more preferably between 100 and 500 amino acids, even with greatest preference between 100 and 362 amino acids. In some embodiments, a fragment of a heterologous protein involved in the induction or regulation of an IFN response or a type I IFN response comprises a fragment of the heterologous protein involved in the induction or regulation of an IFN response or a type I IFN response. Type I IFN usually containing between 25 and 1000 amino acids, preferably between 50 and 600 amino acids, more preferably between 100 and 500 amino acids, even more preferably between 100 and 362 amino acids, in particular between 100 and 246 amino acids or, comprising a fragment of the heterologous protein involved in the induction or regulation of an IFN response or a type I IFN response that has a deletion of an amino acid sequence containing between amino acid 1 and amino acid 160 of the N-terminal amino acids, preferably a deletion of an amino acid sequence containing N-terminal amino acids 1-59 or N-terminal amino acids 1-160, and wherein the fragment of the heterologous protein involved in the induction or regulation of an IFN response or a Type I IFN usually contains between 25 and 1000 amino acids, preferably between 50 and 600 amino acids, more preferably between 100 and 500 amino acids, even more preferably between 100 and 362 amino acids. A fragment of a heterologous protein containing CARD domains involved in the induction or regulation of an IFN response or a type I IFN response usually contains an amino acid sequence from N-terminal amino acid 1 to any of amino acids 100-500, preferably an amino acid sequence from N-terminal amino acid 1 to any of amino acids 100-400, more preferably an amino acid sequence from N-terminal amino acid 1 to any of amino acids 100-300, more preferably an amino acid sequence from the N-terminal amino acid 1 to 37 nojbnn / cznz / B / Yi any of amino acids 100-294, more preferably an amino acid sequence from the N-terminal amino acid 1 to any of amino acids 100-246.In some embodiments, a fragment of a heterologous protein containing a CARD domain involved in the induction or regulation of an IFN response or a type I IFN response contains an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least N-terminal amino acid 1 and no more than amino acid 294, an amino acid sequence comprising at least N-terminal amino acid 1 and no more than amino acid 246, an amino acid sequence comprising at least N-terminal amino acid 1 and no more than amino acid 245, an amino acid sequence comprising at least N-terminal amino acid 1 and no more than amino acid 231, an amino acid sequence comprising at least N-terminal amino acid 1 and no more than amino acid 229, a amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 228, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 218, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 217, an amino acid sequence comprising at least N-terminal amino acid 1 and no more than amino acid 100 and an amino acid sequence comprising at least N-terminal amino acid 1 and no more of amino acid 101, more particularly an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 245, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 228, an amino acid sequence comprising at least N-terminal amino acid 1 and no more than amino acid 217, and an amino acid sequence comprising at least N-terminal amino acid 1 and no more than amino acid 100, most particularly an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 245, of a heterologous protein containing a CARD domain, preferably, of a human heterologous protein containing a CARD domain. In some preferred embodiments, the heterologous protein is a fragment of a heterologous protein containing a CARD domain involved in the induction or regulation of an IFN response or a type I IFN response or comprises a fragment of a heterologous protein containing a CARD domain. CARD involved in the induction or regulation of an IFN response or a type I IFN response. Usually, the fragment of a heterologous protein containing a CARD domain involved in the induction or regulation of an IFN response or an IFN response 38 ncnbnn / cznz / B / Yi type I comprises at least one CARD domain. In those embodiments, the heterologous protein contains or consists in particular of an amino acid sequence selected from the group consisting of an amino acid sequence from N-terminal amino acid 1 to amino acid 294, an amino acid sequence from N-terminal amino acid 1 to amino acid 246, an amino acid sequence from N-terminal amino acid 1 to amino acid 245, an amino acid sequence from N-terminal amino acid 1 to amino acid 231, an amino acid sequence from N-terminal amino acid 1 to amino acid 229, a sequence of amino acids from N-terminal amino acid 1 to amino acid 228, a sequence of amino acids from N-terminal amino acid 1 to amino acid 218, a sequence of amino acids from N-terminal amino acid 1 to amino acid 217, a sequence of amino acids from amino acid N-terminal 1 to amino acid 100, an amino acid sequence from N-terminal amino acid 1 to amino acid 101, more particularly an amino acid sequence selected from the group consisting of an amino acid sequence from N-terminal amino acid 1 to amino acid 245, an amino acid sequence from N-terminal amino acid 1 to amino acid 228, an amino acid sequence from N-terminal amino acid 1 to amino acid 217 and an amino acid sequence from N-terminal amino acid 1 to amino acid 100 of a heterologous protein involved in the induction or regulation of an IFN response or a type I IFN response containing a CARD domain.In those embodiments, the heterologous protein more particularly contains or consists of an amino acid sequence selected from the group consisting of an amino acid sequence from N-terminal amino acid 1 to amino acid 246, an amino acid sequence from N-terminal amino acid 1 to amino acid 245, an amino acid sequence from N-terminal amino acid 1 to amino acid 229, an amino acid sequence from N-terminal amino acid 1 to amino acid 228, an amino acid sequence from N-terminal amino acid 1 to amino acid 218, and a amino acid sequence from the N-terminal amino acid 1 to amino acid 217, in particular an amino acid sequence from the N-terminal amino acid 1 to amino acid 245, an amino acid sequence from the N-terminal amino acid 1 to acidic amino acid 228, a sequence of amino acids from N-terminal amino acid 1 to amino acid 217, more particularly an amino acid sequence from N-terminal amino acid 1 to amino acid 245, of RIG-1, or an amino acid sequence selected from the group consisting of an amino acid sequence from the N-terminal amino acid 1 to amino acid 100, and an amino acid sequence from the N-terminal amino acid 1 to amino acid 101 of MAVS, or an amino acid sequence selected from the group consisting of an amino acid sequence 39 ncnbnn / cznz / B / Yi from the N-terminal amino acid 1 to amino acid 294 and an amino acid sequence from the N-terminal amino acid 1 to amino acid 231 of MDA5, even more particularly an amino acid sequence selected from the group consisting of an amino acid sequence from amino acid N -terminal 1 to amino acid 245, an amino acid sequence from N-terminal amino acid 1 to amino acid 228 and an amino acid sequence from N-terminal amino acid 1 to acidic amino acid 217 of RIG-1, or an amino acid sequence from amino acid Nterminal 1 to amino acid 100, of MAVS, or an amino acid sequence selected from the group consisting of an amino acid sequence from N-terminal amino acid 1 to amino acid 294 and an amino acid sequence from N-terminal amino acid 1 to amino acid 231 of MDA5. Most preferred are the amino acid sequence from N-terminal amino acid 1 to amino acid 245 of human RIG-1 and the amino acid sequence from N-terminal amino acid 1 to amino acid 246 of murine RIG-1. Human RIG-1 fragment 1 -245 and murine RIG-1 fragment 1 -246 correspond to each other by 73% sequence identity (and 85% sequence similarity) and are functionally equivalent, i.e. , both fragments show equivalent activity in murine cells and in human cells. In some preferred embodiments, the heterologous protein is a fragment of cyclic dinucleotide-generating enzymes such as di-cyclic AMP cyclases, cyclic di-GMP, and cyclic di-GAMP. A fragment of cyclic dinucleotide-generating enzymes such as di-cyclic AMP cyclases, cyclic di-GMP and cyclic di-GAMP usually contains an amino acid sequence from the N-terminal amino acid 1 to any of amino acids 100-600, preferably a amino acid sequence from amino acid 50 to any of amino acids 100-550, more preferably an amino acid sequence from amino acid 60 to any of amino acids 100-530, in particular an amino acid sequence from amino acid 60 to amino acid 530, more particularly an amino acid sequence from amino acid 146 to amino acid 507 or an amino acid sequence from amino acid 161 to amino acid 522, most particularly an amino acid sequence from amino acid 161 to amino acid 522 of the cyclic dinucleotide-generating enzymes, preferably human cGAS. In some embodiments a cGAS fragment contains in particular an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least amino acid 60 and no more than amino acid 422, an amino acid sequence comprising at least amino acid 146 and no more than amino acid 507, and an amino acid sequence comprising at least amino acid 161 and no more than amino acid 522. In some embodiments, a cGAS fragment more particularly contains an amino acid sequence selected from the group consisting of an amino acid sequence from amino acid 60 to amino acid 422, an amino acid sequence from amino acid 146 to amino acid 507 and an amino acid sequence from amino acid 161 to amino acid 522, most preferably an amino acid sequence from amino acid 161 to amino acid 522. In one In a more preferred embodiment, the heterologous protein involved in the induction or regulation of a type I IFN response is selected from the group consisting of RIG1, MDA5 and MAVS comprising a CARD domain or a fragment thereof, wherein the fragment comprises at least a CARD domain, and cGAS and a fragment thereof, in particular selected from the group consisting of RIG1 comprising a CARD domain and a fragment thereof, wherein the fragment comprises at least one CARD domain, a MAVS comprising a CARD domain and a fragment thereof, wherein the fragment comprises at least one CARD domain, and cGAS and a fragment thereof. Fragments of these proteins, as described above, are particularly preferred. In this most preferred embodiment, the RIG1, MDA5, MAVS comprising the CARD domain comprises the naturally occurring CARD domain(s) and additionally optionally the C-terminal amino acids following the domain(s). ) naturally occurring CARDs, for example, comprising the naturally occurring helicase domain in the case of RIG-1 or a fragment thereof, preferably a fragment containing 1-500, more preferably 1250, even more preferably 1- 150 amino acids wherein the naturally occurring helicase domain or fragment thereof is not functional, that is, it does not bind to a CARD domain or, optionally comprises the downstream C-terminal sequence in the case of MAVS or a fragment thereof , preferably a fragment containing 1-500, more preferably 1-250, even more preferably 1-150 amino acids. In these embodiments, cGAS and a fragment thereof usually comprise the naturally occurring synthase domain (NTase core and C-terminal domain; amino acids 160-522 of human cGAS as described in 6?l and as Uniprot.Q8N884 for the human protein), preferably cGAS and a fragment of this comprises the naturally occurring synthase domain, but has a deletion of part or the entire N-terminal domain, preferably a deletion of the entire N-terminal helix extension ( N-terminal helix extension; amino acids 1-160 of human cGAS as described in 63 and as Uniprot for the human protein). The deletion of a part or the entire N-terminal domain is preferably a deletion of amino acids 1-59. In a preferred embodiment, the heterologous ncnbnn / cznz / B / Yi proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of the RIG-I-like receptor (RLR) family (such as RIG1 and MDA5) and / or a fragment of these, other CARD domain-containing proteins involved in antiviral signaling and type I IFN induction (such as MAVS) and / or a fragment of these and enzymes that generate cyclic dinucleotides such as cyclases of cyclic di-AMP, cyclic di-GMP and cyclic di-GAMP selected from the group consisting of WspR, DncV, DisA and DisA-like, CdaA, CdaS and cGAS, and / or a fragment thereof, leading to stimulation by STING. The term "other CARD domain-containing proteins involved in antiviral signaling and type I IFN induction and a fragment thereof" includes MAVS, CRADD / RAIDD, RIPK2 / RIP2, CARD6, NOD1 and N0D2, or a fragment thereof. Therefore, in another preferred embodiment the heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of the RIG-I-like receptor (RLR) family (such as RIG1 and MDA5) or a fragment of these, other CARD domain-containing proteins involved in antiviral signaling and type I IFN induction selected from the group consisting of MAVS, CRADD / RAIDD, RIPK2 / RIP2, CARDÓ, NOD1 and NOD2 or a fragment of these , and enzymes that generate cyclic dinucleotides such as di-cyclic AMP, cyclic di-GMP and cyclic di-GAMP cyclases selected from the group consisting of WspR, DncV, DisA and DisA-like, CdaA, CdaS and cGAS, and a fragment of these, which lead to the stimulation of STING. In some embodiments, heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of RIG1, MDA5, LGP2, MAVS, WspR, DncV, DisA and DisA-like, CdaA, CdaS and cGAS. or a fragment thereof, most preferably selected from the group consisting of RIG1, MAVS, MDA5, WspR, DncV, DisA-like and cGAS or a fragment thereof, most preferably selected from the group consisting of RIG1 or a fragment of this and cGAS or a fragment of it. In a more preferred embodiment, the protein involved in the induction or regulation of a type I IFN response is selected from the group consisting of RIG1, MDA5, MAVS, WspR, DncV, DisA and DisA-like, CdaA and cGAS or a fragment of these, even more preferably selected from the group consisting of RIG1, MDA5, MAVS, WspR, DncV, similar to DisA, CdaA and cGAS or a fragment thereof, in particular selected from the group consisting of RIG1, MDA5, MAVS and cGAS or a fragment of these. Fragments of these proteins, as described above, are particularly preferred. In this most preferred embodiment, a fragment of RIG1, MDA5, MAVS usually contains an amino acid sequence from the N-terminal amino acid 1 to any of amino acids 100-500, preferably an amino acid sequence from the N-terminal amino acid 1 to any of amino acids 100-400, more preferably an amino acid sequence from N-terminal amino acid 1 to any of amino acids 100-300. In this most preferred embodiment, a RIG1 fragment contains an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 246, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 245, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 229, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 228, an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 218, and an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 217, in particular a sequence of amino acids comprising at least N-terminal amino acid 1 and no more than amino acid 245; an MDA5 fragment contains an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 294, an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than the 231st amino acid, and a MAVS fragment contains an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least the N-terminal amino acid 1 and no more of amino acid 100 and an amino acid sequence comprising at least the N-terminal amino acid 1 and no more than amino acid 101.In this most preferred embodiment, a RIG1 fragment more particularly contains an amino acid sequence selected from the group consisting of an amino acid sequence from N-terminal amino acid 1 to amino acid 246, an amino acid sequence from N-terminal amino acid 1 to amino acid 245, an amino acid sequence from N-terminal amino acid 1 to amino acid 229, an amino acid sequence from N-terminal amino acid 1 to amino acid 228, an amino acid sequence from N-terminal amino acid 1 to amino acid 218, and a amino acid sequence from the N-terminal amino acid 1 to amino acid 217, even more particularly an amino acid sequence from the N-terminal amino acid 1 to amino acid 245, an amino acid sequence from the N-terminal amino acid 1 to amino acid 228, a sequence of amino acids from N-terminal amino acid 1 to amino acid 217, more particularly a sequence of 43 amino acids from N-terminal amino acid 1 to amino acid 245; an MDA5 fragment more particularly contains an amino acid sequence selected from the group consisting of an amino acid sequence from N-terminal amino acid 1 to amino acid 294 and an amino acid sequence from N-terminal amino acid 1 to amino acid 231; and a MAVS fragment more particularly contains an amino acid sequence selected from the group consisting of the amino acid sequence from the N-terminal amino acid 1 to amino acid 100 and an amino acid sequence from the N-terminal amino acid 1 to amino acid 101. In this More preferred embodiment a cGAS fragment usually contains an amino acid sequence from N-terminal amino acid 1 to any of amino acids 100-600, preferably an amino acid sequence from amino acid 50 to any of amino acids 100-550, more preferably an amino acid sequence from amino acid 60 to any of amino acids 100-530, in particular an amino acid sequence from amino acid 60 to amino acid 530, an amino acid sequence from amino acid 146 to amino acid 507 or an amino acid sequence from amino acid 161 to amino acid 530, more particularly an amino acid sequence from amino acid 60 to amino acid 530, or an amino acid sequence from amino acid 161 to amino acid 530 of human cGAS. In this most preferred embodiment, a cGAS fragment contains in particular an amino acid sequence selected from the group consisting of an amino acid sequence comprising at least amino acid 60 and no more than amino acid 422, an amino acid sequence comprising at least amino acid 146 and no more than amino acid 507, and an amino acid sequence comprising at least amino acid 161 and no more than amino acid 522. In this most preferred embodiment, a cGAS fragment more particularly contains an amino acid sequence selected from the group consisting in an amino acid sequence from amino acid 60 to amino acid 422, an amino acid sequence from amino acid 146 to amino acid 507, an amino acid sequence of acids from amino acid 161 to amino acid 522, more particularly an amino acid sequence from amino acid 161 to amino acid 522. In an even more preferred embodiment, the protein involved in the induction or regulation of a type I IFN response is selected from the group consisting of CARD domains of human RIG1-245 (SEQ ID NO: 1), CARD domains of RIG1 humanoi-228 (SEQ ID NO: 2), CARD domains of RIG1 humanoi-217 (SEQ ID NO: 3), CARD domains of RIG1 murinai-246 (SEQ ID NO: 4), CARD domains of RIG1 murinai-229 ( SEQ ID NO: 5), CARD domains of RIG1 murinai.218 (SEQ ID NO: 6), CARD domain of human MAVS-kmi (SEQ ID NO: 7), CARD domain of. MAVS murinai-ioi (SEQ ID NO: 8), cGAS from N. vectensis (SEQ ID NO: 9), cGAS humani6i-522 (SEQ ID NO: 10), cGAS murinai46-507 (SEQ ID NO: 11), cGAS of N. vectensis 60-422 (SEQ ID NO: 12), MDA5 murinai-294 (SEQ ID NO: 13), MDA5 murinai-231 (SEQ ID NO: 14), MDA5 humanoi294 (SEQ ID NO: 15), and MDA5 humanoi-231 (SEQ ID NO: 16). In a particular preferred embodiment, the protein involved in the induction or regulation of a type I IFN response is selected from the group consisting of CARD domains of human RIG1-245, (SEQ ID NO: 1), CARD domains of human RIG1-245, (SEQ ID NO: 1), CARD domains of human RIG1- 228 (SEQ ID NO: 2), CARD domains of human RIG1-217 (SEQ ID NO: 3), CARD domain of human MAVS-100 (SEQ ID NO: 7), and human cGAS 522 (SEQ ID NO: 10) . In a more particularly preferred embodiment, the protein involved in the induction or regulation of a type I IFN response is selected from the group consisting of CARD domains of human RIG1 i-245 (SEQ ID NO: 1), CARD domains of murine RIG1 246 (SEQ ID NO: 4), CARD domains of RIG1 murinai-229 (SEQ ID NO: 5), CARD domains of RIG1 murinai-2i8 (SEQ ID NO: 6), and human cGASi6i-522 (SEQ ID NO: 10 ), more particularly selected from the group consisting of CARD domains of RIG1 humanoi.245 (SEQ ID NO: 1) and cGAS humanoiñi-522 (SEQ ID NO: 10). The RIG-I-like receptor (RLR) family comprises proteins selected from the group consisting of RIG1, MDA5, and LGP2. Preferred heterologous proteins involved in the induction or regulation of a type I IFN response are the CARD domain-containing proteins RIG1 and MDA5, particularly the CARD domain-containing protein RIG1. Other preferred CARD domain-containing proteins involved in type I IFN induction comprise proteins selected from the group consisting of MAVS. In some preferred embodiments, heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group of proteins comprising a CARD domain of RIG1, a CARD domain of MDA5 and / or a CARD domain of MAVS and WspR. , DncV, DisA and similar to DisA, CdaA, CdaS and cGAS and a fragment of these, preferably selected from the group of proteins comprising a CARD domain of RIG1, a CARD domain of MDA5 and / or a CARD domain of MAVS, and WspR , DncV, DisA and similar to DisA, CdaA and cGAS or a fragment of these. In some preferred embodiments, heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of a CARD domain of RIG1, a CARD domain of MDA5, a CARD domain of MAVS, WspR, DncV, DisA and similar to DisA, CdaA, CdaS and cGAS, most preferably selected from the group consisting of a CARD domain of RIG1, WspR, DncV, similar to DisA and cGAS. In some preferred embodiments, heterologous proteins involved in the induction or regulation of a type I IFN response comprise one or more (e.g. two, three or four) CARD domains, preferably comprising one or more ( for example two, three or four) CARD domains of RIG1, MDA5, and / or MAVS, preferably of RIG1 and / or MAVS. In a more preferred embodiment, heterologous proteins involved in the induction or regulation of a type I IFN response comprise both CARD domains of RIG1. both CARD domains of MDA5 and / or the CARD domain of MAVS and cGAS or a fragment thereof, in particular both CARD domains of RIG1 and cGAS or a fragment thereof, more particularly both CARD domains of RIGE In some embodiments, heterologous proteins involved in the induction or regulation of a type I IFN response are selected from the group consisting of a type I IFN response-inducing protein without enzymatic function and a type I IFN response-inducing protein with enzymatic function. A type I IFN response-inducing protein without enzymatic function encompassed in the present invention usually comprises at least one CARD domain, preferably two CARD domains. A CARD domain is typically composed of a cluster of six to seven alpha-helices, preferably an arrangement of six to seven antiparallel alpha helices with a hydrophobic core and an outer face composed of charged residues. A type I IFN response-inducing protein with enzymatic function encompassed in the present invention usually comprises an enzyme that generates cyclic dinucleotides (di-cyclic AMP, cyclic di-GMP and cyclic di-GAMP cyclases) or a domain thereof that drives to the stimulation of STING, preferably a diadenylate cyclase (DAC), diguanylate cyclase (DGC) or GMP-AMP cyclase (GAC) or domain thereof. According to the present invention "proteins involved in apoptosis or regulation of apoptosis" include, but are not limited to, Bad, Bcl2, Bak, Bmt, Bax, Puma, Noxa, Bim, Bcl-xL, Apafl, Caspase 9, Caspase 3, Caspase 6, Caspase 7, Caspase 10, DFFA, DFFB, ROCK1, APP, CAD, ICAD, CAD, EndoG, AIF, HtrA2, Smac / Diablo, Arts, ATM, ATR, Bok / Mtd, Bmf , Mcl1(S), IAP family, LC8, PP2B, 14-3-3 proteins, PKA, PKC, PI3K, Erkl / 2, p90RSK, TRAF2, TRADD, FADD, Daxx, Caspase8, Caspase2, RIP, RAIDD, MKK7, JNK, FLIP, FKHR, GSK3, CDKs and their inhibitors such as the INK4 family (pl6(Ink4a), pl5(Ink4b), pl8(Ink4c), pl9(Ink4d)), and the Cipl / Wafl / Kipl-2 family ( p21 (Cip 1 / Waf 1), p27(Kipl), p57(Kip2) Bad, Bmt, Bcl2, Bak, Bax, Puma, Noxa, Bim, Bcl-xL, Caspasa9, Caspasa3, Caspasaó, Caspasa7, are preferably used. Smac / Diablo, Bok / Mtd, Bmf, Mcl-l(S), LC8, PP2B, TRADD, Daxx, Caspase8, Caspase2, RIP, RAIDD, FKHR, CDKs and their inhibitors such as the INK4 family (pl6(Ink4a), pl5(Ink4b), pl8(Ink4c), pl9(Ink4d)), with the highest preference BIM, Bid, truncated Bid, FADD, Caspase 3 (and its subunits), Bax, Bad, Akt, CDKs and their inhibitors such as the INK4 family (pl6(lnk4a), pl5(Ink4b), pl8(Ink4c), pl9(Ink4d))l113. Other proteins involved in apoptosis or regulation of apoptosis include DIVA, Bcl-Xs, Nbk / Bik, Hrk / Dp5, Bid and tBid, Egl-1, Bcl-Gs, Cytochrome C, Beclin, CED-13, BNIP1, BNIP3, Bcl-B, Bcl-W, Ced-9, Al, NR13, Bfl-1, Caspase 1, Caspase 2, Caspase 4, Caspase 5, Caspase 8. Proteins involved in apoptosis or regulation of apoptosis are selected from the group consisting of pro-apoptotic proteins, anti-apoptotic proteins, inhibitors of apoptosis prevention pathways, and inhibitors of pro-survival signaling or pathways. Proapoptotic proteins comprise proteins selected from the group consisting of Bax, Bak, Diva, BclXs, Nbk / Bik, Hrk / Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Apafl, Smac / Diablo, BNIP1 , BNIP3, Bcl-Gs, Beclin 1, Egl-1 and CED-13, Cytochrome C, FADD, the caspase family, and CDKs and their inhibitors such as the INK4 family (pl6(Ink4a), pl5(Ink4b), pl8(Ink4c), pl9(Ink4d)) or selected from the group consisting of Bax, Bak, Diva, Bcl-Xs, Nbk / Bik, Hrk / Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok , Egl-1, Apafl, Smac / Diablo, BNIP1, BNIP3, BclGs, Beclina 1, Egl-1 and CED-13, Cytochrome C, FADD, and the caspase family. Bax, Bak, Diva, Bcl-Xs, Nbk / Bik, Hrk / Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Egl-1, Apafl, BNIP1, BNIP3, Bcl-Gs, are preferred. Beclin 1, Egl-1 and CED-13, Smac / Diablo, FADD, the caspase family, CDKs and their inhibitors such as the INK4 family (pl6(Ink4a), pl5(Ink4b), pl8(Ink4c), p! 9(Ink4d)). Bax, Bak, Diva, Bcl-Xs, Nbk / Bik, Hrk / Dp5, Bmf, Noxa, Puma, Bim, Bad, Bid and tBid, Bok, Apafl, BNIP1, BNIP3, Bcl-Gs, Beclina 1, Egl-1 and CED-13, Smac / Diablo, FADD, the caspase family. Antiapoptotic proteins comprise proteins selected from the group consisting of Bcl-2, Bcl-Xl, Bcl-B, Bcl-W, Mcl-1, Ced-9, Al, NR13, the IAP family and Bfl-1. Bcl-2, BclXI, Bcl-B, Bcl-W, Mcl-1, Ced-9, Al, NR13 and Bfl-1 are preferred. Inhibitors of apoptosis prevention pathways comprise proteins selected from the group consisting of Bad, Noxa and Cdc25A. Bad and Noxa are preferred. Inhibitors of pro-survival signaling or pathways comprise proteins selected from the group consisting of PTEN, ROCK, PP2A, PHLPP, JNK, p38. PTEN, ROCK, PP2A and PHLPP are preferred. In some embodiments, heterologous proteins involved in apoptosis or regulation of apoptosis are selected from the group consisting of BH3-only proteins, caspases, and death receptor apoptosis control intracellular signaling proteins or a fragment thereof. BH3-only proteins or a fragment thereof are preferred. BH3-only proteins comprise proteins selected from the group consisting of Bad, BIM, Bid and tBid, Puma, Bik / Nbk, Bod, Hrk / Dp5, BNIP1, BNIP3, Bmf, Noxa, Mcl-1, Bcl-Gs, Beclina 1 , Egl-1 and CED-13. Bad, BIM, Bid and tBid are preferred, in particular tBid. Caspases comprise proteins selected from the group consisting of Caspase 1, Caspase 2, Caspase 3, Caspase 4, Caspase 5, Caspase 6, Caspase 7, Caspase 8, Caspase 9, Caspase 10. Caspase 3, Caspase 8 and Caspase are preferred. 9. Intracellular signaling proteins controlling death receptor apoptosis comprise proteins selected from the group consisting of FADD, TRADD, ASC, BAP31, GULP1 / CED-6, CIDEA, MFG-E8, CIDEC, RIPK1 / RIP1, CRADD , RIPK3 / RIP3, Crk, SHB, CrkL, DAXX, 14-3-3 family, FLIP, DFF40 and 45, PEA-15, SODD. FADD and TRADD are preferred. In some embodiments, two heterologous proteins involved in apoptosis or the regulation of apoptosis are comprised in the gram-negative bacterial strain, wherein one protein is a proapoptotic protein and the other protein is an inhibitor of apoptosis prevention pathways or in where one protein is a pro-apoptotic protein and the other protein is an inhibitor of pro-survival signaling or pathways. The proapoptotic proteins encompassed in the present invention usually have an alpha helical structure, preferably a hydrophobic helix surrounded by amphipathic helices and usually comprise at least one of the BH1, BH2, BH3 or BH4 domains, preferably they comprise at least one BH3 domain. Usually the proapoptotic proteins encompassed in the present invention do not have enzymatic activity. The antiapoptotic proteins encompassed in the present invention usually have an alpha helical structure, preferably a hydrophobic helix surrounded by amphipathic helices and comprise a combination of different BH1, BH2, BH3 and BH4 domains, preferably a combination of BH1, BH2, BH3 and Different BH4s where a BH1 and a BH2 domain are present, most preferably BH4-BH3-BH1-BH2, BH1-BH2, BH4-BH1-BH2 or BH3BH1-BH2 (from the N- to the C-terminus). Additionally, proteins containing at least one BIR domain are also covered. Inhibitors of apoptosis prevention pathways encompassed in the present invention usually have an alpha helical structure, preferably a hydrophobic helix surrounded by amphipathic helices and usually comprise a BH3 domain. The BH1, BH2, BH3 or BH4 domains are each usually between about 5 to about 50 amino acids in length. Therefore, in some embodiments the heterologous proteins involved in apoptosis or the regulation of apoptosis are selected from the group consisting of heterologous proteins involved in apoptosis or the regulation of apoptosis having about 5 to about 200, preferably about 5 to about 150, more preferably about 5 to about 100, most preferably about 5 to about 50, in particular about 5 to about 25 amino acids in length. A particularly preferred heterologous protein is the BH3 domain of the apoptosis inducer tBID, more particularly the BH3 domain comprising a sequence selected from the group consisting of SEQ ID NO: 17-20, preferably SEQ ID NO: 17 or SEQ ID NO: 18. Equally preferred is the BH3 domain of the apoptosis regulator BAX, more particularly the BAX domain comprising a sequence selected from the group consisting of SEQ ID NO: 21-24, preferably SEQ ID NO: 21 or SEQ ID NO: 22. The human and murine sequences are provided in SEQ ID NO, but the BH3 domains of tBID and BAX from the rest of the species are also included. According to the present invention, "cell cycle regulators include, but are not limited to, cyclins (such as cyclin A, cyclin B, cyclin DI, cyclin D2, cyclin D3, cyclin E, cyclin H), cell-dependent kinases. cyclin (CDK, such as CDK1, CDK2, CDK4, CDK6) and CDK-activating kinases (such as CDK7), Cdk inhibitors (such as the INK4 family including INK4A, INK4B, INK4C, INNK4D and the Cip / Kip family including p21 ( Wafl, Cipl), p27 (Cip2), p57 (Kip2)), CDK substrates (such as retinoblastoma tumor suppressor gene product, NPAT, HistoneHI, pl07, pl 30) and anaphase / cyclosome promoter complex and proteins cell cycle checkpoint proteins (such as Madl, Mad2, BubRl, BUB1, p53, Mdm2, Cdc25, 14-3-3 proteins, Cdc20). Preferred cell cycle regulators are selected from the group consisting of cyclins, cyclin-dependent kinases (CDKs), CDK-activating kinases, Cdk inhibitors, CDK substrates, anaphase-promoting / cyclosome complex, and cycle checkpoint proteins. cell phone. The most preferred cell cycle regulators are selected from the group consisting of cyclin A, cyclin B, cyclin DI, cyclin D2, cyclin D3, cyclin E, cyclin H, CDK1, CDK2, CDK4, CDK7, INK4A, INK4B, INK4C, INNK4D , Wafl (Cipl / p21), p27 (Cip2), p57 (Kip2), NPAT, HistoneHl, pl07, pl30, Madl, Mad2, BubRl, BUB1, p53, Mdm2, Cdc25, 14-3-3 and Cdc20 proteins. According to the present invention, “cell signaling proteins” include, but are not limited to, ncnbnn / cznz / B / Yi. I. cytokine signaling (such as cytokines and interleukin receptors such as IL-2 receptor; adapter proteins and kinases such as the JAK family; regulatory factors such as SOCS; transcription factors such as IRF3 or IRF9 or the STAT family; and kinase targets / downstream like AKT, GRB2), II. survival factor signaling / death signaling / growth factor or hormone signaling (such as kinases such as MAPKinases such as MEK, ERK, other kinases such as Akt or PI3K or SRC or ATM, and kinase complexes such as ComplejomTORl; transcription factors such as Elkl or c-Myc; GTPases such as Ras; growth factor receptors that are usually tyrosine kinase receptors such as EGFR; III. chemokine signaling (such as chemokine receptors which are usually 7-transmembrane protein / G protein-coupled receptors such as CXCR2; G protein complexes such as the Gi complex composed of Galfai, Gbeta and Ggamma, kinases; adapter proteins and transducers / signal regulators such as phospholipase C, protein kinase C, JAK family, PI3K, RhoGTPases such as CDC42 or RhoA, MAPK such as JNK, ComplexomTORl; transcription factors such as STAT family or NFkB) and IV. extracellular matrix / Wnt / Hedgehog signaling (such as WNT ligands such as Wntl or Wnt3a; WNT ligand receptors such as Frizzled; LRP coreceptors such as LRP6; beta-catenin, LGR5, Axin. APC, kinases such as GSK3beta, CKlalpha, FAK and casein ; cadherins; ubiquitin ligases such as beta-TrCP, repressive nuclear complex composed of TLE, HDAC histone deacetylases, enhancers such as TCF and LEF, coactivators such as p300; Preferred cell signaling proteins are selected from the group consisting of cytokine signaling proteins, survival factor signaling proteins, death signaling proteins, growth factor signaling proteins, hormone signaling proteins, signaling proteins of chemokines and extracellular matrix / Wnt / Hedgehog signaling proteins. The most preferred cell signaling proteins are selected from the group consisting of cytokine receptors such as GM-CSF receptor, interferon alpha / beta receptor, interferon gamma receptor, CD40 or CD120, or their adapter proteins; interleukin receptors such as IL-2 receptor, IL-7 receptor, IL-12 receptor, ncnbnn / cznz / B / Yi receptor IL-21 or IL-18 receptor, or its adapter proteins; kinases such as the JAK family, MAPKinases, PI3K, Akt and kinase complexes such as ComplejomTOR; transcription factors such as IRF3 or 1RF9, the STAT family or NFkB; RhoGTPases such as CDC42, RhoA or Racl. Even more preferred cell signaling proteins are selected from the group consisting of GM-CSF receptor, interferon alpha / beta receptor, interferon gamma receptor, CD40, CD120 or their adapter proteins; IL-2 receptor, IL-7 receptor, IL-12 receptor, IL-21 receptor, IL-18 receptor or their adapter proteins; the JAK family, MAPKinases, PI3K, Akt, ComplejomTOR, IRF3, IRF9, the STAT family, NFkB, CDC42, RhoA and Racl. According to the present invention, 'reporter proteins' include, but are not limited to, fluorescent proteins (such as GFP), luciferases or enzymatic reporter proteins (such as alkaline phosphatase). Preferred reporter proteins are enzymatic reporter proteins. According to the present invention, "GPCR-related proteins" include, but are not limited to, G protein-coupled receptors (such as CXCR2), G protein complexes (composed of Galpha, Gbeta and Ggamma), kinases (such as PKA), adapter proteins and signal transducers / regulators (such as phospholipases, adenylate cyclases, phosphodiesterases), kinases (such as protein kinase C PKC or PKA), transcription factors (such as CREB). Preferred GPCR-related proteins are selected from the group consisting of G protein-coupled receptors, G protein complexes, kinases, adapter proteins, signal transducers / regulators and transcription factors. The most preferred GPCR-related proteins are selected from the group consisting of CXCR2, G protein complexes composed of Galpha, Gbeta and Ggamma, PKA, phospholipases, adenylate cyclases, phosphodiesterases), protein kinase C PKC and CREB. According to the present invention, "nanobody fusion proteins" include, but are not limited to, nanobodies fused to protein degradation domains (such as the N-terminal F-box domain of the drosophila Slmb protein or ubiquitin). ligases; thus, nanobodies fused to cell signaling proteins or parts thereof), nanobodies fused to identical or other nanobodies (bispecific or multispecific nanobodies), nanobodies fused to reporter proteins, nanobodies fused to subcellular localization signals (such as a signal). nuclear localization (NLS). Preferred nanobody fusion proteins are selected from the group consisting of nanobodies fused to protein degradation domains, nanobodies fused to cell signaling proteins or parts thereof, nanobodies fused to identical or other nanobodies, ncnbnn / cznz / B / nanobodies. Yi fused to reporter proteins and nanobodies fused to subcellular localization signals. The most preferred nanobody fusion proteins are selected from the group consisting of nanobodies fused to the N-terminal F-box domain of the drosophila Slmb protein, nanobodies fused to ubiquitin ligases, nanobodies fused to identical nanobodies or others that are bispecific or multispecific, NLS-fused nanobodies. "Nanobodies" according to the present invention include, but are not limited to, single antibodies composed of a variable single-chain monomeric antibody domain. Camelid VHH fragments are an example of nanobodies. Preferred nanobodies are single antibodies composed of a variable single-chain monomeric antibody domain. Another particularly preferred heterologous protein is a heterologous protein that contains a domain of a protein involved in the induction or regulation of a type I IFN response, more particularly a heterologous protein that contains a domain of a protein involved in the induction or regulation of a type I IFN response selected from the group consisting of i) a CARD domain of RIG1 comprising a sequence selected from the group consisting of SEQ ID NO: 1-6, ii) a CARD domain of MDA5 comprising a sequence selected from group consisting of SEQ ID NO: 13-16, preferably SEQ ID NO: 15 or 16, and iii) a MAVS CARD domain comprising a sequence selected from the group consisting of SEQ ID NO: 7 or 8, preferably SEQ ID NO: 7. Another particularly preferred heterologous protein is a full-length cGAS such as N. vectensis cGAS (SEQ ID NO: 9), human i6i-522 cGAS (SEQ ID NO: 10), N. cGAS. vectensis6o-422 (SEQ ID NO: 12) or cGAS murinai46-507 (SEQ ID NO: 11). More particularly preferred heterologous proteins are heterologous proteins containing a CARD domain of human RIG1 (SEQ ID NO: 1-3), in particular a CARD domain of human RIG1 (SEQ ID NO: 1), and human cGASi6i-522 ( SEQ ID NO: 10). In some embodiments, the heterologous protein is a prodrug converting enzyme. In these embodiments the recombinant gram-negative bacterial strain expresses, preferably expresses and secretes, a prodrug converting enzyme. A prodrug converting enzyme as referred to herein comprises enzymes that convert non-toxic prodrugs into a toxic drug, preferably enzymes selected from the group consisting of cytosine deaminase, purine nucleoside phosphorylase, thymidine kinase, beta-galactosidase, carboxylesterases, nitroreductase, carboxypeptidases and beta-glucuronidases, most preferably enzymes selected from the group consisting of cytosine deaminase, purine nucleoside phosphorylase, 52 nojbnn / cznz / B / Yi thymidine kinase, and beta-galactosidase. The term “protease cleavage site” as used herein refers to a specific amino acid motif within an amino acid sequence, for example, within an amino acid sequence of a protein or a fusion protein, which It is cleaved by a specific protease, which recognizes the amino acid motif. For a review see 14. Examples of protease cleavage sites are amino acid motifs, which are cleaved with a protease selected from the group consisting of enterokinase (light chain), enteropeptidase, PreScission protease, human rhinovirus (HRV 3C) protease, TEV protease, protease of TVMV, Factor Xa protease and thrombin. The following amino acid motif is recognized by the respective protease: - Asp-Asp-Asp-Asp-Lys: Enterokinase (light chain) / Enteropeptidase (SEQ ID NO: 45) - Leu-Glu-Val-Leu-Phe-Gln / Gly-Pro: PreScission Protease / human rhinovirus protease (HRV 3C) (SEQ ID NO: 46) - Glu-Asn-Leu-Tyr-Phe-Gln-Ser ( SEQ ID NO: 47) and modified motifs based on Glu-X-X-Tyr-X-Gln-Gly / Ser (where X is any amino acid) recognized by TEV (tobacco etch virus) protease (SEQ ID NO: 48) - Glu-Thr-Val-Arg-Phe-Gln-Ser: TVMV Protease (SEQ ID NO: 49) - Ile-(Glu or Asp)-Gly-Arg: Factor Xa Protease (SEQ ID NO: 50) - Leu-Val-Pro-Arg / Gly-Ser: Thrombin (SEQ ID NO: 51). Encompassed by the protease cleavage sites as used herein is ubiquitin. Therefore, in some preferred embodiments ubiquitin is used as a protease cleavage site, i.e. a nucleotide sequence encoding ubiquitin as a protease cleavage site, which can be cleaved with one of the site-specific ubiquitin processing proteases. Nterminal, for example that can be cleaved with specific ubiquitin processing proteases called deubiquitizing enzymes at the N-terminal site endogenously in the cell where the fusion protein has been delivered. Ubiquitin is processed at its C-terminus by a group of endogenous ubiquitin-specific C-terminal proteases (deubiquitizing enzymes, DUBs). Cleavage of ubiquitin by DUBs is assumed to occur at the same C-terminus of ubiquitin (after G76). An “individual,” “subject,” or “patient” is a vertebrate. In certain embodiments, the vertebrate is a mammal. Mammals include, but are not limited to, primates (including human and non-human primates) and rodents (e.g., mice and rats). In preferred embodiments, a subject is a human being. The term “mutation” is used herein as a general term and includes 53 ncnbnn / cznz / B / Yi single base pair and multiple base pair changes. Such mutations may include substitutions, frameshift mutations, deletions, insertions and truncations. The term "nuclear localization signal" as used herein refers to an amino acid sequence that marks a protein for import into the nucleus of a eukaryotic cell and preferably includes a viral nuclear localization signal such as antigen-derived NLS. SV40 large tee (PPKKKRKV) (SEQ ID NO: 52). The term "multiple cloning site" as used herein refers to a short DNA sequence containing several restriction sites for cleavage by restriction endonucleases such as Acll, HindIII, SspI, MluCI, Tsp509I, Pcil, Agel, BspMI, BfuAI, SexAI, MluI, BceAI, HpyCH4IV, HpyCH4III, Bael, BsaXI, AflIII, Spel, Bsrl, Bmrl, BglII, Afel, AluI, Stul, Seal, Clal, BspDI, PI-SceI, Nsil, Asel, SwaI, CspCI, Mfel, BssSI, BmgBI, Pmll, DralII, Alel, EcoP15I, PvuII, AlwNI, BtsIMutI, TspRI, Ndel, NlalII, CviAII, Fatl, Msll, FspEI, Xcml, BstXI, PflMI, Bccl, Ncol, BseYI, Faul, Smal, BbvCI, Sbfl, BpulOI, Bsu36I, EcoNI, HpyAV, BstNI, PspGI, Styl, Bcgl, Pvul, BstUI, EagI, RsrII, BsiEI, BsiWI, BsmBI, Hpy99I, MspAH, MspJI, SgrAI, Bfal, BspCNI, Xhol, EarI, Acul, PstI, Bpml, Ddel, Sfcl, AflII, BpuEI, Smll, Aval, BsoBI, MboII, Bbsl, Xmnl, Bsml, Nb.Bsml, EcoRI, Hgal, Aatll, Zral, Tthllll PflFI, PshAI, Ahdl, DrdI, Eco53kl , SacI, BseRI, Piel, Nt.BstNBI, Mlyl, Hinfl, EcoRV, Mbol, Sau3AI, Dpnll BfuCI, Dpnl, BsaBI, Tfil, BsrDI, Nb.BsrDI, Bbvl, Btsl, Nb.Btsl, BstAPI, SfaNl, Sphl, NmeAIII, Nael, NgoMIV, Bgll, AsiSI, BtgZI, HinPlI, Hhal, BssHII, Notl, Fnu4HI, Cac8I, Mwol, Nhel, Bmtl, SapI, BspQI, Nt.BspQI, BlpI, Tsel, ApeKI, Bspl286I, Alwl, Nt. AlwI, BamHI, Fokl, BtsCI, HaelII, Phol, Fsel, Sfil, NarI, KasI, Sfol, PluTI, AscI, Ecil, BsmFI, Apal, PspOMI, Sau96I, NlalV, Kpnl, Acc65I, Bsal, Hphl, BstEII, A valí , BanI, BaeGI, BsaHI, Bañil, Rsal, CviQI, BstZ17I, BciVI, Salí, Nt.BsmAI, BsmAI, BcoDI, ApaLI, Bsgl, Accl, Hpyl66II, Tsp45I, Hpal, Pmel, HincII, BsiHKAI, Apol, NspI, BsrFI , BstYI, Haell, CviKI-1, EcoO109I, PpuMI, I-Ceul, SnaBI, I-Scel, BspHI, BspEI, Mmel, Taqal, NruI, Hpyl88I, Hpyl88III, Xbal, Bell, HpyCH4V, FspI, PI-PspI, MscI , BsrGI, Msel, Pací, Psil, BstBI, Dral, PspXI, BsaWI, BsaAI, Eael, preferably Xhol, Xbal, HindIII, Ncol, Notl, EcoRI, EcoRV, BamHI, Nhel, SacI, Salí, BstBI. The term "multiple cloning site" as used herein further refers to a short DNA sequence used for recombination events such as in the Gateway cloning strategy or for methods such as Gibbson assembly or Mole cloning. The term "wild-type strain or wild-type strain of the gram-negative bacterial strain as used herein refers to a naturally occurring variant or a naturally occurring variant that contains genetic modifications that allow the use of vectors, such as mutations of deletion in restriction endonucleases or antibiotic resistance genes. These strains contain chromosomal DNA as well as in some cases (e.g. Y. enterocolitica, S. flexnerí) an unmodified virulence plasmid. The term “Yersiniá wild-type strain” as used herein refers to a naturally occurring variant (such as Y. enterocolitica E40) or a naturally occurring variant containing genetic modifications that allow the use of vectors, such as such as deletion mutations in restriction endonucleases or antibiotic resistance genes (such as Y. enterocolitica MRS40, the ampicillin-susceptible derivative of Y. enterocolitica E40). These strains contain chromosomal DNA as well as an unmodified virulence plasmid (called pYV). Y. enterocolitica subspecies palearctica refers to the low pathogenic strains of Y. enterocolitica, which contrast with the higher virulence strains of the enterocolitica subspecies1516. Y. enterocolitica subsp. palearctica lacks, compared to Y. enterocolitica subsp. enterocolitica, from a high pathogenicity island (HPI). This HPI encodes the iron siderophore called yersiniabactinal7. The lack of yersiniabactin in Y. enterocolitica subsp. palearctica makes this subspecies less pathogenic and dependent on the systemic accessible iron induced for persistent infection in, for example, the liver or bazol7. Iron can be made accessible to bacteria in an individual for example by pretreatment with deferoxamine, an iron chelator used to treat iron overload in patients18. The term “comprehend” and variations thereof, such as “comprises” and “comprises” is generally used in the sense of includes, that is, as “including, but not limited to, that is, allowing for the presence of one or more features or components. The singular forms “a,” “an,” and “the / the” include plural referents unless the context clearly dictates otherwise. The term “approximately” refers to a range of values ​​+ 10% of a specified value. For example, the phrase “about 200 includes ± 10% of 200, or 180 to 220. In one aspect, the present invention provides a recombinant gram-negative bacterial strain comprising ncnbnn / cznz / B / Yi i) a first polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; ii) a second polynucleotide molecule comprising a nucleotide sequence encoding a heterologous prolein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; iii) a third polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; and iv) a fourth polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein nucleotide sequence encoding the delivery signal of a bacterial effector protein is operably linked to a promoter, wherein said first and said second polynucleotide molecules are located in a vector comprised of said gram-negative bacterial strain and said third and said fourth polynucleotide molecules are located in a chromosome of said gram-negative bacterial strain or in an extrachromosomal genetic element comprised by said gram-negative bacterial strain, with the condition that the extrachromosomal genetic element is not the vector on which said first and said second polynucleotide molecules are located. In some embodiments, the recombinant gram-negative bacterial strain is a recombinant attenuated virulence gram-negative bacterial strain. The recombinant gram-negative bacterial strain of the present invention can be obtained 1) by transforming a gram-negative bacterial strain with a polynucleotide molecule, preferably a polynucleotide DNA molecule, comprising a nucleotide sequence that encodes a heterologous protein and a nucleotide sequence that is homologous ncnbnn / cznz / B / Yi or identical to one nucleotide sequence that encodes a delivery signal of a bacterial effector protein or that is homologous or identical to a nucleotide sequence that encodes a fragment of a delivery signal of a bacterial effector protein, wherein the delivery signal of an effector protein bacterial strain or a fragment thereof is encoded in the chromosome or in an endogenous virulence plasmid of the gram-negative bacterial strain. Preferably, the nucleotide sequence that is homologous or identical to a nucleotide sequence of a delivery signal of a bacterial effector protein or a fragment thereof is located at the 5' end of the nucleotide sequence that encodes a heterologous protein. The nucleotide sequence encoding a heterologous protein may be flanked at its 3' end by a nucleotide sequence homologous to the nucleotide sequence of the chromosome or endogenous virulence plasmid at the 3' end of the delivery signal of an effector protein. bacterial or a fragment of it. This nucleotide sequence flanking the homologous protein at its 3' end may be homologous to the nucleotide sequence residing within 10 kbp on the chromosome or on an endogenous virulence plasmid at the 3' end of the delivery signal of a bacterial effector protein or a fragment of it. This nucleotide sequence flanking the homologous protein at its 3' end may be homologous to the nucleotide sequence and may be within the same operon on the chromosome or on an endogenous virulence plasmid that delivers the signal of a bacterial effector protein or a fragment of this. The transformation is usually performed so that the nucleotide sequence encoding a heterologous protein is inserted into an endogenous virulence plasmid or a chromosome of the recombinant attenuated virulence gram-negative bacterial strain, preferably into an endogenous virulence plasmid, at the 3-end. ' of a delivery signal of a bacterial effector protein encoded by the chromosome or the endogenous virulence plasmid, where the heterologous protein fused to the delivery signal is expressed and secreted. 2) Subsequently (or in parallel) to step 1) the recombinant bacterial strain obtained in 1) can be transformed with an additional polynucleotide molecule, preferably a polynucleotide DNA molecule, comprising a nucleotide sequence that encodes a heterologous protein and a sequence of nucleotides that is homologous or identical to a nucleotide sequence that encodes a delivery signal of a bacterial effector protein or that is homologous or identical to a nucleotide sequence that encodes a fragment of a delivery signal of a bacterial effector protein, in where the delivery signal of a bacterial effector protein or a fragment thereof is encoded in the chromosome or in an endogenous virulence plasmid of the gram-negative bacterial strain. The nucleotide sequence may be homologous or identical to a nucleotide sequence of a delivery signal of a bacterial effector protein or a fragment thereof may be located at the 5' end of the nucleotide sequence that encodes a heterologous protein. The nucleotide sequence encoding a heterologous protein may be flanked at its 3' end by a nucleotide sequence homologous to the nucleotide sequence of the chromosome or endogenous virulence plasmid at the 3' end of the delivery signal of a bacterial effector protein. or a fragment of it. This nucleotide sequence flanking the homologous protein at its 3' end may be homologous to the nucleotide sequence residing within 10 kbp on the chromosome or on an endogenous virulence plasmid at the 3' end of the delivery signal of a bacterial effector protein or a fragment of it. This nucleotide sequence flanking the homologous protein at its 3' end may be homologous to the nucleotide sequence and may be within the same operon on the chromosome or on an endogenous virulence plasmid that delivers the signal of a bacterial effector protein or a fragment of this. The transformation is usually performed so that the nucleotide sequence encoding a heterologous protein is inserted into an endogenous virulence plasmid or a chromosome of the recombinant attenuated virulence gram-negative bacterial strain, preferably into an endogenous virulence plasmid, at the 3-end. ' of a delivery signal of a bacterial effector protein encoded by the chromosome or the endogenous virulence plasmid, where the heterologous protein fused to the delivery signal is expressed and secreted. 3) The recombinant bacterial strain obtained in 1) and 2) can be further genetically transformed with one or two polynucleotide constructs as an expression vector comprising one (in the case of two vectors) or two (in the case of one vector) sequence (s) nucleotide(n) that encodes a heterologous protein and a nucleotide sequence that is homologous or identical to a nucleotide sequence that encodes a delivery signal of a bacterial effector protein or that is homologous or identical to a nucleotide sequence which encodes a fragment of a delivery signal of a bacterial effector protein. In the event that the recombinant bacterial strain obtained in 1) and 2) is transformed with a vector comprising two nucleotide sequences that each encode a heterologous protein and a nucleotide sequence that is homologous or identical to a nucleotide sequence that encodes a delivery signal of a bacterial effector protein or that is homologous or identical to a nucleotide sequence that encodes a fragment of a delivery signal of a bacterial elector protein, in one embodiment these two sequences can be fused to form an operon. The order of steps 1-3) can be interchanged or the steps can be combined without altering the finally generated recombinant bacterial strain. In case the gram-negative bacterial strain with recombinant attenuated virulence is a Yersinia strain, the endogenous virulence plasmid is pYV (Yersinia virulence plasmid). In case the recombinant attenuated virulence gram-negative bacterial strain is a Salmonella strain, the endogenous location of the insertion is one of the groups of genes called Spil or Spill (for the Salmonella pathogenicity island), a position where an elector protein it is encoded elsewhere or alternatively one of the Salmonella virulence plasmids (SVP). In one embodiment, the third and fourth polynucleotide molecule is inserted and / or located in an endogenous virulence plasmid, preferably inserted and / or located in an endogenous virulence plasmid at the native site of a bacterial effector protein, for example, in the native site of a virulence factor, preferably in the case that the recombinant gram-negative bacterial strain is a Yersinia strain, at the native site of YopE and / or YopH or at the native site of another Yop (YopO, YopP, YopM , YopT), preferably at the native site of YopE and YopH, respectively, or in case the recombinant gram-negative bacterial strain is a Salmonella strain at the native site of an effector protein encoded within Spil, Spill or encoded elsewhere , preferably at the native site of an effector protein encoded within Spil or Spill, most preferably at the native site of SopE or SteA. In a preferred embodiment, the heterologous protein or a fragment thereof encoded by the nucleotide sequence of the first, second, third and fourth polynucleotide molecule is selected, independently of each other, from the group consisting of proteins involved in the induction or regulation of a type I IFN response selected from the group consisting of cGAS, STING, TRIF, TBK1, IKKepsilon, IRF3, TREX1, VPS34, ATG9a, DDX3, LC3, DDX41, IFI16, MRE11, DNA-PK, RIG1, MDA5, LGP2, IPS-l / MAVS / Cardif / VISA, Trim25, Trim32, Trim56, Riplet, TRAF2, TRAF3, TRAF5, ΤΑΝΚ, IRF3, IRF7, IRF9, STATE STAT2, PKR, TLR3, TLR7, TLR9, DAI, IFI16, IFIX, MRE11 , DDX41, LSml4A, LRRF1P1, DHX9, DHX36, DHX29, DHX15, Ku70, cyclic dinucleotide-generating enzymes (cyclic di-AMP, cyclic di-GMP, and cyclic di-GAMP cyclases) such as WspR, DncV, DisA, and DisA-like , CdaA, CdaS and cGAS, or a fragment of these; proteins involved in apoptosis or regulation of apoptosis selected from the group consisting of pro-apoptotic proteins, anti-apoptotic proteins, inhibitors of apoptosis prevention pathways, and inhibitors of pro-survival signaling or pathways; cell cycle regulators selected from the group consisting of cyclins, cyclin-dependent kinases (CDKs), CDK-activating kinases, Cdk inhibitors, CDK substrates, anaphase-promoting / cyclosome complex and cell cycle checkpoint proteins; proteins with ankyrin repeats; cell signaling proteins selected from the group consisting of cytokine signaling proteins, survival factor signaling proteins, death signaling proteins, growth factor signaling proteins, hormone signaling proteins, chemokine signaling proteins and extracellular matrix / Wnt / Hedgehog signaling proteins; reporter proteins selected from the group consisting of fluorescent proteins, luciferases and enzymatic reporter proteins; transcription factors; proteases; small GTPases; GPCR-related proteins selected from the group consisting of G protein-coupled receptors, G protein complexes, kinases, adapter proteins, signal transducers / regulators and transcription factors; nanobody fusion constructs selected from the group consisting of nanobodies fused to protein degradation domains, nanobodies fused to cell signaling proteins or parts thereof, nanobodies fused to identical or other nanobodies, nanobodies fused to reporter proteins and nanobodies fused to signals subcellular localization; nanobodies; bacterial T3SS effectors; bacterial T4SS effectors and viral proteins; or a fragment of these. In one embodiment, the nucleotide sequence encoding a heterologous protein or a fragment thereof of the first polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof of the third polynucleotide molecule encode the same heterologous protein or a fragment thereof. fragment of this. In a further embodiment, the nucleotide sequence encoding a heterologous protein or a fragment thereof of the second polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof of the fourth polynucleotide molecule encode the same heterologous protein or a fragment of this. In a preferred embodiment, the nucleotide sequence encoding a heterologous protein or a fragment thereof of the first polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof of the third polynucleotide molecule encode the same heterologous protein or a fragment thereof and the nucleotide sequence that encodes a heterologous protein or a fragment thereof of the second polynucleotide molecule and the nucleotide sequence that encodes a heterologous protein or a fragment thereof of the fourth polynucleotide molecule encode the same heterologous protein or a fragment thereof, wherein the heterologous protein or a fragment thereof encoded by the first and third polynucleotide molecules is different from the heterologous protein or a fragment thereof encoded by the second and fourth polynucleotide molecules. . In a more preferred embodiment, the heterologous protein encoded by the nucleotide sequence of the first and third polynucleotide molecules, independently of each other, is selected from the group consisting of the RIG-I-like receptor (RLR) family, other proteins containing CARD domains involved in antiviral signaling and type I IFN induction or a fragment thereof, and cyclic dinucleotide-generating enzymes such as cyclic diAMP cyclases, cyclic di-GMP and cyclic di-GAMP selected from the group consisting of WspR, DncV, DisA and similar to DisA, CdaA, CdaS and cGAS, which lead to the stimulation of STING or a fragment thereof as described above. Even more preferably, the heterologous protein encoded by the nucleotide sequence of the first and third polynucleotide molecules, independently of each other, is selected from the group consisting of RIG1, MDA5, MAVS, WspR, DncV, DisA and DisA-like, CdaA, and cGAS or a fragment thereof as described above. In particular, the heterologous protein encoded by the nucleotide sequence of the first and third polynucleotide molecules is cGAS or a fragment thereof, for example, fragments thereof as described above, more particularly human cGAS as shown in SEQ ID NO: 10 or a fragment of this. In a more preferred embodiment, the heterologous protein encoded by the nucleotide sequence of the second and fourth polynucleotide molecules, independently of each other, is selected from the group consisting of the RIG-I-like receptor (RLR) family, other proteins that contain CARD domains involved in antiviral signaling and type I IFN induction or a fragment thereof, and cyclic dinucleotide-generating enzymes such as cyclic diAMP, cyclic di-GMP, and cyclic di-GAMP cyclases selected from the group consisting of WspR , DncV, DisA and similar to DisA, CdaA, CdaS and cGAS, which lead to the stimulation of STING or a fragment thereof as described above. Even more preferably, the heterologous protein encoded by the nucleotide sequence of the second and fourth polynucleotide molecules, independently of each other, is selected from the group consisting of RIG1, MDA5, MAVS, WspR, DncV, DisA and DisA-like, CdaA , and cGAS or a fragment of these. In particular, the heterologous protein encoded by the nucleotide sequence of the second and fourth polynucleotide molecules, independently of each other, is selected from the group consisting of RIG1, MDA5, MAVS, WspR, DncV, DisA and DisA-like, and CdaA, or a fragment of these. More particularly, the heterologous protein encoded by the nucleotide sequence of the second and fourth polynucleotide molecules is RIG1 or a fragment thereof as described above, more particularly a fragment of R1G1 comprising a CARD domain, even more particularly a fragment of RIG1 , preferably human RIG1, comprising two CARD domains, more particularly a fragment of human RIG1 comprising two CARD domains as shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, preferably as shown in SEQ ID NO: 1. In one embodiment, the nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial effector protein of the first polynucleotide molecule and the sequence of nucleotides encoding a heterologous protein or a fragment thereof fused in frame with the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial effector protein of the second polynucleotide molecule are each operatively linked to the same promoter. The term "each operatively linked to the same promoter" means in this connection that a promoter (the same promoter) directs the expression of the heterologous proteins of the first and the second polynucleotide molecule. In a preferred embodiment, the nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame with the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial effector protein of the first polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame with the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial effector protein of the second polynucleotide molecule are each operably linked to the same YopE promoter . In a further embodiment, the nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame with the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial effector protein of the third polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame with the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial effector protein of the fourth polynucleotide molecule are operably linked to two different promoters. In a preferred embodiment, the 62 ncnbnn / cznz / B / Yi nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of the nucleotide sequence encoding a delivery signal of an effector protein bacterial cell of the third polynucleotide molecule is operably linked to the YopE promoter and the nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of the nucleotide sequence encoding a delivery signal of an effector protein bacterial fourth polynucleotide molecule is operatively linked to the YopH promoter. In a further preferred embodiment, the nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial effector protein of the first polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame with the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial effector protein of the second polynucleotide molecule are operably linked to the same promoter and the nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial effector protein of the third polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial effector protein of the fourth polynucleotide molecule are operably linked to two different promoters. The vector comprising said first and second polynucleotide molecules may be a plasmid with a low, medium or high copy number. Low copy number plasmids usually have 1-15 copies / bacterial cell, preferably 1-10 copies / bacterial cell. Plasmids with a medium copy number usually have 5-200 copies / bacterial cell, preferably 10-150 copies / bacterial cell. High copy number plasmids usually have 100-1000 copies / bacterial cell, preferably 150-700 copies / bacterial cell. In a preferred embodiment, the vector comprising said first and second polynucleotide molecules is a plasmid of medium copy number. In a preferred embodiment, the vector is a plasmid with an average copy number with 5-200 copies / bacterial cell, that is, 5-200 copies of the plasmid are present in a single bacterial cell, preferably 10150 copies / bacterial cell, that is That is, 10-150 copies of the plasmid are present in a single bacterial cell. In one embodiment, the vector comprising said first and second polynucleotide molecule is 63 ncnbnn / cznz / B / Yi, a plasmid having without insert a size of between 1 and 15 kDa, preferably between 2 and 10 kDa, more preferably between 3 and 7 kDa. In one embodiment, the extrachromosomal genetic element is an endogenous virulence plasmid, preferably an endogenous virulence plasmid that naturally encodes (in nature) type III secretion system proteins. In a preferred embodiment, the extrachromosomal genetic element is the endogenous virulence plasmid pYV. In one embodiment of the present invention the recombinant gram-negative bacterial strain is selected from the group consisting of the genera Yersinia, Escherichia, Salmonella and Pseudomonas. In one embodiment, the recombinant gram-negative bacterial strain is selected from the group consisting of the genera Yersinia and Salmonella. Preferably the recombinant gram-negative bacterial strain is a Yersinia strain, more preferably a Yersinia enterocolitica strain. The most preferred is Yersinia enterocolitica E40 (0:9, biotype 2)19 or derivatives of this sensitive to ampicillin such as Y. enterocolitica MRS40 (also called Y. enterocolitica subsp. palearctica MRS4Ü) as described in20. Y. enterocolitica E40 and its derivative Y. enterocolitica MRS40 as described in 20 are identical to Y. enterocolitica subsp. palearctica E40 and its derivative Y. enterocolitica subsp. palearctica MRS40 as described in 15·17·21. Also preferably the recombinant gram-negative bacterial strain is a Salmonella strain, more preferably a Salmonella enterica strain. Most preferred is Salmonella enterica Serovar Typhimurium SL1344 as described in the English Public Health Culture Collection (NCTC 13347). In some embodiments of the present invention the recombinant gram-negative bacterial strain is a strain that does not produce a siderophore, for example, is deficient in the production of a siderophore, preferably does not produce siderophores, for example, is deficient in the production of any siderophore. Such a strain is, for example, Y. enterocolitica subsp. palearctica MRS4Ü as described in ^17 20 21which does not produce yersiniabactin and is preferred. In one embodiment of the present invention, the delivery signal of a bacterial effector protein comprises a bacterial effector protein or an N-terminal fragment thereof, preferably a bacterial effector protein that is virulent towards eukaryotic cells or an N-terminal fragment thereof. -terminal of this. In one embodiment of the present invention, the delivery signal of a bacterial effector protein is a delivery signal of a bacterial effector protein selected from the group consisting of a bacterial T3SS effector protein or an N-terminal fragment thereof, a bacterial T4SS effector protein or a fragment of the N-terminal end thereof and a bacterial T6SS effector protein or a fragment of the N-terminal end thereof. In one embodiment of the present invention, the delivery signal of a bacterial effector protein is a bacterial T3SS effector protein comprising a bacterial T3SS effector protein or an N-terminal fragment thereof, wherein the T3SS effector protein or an N-terminal fragment thereof may comprise a chaperone binding site. A T3SS effector protein or an N-terminal fragment thereof comprising a chaperone binding site is particularly useful as a delivery signal in the present invention. Preferred T3SS elector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SopE2, SptP, YopE, ExoS, SipA, SipB, SipD, SopA, SopB, SopD, IpgBl, IpgD, SipC , SifA, SseJ, Sse, SrfH, YopJ, AvrA, AvrBsT, YopT, YopH, YpkA, Tir, EspF, TccP2, IpgB2, OspF, Map, OspG, OspI, IpaH, SspHLVopF, ExoS, ExoT, HopAB2, XopD, AvrRpt2 , HopAOl, HopPtoD2, HopUl, GALA protein family, AvrBs2, AvrDl, AvrBS3, YopO, YopP, YopE, YopM, YopT, EspG, EspH, EspZ, IpaA, IpaB, IpaC, VirA, IcsB, OspCl, OspE2, IpaH9. 8, IpaH7.8, AvrB, AvrD, AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, VirPphA, AvrRpml, HopPtoE, HopPtoF, HopPtoN, PopB, PopP2, AvrBs3, XopD and AvrXv3. The most preferred T3SS effector proteins or the N-terminal fragments thereof are selected from the group consisting of SopE, SptP, YopE, ExoS, SopB, IpgBl, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO, YopP, YopE, YopM, YopT, where the most preferred T3SS effector proteins or the N-terminal fragments thereof are selected from the group consisting of IpgBl, SopE, SopB, SptP, OspF, IpgD, YopH, YopO, YopP , YopE, YopM, YopT, in particular YopE or a fragment of the N-terminal end thereof. Equally preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SopE2, SptP, SteA, SipA, SipB, SipD, SopA, SopB, SopD, IpgBl, IpgD, SipC, SifA, SifB, SseJ, Sse, SrfH, YopJ, AvrA, AvrBsT, YopH, YpkA, Tir, EspF, TccP2, IpgB2, OspF, Map, OspG, OspI, IpaH, VopF, ExoS, ExoT, HopAB2, AvrRpt2, HopAOl, HopUl, GALA protein family, AvrBs2, AvrDl, YopO, YopP, YopE, YopT, EspG, EspH, EspZ, IpaA, IpaB, IpaC, VirA, IcsB, OspCl, OspE2, IpaH9.8, IpaH7.8, AvrB, AvrD , AvrPphB, AvrPphC, AvrPphEPto, AvrPpiBPto, AvrPto, AvrPtoB, VirPphA, AvrRpml, HopPtoD2, HopPtoE, HopPtoF, HopPtoN, PopB, PopP2, AvrBs3, XopD, and AvrXv3.Equally more preferred T3SS effector proteins or N-terminal fragments thereof are selected from the group consisting of SopE, SptP, SteA, SifB, SopB, IpgBl, IpgD, YopJ, YopH, EspF, OspF, ExoS, YopO , YopP, YopE, YopT, where the equally most preferred T3SS effector proteins or the N65 ncnbnn / cznz / B / Yi terminal fragments thereof are selected from the group consisting of IpgBl, SopE, SopB, SptP, SteA, SifB , OspF, IpgD, YopH, YopO, YopP, YopE, and YopT, in particular SopE, SteA, or YopE or an N-terminal fragment thereof, more particularly SteA or YopE or an N-terminal fragment of this, more particularly YopE or a fragment from the N-terminal end of it. In some embodiments, the delivery signal of a bacterial effector protein of the first, second, third and fourth polynucleotide molecule is the same delivery signal. In a preferred embodiment, the delivery signal of a bacterial effector protein of the first, second, third and fourth polynucleotide molecule is a delivery signal of a bacterial T3SS effector protein, preferably the same delivery signal of a T3SS effector protein. bacterial. In a more preferred embodiment, the delivery signal of a bacterial effector protein of the first, second, third and fourth polynucleotide molecule comprises the YopE effector protein or an N-terminal fragment thereof. In some embodiments, the delivery signal of a bacterial effector protein is encoded by a nucleotide sequence comprising the bacterial effector protein or an N-terminal fragment thereof, wherein the N-terminal fragment thereof includes the least the first 10, preferably at least the first 20, more preferably at least the first 100 amino acids of the bacterial T3SS effector protein. The term “at least the first 10 amino acids of the bacterial T3SS effector protein” refers to the first 10 amino acids of the NFE-terminal end (also called the N-terminal end) of the bacterial T3SS effector protein. In some embodiments, the bacterial effector protein delivery signal is encoded by a nucleotide sequence comprising the bacterial T3SS effector protein or a fragment of the N-terminal end thereof, wherein the bacterial T3SS effector protein or fragment The N-terminal end of this comprises a chaperone binding site. Preferred T3SS elector proteins or an N-terminal fragment thereof, comprising a chaperone binding site comprise the following combinations of the chaperone binding site and the T3SS effector protein or the N-terminal fragment of this: SycE-YopE, InvB-SopE, SicP-SptP, SycT-YopT, SycO-YopO, SycN / YscB-YopN, SycH-YopH, SpcS-ExoS, CesF-EspF, SycD-YopB, SycD-YopD. The most preferred are SycE-YopE, InvB-SopE, SycT-YopT, SycO-YopO, SycN / YscB-YopN, SycH-YopH, SpcS-ExoS, CesF-EspF. Most preferred is a YopE or an N-terminal fragment thereof that comprises the SycE chaperone binding site such as an N-terminal fragment of a YopE effector protein containing the N-terminal 138 amino acids. terminal of the YopE effector protein designated herein as YopEi-iss and as shown in SEQ ID NO: 25 or a SopE effector protein or an N-terminal fragment thereof comprising the InvB chaperone binding site such as a fragment from the N-terminal end of a SopE effector protein containing the N-terminal 81 or 105 amino acids of the SopE effector protein designated herein as SopEi-si or SopEi-ios respectively, and as shown in SEQ ID NO: 26 and 27. In one embodiment of the present invention, the recombinant gram-negative bacterial strain is a Yersinia strain and the bacterial effector protein delivery signal comprises a YopE effector protein or an N-terminal part, preferably the Y. enterocolitica effector protein YopE or an N-terminal part thereof. Preferably the SycE binding site is included within the N-terminal part of the YopE effector protein. In relation to this, a fragment from the N-terminal end of a YopE effector protein may comprise the 12, 16, 18, 52, 53, 80 or 138 amino acids of the N-terminal end22 24 68_ The most preferred is a fragment from the N-terminal end of a YopE effector protein containing the N-terminal 138 amino acids of the YopE effector protein, for example, as described in Forsberg and Wolf-Watz2? designated herein as YopEi-jís and as shown in SEQ ID NO: 25. In one embodiment of the present invention, the recombinant gram-negative bacterial strain is a Salmonella strain and the bacterial effector protein delivery signal encoded by a nucleotide sequence comprises a SopE or SteA effector protein or an N part. -terminal part of this, preferably the effector protein SopE or SteA of Salmonella enterica or an N-terminal part of this. Preferably the chaperone binding site is included within the N-terminal part of the SopE effector protein. In this connection an N-terminal fragment of a SopE effector protein may comprise N-terminal amino acids 81 or 105. Most preferred is full-length SteA (SEQ ID NO: 28) and a fragment from the N-terminal end of a SopE effector protein containing amino acids 105 from the N-terminal end of the effector protein, for example, as described in SEQ ID NO: 27. One skilled in the art is familiar with methods for identifying polypeptide sequences of an effector protein that are capable of delivering a protein. For example, one such method is that described by Sory et al.19. In summary, polypeptide sequences, for example, from various portions of the Yop proteins can be fused in frame to a reporter enzyme such as the calmodulin-activated adenylate cyclase (or Cya) domain of Bordetella pertussis cyclolysin. The 67 delivery of a Yop-Cya hybrid protein to the cytosol of eukaryotic cells is indicated by the appearance of cyclase activity in infected eukaryotic cells leading to the accumulation of cAMP.By employing such an approach, one skilled in the art can determine, if desired, the minimum sequence requirement, i.e., a contiguous amino acid sequence of the shortest length, that is capable of delivering a protein, see, for example ,9. Accordingly, the preferred delivery signals of the present invention consist of at least the minimal amino acid sequence of a T3SS effector protein that is capable of delivering a protein. In one embodiment, the recombinant gram-negative bacterial strain is deficient in the production of at least one bacterial effector protein, more preferably it is deficient in the production of at least one bacterial effector protein that is virulent towards eukaryotic cells, even more preferably it is deficient. in the production of at least one T3SS effector protein, most preferably it is deficient in the production of at least one T3SS effector protein that is virulent towards eukaryotic cells. In some embodiments, the recombinant gram-negative bacterial strains are deficient in the production of at least one, preferably at least two, more preferably at least three, even more preferably at least four, particularly at least five, more particularly at least six , most particularly all bacterial effector proteins that are virulent towards eukaryotic cells. In some embodiments, the recombinant gram-negative bacterial strains are deficient in the production of at least one, preferably at least two, more preferably at least three, even more preferably at least four, particularly at least five, more particularly at least six , most particularly all functional bacterial effector proteins that are virulent towards eukaryotic cells such that the resulting recombinant gram-negative bacterial strain produces fewer bacterial effector proteins or produces bacterial effector proteins to a lesser extent compared to the virulent gram-negative bacterial wild-type strain unattenuated, that is, compared to the gram-negative bacterial wild-type strain that normally produces bacterial effector proteins or such that the resulting recombinant gram-negative bacterial strain no longer produces any of the functional bacterial effector proteins that are virulent toward eukaryotic cells. According to the present invention, said mutant gram-negative bacterial strain, that is, said recombinant gram-negative bacterial strain that is deficient in the production of at least one bacterial effector protein, for example, that is deficient in the production of at least one effector protein bacterial that is virulent towards eukaryotic cells, for example, said Yersinia 68 mutant strain can be generated by introducing at least one mutation in at least one effector-encoding gene. Preferably, such effector-encoding genes include YopE, YopH, YopO / YpkA, YopM, YopP / YopJ and YopT with respect to a Yersinia strain. Preferably, such effector-encoding genes include AvrA, CigR, GogB, GtgA, GtgE, PipB, SifB, SipA / SspA, SipB, SipC / SspC, SipD / SspD, SlrP, SopB / SigD, SopA, SpiC / SsaB, SseB, SseC, SseD, SseF, SseG, Ssel / SrfH, SopD, SopE, SopE2, SspHl, SspH2, PipB2, SifA, SopD2, SseJ, SseKl, SseK2, SseK3, SseL, SteC, SteA, SteB, SteD, SteE, SpvB, SpvC, SpvD, SrfJ, SptP, as it relates to a strain of Salmonella. Most preferably, all effector-encoding genes are deleted. The skilled person can employ any number of standard techniques to generate mutations in these T3SS effector genes. Sambrook et al generally describe such techniques. See Sambrook et al26. According to the present invention, the mutation can be generated in the promoter region of an effector-encoding gene such that the expression of such effector gene is suppressed. The mutation can also be generated in the coding region of an effector-coding gene so that the catalytic activity of the encoded effector protein is suppressed. The “catalytic activity” of an effector protein typically refers to the anti-target cell function of an effector protein, i.e., toxicity. Such activity is governed by catalytic motifs in the catalytic domain of an effector protein.Approaches to identify the catalytic domain and / or catalytic motifs of an effector protein are well known to those skilled in the art. See, for example,27 2s. Accordingly, a preferred mutation of the present invention is a deletion of the entire catalytic domain. Another preferred mutation is a frameshift mutation in an effector-encoding gene such that the catalytic domain is not present in the protein product expressed from such a "frameshifted" gene. A more preferred mutation is a mutation with deletion of the entire coding region of the effector protein. Other mutations are also contemplated by the present invention, such as small deletions or base pair substitutions, which are generated in the catalytic motifs of an effector protein leading to the destruction of the catalytic activity of a given effector protein. Mutations generated in the genes for functional bacterial selector proteins can be introduced into the particular strain by a number of methods. One such method involves cloning a mutated gene into a “suicide” vector that is capable of introducing the mutated sequence into the strain through allelic exchange. An example of such a “suicide” vector is described in29. In this way, mutations generated in multiple genes can be successively introduced into a gram-negative bacterial strain giving rise to a polymutant ncnbnn / cznz / B / Yi, for example, a recombinant strain with six mutations. The order in which these mutated sequences are introduced is not important. Under some circumstances, it may be desirable to mutate only some but not all effector genes. Accordingly, the present invention also contemplates polymutant Yersinia instead of Yersinia with six mutations, for example, strains with two mutations, with three mutations, with four mutations and with five mutations. For the purpose of protein delivery, the secretion and translocation system of the present mutant strain needs to be intact. A preferred recombinant gram-negative bacterial strain of the present invention is a Yersinia strain with six mutations in which all of the effector-encoding genes (which are yopH, yopO, yopP, yopE, yopM, yopT) are mutated so that the resulting Yersinia it no longer produces any of the functional effector proteins. Such a Yersinia strain with six mutations is designated as ΔγορΗ,Ο,Ρ,Ε,Μ,Τ for Y. enterocolitica. As an example such a six-fold mulant can be produced from the strain Y. enterocolitica MRS40 which gives rise to Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ, (also called Y. enterocolitica subsp. palearctica MRS40 ΔγορΗ ,Ο,Ρ,Ε,Μ,Τ or Y. enterocolitica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ in the present description) which is preferred. Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ which is deficient in the production of yersiniabactin has been described in WO02077249 and was deposited on September 24, 2001, in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure with the Belgian Coordinated Collections of Microorganisms (BCCM) and was assigned the accession number LMG P21013. Equally preferred is Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ which comprises a deletion in the endogenous virulence plasmid pYV that eliminates an RNA hairpin structure or parts thereof such as a deletion of Hairpin I waters. upstream of the gene encoding an endogenous AraC-type DNA binding protein (AHorquillal-virF) such as Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ AHorquillal-virF (also called Y. enterocolitica ΔγορΗ,Ο, Ρ,Ε,Μ,Τ AFork-virF). Equally preferred is Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ which comprises a deletion of a chromosomal gene encoding asd and the endogenous virulence plasmid pYV comprising a nucleotide sequence comprising a gene encoding asd operably linked to a promoter (pYV-asd) such as Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ Aasd pYV-asd (also called Y. enterocolitica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ Aasd pYV -asd in this description). Particularly preferred is Y. enterocolitica MRS40 nojbnn / cznz / B / Yi ΔγορΗ,Ο,Ρ,Ε,Μ,Τ Aasd AHorquillalvirF pYV-asd comprising both modifications as described above (also called Y. enterocolitica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ Aasd AHorquillalvirF pYV-asd in the present description). Particularly preferred strains are Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ AIlorquillal-virF (also called Y. enterocolitica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ AForkLvirF), Y. enterocolitica MRS40 ΔγορΗ,Ο ,Ρ,Ε,Μ,Τ Aasd pYV-asd (also called Y. enterocolitica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ Aasd pYV-asd in the present description) or Y. enterocolitica MRS40 ΔγορΗ,Ο,Ρ,Ε ,Μ,Τ Aasd AForkLvirF pYV-asd (also called Y. enterocolitica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ Aasd AFork-virF pYV-asd in the present description) that are deficient in the production of a siderophore, preferably not produce siderophores, for example, are deficient in the production of any siderophore, as is the case for all strains of Y. enterocolitica subsp. palearctica. Therefore, equally particularly preferred strains are Y. enterocolitica subsp. palearctica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ AFork-virF (also called Y. enterocolitica subsp. palearctica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ AForkLvirF), Y. enterocolitica subsp. palearctica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ Aasd pYV-asd also called Y. enterocolitica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ Aasd pYV-asd in the present description) or Y. enterocolitica subsp. palearctica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ Aasd AFork-virF pYV-asd (also called Y. enterocolitica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ Aasd AForkLvirF pYV-asd in the present description). The most preferred is the Yersinia enterocolitica strain with six mutations which is designated as ΔγορΗ,Ο,Ρ,Ε,Μ,Τ. The polynucleic acid constructs as vectors that can be used according to the invention to transform a gram-negative bacterial strain may depend on the gram-negative bacterial strains used as known to those skilled in the art. Polynucleic acid constructs that can be used in accordance with the invention include expression vectors (including synthetic or otherwise modified versions generated from the endogenous virulence plasmids), vectors for chromosomal insertion or into the virulence plasmid and sequences of nucleotides such as, for example, DNA fragments for chromosomal insertion or into the virulence plasmid. Expression vectors that are useful, for example, in a strain of Yersinia, Escherichia, Salmonella or Pseudomonas are, for example, the plasmids pUC, pBad, pACYC, pUCP20 and pET. Vectors for chromosomal or virulence plasmid insertion that are useful, for example, in a strain of Yersinia, Escherichia, Salmonella or Pseudomonas are, for example, pKNGIOL DNA fragments for chromosomal or virulence plasmid insertion refers to methods used, for example, on a strain of Yersinia, Escherichia, Salmonella or Pseudomonas such as, for example, ncnbnn / cznz / B / Yi genetic engineering with lambda-network. Vectors for chromosomal insertion or virulence plasmid or DNA fragments for chromosomal insertion or virulence plasmid may insert the nucleotide sequences of the present invention so that, for example, the nucleotide sequence encoding a heterologous protein fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein is operably linked to an endogenous promoter of the recombinant gram-negative bacterial strain. Therefore, if a vector is used for chromosomal or virulence plasmid insertion or a DNA fragment is used for chromosomal or virulence plasmid insertion, an endogenous promoter can be encoded in the endogenous bacterial DNA (chromosomal or plasmid DNA). ) and only the respective nucleotide sequence will be provided by the transformed vector for chromosomal insertion or into the virulence plasmid or a DNA fragment for chromosomal insertion or into the virulence plasmid. Alternatively, if a vector is used for chromosomal or virulence plasmid insertion or a polynucleic acid construct such as, for example, a nucleotide sequence for chromosomal or virulence plasmid insertion, an endogenous promoter and the delivery signal of a bacterial effector protein on endogenous bacterial DNA (chromosomal or plasmid DNA) and only the polynucleic acid construct such as, for example, a nucleotide sequence encoding the heterologous protein will be provided by a vector for insertion chromosomal or in the virulence plasmid or by a polynucleic acid construct such as, for example, a nucleotide sequence for chromosomal insertion or in the virulence plasmid. Therefore, it is not necessary that a promoter be comprised by the vector used for the transformation of the recombinant gram-negative bacterial strains, that is, the recombinant gram-negative bacterial strains of the present invention can be transformed with a vector that does not comprise a promoter. A preferred vector, for example, a preferred expression vector for Yersinia is selected from the group consisting of pBad_Si_l, pBad_Si_2 and pT3P-715, pT3P-716 and pT3P-717. pBad_Si2 was constructed by cloning the SycE-YopEi-ns fragment containing endogenous promoters for YopE and SycE from purified pYV40 into the Kpnl / HindIII site of pBadMycHisA (Invitrogen). Additional modifications include removal of the NcoI / BglII fragment from pBad-MycHisA by digestion, treatment and religation of the Klenow fragment. In addition, the following cleavage sites were added to the 3' end of YopEi-138: Xbal-XholBstBI-(HindlII). pBad_Sil is the same as pBad_Si2 but encodes EGFP amplified from ncnbnn / cznz / B / Yi pEGFP-Cl (Clontech) at the NcoI / BglII site under the Arabinose-inducible promoter. Equally preferred is the use of modified versions of the endogenous Yersinia virulence plasmid pYV that encode heterologous proteins as fusions to a T3SS signal sequence. A preferred vector, for example, a preferred expression vector for Salmonella is selected from the group consisting of pT3P_267, pT3P_268 and pT3P_269. Plasmids pT3P_267, pT3P_268, and pT3P_269 containing the corresponding endogenous promoter and the full-length SteA fragment (pT3P_267), the SopEi-si fragment (pT3P_268), or the SopEi-105 fragment (pT3P_269) were amplified from the genomic DNA of S .enterica SL1344 and were cloned into the Ncol / Kpnl site of pBad-MycHisA (Invitrogen). pT3P-715 is a fully synthetic plasmid (de novo synthesized vector) with similar characteristics to pSi_2, while the corresponding AraC coding region has been deleted and the ampicillin resistance gene (plus 70 bp upstream) is replaced by a chloramphenicol resistance gene with 200 bp in the upstream region. For clarity, pT3P-715 comprises the SycE-YopEj.tas fragment containing endogenous promoters for YopE and SycE from pYV40, where at the 3' end of YopEl-138 the following cleavage sites were added: XbalXhoI-BstBI-HindlII. It has a pBR322 origin of replication, and a chloramphenicol acetyl transferase (cat) of the transposable genetic element Tn967. pBad_Si2 and pT3P-715 are medium copy number plasmids with a pBR322 (pMBl) origin of replication (SEQ ID NO: 29). The pT3P-716 derivative is a high copy number plasmid based on a point mutation in the pBR322 origin of replication (SEQ ID NO: 29), which then results in the ColEl origin of replication (SEQ ID NO: 30). High copy number plasmids for expression and delivery of heterologous cargo proteins are based on pT3P-716. The pT3P-717 derivative is a low copy number plasmid based on the pBR322 origin of replication as in pT3P-715, but additionally comprising the rop (for “primer repressor) gene (SEQ ID NO: 31). Low-copy number plasmids for expression and delivery of heterologous cargo proteins are based on pT3P-717. The polynucleotide molecules of the present invention may include other sequence elements such as a 3' termination sequence (including a stop codon and a poly A sequence), or a gene that confers drug resistance that allows selection of transformants. that have received the polynucleotide molecules or other element that allows the selection of transformants. The polynucleotide molecules of the present invention can be transformed by a number of known methods into recombinant gram-negative bacterial strains. For the purpose of the present invention, transformation methods for introducing polynucleotide molecules include, but are not limited to, electroporation, calcium phosphate-mediated transformation, conjugation, or combinations thereof. For example, polynucleotide molecules, for example, located in a vector, can be transformed into a first bacterial strain by a standard electroporation procedure. Subsequently, such polynucleotide molecules, for example, located in a vector, can be transferred from the first bacterial strain to the desired strain by conjugation, a process also called "mobilization." The transformant (i.e. the gram-negative bacterial strains that have taken up the vector) can be selected, for example, with antibiotics. These techniques are well known in the art. See, for example, 19. According to the present invention, the promoter operably linked to the bacterial effector protein of the recombinant gram-negative bacterial strain of the invention may be a native promoter of a T3SS effector protein of the respective strain or a compatible bacterial strain, or another native promoter. of the respective strain or a compatible bacterial strain or a promoter used in expression vectors that are useful, for example, in a strain of Yersinia, Escherichia, Salmonella or Pseudomonas, for example, pUC and pBad. Such promoters are the T7 promoter, the Plac promoter or the Ara-bad-inducible Ara-bad promoter. If the recombinant gram-negative bacterial strain is a Yersinia strain, the promoter may be from a Yersinia virulon gene. A “Yersinia virulon gene” refers to the genes on the Yersinia plasmid pYV, whose expression is controlled both by temperature and by any contact with a target cell. Such genes include genes encoding elements of the secretory machinery (the Ysc genes), genes encoding translocators (YopB, YopD, and LcrV), genes encoding control elements (YopN, TyeA, and LcrG), genes encoding T3SS effector chaperones (SycD, SycE, SycH, SycN, SycO and SycT), and genes encoding effectors (YopE, YopH, YopO / YpkA, YopM, YopT and YopP / YopJ) as well as other pYV-encoded proteins such as VirF and YadA. In a preferred embodiment of the present invention, the promoter is the native promoter of a gene encoding a functional T3SS effector. If the recombinant gram-negative bacterial strain is a Yersinia strain, the promoter is selected from any of YopE, YopH, YopO / YpkA, YopM and YopP / YopJ. More preferably, the promoter is from YopE and / or YopH. The most preferred is the YopE and YopH promoter, respectively. If the recombinant gram-negative bacterial strain is a Salmonella strain, the promoter may be from the Spil or Spill pathogenicity island or from an effector protein encoded elsewhere. Such genes include genes encoding elements of the secretory machinery, genes encoding translocators, genes encoding control elements, genes encoding T3SS elector chaperones, and genes encoding electors as well as other proteins encoded by SPI-1 or SPI. -2. In a preferred embodiment of the present invention, the promoter is the native promoter of a gene encoding a functional T3SS effector. If the recombinant gram-negative bacterial strain is a Salmonella strain, the promoter is selected from any of the effector proteins. More preferably, the promoter is from SopE, InvB or SteA. In some embodiments, the promoter is an artificially inducible promoter, such as, for example, the IPTG-inducible promoter, a light-inducible promoter, and the arabinose-inducible promoter. In one embodiment of the present invention, the recombinant gram-negative bacterial strain comprises a nucleotide sequence encoding a protease cleavage site. The protease cleavage site is usually located in the polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein between the sequence. of nucleotides that encode a heterologous protein and the nucleotide sequence that encodes a delivery signal. The generation of a functional and generally applicable cleavage site allows cleavage of the delivery signal after translocation. As the delivery signal can interfere with the correct localization and / or function of the translocated protein within the target cells, the introduction of a protease cleavage site between the delivery signal and the protein of interest provides delivery of the proteins almost native to eukaryotic cells. Preferably the protease cleavage site is an amino acid motif that is cleaved by a protease or the catalytic domains thereof selected from the group consisting of enterokinase (light chain), enteropeptidase, PreScission protease, human rhinovirus 3C protease, TEV protease, TVMV protease, FactorXa protease and thrombin, more preferably an amino acid motif that is cleaved by a TEV protease. Equally preferable, the protease cleavage site is an amino acid motif that is cleaved by a protease or the catalytic domains thereof selected from the group consisting of enterokinase (light chain), enteropeptidase, PreScission protease, human rhinovirus 3C protease, 75 ncnbnn protease. TEV / cznz / B / Yi, TVMV protease, FactorXa protease, ubiquitin processing protease, called deubiquitinating enzymes and thrombin. Most preferred is an amino acid motif that is cleaved by a TEV protease or a ubiquitin processing protease. Therefore, in a further embodiment of the present invention, the heterologous protein is cleaved from the delivery signal of a bacterial effector protein by a protease. Preferred cleavage methods are methods where: a) the protease is translocated into the eukaryotic cell by a recombinant gram-negative bacterial strain as described herein which expresses a fusion protein comprising the delivery signal of the bacterial effector protein and the protease as a heterologous protein; or b) the protease is constitutively or transiently expressed in the eukaryotic cell. Usually the recombinant gram-negative bacterial strain used to deliver a desired protein into a eukaryotic cell and the recombinant gram-negative bacterial strain that translocates the protease to the eukaryotic cell are different. In one embodiment of the present invention, the recombinant gram-negative bacterial strain comprises an additional nucleotide sequence that encodes a labeling molecule or an accept site for a labeling molecule. The additional nucleotide sequence encoding a labeling molecule or an acceptor site for a labeling molecule is generally fused to the 5' end or the 3' end of the nucleotide sequence encoding a heterologous protein. A preferred labeling molecule or an acceptor site for a labeling molecule is selected from the group consisting of enhanced green fluorescent protein (EGFP), coumarin, coumarin ligase acceptor site, resorufin, resurofin ligase acceptor site, the tetra-motif. Cysteine ​​in use with the FlAsH / ReAsH dye (life technologies). The most preferred is resorufin and a resurofin ligase or EGFP acceptor site. The use of a labeling molecule or an acceptor site for a labeling molecule will lead to the binding of a labeling molecule to the heterologous protein of interest, which will then be delivered as such to the eukaryotic cell and enable tracking of the protein, for example, by live cell microscopy. In one embodiment of the present invention, the recombinant gram-negative bacterial strain comprises an additional nucleotide sequence encoding a peptide tag. The additional nucleotide sequence encoding a peptide tag is generally fused to the 5' end or the 3' end of the nucleotide sequence encoding a heterologous protein. A preferred peptide tag is selected from the group consisting of Myc tag, His tag, Flag tag, HA tag, Strep tag or V5 tag or a combination of two or more ncnbnn / cznz / B / Yi tags from these groups. The most preferred are the Myc tag, Flag tag, His tag and combined Myc and His tags. The use of a peptide tag will lead to traceability of the tagged protein, for example by immunofluorescence or Western blotting with the use of anti-tag antibodies. Furthermore, the use of a peptide tag allows affinity purification of the desired protein either after secretion into the culture supernatant or after translocation to eukaryotic cells, in both cases with the use of a purification method suitable for the corresponding tag (for example, metal chelate affinity purification in use with a His tag or anti-Flag antibody-based purification in use with the Flag tag). In one embodiment of the present invention, the recombinant gram-negative bacterial strain comprises an additional nucleotide sequence encoding a nuclear localization signal (NLS). The additional nucleotide sequence encoding a nuclear localization signal (NLS) is generally fused to the 5' end or the 3' end of the nucleotide sequence encoding a heterologous protein wherein said additional nucleotide sequence encodes a nuclear localization signal. (NLS). A preferred NLS is selected from the group consisting of SV40 long T antigen NLS and derivatives thereof as well as other viral NLS. The most preferred is NLS of the long T antigen of SV40 and derivatives thereof. In one embodiment of the present invention, the recombinant gram-negative bacterial strain comprises a multiple cloning site. The multiple cloning site is generally located at the 3' end of the nucleotide sequence encoding a delivery signal of a bacterial elector protein and / or at the 5' end or 3' end of the nucleotide sequence encoding a protein. heterologous. One or more than one of the multiple cloning sites may be comprised by the vector. A multiple cloning site is selected from the group of restriction enzymes consisting of Xhol, Xbal, HindIII, Ncol, Notl, EcoRI, EcoRV, BamHl, Nhel, SacI, Salí, BstBI. The most preferred are Xbal, Xhol, BstBI and HindIII. The fused protein expressed by the recombinant gram-negative bacterial strain of the present invention is also called a “fusion protein or a “hybrid protein”, that is, a fused or hybrid protein of the delivery signal and a heterologous protein. The fusion protein may further comprise, for example, a delivery signal and two or more different heterologous proteins. The present invention contemplates the gram-negative bacterial strain as described herein for use as a medicament. Thus, in another aspect, the present invention relates to a recombinant gram-negative bacterial strain comprising i) a first polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; ii) a second polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; iii) a third polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; and iv) a fourth polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the nucleotide sequence encoding the delivery signal of a bacterial effector protein is operably linked to a promoter, wherein said first and said second polynucleotide molecules are located in a vector comprised of said gram-negative bacterial strain and said third and said fourth polynucleotide molecules are located in a chromosome of said gram-negative bacterial strain or in an extrachromosomal genetic element comprised by said gram-negative bacterial strain, with the condition that the extrachromosomal genetic element is not the vector on which said first and said second polynucleotide molecules are located, for their use as a medicine. The present invention also contemplates methods of treating cancer in a subject, for example, for treating malignant solid tumors which includes delivering heterologous proteins as described above to cancer cells, for example, to cells of a malignant solid tumor or to cells of the microenvironment. tumor. Thus, in another aspect, the present invention relates to a recombinant gram-negative bacterial strain comprising i) a first polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; ii) a second polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; iii) a third polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the sequence of nucleotides encoding the delivery signal of a bacterial effector protein is operably linked to a promoter; and iv) a fourth polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof fused in frame to the 3' end of a nucleotide sequence encoding a delivery signal of a bacterial effector protein, wherein the nucleotide sequence encoding the delivery signal of a bacterial effector protein is operably linked to a promoter, wherein said first and said second polynucleotide molecules are located in a vector comprised of said gram-negative bacterial strain and said third and said fourth polynucleotide molecules are located in a chromosome of said gram-negative bacterial strain or in an extrachromosomal genetic element comprised by said gram-negative bacterial strain, with the condition that the extrachromosomal genetic element is not the vector in which said first and said second polynucleotide molecules are located, for their use in a method of treating cancer in a subject, the method comprises administering to the subject said recombinant gram-negative bacterial strain, wherein the recombinant gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject. Likewise, the present invention relates to a method of treating cancer in a subject, comprising administering to the subject the recombinant gram-negative bacterial strain described ncnbnn / cznz / B / Yi above, wherein the recombinant gram-negative bacterial strain is administered in an amount which is sufficient to treat the subject. Likewise, the present invention relates to the use of the recombinant gram-negative bacterial strain described above for the manufacture of a medicament to treat cancer in a subject. Likewise, the present invention relates to the use of the recombinant gram-negative bacterial strain described above to treat cancer in a subject. The proteins can be delivered, that is, translocated to the cancer cell, for example, to cells of a malignant solid tumor at the time of administering the recombinant gram-negative bacterial strain to a subject or can be delivered, that is, translocated to the cancer cell, for example, to cells of a malignant solid tumor or to cells of the tumor microenvironment at a later time, for example, after the recombinant gram-negative bacterial strain has reached a cancer cell, for example, the site of the malignant solid tumor and / or has reached a cancer cell, for example, the site of the malignant solid tumor and has replicated as described above. The timing of delivery may be regulated, for example, by the promoter used to express the heterologous proteins in the recombinant gram-negative bacterial strain. In the first case, a constitutive promoter or, more preferably, an endogenous promoter of a bacterial effector protein could drive the heterologous protein. In the case of delayed protein delivery, an artificially inducible promoter, such as the arabinose-inducible promoter, could drive the heterologous protein. In this case, arabinose (or an inducer of a corresponding inducible promoter) will be administered to a subject once the bacteria have reached and accumulated at the desired site. The arabinose will then induce bacterial expression of the protein to be delivered. Thus, in one embodiment, the method of treating cancer comprises i) culturing the recombinant gram-negative bacterial strain as described herein; ii) administering to the subject said recombinant gram-negative bacterial strain of i) wherein a fusion protein comprising a delivery signal of a bacterial effector protein and the heterologous protein are expressed by the recombinant gram-negative bacterial strain and translocated into the cancer cell or a cell from the tumor microenvironment; and optionally iii) cleaving the fusion protein so that the heterologous protein is cleaved from the delivery signal of the bacterial effector protein within the cancer cell, wherein the recombinant gram-negative bacterial strain ncnbnn / cznz / B / Yi is administered in a sufficient amount to treat the subject. The cancer cells to supply heterologous proteins are usually cancer cells from cancers selected from the group consisting of sarcoma, leukemia, lymphoma, multiple myeloma, cancers of the central nervous system and malignant solid tumors, including, but not limited to, abnormal mass of cells that can come from different types of tissues, such as liver, colon, colon and rectum, skin, breast, pancreas, cervix, uterine corpus, bladder, gallbladder, kidney, larynx, lip, oral cavity, esophagus, ovary, prostate, stomach, testicle, thyroid gland or lung and therefore includes malignant solid tumors of the liver, colon, colon and rectum, skin, breast, pancreas, cervix, uterine corpus, bladder, gallbladder, kidney, larynx, lip, oral cavity, esophagus, ovary, prostate, stomach, testicles, thyroid or lung. Preferably, the cancer cells for delivering heterologous proteins are cancer cells of malignant solid tumors. Thus, in a preferred embodiment, the cancer is a malignant solid tumor and the method comprises i) culturing the recombinant gram-negative bacterial strain as described herein; ii) administering to the subject said recombinant gram-negative bacterial strain of i) wherein a fusion protein comprising a delivery signal of a bacterial effector protein and the heterologous protein are expressed by the recombinant gram-negative bacterial strain and translocated to the cell of a malignant solid tumor or a cell in the tumor microenvironment; and optionally ii i) cleaving the fusion protein so that the heterologous protein is cleaved from the delivery signal of the bacterial effector protein within the cell of a malignant solid tumor, wherein the recombinant gram-negative bacterial strain is administered in a sufficient amount to treat the subject. In some embodiments, at least two fusion proteins each comprising a delivery signal of a bacterial effector protein and a heterologous protein are expressed by the recombinant gram-negative bacterial strain and translocated to the eukaryotic cell, for example, the cancer cell by the methods of the present invention. The recombinant gram-negative bacterial strain can be cultured such that a fusion protein comprising the delivery signal of the bacterial effector protein and the heterologous protein is expressed according to methods known in the art (e.g. FDA, ncnbnn / cznz / B / Yi Bacteriological Analytical Manual (BAM), chapter 8: Yersinia ente rocolítica). Preferably, the recombinant gram-negative bacterial strain can be grown in Brain Heart infusion broth, for example, at 28°C. For induction of expression of T3SS and, for example, YopE / SycE promoter-dependent genes, bacteria can be grown at 37°C. In one embodiment, the cancer cell, for example, the cell of a malignant solid tumor is contacted with two recombinant gram-negative bacterial strains of i), wherein the first recombinant gram-negative bacterial strain expresses a first fusion protein comprising the signal of the bacterial effector protein and a first heterologous protein and the second recombinant gram-negative bacterial strain expresses a second fusion protein comprising the delivery signal of the bacterial effector protein and a second heterologous protein, so that the first and the second fusion protein are translocated to the cell of a malignant solid tumor or a cell of the tumor microenvironment. This modality provides coinfection of a cancer cell, for example, a cell of a malignant solid tumor with two bacterial strains as a valid method to deliver, for example, two different hybrid proteins in single cells. One skilled in the art may further use a number of assays to determine whether delivery of a fusion protein is successful. For example, the fusion protein can be detected through immunofluorescence with the use of antibodies that recognize a fused tag (such as the Myc tag). The determination can also be based on the enzymatic activity of the protein being supplied, for example the assay described in 19. The present invention also provides a pharmaceutical composition comprising a recombinant gram-negative bacterial strain as described herein optionally comprising a suitable pharmaceutically acceptable carrier. Therefore, the present invention also provides a pharmaceutical composition comprising a recombinant gram-negative bacterial strain as described herein for use in a method of treating cancer, for example, a malignant solid tumor in a subject. The recombinant gram-negative bacteria can be combined for convenient and effective administration in an amount sufficient to treat the subject as a pharmaceutical composition with a suitable pharmaceutically acceptable carrier. A unit dosage form of the recombinant gram-negative bacteria or the pharmaceutical composition to be administered may contain, for example, the recombinant gram-negative bacteria in an amount of about ΙΟ3a about 1O10bacteria per ml, preferably about 106a about 109bacteria per ml, more preferably about 107a approximately 109bacteria for me, with the greatest preference approximately 108bacteria for me. By "amount that is sufficient to treat the subject" or "effective amount" which are used interchangeably in the present description, it is intended to be an amount of a bacteria or bacteria, high enough to significantly positively modify the condition to be treated but which low enough to avoid serious side effects (with a reasonable benefit / risk ratio), within the scope of good medical judgment. An effective amount of a bacteria will vary with the particular objective to be achieved, the age and physical condition of the subject to be treated, the duration of treatment, the nature of the concurrent therapy and the specific bacteria employed. The effective amount of a bacteria will therefore be the minimum amount that will provide the desired effect. Usually an amount of about 105 to about 1010 bacteria is administered to the subject, for example, from about 10 to about 1010 bacteria / m2 of body surface, preferably from about 106 to about 109 bacteria, for example, from about 106 to about 109 bacteria / m2 of body surface, with greater preferably about 107 to about 108 bacteria, for example, about 107 to about 108 bacteria / m2 of body surface, most preferably 108 bacteria, for example, 1()8 bacteria / m2 of body surface. A single dose of the recombinant gram-negative bacterial strain to administer to a subject, for example, a human to treat cancer, for example, a malignant solid tumor, is usually about 104a lü1()bacteria, for example, about 104 bacteria / m2 of body surface to about 1O10 bacteria / m2 of body surface, preferably from about 10? to about 109 bacteria, for example, from about 103 to about 109 bacteria / m2 of body surface, more preferably from about 106 to about 108 bacteria, for example, from about 106 a about 108 bacteria / m2 of body surface, even more preferably about 107 to about 108 bacteria, for example, of about 107 to about 108 bacteria / m2 of body surface, most preferably 108 bacteria, for example, 108 bacteria / m2 of body surface of total recombinant gram-negative bacteria. Examples of substances that can serve as pharmaceutical carriers are sugars, such as lactose, glucose and sucrose; starches and their derivatives such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose and cellulose acetates; powdered tragancanth; malt; jelly; talcum powder; stearic acids; magnesium stearate; calcium sulfate; calcium carbonate; vegetable oils, such as peanut oils, cottonseed oil, sesame oil, olive oil, corn oil and theobroma oil; polyols such as propylene glycol, glycerin, sorbitol, mannitol and polyethylene glycol; agar; alginic acids; pyrogen-free water; isotonic saline solution; cranberry extracts and phosphate buffer solution; skimmed milk powder; as well as other compatible non-toxic substances used in pharmaceutical formulations such as vitamin C, estrogens and echinacea, for example. Wetting and lubricating agents such as sodium lauryl sulfate may also be present, as well as coloring agents, flavoring agents, lubricants, excipients, tableting agents, stabilizers, antioxidants and preservatives. The modes of administration of the recombinant gram-negative bacteria to a subject can be selected from the group consisting of intravenous, intratumoral, intraperitoneal and peroral administration. Although it is not intended to limit this invention to any particular mode of application, intravenous or intratumoral administration of the bacteria or pharmaceutical compositions is preferred. Depending on the route of administration, it may be necessary to coat the active ingredients comprising bacteria in a material to protect said organisms from the action of enzymes, acids and other natural conditions that may inactivate said organisms. To administer bacteria by other than parenteral administration, they should be coated by, or administered with, a material to prevent inactivation. For example, bacteria can be co-administered with enzyme inhibitors or in liposomes. Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DFP), and trasilol. Liposomes include water-in-oil-in-water P40 emulsions as well as conventional and specifically designed liposomes that transport bacteria, such as Lactobacillus, or their byproducts to an internal target of a host subject. One bacteria can be administered alone or together with a second, different bacteria. Any number of different bacteria can be used together. “Together with” means together, substantially simultaneously or sequentially. The compositions may further be administered in the form of a tablet, pill or capsule, for example, such as a lyophilized capsule comprising the bacteria or pharmaceutical compositions of the present invention or as solutions of frozen bacteria or the 84 ncnbnn / cznz / B / Yi pharmaceutical compositions of the present invention containing DMSO or glyceroL Another preferred form of application involves the preparation of a lyophilized capsule of the bacteria or the pharmaceutical compositions of the present invention. Still another preferred form of application involves the preparation of a heat-dried capsule of bacteria or the pharmaceutical compositions of the present invention. The recombinant gram-negative bacteria or the pharmaceutical composition to be administered can be administered by injection. Forms suitable for injectable use include monoseptic suspensions and monoseptic powders for the extemporaneous preparation of monoseptic injectable suspensions. In all cases the form must be monoseptic and must be fluid to the extent that easy injectability exists. It should be stable under manufacturing and storage conditions. The carrier may be a solvent or dispersion medium containing, for example, water, sugars, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures of these and vegetable oils. Appropriate fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersion. In many cases it will be preferable to include isotonic agents, for example sugars or sodium chloride. Prolonged absorption of the injectable compositions can be provided by the use in the compositions of delayed absorption agents, for example, aluminum monostearate and gelatin. In some embodiments of the present invention, the recombinant gram-negative bacterial strain is co-administered with a siderophore to the subject. These modalities are preferred. Siderophores that can be co-administered are siderophores that include hydroxamate, catecholate, and mixed siderophore ligands. Preferred siderophores are Deferrioxamine (also known as desferrioxamine B, desferoxamine B, DFO-B, DFOA, DFB or desferal), Desferrioxamine E, Deferasirox (Exjade, Desirox, Defrijet, Desifer) and Deferiprone (Ferriprox), the most preferred being Deferoxamine. Deferoxamine is a bacterial siderophore produced by the Actinobacteria Streptomyces pilosa and is commercially available from, for example, Novartis Pharma Schweiz AG (Switzerland). Coadministration with a siderophore may be before, simultaneously with, or after administration of the recombinant gram-negative bacterial strain. Preferably, a siderophore is administered before administration of the recombinant gram-negative bacterial strain, more preferably it is administered about 24 hours before, preferably 85 ncnbnn / cznz / B / Yi about 6 hours before, more preferably 3 hours before, in particular 1 hour before administration of the recombinant gram-negative bacterial strain to the subject. In a particular embodiment, the subject is pretreated with desferoxamine 1 h before infection with the recombinant gram-negative bacterial strain to allow bacterial growth. Usually a siderophore is co-administered at a single dose of about 0.5x10'5Mol to about 1x10'3Mol, more preferably from about 1x10'3Mol to about 5x10'4Mol, preferably from about IxlO'4Mol to about 4x10-4Mol. Usually desferrioxamine is co-administered at a single dose of about 20 mg to about 500 mg, preferably about 50 mg to about 200 mg per subject, more preferably a single dose of 100 mg of desferrioxamine is co-administered. The dosage regimens of administration of the recombinant gram-negative bacterial strain or the pharmaceutical composition described herein will vary with the particular objective to be achieved, the age and physical condition of the subject being treated, the duration of treatment, the nature of the simultaneous therapy and the specific bacteria used, as is known to the expert. The recombinant gram-negative bacterial strain is administered to the subject generally according to a dosage regimen consisting of a single dose every 1-20 days, preferably every 1-10 days, more preferably every 1-7 days. The administration period is generally about 20 to about 60 days, preferably about 30-40 days. Alternatively the administration period generally is about 8 to about 32 weeks, preferably about 8 to about 24 weeks, more preferably about 12 to about 16 weeks. The present invention also provides a kit for treating cancer, for example, such as malignant solid tumors, preferably in a human. Such kits will generally comprise the recombinant gram-negative bacterial strain or pharmaceutical composition described herein and instructions for using the kit. In some embodiments, the kits include a carrier, package or container that is compartmentalized to receive one or more containers such as vials, tubes and the like, each of the containers including one of the separate elements for use in a method described herein. description. Suitable containers include, for example, bottles, flasks, syringes and test tubes. In other embodiments, the containers are formed from a variety of materials such as glass or plastic. ncnbnn / cznz / B / Yi EXAMPLES Example 1: A) Materials and methods Bacterial strains and culture conditions. The strains used in this study are listed in Figures 27A to 27E. E. coli ToplO, used for plasmid purification and cloning, and E. coli SmlO λ pir, used for conjugation, as well as E. coli BW1961031, used to propagate pKNGlOl, were routinely grown on plates of LB agar and in LB broth at 37 °C. Ampicillin was used at a concentration of 200 pg / ml (Yersinia) or 100 pg / ml (E. coli) and chloramphenicol was used at 10 pg / ml to select expression vectors. Streptomycin was used at a concentration of 100 pg / ml to select suicide vectors. Y. enterocolitica MRS40 (0:9, biotype 2)20, a derivative of E40 not resistant to Ampicillin19, and strains derived from it were routinely grown in Brain Heart Infusion (BHI; Difeo) at RT. Nalidixic acid was added to all Y. enterocolitica strains (35 pg / ml) and all Y. enterocolitica asd strains were additionally supplemented with 100 pg / ml / 7n?.so-2,6-diaminopimelic acid (mDAP , Sigma Aldrich). Genetic manipulations of Y. enterocolitica. Genetic manipulations of Y. enterocolitica have been described32'33. In summary, mutators for modification or deletion of genes in the pYV plasmids or in the chromosome were constructed by 2-fragment overlap PCR with the use of plasmid pYV40 or purified genomic DNA as template, leading to 200- 250 bp of flanking sequences on both sides of the deleted or modified part of the respective gene. Alternatively, fully synthetic DNA fragments (synthesized de novo) with 200-250 bp of flanking sequences on both sides of the deleted or modified part of the respective gene were used. The resulting fragments were cloned into pKNGlOl29 in E. coli BW1961031. Sequence-verified plasmids were transformed into E. coli SmlO λ pir, from where the plasmids were mobilized into the corresponding Y. enterocolitica strains. Mulants carrying the integrated vector were propagated for several generations without selection pressure. Sucrose was then used to select clones that lost the vector. Finally, the mulants were identified by colony PCR. The specific mutators (pT3P-456, pT3P-457, pT3P-697 and pT3P-714) are listed in Table III. Construction of plasmids. Plasmids pBad_Si2, pBad_Sil or pT3P-715 (or the derivatives pT3P-716 and pT3P-717) were used for the cloning of fusion proteins with the N-terminal 138 amino acids of YopE (SEQ ID NO: 25). pBad_Si2 (Figures 3A-3B) was constructed 87 ncnbnn / cznz / B / Yi by cloning the SycE-YopEmis fragment containing endogenous promoters for YopE and SycE from purified pYV40 into the Kpnl / HindlH site of pBad-MycHisA (Invitrogen). . Additional modifications include removal of the NcoI / BglII fragment from pBadMycHisA by digestion, treatment and religation of the Klenow fragment. A bidirectional transcription terminator (BBa_B1006; iGEM foundation) was cloned into the Kpnl cleavage site and into the Klenow-treated site (pBad_Si2) or the BglII cleavage site (pBad_Sil). Furthermore, at the 3' end of YopEi-138 the following cleavage sites were added: Xbal-XhoLBstBI(HindlII) (Figure 3B). pBad_Sil is the same as pBad_Si2 but encodes EGFP amplified from pEGFP-Cl (Clontech) in the NeoI / Bgilí site under the inducible Arabinosa promoter. pT3P-715 (Figure 4) is a fully synthetic plasmid (de novo synthesized vector) with similar characteristics to pSi_2, while the corresponding AraC coding region was deleted and the ampicillin resistance gene (plus 70 bp upstream) was deleted. replaced by a chloramphenicol resistance gene with an upstream region of 200 bp. For clarity, pT3P-715 comprises the SycE-YopEl-138 fragment containing endogenous promoters for YopE and SycE from pYV40, where at the 3' end of YopEl-138 the following cleavage sites were added: Xbal-XholBstBI-HindllI. It presents a pBR322 origin of replication and a chloramphenicol acetyl transferase (cat) of the transposable genetic element Tn9 (Alton NK, Vapnek D (1979) Nucleotide sequence analysis of the chloramphenicol resistance transposon Tn9. Nature 282:864-869). The pT3P-716 derivative (Figure 5) is a high copy number plasmid based on a point mutation in the pBR322 origin of replication (SEQ ID NO: 29), which then results in the ColEl origin of replication (SEQ ID NO: : 30). High copy number plasmids for expression and delivery of heterologous cargo proteins are based on pT3P-716. The pT3P-717 derivative (Figure 6) is a low copy number plasmid based on the pBR322 origin of replication as in pT3P-715, but additionally comprising the rop (for “primer repressor) gene (SEQ ID NO: 31). Low-copy number plasmids for the expression and delivery of heterologous cargo proteins are based on pT3P-717. pT3P-716 and fully synthetic plasmid pT3P-717 (de novo synthesized vectors). Heterologous proteins for delivery - RIG-I. RIG-I (also called DDX58; Uniprot 095786 for human protein) is a cytoplasmic sensor for short double-stranded RNA and an important pattern recognition receptor of the innate immune system. RIG-I consists of an RNA helicase domain, a C-terminal domain, and an N-terminal domain (Brisse and Ly, 2019). The helicase domain is responsible for the recognition of double-stranded RNA; the C88 terminal domain includes a repressor domain; and the N-terminal domain includes two caspase recruitment domains (CARDs) that activate downstream signaling pathways. In its resting state, RIG-I is in a state with the C-terminal repressor domain covering the helicase and RNA-binding domains. Upon binding of the agonist viral RNA to the helicase domain, the protein unfolds and the N-terminal CARD domains become accessible for interaction with downstream partners, such as mitochondrial antiviral signaling protein (MAVS) and binding kinase 1. to ΤΑΝΚ (TBK1). This is followed by nuclear translocation of activated IFN regulatory factor 3 (IRF3) and IRF7, resulting in the transcription of coding sequences regulated by the interferon-stimulating response element (ISRE), such as IFN-α and - β. The heterologous protein for delivery was selected to be composed of the N-terminal CARD domains of RIG-I alone (without the rest of the protein; e.g., RIG-I humanoi-245 or RIG-I1-229 or RIG-I1 -218. resulting in constitutive, RNA-independent activation of the RIG-I pathway. Bacteria-delivered RIGI CARD domains are accessible and result in activation of MAVS and TBK1. This is followed by nuclear translocation of activated IRF3 and IRF7, resulting in the transcription of ISRE-regulated coding sequences such as IFN a and b. Similarly, the CARD domain(s) of MAVS or MDA5 have been selected to function independently of the agonist upon delivery by bacteria. Heterologous proteins for delivery - cGAS. Cyclic GMP-AMP synthase (cGAS; Uniprot Q8N884 for human protein) is a cytoplasmic sensor for DNA. cGAS is a nucleotidyltransferase that catalyzes the formation of cyclic GMP-AMP (cGAMP) from ATP and guanosine triphosphate (GTP), and is part of the cGAS-STING DNA sensing pathway. It has two major dsDNA binding sites on opposite sides of a catalytic pocket and is activated by binding to cytosolic DNA. After binding to DNA, cGAS catalyzes the synthesis of cGAMP, which then functions as a second messenger that binds and activates transmembrane protein 173 (TMEM173) / STING located in the endoplasmic reticulum. STING then activates the protein kinases IkB kinase (IKK) and TBK1, which in turn activate the transcription factors NF-κΒ and IRF3 to induce interferons and other cytokines. The second messenger cGAMP can also pass to other cells in several ways and thus transmit the danger signal from cytosolic DNA to surrounding cells. cGAS truncated at the N-terminus (like human cGASi6i-522), lacks the N-terminal DNA binding domain but retains enzymatic activity. Supply of this truncated cGAS into eukaryotic cells leads to the production of intracellular cGAMP due to the enzymatic activity of cGAS, resulting in the activation of the STING pathway. As seen with the RIG-I pathway, activation of the STING pathway ultimately results in the production of type I IFN. Human (and other eukaryotic) genes were synthesized de novo, allowing adaptation of codon usage to Y. enterocolitica (Figures 27 A to 27E) and cloned as fusions to YopEi-i38 in plasmid pBad_Si2 or pT3P-715 ( for medium copy number), pT3P-716 (high copy number) or pT3P-717 (for low copy number) (see Table II below). The ligated plasmids were cloned into E. coli ToplO. The sequenced plasmids were electroporated into the desired Y. enterocolitica strain using the settings for standard E. coli electroporation. Table I (Primer no. T3P_: Sequence) SEQ ID NO 32: Primer no. : T3T_887 cacatgtggtcgacGAATAGACAGCGAAAGTTGTTGAAATAATTG SEQ ID NO 33: Primer no. : T3T_955 cactacccccttgtttttatccataTTAATTGCGCGGTTTAAACGGG SEQ ID NO 34: Primer no. : T3T_956 TATGGATAAAAACAAGGGGGTAGTG SEQ ID NO 35: Primer no. : T3T_888 catgcgaatgggcccGTTTTCAGTATAAAAAGCACGGTATATAC SEQ ID NO 36: Primer no. : T3T_957 cactacccccttgtttttatccataTTAATTGCGCGGTTTCAGCG SEQ ID NO 37: Primer no. : T3T_995 catggtcgacGTTTTCAGTATAAAAAGCACGGTATATAC SEQ ID NO 38: Primer no. : T3T_822 catggtcgacCTCAGGGTTCCAGCTTAGC SEQ ID NO 39: Primer no. : T3TJ021 catggtcgacCTCAGGGTTCCAGCTTAGC SEQ ID NO 40: Primer no. : T3T_1022 catggtcgacCTCAGGGTTCCAGCTTAGC SEQ ID NO 41: Primer no. : T3T.1023 catggtcgacCTCAGGGTTCCAGCTTAGC ncnbnn / cznz / B / Yi SEQ ID NO 42: Primer no. : T3T_287 CGGGGTACCTCAACTAAATGACCGTGGTG SEQ ID NO 43: Primer no. : T3T_288 GTTAAAGCTTttcgaatctagactcgagCGTGGCGAACTGGTC Table II: Cloned fusion proteins Protein to be supplied by T3SS protein sequence ID. Plasmid Backbone No. Name of the resulting plasmid Primers. T3T Nr.: SEQ ID NO of primer. YopEi-Bs- human RIG-1 CARD2 with codons optimized in Y. enterocolitica (Aa. 1-245) 1 pBad_Si_2 pT3P_453 synthetic construct / YopEi-i38- human RIG-1 CARD2 with optimized codons in Y. enterocolitica (Aa. 1-245) 245) 1 pT3P-715 pT3P-718 synthetic construct / YopEi-138* RIG-1 human CARD2 with codons optimized in Y. enterocolitica (Aa. 1-245) 1 pT3P-716 pT3P-719 synthetic construct / YopEi-138- RIG -1 human CARD2 with optimized codons in Y. enterocolitica (Aa. 1-245) 1 pT3P-717 pT3P-720 synthetic construct / YopEi-138- RIG-1 murine CARD2 with optimized codons in Y. enterocolitica (Aa. 1-246 ) 4 pBad_Si_2 pT3P-454 synthetic construct / YopEi-138- RIG-1 murine CARD2 with optimized codons in Y. enterocolitica (Aa. 1-246) 4 pT3P-715 pT3P-721 synthetic construct / YopEi-138- RIG-1 CARD ? murine with optimized codons in Y. enterocolitica 4 pT3P-716 pT3P-722 synthetic construct / (Aa. 1-246) YopEi-138- murine RIG-1 CARD2 with optimized codons in Y. enterocolitica (Aa. 1-246) 4 pT3P-717 pT3P-723 synthetic construct / YopEl-138 - RIG-1 CARD? murine with optimized codons in Y. enterocolitica (Aa. 1-229) 5 pBad_Si_2 pT3P_521 1021 / 1022 39 / 40 YopEl-138 - RIG-1 CARD? murine with codons optimized in Y. enterocolitica (Aa. 1-218) 6 pBad_Si_2 pT3P_522 1021 / 1023 39 / 41 YopEl-138- human cGAS with codons optimized in Y. enterocolitica (Aa. 161-522) 10 pBad_Si_2 pT3P_515 synthetic construct / YopEl-138- human cGAS with optimized codons in Y. enterocolitica (Aa. 161-522) 10 pT3P-715 pT3P-745 synthetic construct / YopEi-i38- RIG-1 CARD? human with codons optimized in Y. enterocolitica (Aa. 1-245) and YopEl138- human cGAS with codons optimized in Y. enterocolitica (Aa. 161-522) 1 and 10 pT3P-715 pT3P-751 synthetic construct / YopEi.i38- Human RIG-1 CARD2 with codons optimized in Y. enterocolitica (Aa. 1-245) and YopEl138- human cGAS with codons optimized in Y. enterocolitica (Aa. 161-522) 1 and 10 pT3P-716 pT3P-731 synthetic construct / YopEl-138- RIG-1 1 and 10 pT3P-717 pT3P-732 construct / noybnn / eznz / R / vi CARD? human with codon optimized in K enterocolitica (Aa. 1-245) and human YopEl138- cGAS with codon optimized in Y. enterocolitica (Aa. 161-522) synthetic noybnn / cznz / B / Yi Table III: Matadors for genetic modification and resulting pYV plasmids 10 Mutator / Construct To be inserted into: Plasmid backbone Name of the resulting mutator Name of the resulting pYV Primers T3T_Nr. SEQ ID NO of primers Template used with the original strain 15 ΥθρΕ|.|38RIG-1 card2 murine with optimized codons in Y. enterocolitica (Aa. 1-246) pYV (yopE: :) pKNGl 01 pT3P_4 57 pYV022 PCR1: 887 / 957; PCR2: 956 / 888; Overlapping PCR: 887 / 888 32 / 36, 34 / 35, 32 / 35 PCR1:ppT 3P-454 PCR2: Τ enterocolilica y. enterocolitica EyopHOPE MT 20 25 YopE|.|38RIG-1 human CARD2 with optimized K enterocolitica (Aa. 1-245) pYV (yopE: :) pKNGl 01 pT3P_4 56 pYV021 PCR1: 887 / 955; PCR2: 956 / 888; Superimposed PCR: 887 / 888 32 / 33, 34 / 35, 32 / 35 PCREppT 3P-453 PCR2: Τ enterocolitica Y. enterocolitica ΔγορΗΟΡΕ MT 30 Codon-optimized human YopEl138cGAS in Y. enterocolitica (Aa. 161-522) pYV (yopE: :) pKNGl 01 pT3P_6 97 pYV048 995 / 822 37 / 38 pT3P-515 Y. enterocolitica ΔγορΗΟΡΕ MT Human YopEl138cGAS with optimized codons in Y. enterocolitica (Aa. 161-522) pYV (yopH ::) pKNGl 01 pT3P_7 14 pYV050 / (Synthetic Gene) / / Y. enterocolitica ΔγορΗΟΡΕ MT nojbnn / cznz / B / vi ΥθρΕ|.|3χR1G-1 human CARD2 with codons optimized in Y. enterocolitica (Aa. 1245) and human YopEl138cGAS with codons optimized in Y. enterocolitica (Aa. 161-522) pYV (yopE: : and yopH: :) pKNGl 01 pT3P_7 14 pYV051 / (Synthetic Gene) / / Y. enterocolitica ΔγορΗΟΡΕ MT pYV021 Yop secretion. The induction of the yop region was carried out by changing the culture at 37 °C in BHI-Ox (conditions that allow secretion)34. Glucose was added as a carbon source (4 mg / ml). Total cell and supernatant fractions were separated by centrifugation at 20,800 g for 10 min at 4°C. The cell pellet was taken as the fraction of total cells. Proteins in the supernatant were precipitated with final 10% (w / v) trichloroacetic acid for 1 h at 4 °C. After centrifugation (20,800 g for 15 min) and removal of the supernatant, the resulting pellet was washed in ice-cold Acetone overnight. Samples were centrifuged again, the supernatant was discarded, and the pellet was air-dried and resuspended in application dye with 1x SDS. Secreted proteins were analyzed by SDS-PAGE; In each case, proteins secreted by 3 x 108 bacteria were loaded per lane. Detection of specific secreted proteins by immunoblotting was performed using 12.5% ​​SDS-PAGE gels. For detection of proteins in total cells, 2 x 108 bacteria were loaded per lane, if not otherwise indicated, and proteins were separated on 12.5% ​​SDS-PAGE gels before detection by immunoblotting. Immunoblotting was carried out with the use of rat monoclonal antibodies against YopE (MIPA193 - 13A9 ; 1:1000, -13). Antiserum was preabsorbed twice overnight against Y. enterocolitica ΔΗΟΡΕΜΤ asd to reduce background staining. Detection was performed with secondary antibodies directed against rat antibodies and conjugated to horseradish peroxidase (1:5000; Southern biotech), before color development with ECL chemiluminescent substrate (LumiGlo, KPM). Cell culture and infections. B16F1, LN-229, and RAW cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FCS and 2 mM L-Glutamine (cDMEM). THP-1, A20, Jurkat and 4T1 cells were cultured in RPMI 1640 supplemented with 10% FCS and 2 mM L-glutamine, for A20 cells 1 mM sodium pyruvate, D-glucose 2.5 / 1, HEPES 10 were additionally added. mM and 0.05 mM mercaptoethanol. Y. enterocolitica was grown in BHI with additives overnight at RT, diluted in fresh BHI to an ODooo of 0.2, and grown for 2 h at RT before changing the temperature to a 37°C water bath shaker for 30 min to 1 hour additional. Finally, bacteria were collected by centrifugation (6000 rcf, 30 s) and washed once with DMEM supplemented with 10 mM HEPES and 2 mM L-glutamine. Cells plated in 96-well or 6-well plates were infected at the indicated MOIs in DMEM / RPMI supplemented with 10 mM HEPES and 2 mM Lglutamine. THP-1 cells were differentiated by the addition of PMA (phorbol myristate acetate) to a final concentration of 20–50 ng / ml for 3–48 h before bacterial infection. After addition of bacteria, plates were centrifuged for 1 min at 500 rpm and placed at 37°C for indicated time periods. Direct assay of type I interferon activation. Murine BI6F1 melanoma cells, murine RAW264.7 wild-type macrophages, or human THP-1 monocytes / macrophages that each stably expressed secreted embryonic alkaline phosphatase (SEAP) under the I-ISG54 promoter control that is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE were purchased from InvivoGen (B16-Blue ISG, RAW-Blue ISG, THPl-Blue ISG). Growth conditions and type I IFN assay were adapted from protocols provided by InvivoGen. Briefly, 12,500 B16-Blue ISG, 30,000 RAW-Blue, or 100,000 THP-1 cells were seeded in 150 μΐ assay medium (RPMI + 2 mM Lglutamine + 10% FCS for B16-Blue ISG and THPl cells -Blue ISG differentiated by 96 PMA; DMEM + 2 mM L-glutamine + 10% FCS for RAW-Blue) per well in a flat-bottom 96-well plate (NUNC or Corning). On the same day or the next day, cells were infected with the bacterial strains to be evaluated by adding 15 μΐ per well of the desired multiplicity of infection (MOI, diluted in test medium) followed by brief centrifugation (500 g, 60 s, RT). After 2 hours of incubation (37 °C and 5% CO2), the bacteria were killed by the addition of test medium containing penicillin (100 U / ml) and streptomycin (100 μg / ml). Incubation continued for 20-24 h. SEAP and luciferase detection followed the QUANTI-Blue™ and QUANTI-Luc™ (InvivoGen) protocol, respectively. For SEAP detection: 20 μΐ of the cell supernatant was incubated with 180 μΐ of detection reagent (QUANTI-Blue™, InvivoGen). The plate was incubated at 37°C and SEAP activity was measured by reading the OD at 650 nm using a microplate reader (Molecular Devices). Murine IFNy (stock solution: 1,000,000 U / ml) diluted to the respective concentrations in the test medium was used as a positive control. For luciferase detection: 50 μΐ of detection reagent (QUANTI-Luc™, InvivoGen) was added to 20 μΐ of the cell supernatant in opaque plates (ThermoScientific). Luminescence was measured immediately with the use of a plate reader (BioTek). For activation of LN-229, Jurkat or A20 cells, 20,000-30,000 cells were seeded in 100 μΐ test medium (DMEM + 2 mM L-glutamine + 10% FCS for LNN-29 or RPMI + L-glutamine 2 mM + 10% FCS + 1 mM sodium pyruvate + 2.5 / 1 D-glucose + 10 mM HEPES and for A20 cells additionally 0.05 mM mercaptoethanol) per well in a flat-bottom 96-well plate (NUNC or Corning). On the same day or the next day, cells were infected with the bacterial strains to be evaluated by adding 15 μΐ per well of the desired multiplicity of infection (MOI, diluted in test medium). After 4 hours of incubation (37°C and 5% CO2), supernatants were collected and analyzed for the presence of IFNp using the LumiKine™ Xpress human IFN-β ELISA or the LumiKine™ Xpress murine IFN-β ELISA. (Invivogen) according to the manufacturer's instructions. Biodistribution or efficacy in 4T1, EMT-6, and B16F10 tumor allograft mouse models. All animal experiments were approved (license 1908; Kantonales Veterinaramt Basel-Stadt) and were performed in accordance with local guidelines (Tierschutz-Verordnung, BaselStadt) and the Swiss animal protection law (Tierschutz-Gesetz). Six-week-old BALB / c (4T1 or EMT-6 model) or C57BL / 6 (B16F10 model) mice were ordered from Janvier Labs. After at least one week of adaptation, the mice were subjected to anesthesia using 97 ncnbnn / cznz / B / Yi use of isoflurane and 100 μl of 4T1, EMT-6 or B16F10 cells (1 xl05-lxl06cells) were injected subcutaneously into the flank of the mice. Throughout the experiment, the behavior and physical appearance of the mice were graded, and surface temperature as well as body weight was measured. Once the tumors developed, the mice were administered an 8 mg / ml solution of desferal (10 ml / kg) by i.p. injection. On the same day or the next day, mice were infected with the corresponding Y. enterocolitica strain (IxlO7bacteria for experiment 4T1; IxlO6bacteria for experiment B16F10) by tail vein injection or by intratumoral (i.t.) injection. directly in the tumor on the indicated days (7.5x107bacteria for the EMT-6 and B16F10 experiment). The inoculum administered to the mice was validated by dilution plating. As a control, mice were injected with endotoxin-free PBS alone. For experiments with multiple administrations, 24 hours before the last bacterial treatment, mice were administered an 8 mg / ml solution of desferal (10 ml / kg) by i.p. injection. Tumor progression was monitored by measuring tumor length and width with digital calipers. The tumor volume was determined as 0.5xlengthxwidth2. A tumor volume greater than 1500 mm3 was defined as the endpoint for euthanasia. On the respective days post-infection, mice were sacrificed by inhalation of CCF. The tumor was isolated and the weight was determined. The tumor was homogenized. Total CFU in each sample was determined by applying serial dilutions to LB agar plates containing nalidixic acid (35 μg / ml). To evaluate the presence of the pYV plasmid, replicate colonies were picked on LB agar plates containing nalidixic acid (35 μg / ml) and arsenite (400 uM) and the percentage was calculated. To evaluate the presence of the vector (mean copy number), replicate colonies were picked on LB agar plates containing nalidixic acid (35 μg / ml) and chloramphenicol (10 μg / ml) and the percentage was calculated. To evaluate the presence of both the pYV plasmid and the vector (mean copy number), replicate colonies were picked on LB agar plates containing nalidixic acid (35 ug / ml), arsenite (400 uM), and chloramphenicol (10 ug / ml). ml) and the percentage was calculated. B) Results A protein delivery system based on type 3 secretion of YopE fusion proteins The N-terminal 138 amino acids of YopE (SEQ ID NO: 25) were selected to fuse to the proteins to be delivered, as this has been shown to give the best results for the translocation of other heterologous T3S substrates68. Since these 138 amino acids at the N-terminal end of YopE contain the CBS, it was decided to co-express SycE. The SycE-YopEi-i38 fragment cloned from the purified Y. enterocolitica virulence plasmid pYV40 contains the endogenous promoters of YopE and its chaperone SycE. Therefore, SycE and any fusion protein to YopEi-us are induced by a rapid change in temperature from culture at RT to 37°C. Culture time at 37°C will affect the amount of fusion protein present in the bacteria. A multiple cloning site (MCS) was added to the 3' end of YopEi.138 optionally followed by a Myc and a 6xHis tag and a stop codon (SEQ ID NO: 44). The background strain was carefully selected. First, to limit the translocation of endogenous electors, a Y. enterocolitica strain was used that was deleted for all known effectors, Yop Η, O, P, E, M and T (named ΔΗΟΡΕΜΤ)37. Attenuation of virulence by deletion / mutation of bacterial elector proteins with virulence activity towards eukaryotic cells In the case of Y. enterocolitica, virulence was reduced by deletion of the six endogenous elector proteins, called Yersinia external proteins” (Yop), in detail YopH, O, P, E, Μ, T (MRS40 pIML421 [yopHAl -352, yopOA65-558, yopP23, yopE21, yopM23, yopT135])37. These Yops are encoded in the Yersinia' virulence plasmid (pYV), a plasmid of approximately 70 kbp, in which the complete type 3 secretion system (T3SS) is encoded, as well as other virulence agents (Figure 1). YopH, O, P, E, M and T are the six elector proteins, which are delivered to host cells by the bacterial type three secretion system to modulate and attenuate the immune system. Each Yop has a specific biochemical activity in the host cell. YopT cleaves the C-terminal Cysteine ​​of Rho GTPases and thereby removes the isoprenyl group anchoring the GTPases to the membrane. This inactivation of Rho due to loss of localization prevents phagocytosis by immune cells such as macrophages and neutrophils49. In the same pathway, YopE acts as a GTPase-activating protein (GAP) for Rho GTPases, inactivating them. This results in decreased phagocytosis and inhibition of IL-1 beta release by immune cells49. Furthermore, YopO acts as a guanidine nucleotide dissociation inhibitor (GDI), deactivating Rho GTPases. YopO also has a serine / threonine kinase domain that acts in an as yet undefined manner on the actin cytoskeleton49. YopH is a tyrosine phosphatase that acts on focal adhesion proteins such as Focal Adhesion Kinase (Fak), paxillin and others, thereby 99 strongly preventing phagocytosis by macrophages and neutrophils49. YopP, named YopJ in Y. pseudotubercidosis or Y. pestis, was found to inactivate the MAPK / NFkB pathway in immune cells, preventing the release of TNFα and IL-8 from immune cells stimulated by the presence of the bacteria. Furthermore, YopP was found to induce apoptosis in immune cells, which could be related to the effect on the MAPK pathway, which in its activated state protects cells from apoptosis49. The role of YopM is not completely clear, but it was found associated with ribosomal S6 kinase 1 (RSK1) and protein kinase C-like 2 (PRK2). It appears that YopM could stimulate RSK1 phosphorylation and therefore affect downstream targets, such as cell cycle progression49. By deleting one or more of these Yops, the defense mechanism of bacteria against the immune system is dramatically affected3°. The mutation of the respective yops was confirmed by PCR in the respective region, and by an in vitro secretion assay. Analysis of in vitro secretion by SDS-PAGE and Coomassie blue staining confirmed the absence of full-length ΥορΗ,Ο,Μ and YopE. Additionally, a Y. enterocolitica strain with deletions in asd (aspartate semialdehyde dehydrogenase) was optionally constructed. The mutation in asd leads to a complete loss of growth capacity without the addition of meso-diamino-pimelic acid. This allows generating antibiotic-free plasmid maintenance systems based on the presence of asd in the respective plasmid. In a similar manner, other auxotrophic mutants could be used. Fusion to the N-terminal secretion signal of bacteria led to the successful delivery of the YopEj.Bs-leucine zipper protein from GCN4 (yeast)-GGDEF from WspR (P. aeruginosa) expressed in bacteria and did not prevent folding and function of this tripartite protein within the eukaryotic cell. This implies, that the leucine zipper of GCN4 fused to YopE GGDEF of WspR can still dimerize and thus lead to active GGDEF domains, which is surprising. Delivery of proteins that trigger the cGAS / STING pathway and the RIG-1-like receptor through the bacterial T3SS for the induction of a type I IFN response and optimization of gene coding. In the following section, different type I IFN reporter cell lines (as well as native non-reporter cell lines) have been used: • B16F1 murine melanoma: In the B16F1 reporter cell line, cGAS delivery only minimally contributes to IFN induction compared to RIG-1 signaling 100 ncnbnn / cznz / B / Yi (Figures 18A-18D). Therefore, the B16F1 reporter cell line can be used to primarily assess RIG1-dependent signaling and its perturbation by additionally encoding cGAS or other STING-activating proteins. • RAW 264.7 murine macrophages: In the RAW reporter cell line, cGAS delivery and activation of RIG signaling contribute to overall activation in a comparable manner (Figures 18A-18D). Therefore, the RAW reporter cell line can be used to evaluate the combination of RIG1- and cGAS-dependent signaling and its perturbation or potentiation by multiple coding. • THP-1 human monocytes / macrophages: In the THP-1 reporter cell line, cGAS delivery mainly contributes to the induction of IFN in THP-1 cells compared to RIG-1 signaling (Figures 18A-18D) . Therefore, the THP-1 reporter cell line can be used to primarily assess cGAS-dependent signaling and its perturbation by additionally encoding RIG-1 or other RLR-activating proteins. Delivery of the ΥορΕι-πχ RIG-1 CARD fusion protein? human (RIG-11-245) was evaluated in a melanoma reporter cell line for the induction of type I IFN. Murine B16F1 melanoma reporter cells for type I IFN stimulation rely on secreted alkaline phosphatase activity, which is under the control of the I-ISG54 promoter, which is comprised of the IFN-inducible ISG54 promoter enhanced by a multimeric ISRE. In this cell line, cGAS delivery only minimally contributes to IFN induction in B16F1 cells compared to RIG signaling. Therefore, this reporter cell line can be used to primarily evaluate RIG-dependent signaling and its perturbation by additionally encoding cGAS or other STING-activating proteins. Reporter cells were infected with various amounts (MOI) of bacterial strains that express and translocate the YopEi138 - RIG-1 CARD? human (RIG-I1.245) and ΥορΕι-Bs- cGAS humanoi6i-5??. It was shown that YopE1-138 — RIG-1 CARD? human dose-dependently induces a type I IFN response in this melanoma reporter cell line (Figure 8), while the background bacterial strain (T. enterocolitica ΔΗ0ΡΕΜΤ) was unable to induce such a response (Figure 8). YopEi-i.38 RIG-1 CARD activity was found? human slightly higher when encoded in the medium copy number vector (such as pBad_Si2 or pT3P-715) compared to encoded in the pYV (Figure 8). It was found that the additional coding of YopEi-i38- human cGASiói-5?? in pYV (where the supply of cGASi6i-5?? only minimally contributes to the induction of IFN in B16F1 cells) does not affect the activity of YopEiuís - RIG-1 CARD? 101 human ncnbnn / cznz / B / Yi encoded by pYV. Therefore, the activity of human YopEi-us-RIG-1 CARD2 was found surprisingly high when encoded in the pYV compared to vector encoding, since due to the very low copy number (single) compared to a vector (of medium copy number) a strongly reduced activity must be assumed. Furthermore, we found that additional encoding of YopEi-i38-human cGASi6i-522 in the pYV did not impair the activity of YopE|.| <s rig-1 card2 humana codificada por pyv, lo que es igualmente sorprendente, ya debe esperarse la presencia de una segunda proteína carga conduzca a cantidades reducidas suministro primera carga.Delivery of the YopEi-138 - human cGAS i6i-522 fusion protein was evaluated in a RAW macrophage reporter cell line for the induction of type I IFN. Reporter cells were infected with various amounts (MOI) of bacterial strains expressing and they translocate the YopEi. 138- cGAS humanoi6i-522. YopEi-138-human cGASi6i-522 was shown to dose-dependently induce a type I IFN response in this melanoma reporter cell line (Figure 9), while the background bacterial strain (Y. enterocolitica ΔΗ0ΡΕΜΤ) did not. could induce such a response (Figure 9). The activity of YopE|.i38 - cGAS humani6i-?22 was found strongly increased when encoded in the medium copy number vector (such as pBad_Si2 or pT3P-715) compared to encoded in the pYV (Figure 9). Delivery of the murine YopEi-138-RIG-1 CARD2 fusion protein (RIG-Ij-246) was evaluated in a melanoma reporter cell line for the induction of type I IFN. Murine B16F1 melanocyte reporter cells were infected with various quantities (MOI) of bacterial strains that express and translocate the YopEi-i38-RIG-1 CARD? murine. Murine YopEi-138 RIG-1 CARD2 was shown to dose-dependently induce a type I IFN response in this melanoma reporter cell line (Figure 10), whereas the background bacterial strain (K. enterocolitica AHOPEMT) did not. could induce such a response (Figure 10). The activity of murine YopEi438RIG-1 CARD2 was found slightly higher when encoded in the medium copy number vector (such as pBad_Si2 or pT3P-715) compared to encoded in the pYV (Figure 10). The dual encoding of murine YopEi-ns- RIG-1 CARD2 in the pYV and a medium copy number vector was found comparable to murine YopEi-138- RIG-1 CARD2 encoded only with medium copy number vector, while surprisingly shows a higher signal already at lower MOIs (Figure 10). The delivery of the human YopEi-i3s-RIG-1 CARD2 fusion protein (RIG-I1-245) was evaluated. 102 combined with YopEi-i38-human cGASi6i-522 in a melanoma reporter cell line for the induction of type I IFN. In the murine B16F1 melanocyte reporter cell line, delivery of cGASi6i-522 only minimally contributes to the induction of IFN in B16F1 cells compared to RIG signaling. Therefore, this reporter cell line can be used to primarily evaluate RIG-dependent signaling and its perturbation by additionally encoding cGASiéi-522 or other STING-activating proteins. Reporter cells were infected with various amounts (MOI) of bacterial strains that express and translocate human YopEi-138-RIG-1 CARD2, and human YopEi-138-cGASi6i-522. Human YopEi-138RIG-1 CARD 2 combined with human YopEi-138-cGASi6i-522 was shown to dose-dependently induce a type I IFN response in this melanoma reporter cell line (Figure 11), while the bacterial strain of background (Y. enterocolitica AHOPEMT) could not induce such a response (Figure 11). The activity was found identical when both human YopEi-138- RIG-1 CARD 2 and human YopEi-138- cGAS 61-522 were encoded in the medium copy number vector (such as pBad_Si2 or pT3P-715) as well as in the pYV compared to the human YopEi-138 RIG-1 encoding in the medium copy number vector (such as pBad_Si2 or pT3P-715) and in the pYV and, additionally, the human YopEi.j38-cGAS encoding i6i-522 alone in the pYV (Figure 11). Therefore, we found that additional encoding of YopE1-138-cGAS humanolñi-522 (where delivery of CGAS161-522 only minimally contributes to the induction of IFN in B16F1 cells) in the vector does not affect YopEi activity. -138-RIG1-human CARD2 encoded by pYV and the vector (Figure 11). The delivery of the YopE fusion protein was evaluated. 1 for the induction of type I IFN. The B16F1 reporter cell line can be used to primarily evaluate RIG1-dependent signaling, the THP-1 cell line to primarily evaluate cGAS-dependent signaling, and the RAW cell line to evaluate the potential of joint activation of cGAS and RIG-1. Reporter cells were infected with various amounts (MOI) of bacterial strains that express and translocate human YopEi138- RIG-1 CARD2, and human YopEi-us- cGAS i6i-522- YopEi-138 - RIG-1 CARD 2 combined with YopEi-138-human cGAS-522 was shown to dose-dependently induce a type I IFN response in all reporter cell lines (Figures 12A-12C), while the background bacterial strain (F. enterocolitica ΔΕΙΟΡΕΜΓ) could not induce such a response (Figures 12A-12C). ncnbnn / cznz / B / Yi 103 In B16F1 cells reflecting RIG-1-dependent signaling, a stronger signal was observed when human YopEi-ias-RIG-1 CARD2 was encoded in a medium copy number vector, while the difference with YopE 1-138 - Human RIG-1 CARD2 encoded by pYV is small. The additional encoding of cGASiñi-522 in the vector appears not to hinder the delivery and activity of human RIG-1 CARD2 (Figures 12A-12C). In THP-1 cells reflecting cGAS-dependent signaling, the strongest signal was observed when YopEi-138-humani6i-522 cGAS was encoded in a medium copy number vector, with a marked difference from YopEi-138-cGAS. humanoi6i-522 encoded by pYV. The additional RIG-1 CARD2 encoding in the vector appears not to hinder the delivery and activity of CGAS161-522 (Figures 12A-12C). In RAW cells reflecting cGAS- and RIG-1-dependent signaling, the signals were found the same whether CGAS161-522 or RIG-1 CARD2 were encoded only by pYV or additionally by a (medium copy number) vector. (Figures 12A-I2C). In this cell line, the maximum level of activation was reached at very low MOIs, which may explain the equality of the signal of all the constructs evaluated. In summary, delivery of human cGAS i6i-522 and RIG-ICARD2 encoded in the endogenous pYV plasmid and, additionally, in a medium copy number vector, provided the best results when considering the results of all cell lines evaluated and, therefore, Therefore, it appears to show high supply and activity independent of cell type. Biodistribution studies in a murine model of breast cancer: Mice carrying syngeneic subcutaneous 4T1 breast tumors were colonized with different bacterial strains by iv administration and colonization was evaluated. To validate the Y. enterocoliticu subsp. palearctica MRS40 AyopH,0,P,E,M,T and derivatives encoding heterologous type I IFN-inducing proteins (either in pYV or in a vector, or in both pYV and in a vector), studies of murine ograft tumors by using the established 4T1 breast cancer model (ATCC no. CRL-2539). When s.c. tumors had reached a certain size (approximately 100-200 mm3), the mice were infected i.v. with 1x107ufe of Y. enterocolitica subsp. palearctica MRS40 AyopH,O,P,E,M,T, either with a control strain that does not supply cargo, or that encodes the endogenous pYV plasmid human YopEi-i38-cGASi6i-?22 and YopE,-138- RIG -I human CARD2 (RIG-I1-245) or that encodes both the endogenous pYV plasmid and a medium copy number vector ΥορΕι-138-cGAS humani6i-522 and ΥορΕι-138-RIG-I CARD2 human, or that encodes both the endogenous pYV plasmid and a vector of number ncnbnn / cznz / B / Yi 104 high-copy YopEi-iss-cGAS humani6i-522 and YopEi-138 human- RIG-I CARD2 human, or encoding both the endogenous pYV plasmid and a low-copy vector ΥορΕχ 138-cGAS humanoi6i-522 and YopE1-138- RIG-I CARD2 human. To allow bacterial growth, mice were pretreated 24 hours before infection with desferoxamine. Mice infected with the strain Y. enterocolitica subsp. palearctica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ with attenuated virulence did not show significant weight loss and had a normal physical appearance or behavior score even on day 6 after infection. Bacterial load was determined as colony-forming units CFU per gram of tumor (CFU / g) (Figure 13) on day 6 after infection. In these mice infected with Y. enterocolitica subsp. palearctica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ, live bacteria were found in the malignant solid tumor on day 6 after infection (Figure 13). Similarly, for all strains derived from Y. enterocolitica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ, whether encoding a heterologous type I IFN protein in the pYV, in a vector or in both the pYV and a vector, live bacteria were found in the malignant solid tumor on day 6 after infection at levels similar to Y. enterocolitica ΔγορΗ,Ο,Ρ,Ε,Μ,Τ. Delivery of YopEi-ns-cGAS humani6i-522 and YopEi-138RIG-I CARD2 and vector copy number was found not to alter bacterial loads in solid tumors in the 4T1 breast cancer model (Figure 13). The expression and secretion of human YopEj.ias-RIG-I CARD 2 (RIG-I1-245) was evaluated in relation to the copy number of the vector encoding human YopE]-j3s-RIG-I CARD2. For this, in vitro secretion experiments were carried out. Expression in bacteria or secretion to the supernatant was evaluated for Y. enterocolitica ΔγορΗΟΡΕΜΤ, either a control strain that does not supply a cargo, or encoding a low, medium or high copy number vector YopEi.138-RIG- I CARD2 human. Expression was found higher for the high copy number plasmid (Figure 14 I), which is in agreement with expectations based on a higher copy number of the vector encoding human YopEi-138-RIG-I CARD2. Surprisingly, in the secretion assay, secretion was found higher for low and medium copy number plasmid, while encoding based on high copy number plasmid evidently produced less secretion of YopEi-138-RIG-I. human CARD2. (Figure 14 II). Therefore, the high copy number plasmid appears to lead to increased expression but decreased secretion capacity of human YopEi-us-RIG-I CARD2 (Figure 14). Furthermore, in cell-based assays using the B16F1 reporter cell line, activation potential was assessed in relation to the copy number of the vector encoding only YopEi.138105 nojbnn / cznz / B / Yi Human RIG-I CARD2 (RIG-I1-245) in addition to human YopEi-Bs-RIG-I CARD2 and human YopEi-Bs-cGAS6i-522 encoded by pYV (Figure 15). Surprisingly, for human YopEi.ns-RIG-I CAREE encoded in a vector in addition to human 1-138RIG-I CARD2 and human YopEi.B8-cGASi6i-522 encoded by pYV, the induction of type IFN I was weaker when encoding human YopEi-138-RIG-I CARD2 in a low copy number vector (Figure 15). This is in contrast to the secretion analysis (Figure 14), but can be explained by the interaction of vector- and pYV-based coding (as in Figure 10) and vector-only-based coding (as in Figure 8). The greatest induction of type I IFN was observed when human YopE1-138-RIG-I CARD2 was encoded from a medium copy number plasmid (Figure 15). Delivery of human YopEi-ns RIG-1 CARD2 (RIG-I1-245) fusion protein combined with human YopEi-B8- cGAS i6i-522 was evaluated in B16F1 melanoma, RAW macrophage, and THP-1 reporter cell line. human for the induction of type I IFN in relation to the number of copies of the vector encoding both human YopE|-B8-RIG-I CARD2 and human YopEi-B8-cGASi6i-522 (Figures 16A-16C). The B16F1 reporter cell line can be used to primarily assess RIG1-dependent signaling, the THP-1 cell line to primarily assess cGAS-dependent signaling, and the RAW cell line to assess the joint activation potential of cGAS and RIG-1 (Figures 18A-18D). Reporter cells were infected with various amounts (MOI) of bacterial strains that express and translocate human YopEi138 RIG-1 CARD2, and human YopEi.138- cGAS i6i-522- YopEi-Bs - RIG-1 CARD 2 combined with YopEj. .i.38- human cGASi6i-522 was shown to dose-dependently induce a type I IFN response in all reporter cell lines (Figures 16A-16C), while the background bacterial strain (T. enterocolitica ΔΗΟΡΕΜΤ) did not was able to induce such a response (Figures 16A-16C). In all cell lines evaluated, the combination of pYV-encoding for human YopEi-138RIG-1 CARD2 and human YopEi-138-cGASi6i-522 with vector-based encoding for human YopEi-i38-RIG-1 CARD2 and YopEi-B8- Human cGAS i6i-?22 was inducing the highest type I IFN activation when the vector was a medium copy number vector (Figures 16A-16C), followed by the low copy number plasmid and the weakest by the high copy number (Figures 16A-16C). While the results show that a double encoding in the pYV and a vector is beneficial for greater activation of type I IFN (see Figures 10 and 19A-19B) as well as for genetic stability (see Figures 20 and 106 21), these data suggest that a medium copy number vector would be optimal. Summarizing the results on the impact of the copy number of the vector encoding YopEi. 138- human RIG-I CARD2 (RIG-I1-245), ΥορΕι-138-human cGASi6i-522 or YopEi-i38- human RIG-I CARD2 and human YopEi-i38-cGASi6i-522 (Figures 14-16A-16C) , a medium copy number vector is the most favorable. The optimal combination for delivery of two proteins encoded in an endogenous virulence plasmid and in a medium copy number vector, shown here for YopEi-138 - human RIG-1 CARD2 (RIG-I1-245) and YopEi- 138- cGAS humanoi6i-522 is depicted in Figure 17. The optimized delivery and genetic stability of cGAS humanoi6i-522 and RIG-I CARD2 is achieved by encoding in the endogenous pYV plasmid and, additionally, in a vector of number means of copies. By studying the delivery of type I IFN-inducing proteins YopEi-i38-human cGASi6i-522 and YopEi-138-RIG-I CARD2 and their effect on different cell types, the differential induction capacity of these two proteins was evaluated. An optimized combination of fusion proteins should then allow activation of a diverse set of cell types. Delivery of human YopEi-i3s-cGASi6i-?22 and YopEj.i38-RIG-I CARD2 leads to differential induction of type I IFN signaling in B16F1 melanocytes (Figure 18A), human glioblastoma LN-229 (Figure 18B) , murine RAW macrophages (Figure 18C) or human THP-1 macrophages (Figure 18D). YopEi-i38-RIG-I CARD2 leads to stronger type I IFN induction than human YopEi-i3s-cGASi6i-522 in murine B16F1 and human LN-229 glioblastoma cells. In murine RAW macrophages, the type I IFN-inducing potential of YopE|.i3s-cGAShumani6i-522 and YopEi-i38-RIG-I CARD2 is comparable, while ΥορΕι-138-cGAShumani6i522 outperforms YopEi-138-RIG- I CARD2 in human THP-1 macrophages. As an example, the murine B-cell lymphoma cell line A20 was infected with Y. enterocolitica ΔΗΟΡΕΜΤ encoding human YopEi-138RIG-I on a medium-copy number plasmid CARD2, which encodes on a medium-copy number plasmid ΥορΕι- 138-human RIG-I CARD2 and YopEi-i38-human cGASi6i-522 or encoding on a medium copy number plasmid and in the pYV YopEi-138- human RIG-I CARD2 and YopE].]38-human cGASi6i- 522- The strain encoding a plasmid of medium copy number YopEi-138- RIG-I human CARD2 induces less type I IFN response in A20 cells than the strain encoding a plasmid with a medium copy number YopEi- 138- human RIG-I CARD2 and human YopEi-B8-cGAS, 1-522, which is again surpassed by a strain that encodes a medium copy number plasmid and ncnbnn / cznz / B / Yi 107 on the pYV ΥορΕι-Bs- RIG-I CARD? human and YopEi-i38-cGAS humanoi6i-522 (Figure 19A). In another example, the human T cell line Jurkat was infected with Y. enterocolitica \H0PEMT encoding human YopEi-B8-RIG-I CARD2 and human YopEi.138-cGASi6i-522 on a medium copy number plasmid. in a plasmid of medium copy number and in the pYV YopEi-i38-RIG-I CARD? human and human ΥορΕΐ-138-cGAS i6i-522. The strain encoding a medium copy number plasmid YopEi.138-RIG-I CARD? human and Yopei-138-cGAS humanoi6i-52?, is surpassed by a strain that encodes a medium copy number plasmid and the pYV YopEi-138-RIG-I CARD? human and ΥορΕΐ-138-cGAS humanoi6i-5?? (Figure 19B). To evaluate genetic stability when bacterial strains are cultured in vivo (grown in tumors), mice bearing syngeneic subcutaneous B16F10 melanoma tumors were colonized with a bacterial strain of Y. enterocolitica subsp. palearctica MRS40 ΔνορΗ,Ο,Ρ,Ε,Μ,Τ encoding in the endogenous pYV plasmid both YopEi.B8-cGAS humani6i522 and YopEi-138- RIG-I CARD2 human (RIG-I1-245) by iv administration and were evaluated bacteria isolated from the tumor to determine the presence of the respective selection marker. When s.c. tumors had reached a certain size (approximately 100-200 mm3), the mice were infected i.v. with IxlO6ufe from Y. enterocolitica subsp. palearctica MRS40 AyopH,O,P,E,M,T, which encodes both YopE in the endogenous pYV plasmid]. 138-cGAS humanioi52? like YopEj-138-RIG-I CARD? human. To allow bacterial growth, mice were pretreated 24 hours before infection with desferoxamine. Mice infected with the Y. enterocolitica subsp. palearctica MRS40 AyopH,O,P,E,M,T with attenuated virulence did not show significant weight loss and had a normal physical appearance and behavior score. Bacteria were isolated on days 2 and 4 postinfection and replicates were collected on selective agar plates to evaluate the presence of the endogenous pYV plasmid (Figure 20). In almost all animals tested, the pYV plasmid was found highly stable and present on day 2 and day 4 after administration (Figure 20). Similarly, mice bearing syngeneic subcutaneous EMT-6 breast tumors were colonized with a bacterial strain Y. enterocolitica subsp. palearctica MRS40 AyopH,O,P,E,M,T that encodes both YopEj.Bs-cGAS humanoiei52 in the endogenous pYV plasmid? like YopEi.i38-RIG-I CARD? human (RIG-I1-245) by its administration and the bacteria isolated from the tumor were evaluated to determine the presence of the respective selection marker. When s.c. tumors reached a certain size (approximately 100-200 mm3), the mice were infected i.v. with 7.5x107ufe of Y. enterocolitica subsp. palearctica MRS40 108 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ, which encodes both human YopEi-ns-cGASiói522 and human YopEi.i38-RIG-I CAREE in the endogenous pYV plasmid. To allow bacterial growth, mice were pretreated before infection with deferoxamine. Mice infected with the Y. enterocolitica subsp. palearctica MRS40 ΔγορΗ,Ο,Ρ,Ε,Μ,Τ with attenuated virulence did not show significant weight loss and had a normal physical appearance and behavior score. Bacteria were isolated on day 1 and 2 postinfection and replicates were picked on selective agar plates to assess the presence of the endogenous pYV plasmid and the medium copy number vector (Figure 21). In almost all animals tested, the pYV plasmid and vector were found highly stable and present on day 1 and day 2 after administration (Figure 21). It was also found that some isolated bacterial colonies only contained the pYV plasmid but not the medium copy number vector and vice versa. Overall, the pYV plasmid was found to be slightly more stable than the mid-copy number vector until day 2 post-administration. To evaluate the impact of human YopE|-i3s-RIGl CARD2 (RIG-li-245) and human YopEi-i.ss-cGASi6i-522 delivered to tumor cells in vivo, studies were performed in wild-type C57BL / 6 mice with s.c. allograft of B16F10 melanoma cells. The mice were injected intratumorally (it) with PBS (Figure 23) or 7.5* 107Y. enterocolitica ΔΗΟΡΕΜΤ (Figure 24), Y. enterocolitica ΔΗΟΡΕΔ1Τ + YopE1-138 human RIG1 CARD2 and YopEi.138 human cGASi6i-522 encoded in the endogenous pYV plasmid (at the endogenous yopH and yopE sites, respectively) (Figure 25) and, Additionally, in a medium copy number vector (where YopE].i3s-cGAS humani6i-522 and YopEi.]38-RIG-I CARD2 are encoded in an operon under the control of the yopE promoter) once the tumor reached a size of approximately 60-130 mm3. The day of the first it injection of bacteria was defined as day 0. Mice were injected via it on day dO, di, d5, d6, dlO and di 1. Tumor volume was measured over the following days with calipers. Treatment with Y. enterocolitica ΔΗΟΡΕΜΤ alone showed an impact on tumor volume progression, where 2 / 15 mice exhibited complete tumor regression (Figure 24). Y. enterocolitica ΔΗΟΡΕΜΤ delivering human YopEi-i3s-cGASi6i-522 and ΥορΕι-138-RIG-l CARD2 was found to lead to a more pronounced impact on tumor progression with 8 / 15 mice showing complete and long-lasting tumor regression (Figure 25). Also on average tumor volumes, the impact of Y. enterocolitica ΔΗΟΡΕΜΤ alone and additionally by delivery of ΥορΕι-138-cGAS humanoi6i-522 and YopEι-138-RIG-I CARD2 can be seen (Figure 22). These findings indicate that such bacteria and their T3SS 109 ncnbnn / cznz / B / Yi can be used for very significant interference with tumor progression and that the delivery of type I IFN-inducing proteins is very suitable to induce regression of a primary tumor. . In summary, vector-encoded human YopEi.ns-cGAS61,522 and to a lesser extent also vector-encoded human YopEι-138-RIG-I CARD2 lead to greater activation of the type I IFN response than encoded by the plasmid pYV (Figures 8 and 9). Dual coding of human YopEi-138-RIG-I CARD2 and human ΥορΕΐ-138-cGASi6i-522 in the vector does not affect the activity of each individual cargo (Figures 11 and 12A-12C). Encoding two different heterologous cargoes has the advantage of a broader activation potential in various cell types (Figures 18A-18D and 19A-19B). Therefore, vector-based encoding seems necessary for high activation potential, while a double encoding of two heterologous charges was found to increase the overall activity, i.e., the combination of RIG-I CARD2 with cGASi6i-522 led to interferon signaling in more diverse cell types compared to delivery of CGAS161-522 or RIG-I CARD2 alone. pYV coding of heterologous proteins has the advantage of greater genetic stability in vivo over vector-based coding (Figure 20 and 21). Vector and pYV-based coding of human ΥορΕΐ-138-RIG-I CARD2 and human YopE|.i3s-cGASiói-522 were found superior or comparable to vector-only coding in terms of IFN activation potential (Figures 10 and 19A-19B). Overall, these findings show that combined delivery of human cGAS and human RIG-I CARD increases the range of cell types in which type I IFN induction can be achieved (compared to delivery of cGAS alone or RIG-I CARD). I CARD alone), and increases the potency of interferon induction in some cell types. A double encoding, on pYV and a vector, of human ΥορΕΐ-138-RIG-I CARD2 and human YopEi138-cGASi6i-522. therefore, it can be considered optimal for maximum activity of human YopEi-138-RIG-I CARD2 and human YopEi-138-cGASi6i-522 (see Figures 19A-19B as an example) and for the best genetic stability (see Figures 20 and twenty-one). Additionally, a medium copy number vector was found to be superior to low or high copy number vectors (Figures 13-16A-16C). A strain combining pYV-based encoding and a medium copy number vector of human YopEi-i38-cGASi6i-522 and YopEi-i38-RIG-I CARD2 (e.g., as shown in Figure 17), where in the mean copy number vector YopE|.i3s-cGAS humani6i-522 and YopEi. 110 138-RIG-I CARD2 are encoded in one operon, thus combining all the beneficial characteristics (wide range of activation potential of cell types, higher potency and genetic stability). Such a strain (as shown in Figure 17) has also finally been verified for its impact on tumor progression in a solid tumor animal model (Figures 22-25), where it was found to cause complete and long-lasting tumor regression in more of 50% of the treated animals. REFERENCE LIST Hayes, C. S., Aoki, S. K. and Low, D. A. Bacterial contact-dependent delivery systems. Annu Rev Genet 44, 71-90, doi: 10.1146 / annurev.genet.42.110807.091449 (2010). Comelis, G. R. The type III secretion injectisome. Nat Rev Microbiol 4, 811-825, doi:nrmicro 1526 [pii]10.1038 / nrmicrol526 (2006). Blanco-Toribio, A., Muyldermans, S., Frankel, G. and Fernandez, L. A. Direct injection of functional single-domain antibodies from E. coli into human cells. 3PLoS One 5, el5227, doi: 10.1371 / journal.pone.OO 15227 (2010). Bichsel, C. et al. Direct reprogramming of fibroblasts to myocytes via bacterial injection of MyoD protein. Cell Reprogram 15, 117-125, doi: 10.1089 / cell.2012.0058 (2013). Bichsel, C. et al. Bacterial delivery of nuclear proteins into pluripotent and differentiated cells. PLoS One 6, el6465, doi: 10.1371 / journaLpone.0016465 (2011). Chamekh, M. et al. Delivery of biologically active anti-inflammatory cytokines IL-10 and IL-lra in vivo by the Shigella type III secretion apparatus. JImmunol 180, 4292-4298 (2008). Skurnik, M. and Wolf-Watz, H. Analysis of the yopA gene encoding the Yopl virulence determinants of Yersinia spp. Mol Microbiol 3, 517-529 (1989). Isberg, R. R., Voorhis, D. L. and Falkow, S. Identification of invasion: a protein that allows enteric bacteria to penetrate cultured mammalian cells. Cell 50, 769-778 (1987). Mota, L. I. and Cornelis, G. R. The bacterial injection kit: type III secretion systems. Ann Med 37, 234-249, doi:R673752030212825 [pii] 10.1080 / 07853890510037329 (2005). Trosky, J. E., Liverman, A. D. and Orth, K. Yersinia outer proteins: Yops. Cell Microbiol 10, 557-565, doi: 10.1111 / j. 1462-5822.2007.01109.x (2008). Brenner, D. and Mak, T. W. Mitochondrial cell death effectors. Curr Opin Cell Biol 21, 871877, doi:S0955-0674(09)00160-4 [pii] 10.1016 / j.ceb.2009.09.004 (2009). Chalah, A. and Khosravi-Far, R. The mitochondrial death pathway. Adv Exp Med Biol 615, ncnbnn / cznz / B / Yi 111 25-45, doi: 10.1007 / 978-1-4020-6554-5.3 (2008). Fuchs, Y. and Steller, H. Programmed cell death in animal development and disease. Cell 147, 742-758, doi:S0092-8674( 11 )01283-9 [pii] 10.1016 / j.cell.2011.10.033 (2011). Waugh, D. S. An overview of enzymatic reagents for the removal of affinity tags. Protein ExprPurifW, 283-293, doi:S1046-5928(l 1)00203-8 [pii] 10.1016 / j.pep.2011.08.005 (2011). Howard, S. L. et al. Application of comparative phylogenomics to study the evolution of Yersinia enterocolitica and to identify genetic differences relating to pathogenicity. J Bacteriol 188, 3645-3653, doi: 10.1128 / JB. 188.10.3645-3653.2006 (2006). Thomson, N. R. et al. The complete genome sequence and comparative genome analysis of the high pathogenicity Yersinia enterocolitica strain 8081. PLoS Genet 2, e206, doi: 10.137 l / joumal.pgen.0020206 (2006). Pelludat, C., Hogardt, M. and Heesemann, J. Transfer of the core region genes of the Yersinia enterocolitica WA-C serotype 0:8 high-pathogenicity island to Y. enterocolitica MRS40, a strain with low levels of pathogenicity, confers a yersiniabactin biosynthesis phenotype and enhanced mouse virulence. Infect Itnnuin 70, 1832-1841 (2002). Mulder, B., Michiels, T., Simonet, M., Sory, Μ. P. and Cornelis, G. Identification of additional virulence determinants on the pYV plasmid of Yersinia enterocolitica W227. Infect Immun 57, 2534-2541 (1989). Sory, Μ. P. and Cornelis, G. R. Translocation of a hybrid YopE-adenylate cyclase from Yersinia enterocolitica into HeLa cells. Mol Microbiol 14, 583-594 (1994). Sarker, M. R., Neyt, C., Stainier, I. and Cornelis, G. R. The Yersinia Yop virulon: LcrV is required for extrusion of the translocators YopB and YopD. J Bacteriol 180, 1207-1214(1998). Neubauer, H., Aleksic, S., Hensel, A., Finke, E. J. and Meyer, H. Yersinia enterocolitica 16S rRNA gene types belong to the same genospecies but form three homology groups. Int J Med Microbiol 290, 61-64, doi: 10.1016 / S1438-4221 (00)80107-1 (2000). Feldman, M. F., Muller, S., Wuest, E. and Cornelis, G. R. SycE allows secretion of YopEDHFR hybrids by the Yersinia enterocolitica type III Ysc system. Mol Microbiol 46, 1183-1197, doi:3241 [pii] (2002). Ramamurthi, K. S. and Schneewind, O. A synonymous mutation in Yersinia enterocolitica yopE affects the function of the YopE type III secretion signal. J Bacteriol 187, 707-715, doi: 10.1128 / JB. 187.2.707-715.2005 (2005). Wolke, S., Ackermann, N. and Heesemann, J. The Yersinia enterocolitica type 3 secretion ncnbnn / cznz / B / Yi 112 system (T3SS) as toolbox for studying the cell biological effects of bacterial Rho GTPase modulating T3SS effector proteins. Cell Microbe! 13, 1339-1357, doi: 10.1111 / j. 14625822.2011.01623.x (2011). Forsberg, A. and Wolf-Watz, H. Genetic analysis of the yopE region of Yersinia spp.: Identification of a novel conserved locus, yerA, regulating yopE expression. J Bacterial 172, 15471555 (1990). Sambrook, J. (ed David W. Russell) (Coid Spring Harbor Laboratory Press, Coid Spring Harbor, N.Y., 2001). Alto, N. M. and Dixon, J. E. Analysis of Rho-GTPase mimicry by a family of bacterial type III effector proteins. Methods Enzymol 439, 131-143, doi:S0076-6879(07)00410-7 [pii] 10.1016 / S0076-6879(07)00410-7 (2008). Alto, N.M. and others. Identification of a bacterial type III effector family with G protein mimicry functions. Cell 124, 133-145, doi:S0092-8674(05)01229-8 [pii] 10.1016 / j.cell.2005.10.031 (2006). Kaniga, K., Delor, 1. and Cornelis, G. R. A wide-host-range suicide vector for improving reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene 109, 137-141, doi:0378-l 119(91)90599-7 [pii] (1991). Yoneda, Y. and others. A long synthetic peptide containing a nuclear localization signal and its flanking sequences of SV40 T-antigen directs the transpon of IgM into the nucleus efficiently. Exp Cell Res 201, 313-320(1992). Metcalf, W. W., Jiang, W. and Wanner, B. L. Use of the rep technique for allied replacement to construct new Escherichia coli hosts for maintenance of R6K gamma origin plasmids at different copy numbers. Gene 138, 1-7 (1994). Diepold, A. et al. Deciphering the assembly of the Yersinia type III secretion injectisome. EmboJ29, 1928-1940, doi:emboj201084 [pii] 10.1038 / emboj.2010.84 (2010). Iriarte, M., Stainier, I. and Cornelis, G. R. The rpoS gene from Yersinia enterocolitica and its influence on expression of virulence factors. Infected Immun 63, 1840-1847 (1995). Cornelis, G., Vanootegem, J. C. and Sluiters, C. Transcription of the yop regulon from Y. enterocolitica requires trans acting pYV and chromosomal genes. Microb Paíhog 2, 367-379, doi:0882-4010(87)90078-7 [pii] (1987). Grosdent, N., Maridonneau-Parini, L, Sory, Μ. P. and Cornelis, G. R. Role of Yops and adhesins in resistance of Yersinia enterocolitica to phagocytosis. Infect hnmun 70, 4165-4176 113 ncnbnn / cznz / B / Yi (2002). Boyd, A. P., Lambermont, I. and Cornelis, G. R. Competition between the Yops of Yersinia enterocolitica for delivery into eukaryotic cells: role of the SycE chaperone binding domain of YopE. J Bacterio! 182, 4811-4821 (2000). Iriarte, M. and Cornelis, G. R. YopT, a new Yersinia Yop effector protein, affects the cytoskeleton of host cells. Mol Microbiol 29, 915-929 (1998). Kudryashev, M. et al. In situ structural analysis of the Yersinia enterocolitica injectisome. Elife 2, e00792, doi: 10.7554 / eLife.0079200792 [pii] (2013). Schulte, R. et al. Yersinia enterocolitica invasion protein triggers IL-8 production in epithelial cells via activation of Reí p65-p65 homodimers. FASEB J 14, 1471 -1484 (2000). Mota, L. J., Joumet, L., Sorg, L, Agrain, C. and Cornelis, G. R. Bacterial injectisomes: needle length does matter. Science 307, 1278, doi:307 / 5713 / 1278 [pii] 10.1126 / science. 1107679 (2005). Carrington, J. C. and Dougherty, W. G. A viral cleavage site cassette: Identification of amino acid sequences required for tobaceous etch virus polyprotein processing. Proc Nati Acad Sci USA 85, 3391-3395 (1988). Kapust, R. B., Tozser, J., Copeland, T. D. and Waugh, D. S. The ΡΓ specificity of tuffaceous etch virus protease. Biochem Biophys Res Commnn 294, 949-955, doi:10.1016 / S0006291X(02)00574-0S0006-291X(02)(X)574-0 [pii] (2002). Liang, H., Gao, H., Maynard, C. A. and Powell, W. A. ​​Expression of a self-processing, pathogen resistance-enhancing gene construct in Arabidopsis. Biotechnol Lett 27, 435-442, doi:10.1007 / s 10529-005-1884-9 (2005). Weber, W. et al. Macrolide-based transgene control in mammalian cells and mice. Nal Biotechnol 20, 901-907, doi:10.1038 / nbt731nbt731 [pii] (2002). Kapust, R.B. et al. Tobacco etch virus protease: mechanism of autolysis and rational design of stable mutants with wild-type catalytic proficiency. Protein Eng 14, 993-1000 (2001). Lee, V. T., Anderson, D. M. and Schneewind, O. Targeting of Yersinia Yop proteins into the cytosol of HeLa cells: one-step translocation of YopE across bacterial and eukaryotic membranes is dependent on SycE chaperone. Mol Microbiol 28, 593-601 (1998). Gray, D. C., Mahrus, S. and Wells, J. A. Activation of specific apoptotic caspases with an engineered small-molecule-activated protease. Cell 142, 637-646, doi:S0092-8674(10)00783-X [pii] 10.1016 / j.cell.2010.07.014 (2010). Henrichs, T. et al. Target-directed proteolysis at the ribosome. Proc Nati Acad Sci USA 114 102, 4246-4251, doi: 102 / 12 / 4246 [pii] 10.1073 / pnas.0408520102 (2005). Aepfelbacher, M., Trasak, C. and Ruckdeschel, K. Effector functions of pathogenic Yersinia species. Thromb Haemost 98, 521-529 (2007). Trulzsch, K., Sporleder, T., Igwe, E. I., Russmann, H. and Heesemann, J. Contribution of the major secreted yops of Yersinia enterocolitica 0:8 to pathogenicity in the mouse infection model. Infect hnmun 72, 5227-5234, doi: 10.1128 / IAI.72.9.5227-5234.2004 (2004). Bohme, K. et al. Concerted actions of a thermo-labile regulator and a unique intergenic RNA thermosensor control Yersinia virulence. PLoS Pathog 8, el 002518, doi: 10.1371 / journal.ppat. 1002518 (2012). Rohde, J. R., Luán, 181,4198-4204 (1999). Curtiss, R., 3ro, Galan, J. E., Nakayama, K. and Kelly, S. M. Stabilization of recombinant avirulent vaccine strains in vivo. Res Microbiol 141, 797-805 (1990). Spreng, S. and Viret, J. F. Plasmid maintenance systems suitable for GMO-based bacterial vaccines. Vaccine 23, 2060-2065, doi:10.1016 / j.vaccine.2005.01.009 (2005). Neyt, C., Iriarte, M., Thi, V. H. and Cornelis, G. R. Virulence and arsenic resistance in Yersiniae. J Bacterial 179, 612-619 (1997). Wu, J. and Chen, Z. J. Innate immune sensing and signaling of cytosolic nucleic acids. Annu Rev Immunol 32, 461-488, doi:10.1146 / annurev-immunol-032713-120156 (2014). Kranzusch, P.J. et al. Ancient Origin of cGAS-STING Reveal Mechanism of Universal 2',3' cGAMP Signaling. Mol Cell 59, 891-903, doi: 10.1016 / j.molcel.2015.07.022 (2015). Commichau, F. M., Dickmanns, A., Gundlach, J., Ficner, R. and Stulke, J. A jack of all trades: the multiple roles of the unique essential second messenger cyclic di-AMP. Mol Microbiol 97, 189-204, doi: 10.1111 / mmi. 13026 (2015). Corrales, L. and others. Direct Activation of STING in the Tumor Microenvironment Leads to Potent and Systemic Tumor Regression and Immunity. Cell Rep 11, 1018-1030, doi: 10.1016 / j .celrep.2015.04.031 (2015). De, N., Navarro, Μ. V., Raghavan, R. V. and Sondermann, H. Determinants for the activation and autoinhibition of the diguanylate cyclase response regulator WspR. J Mol Biol 393, 619-633, doi: 10.1016 / j.jmb.2009.08.030 (2009). Witte, G., Hartung, S., Buttner, K. and Hopfner, K. P. Structural biochemistry of a bacterial 115 checkpoint protein reveáis diadenylate cyclase activity regulated by DNA recombination intermediates. Mol Cell 30, 167-178, doi: 10.1016 / j.molcel.2008.02.020 (2008). Panne, D., McWhirter, S. M., Maniatis, T. and Harrison, S. C. Interferon regulatory factor 3 is regulated by a dual phosphorylation-dependent switch. J Biol Chem 282, 22816-22822, doi: 10.1074 / jbc.M703019200 (2007). Engel, C., G. Brugmann, S. Lambing, L.H. Muhlenbeck, S. Marx, C. Hagen, D. Horvath, M. Goldeck, J. Ludwig, A.M. Herzner, J.W. Drijfhout, D. Wenzel, C. Coch, T. Tuting, M. Schlee, V. Homung, G. Hartmann, and J.G. Van den Boom. 2017. RIG-I Resists Hypoxia-Induced Immunosuppression and Dedifferentiation. Cancer Immunol Res 5:455-467. Hou, F., L. Sun, H. Zheng, B. Skaug, Q.X. Jiang, and Z.J. Chen. 2011. MAVS forms functional prion-like aggregates to activate and propagate antiviral innate immune response. Cell. 146:448-461. Kranzusch, P.J., A.S. Lee, J.M. Berger, and J.A. Doudna. 2013. Structure of human cGAS reveals a conserved family of second-messenger enzymes in innate immunity. Cell Rep 3:13621368. Seth, R.B., L. Sun, C.K. Ea, and Z.J. Chen. 2005. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell. 122:669-682. Alton, N., Vapnek, D. 1979. Nucleotide sequence analysis of the chloramphenicol resistance transposon Tn9. Nature 282, 864-869. https: / / doi.org / 10.1038 / 282864a0. Ittig, S.J., 2015. A bacterial type III secretion-based protein delivery tool for broad applications in cell biology. J Cell Biol November 23, 2015; 211 (4): 913-931. doi: https: / / doi.org / 10.1083 / jcb.201502074. Eisenhauer, E.A., P. Therasse, J. Bogaerts, L.H. Schwartz, D. Sargent, R. Ford, J. Dancey, S. Arbuck, S. Gwyther, M. Mooney, L. Rubinstein, L. Shankar, L. Dodd, R. Kaplan, D. Lacombe, and J. Verweij . 2009. New response evaluation criteria in solid tumors: revised RECIST guideline (version 1.1). Eur J Cancer. 45:228-247. Seymour, L., J. Bogaerts, A. Perrone, R. Ford, L.H. Schwartz, S. Mandrekar, N.U. Lin, S. Litiere, J. Dancey, A. Chen, F.S. Hodi, P. Therasse, O.S. Hoekstra, L.K. Shankar, J.D. Wolchok, M. Ballinger, C. Caramella, E.G.E. de Vries, and group R.w. 2017. iRECIST: guidelines for response criteria for use in triais testing immunotherapeutics. Lancet Oncol. 18:el43-el52.< / s>

Claims

1. A recombinant gram-negative bacterial strain comprising (i) a first polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof frame-fused to the 3' end of a nucleotide sequence encoding a delivery signal for a bacterial effector protein, wherein the nucleotide sequence encoding the delivery signal for a bacterial effector protein is operatively linked to a promoter; (ii) a second polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof frame-fused to the 3' end of a nucleotide sequence encoding a delivery signal for a bacterial effector protein, wherein the nucleotide sequence encoding the delivery signal for a bacterial effector protein is operatively linked to a promoter;iii) a third polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof frame-fused to the 3' end of a nucleotide sequence encoding a delivery signal for a bacterial effector protein, wherein the nucleotide sequence encoding the delivery signal for a bacterial effector protein is operatively linked to a promoter;and iv) a fourth polynucleotide molecule comprising a nucleotide sequence encoding a heterologous protein or a fragment thereof frame-fused to the 3' end of a nucleotide sequence encoding a delivery signal for a bacterial effector protein, wherein the nucleotide sequence encoding the delivery signal for a bacterial effector protein is operatively linked to a promoter, wherein said first and said second polynucleotide molecules are located on a vector comprising said gram-negative bacterial strain and said third and said fourth polynucleotide molecules are located on a chromosome of said gram-negative bacterial strain or on an extrachromosomal genetic element comprising said gram-negative bacterial strain, provided that the extrachromosomal genetic element is not the vector on which said first and said second polynucleotide molecules are located.

2. The recombinant gram-negative bacterial strain according to claim 1, wherein the nucleotide sequence encoding a heterologous protein or a fragment thereof of the first polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof of the third polynucleotide molecule encode the same heterologous protein or a fragment thereof.

3. The recombinant attenuated virulence gram-negative bacterial strain according to claim 1 or 2, wherein the nucleotide sequence encoding a heterologous protein or a fragment thereof of the second polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof of the fourth polynucleotide molecule encode the same heterologous protein or a fragment thereof.

4. The recombinant gram-negative bacterial strain according to any of claims 1-3, wherein the nucleotide sequence encoding a heterologous protein or a fragment thereof frame-fused to the 3' end of the nucleotide sequence encoding a delivery signal for a bacterial effector protein of the first polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof frame-fused to the 3' end of the nucleotide sequence encoding a delivery signal for a bacterial effector protein of the second polynucleotide molecule are operatively linked to the same promoter.

5. The recombinant gram-negative bacterial strain according to any of claims 1-4, wherein the nucleotide sequence encoding a heterologous protein or a fragment thereof frame-fused to the 3' end of the nucleotide sequence encoding a delivery signal for a bacterial effector protein of the third polynucleotide molecule and the nucleotide sequence encoding a heterologous protein or a fragment thereof frame-fused to the 3' end of the nucleotide sequence encoding a delivery signal for a bacterial effector protein of the fourth polynucleotide molecule are operatively linked to two different promoters.

6. The recombinant gram-negative bacterial strain according to any of claims 1-5, wherein a fragment of a heterologous protein contains between 100 and 800 amino acids and has the same functional properties as the heterologous protein from which it is derived. 118 7. The recombinant gram-negative bacterial strain according to any of claims 1-6, wherein the delivery signal for a bacterial effector protein is a polypeptide sequence that can be recognized by the secretion and translocation system of the recombinant gram-negative bacterial strain and directs the delivery of a protein from the recombinant gram-negative bacterial strain to eukaryotic cells.

8. The recombinant gram-negative bacterial strain according to any of claims 1-7, wherein the delivery signal of a bacterial effector protein is selected from the group consisting of a bacterial T3SS effector protein or an N-terminal fragment thereof, a bacterial T4SS effector protein or an N-terminal fragment thereof, and a bacterial T6SS effector protein or an N-terminal fragment thereof.

9. The recombinant gram-negative bacterial strain according to any of claims 1-7, wherein the bacterial effector protein delivery signal is a bacterial T3SS effector protein comprising a bacterial T3SS effector protein or a fragment of the N-terminal end thereof.

10. The recombinant gram-negative bacterial strain according to claim 9, wherein the N-terminal fragment of a bacterial T3SS effector protein includes at least the first 10 amino acids of the bacterial T3SS effector protein.

11. The recombinant gram-negative bacterial strain according to any of claims 1-10, wherein the vector is a medium copy number plasmid.

12. The recombinant gram-negative bacterial strain according to any of claims 1-11, wherein the extrachromosomal genetic element is an endogenous virulence plasmid.

13. The recombinant gram-negative bacterial strain according to any of claims 1-12, wherein the heterologous protein or a fragment thereof encoded by the nucleotide sequence of the first, second, third, and fourth polynucleotide molecule is 119 selected independently of each other from the group consisting of proteins involved in the induction or regulation of an interferon (IFN) response, proteins involved in apoptosis or the regulation of apoptosis, cell cycle regulators, proteins with ankyrin repeats, cell signaling proteins, reporter proteins, transcription factors, proteases, small GTPases, GPCR-related proteins, nanobody fusion constructs and nanobodies, bacterial T3SS effectors, bacterial T4SS effectors, and viral proteins, or a fragment thereof.

14. The recombinant gram-negative bacterial strain according to any of claims 1-12, wherein the heterologous protein or a fragment thereof encoded by the nucleotide sequence of the first, second, third, and fourth polynucleotide molecule is independently selected from the group consisting of proteins involved in the induction or regulation of a type I IFN response selected from the group consisting of cGAS, STING, TRIF, TBK1, IKKépsilon, IRF3, TREX1, VPS34, ATG9a, DDX3, LC3, DDX41, IFI16, MRE11, DNA-PK, RIG1, MDA5, LGP2, IPS-l / MAVS / Cardif / VISA, Trim25, Trim32, Trim56, Riplet, TRAF2, TRAF3, TRAF5, TANK, IRF3, IRF7, IRF9, STAT1, STAT2, PKR, TLR3, TLR7, TLR9, DAI, IFI16, IFIX, MRE11, DDX41, LSml4A, LRRF1P1, DHX9, DHX36, DHX29, DHX15, Ku70, cyclic dinucleotide generating enzymes (cyclic diAMP, cyclic diGMP and cyclic diGAMP cyclases) such as WspR, DncV, DisA and DisA-like, CdaA, CdaS and cGAS, or a fragment thereof;proteins involved in apoptosis or the regulation of apoptosis selected from the group consisting of pro-apoptotic proteins, anti-apoptotic proteins, inhibitors of apoptosis-prevention pathways, and inhibitors of pro-survival signaling or pathways; cell cycle regulators selected from the group consisting of cyclins, cyclin-dependent kinases (CDKs), CDK-activating kinases, CDK inhibitors, CDK substrates, anaphase-promoting / cyclosome complex, and cell cycle checkpoint proteins; proteins with ankyrin repeats; cell signaling proteins selected from the group consisting of cytokine signaling proteins, survival factor signaling proteins, death signaling proteins, growth factor signaling proteins, hormone signaling proteins, chemokine signaling proteins, and extracellular matrix / Wnt / Hedgehog signaling proteins;Reporter proteins selected from the group consisting of fluorescent proteins, luciferases, and enzymatic reporter proteins; transcription factors; proteases; small GTPases; GPCR-related proteins selected from the group consisting of G protein-coupled receptors, G protein complexes, kinases, adaptor proteins, signal transducers / regulators, and transcription factors; nanobody fusion constructs selected from the group consisting of nanobodies fused with protein degradation domains, nanobodies fused with cell signaling proteins or parts thereof, nanobodies fused with identical or other nanobodies, nanobodies fused with reporter proteins, and nanobodies fused with subcellular localization signals; nanobodies; bacterial T3SS electors; bacterial T4SS electors and viral proteins; or a fragment thereof.

15. The recombinant gram-negative bacterial strain according to any of claims 1-12, wherein the heterologous protein or a fragment thereof encoded by the nucleotide sequence of the first, second, third and fourth polynucleotide molecule is, independently of each other, a protein involved in the induction or regulation of an interferon (IFN) response, or a fragment thereof.

16. The recombinant gram-negative bacterial strain according to any of claims 1-12 and 15, wherein a protein involved in the induction or regulation of an interferon (IFN) response, or a fragment thereof, is a protein involved in the induction or regulation of a type I IFN response selected from the group consisting of cGAS, STING, TRIF, TBK1, IKKépsilon, IRF3, TREX1, VPS34, ATG9a, DDX3, LC3, DDX41, IFI16, MRE11, DNA-PK, RIG1, MDA5, LGP2, IPS-l / MAVS / Cardif / VISA, Trim25, Trim32, Trim56, Riplet, TRAF2, TRAF3, TRAF5, TANK, IRF3, IRF7, IRF9, STAT1, STAT2, PKR, TLR3, TLR7, TLR9, DAI, IFI 16, IFIX, MRE11, DDX41, LSml4A, LRRFIP1, DHX9, DHX36, DHX29, DHX15, Ku7ü, or a fragment thereof, cyclic dinucleotide generating enzymes (cyclic di-AMP, cyclic di-GMP and cyclic di-GAMP cyclases) such as WspR, DncV, DisA and DisA-like, CdaA, CdaS and cGAS, or a fragment thereof.

17. The recombinant gram-negative bacterial strain according to any of claims 1-12, wherein the heterologous protein or a fragment thereof encoded by the nucleotide sequence of the first, second, third, and fourth polynucleotide molecule is selected, independently of each other, from the group consisting of the RIG-I-like receptor (RLR) family, other CARD domain-containing proteins involved in antiviral signaling and type I IFN induction, and cyclic dinucleotide-generating enzymes such as cyclic di-AMP cyclases, cyclic di-GMP, and cyclic di-GAMP cyclases selected from the group consisting of WspR, DncV, DisA and DisA-like, CdaA, CdaS, and cGAS, leading to STING stimulation, or a fragment thereof.

18. The recombinant gram-negative bacterial strain according to any of claims 1-12, wherein the heterologous protein or a fragment thereof encoded by the nucleotide sequence of the first, second, third, and fourth polynucleotide molecule is selected, independently of each other, from the group consisting of the RIG-I-like receptor family (RLR), other CARD domain-containing proteins selected from the group consisting of MAVS, CRADD / RAIDD, RIPK2 / RIP2, CARD, NOD1, and NOD2, or a fragment thereof, and cyclic dinucleotide-generating enzymes such as cyclic diAMP cyclases, cyclic diGMP, and cyclic diGAMP cyclases selected from the group consisting of WspR, DncV, DisA and DisA-like, CdaA, CdaS, and cGAS, leading to STING stimulation, or a fragment thereof.

19. The recombinant gram-negative bacterial strain according to any of claims 1-12, wherein the heterologous protein or a fragment thereof encoded by the nucleotide sequence of the first and third polynucleotide molecules is cGAS or a fragment thereof, preferably a fragment of cGAS.

20. The recombinant gram-negative bacterial strain according to any of claims 1-12, wherein the heterologous protein or a fragment thereof encoded by the nucleotide sequence of the first and third polynucleotide molecules is a fragment of cGAS as shown in SEQ ID NO:

10.

21. The recombinant gram-negative bacterial strain according to any of claims 1-12 or 18, wherein the heterologous protein or a fragment thereof encoded by the nucleotide sequence of the second and fourth polynucleotide molecule is RIG1 or a fragment thereof, preferably a fragment of RIG1 comprising a CARD domain.

22. The recombinant gram-negative bacterial strain according to any of claims 1-12 or 19-20, wherein the heterologous protein or a fragment thereof encoded by the nucleotide sequence of the second and fourth polynucleotide molecule is a fragment of RIG1 comprising a CARD domain as shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:

3.

23. The recombinant gram-negative bacterial strain according to any of claims 1-22, wherein the recombinant gram-negative bacterial strain is a Yersinia strain.

24. The recombinant gram-negative bacterial strain according to any of claims 1-23, for use as a medicament.

25. The recombinant gram-negative bacterial strain according to any of claims 1-23, for use in a method for treating cancer in a subject, the method comprising administering said recombinant gram-negative bacterial strain to the subject, wherein the recombinant gram-negative bacterial strain is administered in an amount that is sufficient to treat the subject.