Method for generating new mutations in organisms, and application thereof
Patent Information
- Application Number
- MYPI2021007350
- Authority / Receiving Office
- MY · MY
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-09-16
- Filing Date
- 2020-10-13
- Publication Date
- 2026-07-28
- Estimated Expiration
- 2040-10-13
AI Technical Summary
Existing gene editing technologies are difficult to achieve efficient base substitution, and the introduction of exogenous DNA fragments and reverse transcriptase may lead to biosafety concerns, especially in cell therapy and biobreeding.
By sequentially generating multiple DNA breaks in an organism and designing new targeted nucleases or RNAs using spontaneous repair events, site-directed mutagenesis can be achieved, avoiding exogenous DNA templates. The CRISPR/Cas system is used to repeatedly cut the RNP complex composed of different gRNAs or sgRNAs, forming continuous targeting to achieve base substitution, deletion, and insertion mutations.
It enables efficient site-directed base substitution and mutation, reduces biosafety risks, simplifies the breeding process, reduces regulatory and approval costs, and is suitable for cell therapy and biobreeding.
Abstract
Description
A method for generating novel mutations in organisms and its application Priority information This application claims the benefits of Chinese invention patent application 201911081617.X, filed on November 7, 2019; Chinese invention patent application 202010821877.2, filed on August 15, 2020; and Chinese invention patent application 202010974151.2, filed on September 16, 2020, all of which are incorporated herein by reference in their entirety. Technical Field This invention belongs to the field of genetic engineering technology, and specifically relates to a method and application for creating fixed-point mutations in organisms without the need for artificial DNA templates. Background Technology The use of genetic engineering techniques to modify the genomes of organisms has been widely applied in industrial and agricultural production, such as transgenic microorganisms commonly used in the pharmaceutical and chemical industries, and insect-resistant and herbicide-resistant transgenic crops in agriculture. With the advent of site-specific nucleases, targeted genome editing has become possible by introducing targeted breaks into the genome of recipient organisms and inducing spontaneous repair, enabling more precise modification of the genome. Gene editing tools mainly include three types of sequence-specific nucleases (SSNs): zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats / CRISPR-Cas system. Sequence-specific nucleases are programmable nucleases that can generate DNA double-strand breaks (DSBs) at specific sites in the genome. These DSBs activate endogenous DNA repair pathways to repair cellular DNA damage. During repair, changes in the DNA sequence at the target site are easily introduced, allowing biologists to precisely target and edit genes. However, ZFNs and TALENs require the design of protein modules that specifically recognize the target sequence, resulting in low throughput and complex operation. In the CRISPR / Cas system, the Cas protein is universal. Target-specific CRISPR-RNA (crRNA) can be designed alone or in combination with trans-activating RNA (tracrRNA) to form guide RNA (gRNA), or a single guide RNA (sgRNA) can be designed. The crRNA and tracrRNA together, or the sgRNA alone, assemble with the Cas protein to form a ribonucleoprotein (RNP). In the genome, it recognizes the target sequence based on the protospacer adjacent motif (PAM) to achieve site-specific editing. Due to its ease of operation, wide applicability, and high throughput, it has become the mainstream gene editing tool. Sequence-specific nucleases can create DNA double-strand breaks at specific locations in the genome. These DNA double-strand breaks can be repaired in various ways, primarily through base insertion or deletion. For example, the two most common types of CRISPR / Cas9 editing are inserting or deleting a base at the break point (Shen et al. 2018. Predictable and precise template-free CRISPR editing of pathogenic variants. Nature. DOI:10.1038 / s41586-018-0686-x). Insertion or deletion of bases in coding regions can cause frameshift mutations, leading to loss of gene function. Therefore, the primary application of these gene editing tools remains gene knockout. Sequence-specific nucleases alone have long been considered incapable of achieving base substitution mutations. To address this, existing technologies have proposed three solutions: 1) adding exogenous DNA fragments as repair templates to trigger homologous recombination repair; 2) fusing deaminases with Cas9 to develop single-base editing tools for C-to-T and A-to-G sequences; and 3) fusing reverse transcriptases with Cas9 to guide the synthesis of small-scale DNA strand substitutions using pegRNA. However, the editing efficiency of these three approaches is significantly lower than that of gene knockout. Furthermore, the introduced exogenous DNA fragments and reverse transcriptases raise concerns about biosafety, and the off-target effects of single-base editing limit its potential application in cell therapy. Especially for long-term plant breeding projects, improving the efficiency of base substitution at target sites while reducing regulatory concerns about biosafety is a problem that needs to be solved in the application of gene editing technology. In summary, there is an urgent technological need in the fields of cell therapy and bio-breeding to achieve site-specific base substitution by targeted knockout of sequence-specific nucleases without introducing exogenous DNA fragments, especially through non-transgenic transient editing systems. Invention Summary This invention provides a method and its application for creating site-directed mutations in an organism by generating double-strand breaks in the genome without providing an artificial DNA template. The technical solution adopted in this invention is as follows: A method for generating novel mutations in an organism includes the following steps: sequentially generating two or more DNA breaks at specific locations in the organism's genome and spontaneously repairing them, wherein the later DNA break is generated based on the new sequence generated after the repair of the earlier DNA break. In one specific embodiment, the “DNA break” is achieved by delivering a nuclease with targeting properties into a living cell to contact a specific location on the genomic DNA. In one specific embodiment, the "nuclease with targeting properties" is a ZFN, TALEN, or CRISPR / Cas system. In one specific embodiment, the phrase "two or more DNA breaks are generated sequentially at a specific location" refers to designing a new ZFN or TALEN protein for the new sequence formed by the prior DNA break repair event generated by ZFN or TALEN editing, and then cutting that site again. In another specific implementation, the phrase "generating two or more DNA breaks sequentially at a specific location" refers to designing a new targeting RNA for the new sequence formed by the prior DNA break repair event edited by the CRISPR / Cas system, and then cutting that site again. For example, the second cut involves designing a new targeting RNA for the new sequence formed by the first break repair event edited by Cas9, and cutting that site again. Similarly, a new targeting RNA can be designed based on the new sequence formed by the subsequent repair event, and a third cut can be performed at that site. As shown in Figure 1, and so on. In one specific embodiment, the "two or more DNA breaks" are generated by sequentially delivering different targeted nucleases to recipient cells at different generations. The previously edited mutant cell then acts as the recipient, receiving the subsequent targeted nuclease for secondary editing, resulting in site-directed mutations. This method is preferably used in ZFN and TALEN editing systems. In another specific embodiment, the "two or more DNA breaks" are generated by delivering different targeted nucleases to the same recipient cell. This approach is preferably used in CRISPR / Cas editing systems. In one specific embodiment, the "two or more DNA breaks" are generated by the same CRISPR / Cas nuclease forming an RNP complex with different gRNAs or sgRNAs, which cut the corresponding target sequences in sequence. In another specific embodiment, the "two or more DNA breaks" are generated by two or more CRISPR / Cas nucleases recognizing different PAM sequences, each forming an RNP complex with its corresponding gRNA or sgRNA, which sequentially cleaves the corresponding target sequence. For example, the PAM sequence recognized by Cas9 from *Streptococcus pyogenes* is "NGG" or "NAG" (Jinek et al., "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", *Science* 2012, 337: 816-821), the PAM sequence recognized by Cas9 from *Staphylococcus aureus* is "NNGRRT" or "NNGRR(N)", the PAM sequence recognized by Cas9 from *Neisseria meningitidis* is NNNGATT, and the PAM sequence recognized by Cas9 from *Streptococcus thermophilus* is NNAGAAW. In this manner, the editable window on the DNA molecule is larger. In one specific embodiment, the targeted nuclease is any CRISPR / Cas nuclease capable of genome editing. In one specific embodiment, the targeted nuclease exists in the form of DNA. In another specific embodiment, the targeted nuclease exists in the form of mRNA or protein, rather than DNA. Protein form is preferred. In one specific embodiment, the method for delivering the targeted nuclease into cells includes: 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun bombardment; 6) Agrobacterium-mediated transformation, etc. The method designs new targets based on the new sequences generated after prior DNA break repair, and can generate mutations multiple times at specific locations in the genome, exponentially enriching the types of DNA break repair events. It achieves new types of base substitution, deletion, and insertion mutations that cannot be obtained by a single gene editing, and is suitable as a tool for creating new mutations. This method can be briefly described as a cyclic targeting or continuous targeting method. In one specific implementation, by designing new target sites based on the prediction of specific new sequences that may be generated after break repair at a specific location in an organism's genome, and performing sequential editing, the mutations that may eventually occur at that location can be designed in advance to achieve the expected editing. In another specific implementation, new targets are designed based on the prediction of new sequences that may be generated after break repair at a specific location in an organism's genome, and then edited sequentially. In addition to the expected editing events, the location may eventually generate a variety of different mutations, which can serve as a tool for creating a variety of different mutations. On the other hand, the present invention also provides a method for generating new mutations in an organism, comprising the following steps: at the level of the organism's genome or chromosomes, by sequentially generating two or more DNA breaks at specific locations of genes to achieve precise base substitution, deletion or insertion. In one specific implementation, the phrase "two or more DNA breaks occur sequentially at a specific location" refers to designing a new targeting RNA for the new sequence formed by the previous break repair event and then cutting that location again. In one specific embodiment, the "DNA break" is achieved by a nuclease with targeting properties. The present invention also provides a novel mutation obtained using the aforementioned method. The present invention further provides a protein having the novel mutation or a bioactive fragment thereof. The present invention also provides a nucleic acid comprising a nucleic acid sequence encoding the protein or a biologically active fragment thereof, or its complementary sequence. The present invention also provides a nucleic acid comprising: (a) The nucleotide sequence encoding the target RNA, wherein, The RNA comprises at least two RNAs, the first of which targets the DNA, causing it to break, and the second targeting RNA which cuts the sequence formed by the previous break repair event again. In one specific embodiment, the nucleic acid further includes (b) a nucleotide sequence encoding a Cas polypeptide. In one specific embodiment, the target RNA is sgRNA or gRNA. In one specific embodiment, the Cas polypeptide and the target RNA are in vitro cells or isolated cells. The present invention also provides a recombinant expression vector comprising the aforementioned nucleic acid and a promoter operatively linked thereto. The present invention also provides an expression cassette containing the aforementioned nucleic acid. The present invention also provides a host cell containing the aforementioned expression cassette. The present invention also provides a organism regenerated using the host cell. The present invention also provides a method for lysing target DNA, comprising contacting the target DNA with a complex, the complex comprising: (a) Cas polypeptide; and (b) At least two target RNAs, the first of which targets DNA and causes it to break, and the second of which targets the sequence formed by the previous break repair event and cuts it again. In one specific embodiment, the target RNA is sgRNA or gRNA. In one specific embodiment, the target DNA is present in bacterial cells, eukaryotic cells, plant cells, or animal cells. In one specific embodiment, the target DNA is chromosomal DNA. In one specific embodiment, the Cas polypeptide and the target RNA are in vitro cells or isolated cells. In one specific embodiment, the contact includes introducing the following into the cell: (a) the Cas polypeptide or a polynucleotide encoding the Cas polypeptide, and (b) the target RNA or a DNA polynucleotide encoding the target RNA. The present invention also provides a composition comprising: (a) a Cas polypeptide, or a polynucleotide encoding the Cas polypeptide; and (b) At least two target RNAs, or DNA polynucleotides encoding the target RNAs, wherein the first RNA targets the DNA, causing it to break, and the second target RNA cuts the sequence formed by the previous break repair event again. In one specific embodiment, the target RNA is sgRNA or gRNA. In one specific embodiment, the Cas polypeptide and the target RNA are in vitro cells or isolated cells. The present invention also provides the use of the described composition in the preparation of pharmaceutical agents for treating diseases. Diseases that can be treated with the compositions of the present invention include, but are not limited to, diseases caused by single gene mutations such as hereditary tyrosinemia type 1, phenylketonuria, progeria, and sickle cell disease. The therapeutic effect is achieved by delivering a combination of Cas protein and crRNA or sgRNA that is expected to be repaired to normal functional protein at the pathogenic mutation site into the cell, thereby inducing spontaneous cell repair. The present invention also provides a reagent kit comprising: (a) a Cas polypeptide, or a nucleic acid containing a nucleotide sequence encoding said Cas polypeptide; and (b) At least two target RNAs, or nucleic acids containing nucleotide sequences encoding the target RNAs, wherein the first RNA targets DNA, causing it to break, and the second target RNA cuts the sequence formed by the previous break repair event again. (a) and (b) are in the same or separate containers. In one specific embodiment, the target RNA is sgRNA or gRNA. In one specific implementation, the target RNA in (b) is in the same or a separate container. This invention also provides a method for screening editing events without relying on exogenous transgenic markers, comprising the following steps: 1) Two or more DNA breaks are generated sequentially at a specific location of the first target gene in the recipient cell and are spontaneously repaired. The later DNA break is generated based on the new sequence generated after the repair of the earlier DNA break. 2) Certain editing events that occur after sequential cutting and repair at a specific location of the first target gene can confer resistance to a certain selection pressure on mutant cells, produce phenotypic selectable traits, apply corresponding selection pressure to select for the trait, and isolate cells, tissues, organs or complete organisms containing such editing events. 3) Optionally, in addition to the first target gene, other targets are edited simultaneously using a targeted nuclease targeting at least one second target gene. By screening for selectable traits generated by mutations in the first target gene, the editing events of the second target gene are enriched and screened simultaneously, and cells, tissues, organs or complete organisms containing both the first target gene and at least one second target gene editing event are isolated. In one specific embodiment, the "first target gene" is a gene locus encoding at least one phenotypic selectable trait, wherein the at least one phenotypic selectable trait is a resistance / tolerance trait or a growth advantage trait. In one specific embodiment, the "specific location of the first target gene" refers to certain mutation types generated after sequential cutting and repair at the location, which can confer resistance to a certain selection pressure on the recipient cell, producing at least one phenotypic selectable resistance / tolerance trait or growth advantage trait. In one specific embodiment, the "certain mutation types" include single base substitution, multiple base substitution, or an unspecified number of base insertions or deletions. In one specific embodiment, the "certain screening pressure" can be environmental pressure, such as high temperature, low temperature, low oxygen, etc., or it can be the pressure of added compounds, such as salt ion concentration, antibiotics, cytotoxins, herbicides, etc. In one specific embodiment, the “DNA break” is achieved by delivering a nuclease with targeting properties into a living cell to contact a specific location on the genomic DNA. In one specific embodiment, the "nuclease with targeting properties" refers to all CRISPR / Cas nucleases capable of genome editing. In one specific implementation, the phrase "generating two or more DNA breaks sequentially at a specific location" refers to designing new target RNAs for new sequences formed by prior DNA break repair events edited by the CRISPR / Cas system, and then cutting that site again. In one specific embodiment, the "two or more DNA breaks" are generated by the same CRISPR / Cas nuclease forming an RNP complex with different gRNAs or sgRNAs, which cut the corresponding target sequences in sequence. In another specific embodiment, the "two or more DNA breaks" are generated by two or more CRISPR / Cas nucleases that recognize different PAM sequences, each forming an RNP complex with its corresponding gRNA or sgRNA, which sequentially cleaves the corresponding target sequences. In this approach, the editable window on the DNA molecule is larger. In one specific implementation, the "second target gene" refers to a gene that encodes a different gene than the first target gene. In one specific embodiment, the “targeting nuclease for at least one second target gene” is the same as the CRISPR / Cas nuclease used to generate DNA breaks at a specific location in the first target gene. In another specific embodiment, the "targeting nuclease for at least one second target gene" differs from the CRISPR / Cas nuclease used to generate DNA breaks at specific locations on the first target gene. In this approach, more editing sites are available on the second target gene. In one specific embodiment, the targeted nuclease exists in the form of DNA. In another specific embodiment, the targeted nuclease exists in the form of mRNA or protein, rather than DNA. Protein form is preferred. In one specific embodiment, the method for delivering the targeted nuclease into cells includes: 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun bombardment; 6) Agrobacterium-mediated transformation, etc. This invention further provides a method for non-transgenic transient editing of an organism's genome, comprising the following steps: 1) Design and synthesize at least two crRNA fragment combinations or at least two sgRNA fragment combinations at a specific location of the first target gene in the recipient cell. The crRNA combination combined with tracrRNA or the sgRNA combination alone can guide the corresponding Cas protein to generate two or more DNA breaks in sequence at a specific location of the first target gene in the recipient cell and repair them spontaneously. The subsequent DNA break is generated based on the new sequence generated after the repair of the previous DNA break. 2) Mix an appropriate amount of CRISPR / Cas protein or its corresponding mRNA with the above-mentioned pre-designed and synthesized crRNA fragment combination and tracrRNA fragment or sgRNA fragment combination that can guide the first target gene to produce endogenous selection markers. Optionally, at least one artificially synthesized crRNA and tracrRNA fragment or artificially synthesized sgRNA fragment targeting the second, third or more target genes is further added, and incubated in vitro to form an RNP complex. 3) The above-mentioned RNP complex is delivered to recipient cells and comes into contact with specific sites on the genomic DNA to achieve gene editing; 4) Based on the phenotypic selectable traits generated by the site-specific editing of the first target gene by the RNP complex, apply corresponding selection pressure to select for the phenotypic traits and isolate cells, tissues, organs or whole organisms containing such editing events, and optionally, isolate cells, tissues, organs or whole organisms containing editing events of both the first target gene and at least one second, third or more target genes. In one specific embodiment, the "first target gene" is a gene locus encoding at least one phenotypic selectable trait, wherein the at least one phenotypic selectable trait is a resistance / tolerance trait or a growth advantage trait. In one specific embodiment, the "specific location of the first target gene" refers to certain mutation types generated after sequential cutting and repair at the location, which can confer resistance to a certain selection pressure on the recipient cell, producing at least one phenotypic selectable resistance / tolerance trait or growth advantage trait. In one specific embodiment, the "certain mutation types" include single base substitution, multiple base substitution, or an unspecified number of base insertions or deletions. In one specific embodiment, the "certain screening pressure" can be environmental pressure, such as high temperature, low temperature, low oxygen, etc., or it can be the pressure of added compounds, such as salt ion concentration, antibiotics, cytotoxins, herbicides, etc. In one specific embodiment, the CRISPR / Cas protein is any CRISPR / Cas nuclease capable of genome editing. In one specific implementation, the phrase "generating two or more DNA breaks sequentially at a specific location" refers to designing new target RNAs for new sequences formed by prior DNA break repair events edited by the CRISPR / Cas system, and then cutting that site again. In one specific embodiment, the "two or more DNA breaks" are generated by the same CRISPR / Cas protein forming an RNP complex with different gRNAs or sgRNAs, which cut the corresponding target sequences in sequence. In another specific embodiment, the "two or more DNA breaks" are generated by two or more CRISPR / Cas proteins that recognize different PAM sequences, each forming an RNP complex with its corresponding gRNA or sgRNA, which sequentially cleaves the corresponding target sequence. In this approach, the editable window on the DNA molecule is larger. In one specific embodiment, the "second, third or more target genes" refers to other genes that encode different genes from the first target gene. In one specific embodiment, the "at least one synthetically produced crRNA and tracrRNA fragment or synthetically produced sgRNA fragment targeting a second, third or more target genes" shares the same Cas protein as the crRNA or sgRNA targeting the first target gene. In another specific embodiment, the "at least one synthetically produced crRNA and tracrRNA fragment or synthetically produced sgRNA fragment targeting a second, third or more target genes" uses a Cas protein that recognizes a different PAM sequence compared to the crRNA or sgRNA targeting the first target gene. In this manner, more editing sites are available on the second target gene. In one specific embodiment, the method for delivering the RNP complex into cells includes: 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation; 4) microinjection; 5) gene gun bombardment, etc. This invention also provides a method for non-transgenic transient editing of plant genomes, comprising the following steps: 1) Design and synthesize at least two crRNA fragment combinations or at least two sgRNA fragment combinations at a specific location of the first target gene in the recipient plant cell or tissue. The crRNA combination, in combination with tracrRNA or using the sgRNA combination alone, can guide the corresponding Cas protein to generate two or more DNA breaks sequentially at a specific location of the first target gene in the recipient cell and repair them spontaneously. The subsequent DNA break is generated based on the new sequence generated after the repair of the previous DNA break. 2) Mix an appropriate amount of CRISPR / Cas protein or its corresponding mRNA with the above-mentioned pre-designed and synthesized crRNA fragment combination and tracrRNA fragment or sgRNA fragment combination that can guide the first target gene to produce endogenous selection markers. Optionally, at least one artificially synthesized crRNA and tracrRNA fragment or artificially synthesized sgRNA fragment targeting the second, third or more target genes is further added, and incubated in vitro to form an RNP complex. 3) The above-mentioned RNP complex is delivered to recipient plant cells or tissues and comes into contact with specific sites of genomic DNA to achieve gene editing; 4) Based on the phenotypic selectable traits generated by the site-specific editing of the first target gene by the RNP complex, apply corresponding selection pressure to select for the phenotypic traits and isolate cells, tissues, organs or whole plants containing such editing events, and optionally, isolate cells, tissues, organs or whole plants containing editing events of both the first target gene and at least one second, third or more target genes. In one specific embodiment, the "first target gene" is a gene locus encoding at least one phenotypic selectable trait, wherein the at least one phenotypic selectable trait is a resistance / tolerance trait or a growth advantage trait. In one specific embodiment, the "specific location of the first target gene" refers to certain mutation types generated after sequential cutting and repair at the location, which can confer resistance to a certain selection pressure on the recipient cell, producing at least one phenotypic selectable resistance / tolerance trait or growth advantage trait. In one specific embodiment, the "certain mutation types" include single base substitution, multiple base substitution, or an unspecified number of base insertions or deletions. In one specific embodiment, the "certain screening pressure" can be environmental pressure, such as high temperature, low temperature, low oxygen, etc., or it can be the pressure of added compounds, such as salt ion concentration, antibiotics, cytotoxins, herbicides, etc. In one specific embodiment, the "recipient plant cell or tissue" is any cell or tissue that can transiently express the receptor and regenerate into a complete plant through tissue culture. Specifically, the cell is a protoplast cell or suspension cell, etc.; the tissue is a callus, immature embryo, mature embryo, leaf, shoot tip, young spike, or hypocotyl, etc. In one specific embodiment, the CRISPR / Cas protein is any CRISPR / Cas nuclease capable of genome editing. In one specific implementation, the phrase "generating two or more DNA breaks sequentially at a specific location" refers to designing new target RNAs for new sequences formed by prior DNA break repair events edited by the CRISPR / Cas system, and then cutting that site again. In one specific embodiment, the "two or more DNA breaks" are generated by the same CRISPR / Cas protein forming an RNP complex with different gRNAs or sgRNAs, which cut the corresponding target sequences in sequence. In another specific embodiment, the "two or more DNA breaks" are generated by two or more CRISPR / Cas proteins that recognize different PAM sequences, each forming an RNP complex with its corresponding gRNA or sgRNA, which sequentially cleaves the corresponding target sequence. In this approach, the editable window on the DNA molecule is larger. In one specific embodiment, the "second, third or more target genes" refers to other genes that encode different genes from the first target gene. In one specific embodiment, the "at least one synthetically produced crRNA and tracrRNA fragment or synthetically produced sgRNA fragment targeting a second, third or more target genes" shares the same Cas protein as the crRNA or sgRNA targeting the first target gene. In another specific embodiment, the "at least one synthetically produced crRNA and tracrRNA fragment or synthetically produced sgRNA fragment targeting a second, third or more target genes" uses a Cas protein that recognizes a different PAM sequence compared to the crRNA or sgRNA targeting the first target gene. In this manner, more editing sites are available on the second target gene. In one specific embodiment, the method for delivering the RNP complex into plant cells includes: 1) PEG-mediated protoplast transformation; 2) microinjection; 3) gene gun bombardment; 4) silicon carbide fiber-mediated delivery; 5) vacuum infiltration or any other transient delivery method. Gene gun bombardment is preferred. In one specific embodiment, the "first target gene" is at least one endogenous gene encoding at least one phenotypic selectable trait selected from herbicide resistance / tolerance, wherein the herbicide resistance / tolerance is selected from resistance / tolerance to EPSPS inhibitors (including glyphosate); resistance / tolerance to glutamine synthesis inhibitors (including glufosinate); resistance / tolerance to ALS or AHAS inhibitors (including imidazoline or sulfonylurea); resistance / tolerance to ACCase inhibitors (including aryloxyphenoxypropionic acid (FOP)); and resistance / tolerance to carotenoid biosynthesis inhibitors, including the phytopene desaturase (PDS) step. Resistance / tolerance to inhibitors of carotenoid biosynthesis, 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitors, or other carotenoid biosynthesis target inhibitors; resistance / tolerance to cellulose inhibitors; resistance / tolerance to lipid synthesis inhibitors; resistance / tolerance to long-chain fatty acid inhibitors; resistance / tolerance to microtubule assembly inhibitors; resistance / tolerance to photosystem I electron shunts; resistance / tolerance to photosystem II inhibitors (including carbamates, triazines, and triazinones); resistance / tolerance to PPO inhibitors; and resistance / tolerance to synthetic auxins (including dicamba and 2,4-D (i.e., 2,4-dichlorophenoxyacetic acid)). The first target gene can be selected from PsbA, ALS, EPSPS, ACCase, PPO, HPPD, PDS, GS, DOXPS, TIR1, and AFB5. Certain mutation types generated after sequential cutting and repair of specific positions of these herbicide target genes can confer resistance / tolerance to the corresponding herbicides to the recipient plant cells. In one specific embodiment, the "first target gene" is ALS, and the "specific location of the gene" refers to the amino acid sequence sites A122, P197, R198, D204, A205, D376, R377, W574, S653, and G654 of the Arabidopsis thaliana AtALS protein (as shown in SEQ ID NO: 1), as well as the corresponding amino acid sites of ALS proteins in other plants using the AtALS amino acid sequence as a reference standard. The crRNA or sgRNA targets a target sequence comprising sequences selected from the amino acid sequence sites A122, P197, R198, D204, A205, D376, R377, W574, S653, and G654 of the AtALS protein, or any combination thereof, as well as the target sequences of the corresponding amino acid sites of ALS proteins in other plants using the AtALS amino acid sequence as a reference standard, or any combination thereof. The ALS W574 site is preferred. The selection pressure is preferably treatment with acesulfame potassium or nicosulfuron. In one specific embodiment, the "first target gene" is ACCase, and the "specific location of the gene" refers to the amino acid sequence of the AmACCase protein of Alopecurus myosuroides (as shown in SEQ ID NO: 3, and the gene sequence as shown in SEQ ID NO: 4) sites I1781, E1874, N1878, W1999, W2027, I2041, D2078, C2088, and G2096, as well as the corresponding amino acid sites of ACCase proteins of other monocotyledonous plants using the AmACCase amino acid sequence as a reference standard. The crRNA or sgRNA targets a sequence comprising amino acid sites I1781, E1874, N1878, W1999, W2027, I2041, D2078, C2088, G2096, or any combination thereof encoding the AmACCase gene, as well as target sequences corresponding to the aforementioned amino acid sites and any combinations thereof in ACCase proteins of other monocotyledonous plants using the AmACCase amino acid sequence as a reference standard. The ACCase W2027 site is preferred. The selection pressure is preferably quizalofop-p-ethyl treatment. In one specific embodiment, the "first target gene" is HPPD, and the "specific location of the gene" refers to the amino acid sequence sites H141, L276, P277, N338, G342, R346, D370, P386, K418, and G419 of the rice OsHPPD protein (as shown in SEQ ID NO: 5, and the genome sequence as shown in SEQ ID NO: 6), as well as the corresponding amino acid sites of HPPD proteins in other plants using the OsHPPD amino acid sequence as a reference standard. The crRNA or sgRNA targets a target sequence comprising sequences selected from the amino acid sequence sites H141, L276, P277, N338, G342, R346, D370, P386, K418, and G419 of the OsHPPD gene, or any combination thereof, as well as the target sequences of the corresponding amino acid sites and any combinations thereof of HPPD proteins in other plants using the OsHPPD amino acid sequence as a reference standard. The selection pressure is preferably biazole herbicides treatment. In one specific embodiment, the "first target gene" is PPO, and the "specific location of the gene" refers to the amino acid sequence sites S128, V217, S223, V364, K373, L423, Y425, and W470 of the rice OsPPO1 protein (as shown in SEQ ID NO: 7, and the genome sequence as shown in SEQ ID NO: 8), as well as the corresponding amino acid sites of PPO proteins in other plants using the OsPPO1 amino acid sequence as a reference standard. The crRNA or sgRNA targets a target sequence comprising sequences selected from the amino acid sequence sites S128, V217, S223, V364, K373, L423, Y425, and W470 encoding the OsPPO1 gene, or any combination thereof, as well as the target sequences of the corresponding amino acid sites and any combinations thereof of PPO proteins in other plants using the OsPPO1 amino acid sequence as a reference standard. The selection pressure is preferably pyrimethanil treatment. In one specific embodiment, the "first target gene" is TIR1, and the "specific location of the gene" refers to the amino acid sequence sites F93, F357, C413, and S448 of the rice OsTIR1 protein (as shown in SEQ ID NO: 9, and the genome sequence as shown in SEQ ID NO: 10), as well as the corresponding amino acid sites in the TIR1 proteins of other plants using the OsTIR1 amino acid sequence as a reference standard. The crRNA or sgRNA targets a target sequence containing sequences selected from the amino acid sequence sites F93, F357, C413, and S448 encoding the OsTIR1 gene, or any combination thereof, as well as the target sequences containing the corresponding amino acid sites and any combinations thereof in the TIR1 proteins of other plants using the OsTIR1 amino acid sequence as a reference standard. The screening pressure is preferably 2,4-D treatment. The present invention also provides a non-GMO instantaneous editing system employing the aforementioned method. The present invention further provides the use of the aforementioned non-GMO instantaneous editing system as a screening marker. The present invention further provides the use of the aforementioned non-GMO instantaneous editing system in disease treatment. The present invention further provides the use of the aforementioned non-GMO instantaneous editing system in biological breeding. The present invention also provides a genetically modified plant obtained by the aforementioned method, wherein the genome contains an editing event of a first target gene, and the genetically modified plant is obtained in a non-transgenic manner. The present invention also provides a genetically modified plant obtained by the aforementioned method, wherein the genome contains an editing event of a first target gene and an editing event of at least one second target gene, and the genetically modified plant is obtained in a non-transgenic manner. The present invention also provides a genetically modified plant obtained by the aforementioned method, the genome of which contains at least one editing event of a second target gene, wherein the genetically modified plant is obtained in a non-transgenic manner, and the editing event of the first target gene has been removed by genetic segregation. The present invention also provides a genome of a genetically modified plant obtained by the aforementioned method, the genome comprising: 1) an editing event of a first target gene; 2) an editing event of the first target gene and an editing event of at least one second target gene; or 3) an editing event of at least one second target gene, wherein the editing event of the first target gene has been removed by genetic segregation; wherein the genetically modified plant is obtained in a non-transgenic manner. In another aspect, the present invention provides a novel plant gene mutation obtained using the aforementioned method. The present invention also provides a novel mutation generated in a plant, comprising one or more of the following types: The substitutions are aspartic acid at position 376 of Arabidopsis thaliana with any other amino acid, tryptophan at position 574 of Arabidopsis thaliana with any other amino acid, serine at position 653 of Arabidopsis thaliana with any other amino acid, or serine at position 654 of Arabidopsis thaliana with any other amino acid; or tryptophan at position 2027 of Alopecurus aequalis indica with any other amino acid. In one specific embodiment, aspartic acid at position ALS376 in Arabidopsis thaliana is replaced by glutamic acid (D376E), tryptophan at position ALS574 is replaced by leucine or methionine (W574L or W574M), serine at position ALS653 is replaced by asparagine or arginine (S653N or S653R), or glycine at position ALS654 is replaced by aspartic acid (G654D), wherein the positions of the amino acids are referenced to the sequence positions of the corresponding amino acids in Arabidopsis thaliana; or, tryptophan at position ACCase2027 in Alopecurus myosuroides is replaced by leucine or cysteine (W2027L or W2027C), wherein the positions of the amino acids are referenced to the sequence positions of the corresponding amino acids in Alopecurus myosuroides. In another specific embodiment, the mutation type is S653R / G654D, wherein the position of the amino acid is referenced to the sequence position of the corresponding amino acid in Arabidopsis thaliana. In one specific embodiment, aspartic acid at position 350 of rice ALS is replaced by any other amino acid, tryptophan at position 548 of rice ALS is replaced by any other amino acid, or tryptophan at position 561 of potato ALS2 is replaced by any other amino acid; or, tryptophan at position 2038 of rice ACCase2 is replaced by any other amino acid. In another specific embodiment, the aspartic acid at position 350 of rice ALS is replaced by glutamic acid (D350E), the tryptophan at position 548 of rice ALS is replaced by leucine or methionine (W548L or W548M), or the tryptophan at position 561 of potato ALS2 is replaced by leucine or methionine (W561L or W561M); or, the tryptophan at position 2038 of rice ACCase2 is replaced by leucine or cysteine (W2038L or W2038C). The amino acid sequence of the rice ALS protein is shown in SEQ ID NO:11, the amino acid sequence of the potato StALS2 protein is shown in SEQ ID NO:19, and the amino acid sequence of the rice ACCase2 protein is shown in SEQ ID NO:13. The present invention further provides a protein having the novel mutation or a bioactive fragment thereof. The present invention also provides a nucleic acid comprising a nucleic acid sequence or its complementary sequence encoding the protein or a biologically active fragment thereof. The present invention also provides a recombinant expression vector comprising the aforementioned nucleic acid and a promoter operatively linked thereto. The present invention also provides an expression cassette containing the aforementioned nucleic acid. The present invention also provides a plant cell containing the aforementioned expression cassette. The present invention further provides a plant regenerated using the plant cells described above. Another aspect of the present invention provides a method for producing plants with increased resistance or tolerance to herbicides, including the aforementioned plant cell regeneration plant. In another aspect, the present invention provides a method for controlling weeds in a plant cultivation site, wherein the plant includes the plant described above or the plant prepared by the method described above, and the method includes applying an effective amount of one or more herbicides to the cultivation site to control weeds. In another aspect, the present invention provides the application of the novel mutation, the protein or its bioactive fragment, the nucleic acid, the recombinant expression vector or the expression cassette in improving the herbicide resistance or tolerance of plant cells, plant tissues, plant parts or plants. This invention has the following superior technical effects: Based on the sequences formed by new repair events generated by sequential editing, new targets are designed to induce multiple mutations at specific locations in the genome, greatly enriching the types of DNA breakage repair events and enabling new base substitution, deletion, and insertion mutations that cannot be obtained through single gene editing. In other words, the cyclic targeting scheme employed in this invention, which uses the prior gene editing repair sequence as the subsequent gene editing target, endows CRISPR / Cas with new capabilities for achieving single-base editing and precise site-specific deletion and insertion through simple knockout. This invention enables the screening of gene editing events without exogenous markers, and further enables non-transgenic gene editing and effective screening of editing events, which can greatly alleviate biosafety concerns regarding the application of this method in cell therapy and biobreeding. In particular, the non-GMO transient editing method for plants provided by this invention involves only Cas proteins and artificially synthesized small fragments of gRNA or sgRNA, with no exogenous DNA involved throughout the process. By continuously targeting and editing the first target gene to generate endogenous resistance selection markers, it can effectively screen editing events. In essence, it does not involve transgenic operations and is equivalent to chemical mutagenesis or radiation-induced breeding. It also does not require continuous isolation and detection of exogenous transgenic components over multiple generations, which can shorten the breeding cycle, ensure biosafety, and save regulatory and approval costs. It has great application prospects in precision plant breeding. Invention Details In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below. As used in this article, “genome” refers to the complete complement of genetic material (genes and non-coding sequences) present in every cell, virus, or organelle of an organism, and / or the complete set of chromosomes inherited as a unit (haploid) from a parent. The term "gene editing" refers to strategies and techniques for targeted and specific modifications to any genetic information or genome of a living organism. Therefore, the term includes editing of gene-coding regions, but also editing of regions other than the gene-coding regions of the genome. It also includes editing or modifying the nucleus (if present) and other genetic information within the cell. The term “CRISPR / Cas nuclease” can refer to a CRISPR-based nuclease or the nucleic acid sequence encoding it, including but not limited to: 1) Cas9, including SpCas9, ScCas9, SaCas9, xCas9, VRER-Cas9, EQR-Cas9, SpG-Cas9, SpRY-Cas9, SpCas9-NG, NG-Cas9, NGA-Cas9(VQR), etc.; 2) Cas12, including LbCpf1, FnCpf1, AsCpf1, MAD7, etc.; or any variant or derivative of the aforementioned CRISPR-based nucleases, preferably wherein at least one of the CRISPR-based nucleases contains a mutation compared to the corresponding wild-type sequence, such that the resulting CRISPR-based nuclease recognizes a different PAM sequence. As used herein, “CRISPR-based nuclease” is any nuclease already identified in a naturally occurring CRISPR system, subsequently isolated from its natural background, and preferably modified or combined into a recombinant construct of interest suitable as a tool for targeted genome engineering. As long as the original wild-type CRISPR-based nuclease provides DNA recognition, i.e., binding properties, any CRISPR-based nuclease can be used and optionally reprogrammed or additionally mutated to suit various embodiments of the present invention. The term "CRISPR" refers to a sequence-specific genetic manipulation technique that relies on clustered, regularly spaced short palindromic repeats, unlike RNA interference which regulates gene expression at the transcriptional level. The terms "Cas9 nuclease" and "Cas9" are used interchangeably in this article, referring to RNA-guided nucleases that include the Cas9 protein or fragments thereof (e.g., proteins containing the active DNA-cutting domain of Cas9 and / or the gRNA-binding domain of Cas9). Cas9 is a component of the CRISPR / Cas (clustered regularly spaced short palindromic repeats and related systems) genome editing system, capable of targeting and cleaving DNA target sequences to form DNA double-strand breaks (DSBs) under the guidance of guide RNA. "Cas protein" or "Cas polypeptide" refers to a polypeptide encoded by a Cas (CRISPR-related) gene. Cas proteins include Cas endonucleases. Cas proteins can be bacterial or archaea proteins. For example, type I-III CRISPR Cas proteins, as discussed in this article, typically originate from prokaryotes; type I and type III Cas proteins can originate from bacterial or archaea species, while type II Cas proteins (i.e., Cas9) can originate from bacterial species. Cas proteins include Cas9, Cpf1, C2c1, C2c2, C2c3, Cas3, Cas3-HD, Cas5, Cas7, Cas8, Cas10, Cas12a, Cas12b, or combinations or complexes thereof. "Cas9 variant" or "Cas9 endonuclease variant" refers to a variant of the parental Cas9 endonuclease that, when associated with crRNA and tracRNA or with sgRNA, retains the ability to: recognize, bind to all or part of a DNA target sequence and optionally unwind all or part of the DNA target sequence, create a nick in all or part of the DNA target sequence, or cleave all or part of the DNA target sequence. Cas9 endonuclease variants include those described herein, wherein the Cas9 endonuclease variant differs from the parental Cas9 endonuclease in that the Cas9 endonuclease variant (when compounded with gRNA to form a polynucleotide-directed endonuclease complex capable of modifying the target site) has at least one improved property compared to the parental Cas9 endonuclease (compounded with the same gRNA to form a polynucleotide-directed endonuclease complex capable of modifying the same target site), such as, but not limited to, increased transformation efficiency, increased DNA editing efficiency, reduced off-target cleavage, or any combination thereof. The Cas9 endonuclease variants described herein include variants that, when associated with crRNA and tracrRNA or sgRNA, can bind to double-stranded DNA target sites and cause cleavage at the double-stranded DNA target sites, while the parental Cas endonuclease, when associated with crRNA and tracrRNA or sgRNA, can bind to the target sites and cause double-strand breaks (cleavage). The terms "guide RNA" and "gRNA" are used interchangeably herein to refer to guide RNA sequences used for CRISPR-based correction of specific genes. These typically consist of partially complementary crRNA and tracrRNA molecules forming a complex. The crRNA contains a sequence sufficiently complementary to the target sequence to hybridize with it and guide the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it is known in the art that a single guide RNA (sgRNA) can be designed that incorporates features of both crRNA and tracrRNA. The terms “single guide RNA” and “sgRNA” are used interchangeably herein and refer to the synthetic fusion of two RNA molecules comprising a crRNA (CRISPRRNA) with a variable targeting domain (linked to a tracr-pairing sequence that hybridizes with tracrRNA) fused to a tracrRNA (trans-activating CRISPRRNA). The sgRNA may comprise a crRNA or crRNA fragment of a type II CRISPR / Cas system and a tracrRNA or tracrRNA fragment, wherein the guide RNA / Cas endonuclease complex guides the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, optionally bind to, and optionally nick or cleave (introduce single-strand or double-strand breaks) the DNA target site. In some embodiments, guide RNA(one or more) and Cas9 can be delivered to cells as a ribonucleoprotein (RNP) complex. RNP consists of purified Cas9 protein complexed with gRNA, and it is well known in the art that RNP can be efficiently delivered to a variety of cell types, including but not limited to stem cells and immune cells (Addgene, Cambridge, MA; Mirus Bio LLC, Madison, WI). In this article, the protospacer adjacent motif (PAM) refers to a short nucleotide sequence adjacent to the (targeted) target sequence (prespacer) recognized by the gRNA / Cas endonuclease system. If the target DNA sequence is not adjacent to a suitable PAM sequence, the Cas endonuclease may fail to recognize the target DNA sequence. The sequence and length of the PAM in this article can vary depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length, but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. As used in this article, the term "organism" or "living organism" includes animals, plants, fungi, bacteria, etc. As used in this article, the term "host cell" includes plant cells, animal cells, fungal cells, bacterial cells, etc. In this invention, "animal" includes, but is not limited to, vertebrates such as humans, non-human mammals, birds, fish, reptiles, amphibians, etc., as well as invertebrates such as insects. In this invention, "plant" should be understood as any differentiated multicellular organism capable of photosynthesis, particularly monocotyledonous or dicotyledonous plants, such as: (1) food crops: *Oryza* spp., such as rice (*Oryza sativa*), broadleaf rice (*Oryza latifolia*), paddy rice (*Oryza sativa*), and gleaming rice (*Oryza glaberrima*); *Triticum* spp., such as common wheat (*Triticum aestivum*) and durum wheat (*T. turgidum ssp. durum*); *Hordeum* spp., such as barley (*Hordeum vulgare*) and Arizona barley (*Hordeum arizonicum*); rye (*Secale cereale*); *Avena* spp., such as oats (*Avena sativa*), wild oats (*Avena fatua*), and byzantina oats (*Avena fatua*). var. sativa, hybrid oats (Avena hybrida); barnyard grass (Echinochloa spp.), for example, pearl millet (Pennisetum glaucum), sorghum (Sorghum bicolor, Sorghum vulgare)), black wheat, maize or corn, millet, rice, foxtail millet, sorghum, millet, buckwheat (Fagopyrum spp.), millet (Panicum miliaceum), millet (Setaria italica), wild rice (Zizania palustris), Ethiopian thrush (Eragrostis tef), millet (Panicum miliaceum), dragon claw millet (Eleusine coracana); (2) legumes: soybean (Glycine spp.), for example, soybean (Glycine max), soybean (Soja hispida), Soja The genera *Vicia*, *Vigna*, *Pisum*, *Field Bean*, *Lupinus*, *Vicia*, *Tamarindus indica*, *Lens culinaris*, and *Lathyrus* are all related to the pea family.), lentils (Lablab), broad beans, mung beans, red beans, chickpeas; (3) oil crops: peanuts (Arachis hypogaea), peanuts (Arachis spp.), sesame (Sesamum spp.), sunflowers (Helianthus spp.) (e.g. sunflowers (Helianthus annuus)), oil palms (Elaeis) (e.g. oil palms (Eiaeis guineensis), American oil palms (Elaeis oleifera)), soybeans (soybeans), rapeseed (Brassicanapus), brassica, sesame, mustard (Brassica juncea), rapeseed rape (oilseedrape), camellia, oil palm, olive, castor bean, European rapeseed (Brassica napus L.), canola (canola); (4) fiber crops: sisal (Agave sisalana), cotton (cotton, sea island cotton (Gossypium barbadense), upland cotton (Gossypium hirsutum), kenaf, sisal, abaca, flax (Linum usitatissimum), jute, ramie, hemp (Cannabis sativa), fire hemp; (5) Fruit crops: Ziziphus spp., Cucumis spp., Passiflora edulis, Vitis spp., Vaccinium spp., Pyrus communis, Prunus spp., Psidium spp., Punica granatum, Malus spp., Citrullus lanatus, Citrus spp., Ficus carica, Fortunella spp., Fragaria spp., Crataegus spp., Diospyros spp.), red fruit (Eugenia unifora), loquat (Eriobotrya japonica), longan (Dimocarpus longan), papaya (Carica papaya), coconut (Cocos spp.), star fruit (Averrhoa carambola), monkey fruit (Actinidia spp.), almond (Prunus amygdalus), banana (Musa spp.).(Banana), Avocado (Persea spp.), (Avocado (Persea americana)), Guava (Psidium guajava), Mammea americana, Mango (Mangifera indica), Olive (Oleaeuropaea)), Papaya (Caricapapaya), Coconut (Cocos nucifera), Malpighia emarginata, Sapodilla (Manilkara zapota), Pineapple (Ananas comosus), Anchovy (Annona spp.), Citrus (Citrus spp.)), Jackfruit (Artocarpus spp.), Lychee (Litchi chinensis), Ribes (Ribes spp.), Rubus (Rubus spp.), Pear, Peach, Apricot, Plum, Waxberry, Lemon, Kumquat, Durian, Orange, Strawberry (6) Root crops: cassava (Manihot spp.), sweet potato (Ipomoea batatas), taro (Colocasia esculenta), pickled mustard greens, onion, water chestnut, sedge, yam; (7) Vegetable crops: spinach (Spinacia spp.), common bean (Phaseolus spp.), lettuce (Lactuca sativa), bitter melon (Momordica spp.), parsley (Petroselinum crispum), pepper (Capsicum spp.), solanum (Solanum spp.) (e.g., potato (Solanum tuberosum), red eggplant (Solanum integrifolium) or tomato (Solanum lycopersicum)), tomato (Lycopersicon spp.) (e.g., tomato (Lycopersicon esculentum), tomato (Lycopersicon lycopersicum, pear-shaped tomato (Lycopersicon pyriforme), and hard-skinned bean (Macrotyloma spp.).), headless cabbage, angular loofah, lentil, okra, onion, potato, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, carrot, cauliflower, celery, collard greens, zucchini, winter melon (Benincasa hispida), asparagus officinalis, celery (Apium graveolens), amaranth (Amaranthus spp.), allium (Allium spp.), okra (Abelmoschus spp.), endive (Cichorium endivia), squash (Cucurbita spp.), coriander (Coriandrum) (8) Flowering crops: Tropaeolum minus, Tropaeolum majus, Canna indica, Opuntia spp., Tagetes genus (e.g., European rapeseed, Brassica napus, Brassica rapa ssp., Canola, Oilseed rape, Turnip rape, Mustard, Cabbage, Black mustard, Rapeseed rape), Brussels sprouts, Solanaceae plants (eggplant), Sweet pepper, Cucumber, Loofah, Chinese cabbage, Rapeseed, Cabbage, Gourd, Leek, Lotus, Lotus root, Lettuce; (8) Flowering crops: Golden lotus (Tropaeolum minus), Golden lotus (Tropaeolum majus), Canna indica, Opuntia spp., Tagetes genus spp.), orchid, spider lily, clivia, amaryllis, rose, rose, jasmine, tulip, cherry blossom, morning glory, marigold, lotus, daisy, carnation, petunia, tulip, lily, plum blossom, daffodil, winter jasmine, primrose, daphne, camellia, white magnolia, purple magnolia, viburnum, clivia, crabapple, peony, peony, lilac, azalea, Western azalea, Michelia figo, Bauhinia, Kerria japonica, weigela, forsythia, jasmine, broom, cyclamen, phalaenopsis, dendrobium, hyacinth, iris, calla lily, marigold, lotus, begonia, fuchsia, begonia maculata, geranium, pothos; (9) medicinal crops: safflower (Carthamus tinctorius), mint (Mentha spp.).), Rheum rhabarbarum, Crocus sativus, Lycium barbarum, Polygonatum odoratum, Polygonatum sibiricum, Anemarrhena asphodeloides, Ophiopogon japonicus, Fritillaria cirrhosa, Curcuma longa, Amomum villosum, Polygonum multiflorum, Rheum palmatum, Glycyrrhiza uralensis, Astragalus membranaceus, Panax ginseng, Panax notoginseng, Acanthopanax senticosus, Angelica sinensis, Ligusticum chuanxiong, Bupleurum chinense, Datura stramonium, Datura stramonium, Mentha haplocalyx, Leonurus japonicus, Pogostemon cablin, Scutellaria baicalensis, Prunella vulgaris, Pyrethrum salicaria, Ginkgo biloba, Cinchona japonica, Rubia cordifolia, Alfalfa, Pepper, Isatis indigotica, Atractylodes macrocephala; (10) Raw material crops: Rubber, Ricinus communis, Tung oil tree, Mulberry, Hops, Birch, Alder, Lacquer tree; (11) Forage crops: Agropyron spp., Trifolium spp., Miscanthus sinensis, Pennisetum sp., Phalaris (12) Sugar crops: sugarcane (species of the genus *Saccharum*), beet (*Beta vulgaris*); (13) Beverage crops: large-leaved tea (*Camellia sinensis*), tea (*Camellia sinensis*), tea tree (*Tetracentron pratense*), turf (*Cyperaceae*) (alpine sedge, *Carex pediformis*, low sedge), alfalfa, turf, alfalfa, sweet clover, milkvetch, tamarisk, sesbania, duckweed, water hyacinth, purple locust, lupin, clover, alfalfa, water hyacinth, water peanut, ryegrass; (14) Sugar crops: sugarcane (species of the genus *Saccharum*), beet (*Beta vulgaris*); (15) Beverage crops: large-leaved tea (*Camellia sinensis*), tea (*Camellia sinensis*), tea tree (*Tea*), coffee (species of the genus *Coffea*). (14) Lawn plants: Ammophila arenaria, Poa spp. (Poa pratensis) (bluegrass), Agrostis spp. (Agrostis palustris) (Agrostis palustris) (strawberry), Lolium spp. (ryegrass), Festuca spp. (festuca), Zoysia spp. (Zoysia japonica) ...Bermuda grass, Cynodon dactylon, Stenotaphrum secunda tum (St. Augustine grass), Paspalum spp. (Paspalum), Eremochloa ophiuroides (Centipede grass), Axonopus spp. (Carpet grass), Bouteloua dactyloides (Buffalo grass), Bouteloua var. bouteloua var.spp.)(Granmargrass), Digitaria sanguinalis, Cyperus rotundus, Kylling abrevifolia, Cyperus amuricus, Erigeroncanadensis, Hydrocotyles ibthorpioides, Kummerowia striata, Euphorbia humifusa, Viola arvensis, white sedge, heterospike, turf; (15) Trees and crops: Pinus spp., Salix sp., Acer spp., Hibiscus spp., Eucalyptus sp., Ginkgo biloba, Bambusa sp., Populus spp.), Prosopis spp., Quercus spp., Phoenix spp., Fagus spp., Ceiba pentandra, Cinnamomum spp., Corchorus sp., Phragmites australis, Physalis spp., Desmodium spp., Poplar, Ivy, Populus alba, Coral tree, Ginkgo, Oak, Ailanthus altissima, Schima superba, Holly, Sycamore, Privet, Buxus macrocarpa, Larch, Black thorn, Pinus massoniana, Pinus yunnanensis, Pinus tabuliformis, Pinus tabuliformis, Pinus koraiensis, Juglans mandshurica, Lemon, Sycamore, Syzygium aromaticum, Davidia involucrata, Bombax ceiba, Bauhinia purpurea, Bauhinia purpurea, Rain tree Albizia, Aristolochia, Erythrina, Magnolia grandiflora, Cycas, Lagerstroemia indica, conifers, trees, shrubs; (16) Nut crops: Brazil chestnut (Bertholletia excelsea), Castanea spp., Corylus spp.), Carya spp., Juglans spp., Pistacia vera, Anacardium occidentale, Macadamia integrifolia, Pecan, Macadamia nut, Pistachio, Almond and other nut-producing plants; (17) Others: Arabidopsis thaliana, Brachypodium album, Tribulus terrestris, Large foxtail grass, Goosegrass, Cadaba farinosa, Algae, Carex elata, Ornamental plants, Carissa macrocarpa, Cynara spp., Daucus carota, Dioscorea spp., Erianthus sp., Festuca arundinacea, Hemerocallis fulva, Lotus spp., Luzula *Sylvatica*, *Medicago sativa*, *Melilotus* spp., *Morus nigra*, *Nicotiana* spp., *Olea* spp., *Ornithopus* spp., *Pastinaca sativa*, *Sambucus* spp., *Sinapis* sp., *Syzygium* spp., *Tripsacum dactyloides*, *Triticosecale rimpaui*, *Viola odorata*, etc. In one specific embodiment, the plants are selected from rice, corn, wheat, soybean, sunflower, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, cassava, potato, sweet potato, cabbage, kale, cucumber, rose, pothos, watermelon, cantaloupe, strawberry, blueberry, grape, apple, citrus, peach, pear, banana, etc. As used herein, the term "plant" includes the whole plant and any offspring, plant cells, tissues, or parts. The term "plant part" includes any part of a plant, including, for example, but not limited to: seeds (including mature seeds, immature embryos without a seed coat, and immature seeds); plant cuttings; plant cells; plant cell cultures; plant organs (e.g., pollen, embryo, flower, fruit, bud, leaf, root, stem, and related explants). Plant tissues or plant organs can be seeds, callus, or any other population of plant cells organized into structural or functional units. Plant cells or tissue cultures are capable of regenerating plants with the physiological and morphological characteristics of the plant from which the cells or tissues originated, and are capable of regenerating plants with substantially the same genotype as that plant. In contrast, some plant cells are incapable of regenerating plants. Regenerative cells in plant cells or tissue cultures can be embryos, protoplasts, meristems, callus, pollen, leaves, anthers, roots, root tips, filaments, flowers, kernels, spikes, rachis, shells, or stems. Plant parts include harvestable parts and parts that can be used to propagate offspring. Plant parts that can be used for propagation include, for example, but not limited to: seeds; fruits; cuttings; seedlings; tubers; and rootstocks. Harvestable parts of a plant can be any useful part of the plant, including, for example, but not limited to: flowers; pollen; seedlings; tubers; leaves; stems; fruits; seeds; and roots. Plant cells are the structural and physiological units of a plant. As used herein, plant cells include protoplasts and protoplasts with a partial cell wall. Plant cells can be in the form of isolated single cells or aggregates of cells (e.g., loose callus and cultured cells) and can be part of higher-level tissue units (e.g., plant tissues, plant organs, and plants). Thus, a plant cell can be a protoplast, a gamete-producing cell, or a cell or collection of cells capable of regenerating into a complete plant. Therefore, in the embodiments described herein, a seed comprising multiple plant cells and capable of regenerating into a whole plant is considered a “plant part”. As used herein, the term "protoplast" refers to a plant cell whose cell wall has been completely or partially removed, exposing its lipid bilayer membrane. Typically, a protoplast is an isolated plant cell without a cell wall, which has the potential to regenerate cell cultures or whole plants. Plant "offspring" includes any subsequent generations of a plant. The term "bacteria" refers to all prokaryotes, including all organisms in the Kingdom of Procaryotae. The term "bacteria" includes all microorganisms considered to be bacteria, including the genera *Mycoplasma*, *Chlamydia*, *Actinomyces*, *Streptomyce*, and *Rickettsia*. All forms of bacteria are included in this definition, including cocci, bacilli, spirilla, protoplasts, protoplasts, etc. The term also includes prokaryotes that are Gram-negative or Gram-positive. "Gram-negative" and "Gram-positive" refer to staining patterns using Gram staining methods well-known in the art (see, for example, Finegold and Martin, *Diagnostic Microbiology*, 6th Ed., CV Mosby St. Louis, pp. 13-15).
[1982] "Gram-positive bacteria" are bacteria that retain the original dye used for Gram staining, causing the stained cells to appear deep blue to purple under a microscope. "Gram-negative bacteria" do not retain the original dye used for Gram staining but are stained with a counterstain. Therefore, Gram-negative bacteria appear red after a Gram staining reaction. The term “fungus” as used in this article refers to eukaryotic organisms, such as molds and yeasts, including dimorphic fungi. The terms "herbicide tolerance" and "herbicide resistance" are used interchangeably, both referring to tolerance to and resistance to herbicides. "Improved herbicide tolerance" and "improved herbicide resistance" refer to increased tolerance or resistance to the herbicide compared to plants containing wild-type genes. The term "wild type" refers to nucleic acid molecules or proteins that can be found in nature. In this invention, the term "site" includes the location where the plants of this invention are cultivated, such as soil, and also includes, for example, plant seeds, seedlings, and mature plants. The term "effective amount for weed control" refers to an amount of herbicide sufficient to affect the growth or development of a target weed, such as preventing or inhibiting the growth or development of the target weed, or killing the weed. Advantageously, the effective amount for weed control does not significantly affect the growth and / or development of the seeds, seedlings, or plants of this invention. Such effective amounts for weed control can be determined by those skilled in the art through routine experiments. As used in this article, “target DNA” refers to a DNA polynucleotide that contains a “target site” or “target sequence”. "Cleavage" refers to the breakage of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods, including but not limited to enzymatic or chemical hydrolysis of phosphodiester bonds. Both single-strand and double-strand cleavage are possible, and double-strand cleavage can occur due to two distinct single-strand cleavage events. DNA cleavage can result in blunt or staggered ends. In some embodiments, a complex comprising RNA targeting the DNA and a site-modified polypeptide is used for targeted double-strand DNA cleavage. The term "gene" includes a segment of nucleic acid that expresses a functional molecule (such as, but not limited to, a specific protein), including regulatory sequences before (5' non-coding sequence) and after (3' non-coding sequence). The DNA sequence that “encodes” a specific RNA is the DNA nucleic acid sequence that is transcribed into RNA. DNA polynucleotides can encode RNA (mRNA) that is translated into proteins, or DNA polynucleotides can encode RNA that is not translated into proteins (such as tRNA, rRNA, or RNA that targets DNA; also known as “non-coding” RNA or “ncRNA”). The terms “polypeptide,” “peptide,” and “protein” are used interchangeably in this invention to refer to polymers of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The terms “polypeptide,” “peptide,” “amino acid sequence,” and “protein” may also include modified forms, including but not limited to glycosylation, lipid linkage, sulfation, γ-carboxylation, hydroxylation, and ADP-ribosylation of glutamate residues. "Bioactive fragments" refer to fragments of proteins that retain their functional activity despite the loss of one or more amino acid residues from the N and / or C ends. For the terminology related to amino acid substitution used in the specification, the first letter represents a naturally occurring amino acid at a specific position in a particular sequence, the following number represents the position in the corresponding sequence, and the second letter represents the different amino acid that replaces that natural amino acid. For example, W574L indicates that tryptophan at position 574 is replaced by leucine. For double or multiple mutations, each mutation is separated by a " / ". The terms "polynucleotide" and "nucleic acid" are used interchangeably, including DNA, RNA, or their hybrids, which can be double-stranded or single-stranded. The terms "nucleotide sequence" and "nucleic acid sequence" both refer to the sequence of bases in DNA or RNA. As used in this invention, "expression cassette," "expression vector," and "expression construct" refer to vectors, such as recombinant vectors, suitable for expressing nucleotide sequences of interest in plants. "Expression" refers to the production of a functional product. For example, the expression of a nucleotide sequence can refer to the transcription of the nucleotide sequence (e.g., transcription to generate mRNA or functional RNA) and / or the translation of RNA into precursor or mature proteins. The "expression construct" of the present invention may be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, a translatable RNA (such as mRNA). The "expression construct" of the present invention may contain regulatory sequences and nucleotide sequences of interest from different sources, or regulatory sequences and nucleotide sequences of interest from the same source but arranged in a manner different from those normally found in nature. The terms “recombinant expression vector” or “DNA construct” are used interchangeably herein and refer to a DNA molecule comprising a vector and at least one insert. Recombinant expression vectors are typically created for the purpose of expressing and / or propagating the insert or for constructing other recombinant nucleotide sequences. The insert may be operatively or inoperably linked to a promoter sequence and may be operatively or inoperably linked to a DNA regulatory sequence. The terms "regulatory sequence" and "regulatory element" are used interchangeably. Both refer to nucleotide sequences located upstream (5' non-coding sequence), midway, or downstream (3' non-coding sequence) of a coding sequence that influence the transcription, RNA processing, stability, or translation of the relevant coding sequence. Plant expression regulatory elements are nucleotide sequences that can control the transcription, RNA processing, stability, or translation of a nucleotide sequence of interest in plants. Regulatory sequences may include, but are not limited to, promoters, translational leader sequences, introns, and polyadenylation recognition sequences. A "promoter" refers to a nucleic acid fragment that controls the transcription of another nucleic acid fragment. In some embodiments of the present invention, the promoter is a promoter capable of controlling gene transcription in plant cells, regardless of whether it originates from plant cells. The promoter can be a constitutive promoter, a tissue-specific promoter, a developmental regulatory promoter, or an inducible promoter. "Constraint promoters" refer to promoters that generally cause gene expression in most cell types and under most conditions. "Tissue-specific promoters" and "tissue-preferred promoters" are used interchangeably and refer to promoters that are primarily, but not necessarily, expressed specifically in one tissue or organ, and may also be expressed in a specific cell type. "Developmental regulatory promoters" are promoters whose activity is determined by developmental events. "Inducible promoters" selectively express manipulated DNA sequences in response to endogenous or exogenous stimuli (environment, hormones, chemical signals, etc.). As used herein, the term "operably linked" refers to the linking of a regulatory element (e.g., but not limited to, promoter sequences, transcription termination sequences, etc.) to a nucleic acid sequence (e.g., coding sequences or open reading frames) such that transcription of the nucleotide sequence is controlled and regulated by the transcriptional regulatory element. Techniques for operably linking regulatory element regions to nucleic acid molecules are known in the art. "Introducing" nucleic acid molecules (such as plasmids, linear nucleic acid fragments, RNA, etc.) or proteins into plants refers to transforming plant cells with the nucleic acids or proteins so that the nucleic acids or proteins can function in the plant cells. The term "transformation" as used in this invention includes both stable transformation and transient transformation. "Stable transformation" refers to the introduction of a foreign nucleotide sequence into a plant genome, resulting in the stable inheritance of the foreign gene. Once stable transformation occurs, the foreign nucleic acid sequence is stably integrated into the genome of the plant and its subsequent generations. "Transient transformation" refers to the introduction of nucleic acid molecules or proteins into plant cells to perform their functions without the foreign gene being stably inherited. In transient transformation, the foreign nucleic acid sequence does not integrate into the plant genome. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may also be used in the practice or testing of this invention, preferred methods and materials are described hereafter. All publications and patents referenced in this specification are incorporated herein by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference, and are incorporated herein by reference to disclose and describe the methods and / or materials relating to the publications referenced. Any reference to a publication is made prior to the filing date and should not be construed as an admission that the invention does not predate such publication. Furthermore, the publication date provided may differ from the actual publication date, which may require independent verification. Unless specifically stated or implied, as used herein, the terms “a,” “an,” and “described” mean “at least one.” All patents, patent applications, and publications mentioned or cited herein are incorporated herein by reference in their entirety as if they were individually cited separately. Attached Figure Description Figure 1 is a schematic diagram of the method for generating new mutations in organisms according to the present invention. The figure only uses Cas9 with NGG as the PAM as an example; similarly, other Cas9 variants with different PAMs (such as NG) can also be applied. Figure 2 is a schematic diagram of the gRNA design at the W574 and S653 sites of the Arabidopsis ALS gene. Figure 3 shows the herbicide-resistant Arabidopsis T2 generation lines transformed with two different cyclic targeting vectors. pQY743 and pQY745 are vector numbers. The resistant lines were able to root normally, while the wild-type Col-0 and non-resistant lines could not root. Figure 4 shows the sequencing peaks of the ALS gene in the T2 generation of Arabidopsis thaliana resistant to nicotinic acid. The T indicated by the arrow is derived from the G mutation, which leads to the W574L mutation. Figure 5 illustrates the design of a cyclic targeting protocol for the W574 site of the Arabidopsis ALS gene. The T-DNA sequence expresses four genes: sgRNA1, sgRNA2, Cas9, and HygR. sgRNA1 and Cas9 form a complex that cleaves the W574 codon of ALS in the genome. It is expected that spontaneous cellular repair will lead to a -G genotype. This new sequence can be recognized and cleaved by the complex formed by sgRNA2 and Cas9, resulting in a +T genotype through spontaneous cellular repair, leading to W574L. Figure 6 shows the sequencing results of Arabidopsis thaliana resistant seedlings screened with mepiquat nicotinic acid and the ALS W574 site. Figure 7 illustrates the design of a cyclic targeting protocol for the S653 site of the Arabidopsis ALS gene. The T-DNA sequence expresses four genes: sgRNA1, sgRNA2, Cas9, and HygR. sgRNA1 and Cas9 form a complex that cleaves the S653 codon of ALS in the genome. This genotype is formed through spontaneous cellular repair, resulting in the -G genotype. This sequence can be recognized and cleaved by the complex formed by sgRNA2 and Cas9. This genotype is then formed through spontaneous cellular repair, resulting in the +A genotype, leading to S653N. Figure 8 shows the sequencing results of Arabidopsis thaliana resistant seedlings screened with methyl nicotinic acid and the ALS S653 site. The left side shows the screening results and the proportion of resistant seedlings, while the right side shows the sequencing peaks and mutation types at the S653 site. Figure 9 illustrates the design of a cyclic targeting protocol for the Arabidopsis ALS gene at codon W574. The T-DNA sequence expresses four genes: sgRNA1, sgRNA2, Cas9, and HygR. sgRNA1 and Cas9 form a complex that cleaves the W574 codon of ALS in the genome. This cleavage, after spontaneous cellular repair, results in the +A genotype. This sequence can then be recognized and cleaved by the complex formed by sgRNA2 and Cas9. After further spontaneous cellular repair, this cleavage results in the -G genotype, leading to W574M. These two cleavages utilize different PAM sites. Figure 10 shows the design of a cyclic targeting scheme for the W2038 site of the ACCase2 gene in rice, corresponding to the large-spike wheatgrass (W2027). The T-DNA sequence expresses four genes: sgRNA1, sgRNA2, Cas9, and HygR. sgRNA1 and Cas9 form a complex that cleaves the W2038 codon of ACCase in the genome. Spontaneous cellular repair results in a -G genotype. This sequence can be recognized and cleaved by the complex formed by sgRNA2 and Cas9. Spontaneous cellular repair then results in a +T genotype, leading to W2038L. Figure 11 shows the sequencing results of resistant rice callus and W2038 site after co-screening with hygromycin (50 ug / L) and quizalofop-P-ethyl (50 ug / L). Figure 12 shows the polyacrylamide gel electrophoresis images of prokaryotically expressed and purified SpCas9 and NGA-Cas9 proteins. The band indicated by the arrow is the Cas9 protein band. Figure 13 shows the cleavage activity of purified Cas9 protein against DNA fragments containing OsALS W548 and OsACCase2 W2038 target sites in vitro, as detected by agarose gel electrophoresis. It can be seen that the DNA fragments can be cleaved to the expected size only when Cas9 protein and sgRNA fragments are added simultaneously. Figure 14 shows the sequencing peaks of the target site OsALS W548 in RNP-transformed rice protoplasts, which corresponds to the Arabidopsis ALS W574 site. The arrow points to a location that, in addition to the original G base signal peak, also shows a mutated T base signal peak, resulting in the W548L mutation. Figure 15 shows rice resistant callus selected from the OsACCase2 W2038 site using 50 μg / L quizalofop-P-ethyl. The arrows indicate resistant callus. Figure 16 shows the sequencing peaks of the OsACCase2 W2038 target site in rice seedlings differentiated from resistant callus. The T at the arrow is derived from the G mutation, which leads to the W2038L mutation. Figure 17 shows the resistance test of T1 generation OsACCase2 W2038L edited seedlings to haloxyfop-R-methyl. The leftmost image shows the wild-type Huai Rice 5 water treatment control; the second to fourth images show the results of treating wild-type Huai Rice 5 and two RNP gene-gun-transformed T1 generation W2038L edited lines QY367-7-12 and QY367-7-18 with 5 grams of haloxyfop-R-methyl per acre. It is evident that the edited lines developed resistance to haloxyfop-R-methyl. Figure 18 shows the resistance test of T1 generation OsACCase2 W2038L edited seedlings to quizalofop-p-ethyl. The leftmost line in the figure is the wild-type Huai rice 5 water treatment control; the second to fourth lines from the left are the results of treating wild-type Huai rice 5 and the two RNP gene gun-transformed T1 generation W2038L edited lines QY367-5-10 and QY367-5-21 with 5 grams of quizalofop-p-ethyl per acre. It is evident that the edited lines developed resistance to quizalofop-p-ethyl. Figure 19 shows rice resistant callus selected by RNP editing with 50 μg / L quizalofop-P-ethyl, simultaneously editing the OsACCase2 W2038 site and the OsBADH2 gene. The arrows indicate resistant callus. Figure 20 shows the sequencing peaks of the OsACCase2 W2038 target site in the T0 generation dual-site edited seedlings. The T at the arrow is derived from the G mutation, which leads to the W2038L mutation. Figure 21 shows the sequencing peaks of the OsBADH2 target site in the T0 generation dual-site edited seedlings. The +A homozygous mutation occurred at the location indicated by the arrow. Figure 22 shows rice resistant callus selected by RNP editing with 5 mg / L pyrazosulfuron-methyl, simultaneously editing the OsALS W548 site and the OsSWEET14 gene. The arrows indicate resistant callus. Figure 23 shows the sequencing peaks of the target site W548 in the T0 generation dual-site edited seedling OsALS. The arrow indicates the presence of signal peaks for both G and T bases, leading to the W548L mutation. Figure 24 shows the sequencing peaks of the OsSWEET14 target site in the T0 generation dual-site edited seedlings. The arrows indicate the occurrence of a homozygous -C mutation. Figure 25 shows the resistance test of T1 generation OsALS W548 and OsSWEET14 double-site edited seedlings to nicosulfuron. The leftmost image shows the wild-type Huai rice 5 water treatment control, while the second and third images show the results of wild-type Huai rice 5 and the RNP gene gun-transformed T1 generation W548L edited line QY360-7-11 treated with 4 grams of nicosulfuron per acre. It is evident that the edited line developed resistance to nicosulfuron. Figure 26 shows the resistance test of T1 generation OsALS W548 and OsSWEET14 double-site edited seedlings to flusulfuron. The leftmost image shows the wild-type Huai rice 5 water treatment control, while the second and third images show the results of treatment with 2 grams of flusulfuron per acre for the T1 generation W548L edited line QY360-7-9 transformed with an RNP gene gun. It is evident that the edited line developed resistance to flusulfuron. Figure 27 shows the resistance test of T1 generation OsALS W548 and OsSWEET14 double-site edited seedlings to methyl imidacloprid. The leftmost image shows the wild-type Huai rice 5 water treatment control, while the second and third images show the results of wild-type Huai rice 5 and the RNP gene gun-transformed T1 generation W548L edited line QY360-7-11 treated with 7 grams of methyl imidacloprid per acre. It is evident that the edited line developed resistance to methyl imidacloprid. Figure 28 shows the resistance test of T1 generation OsALS W548 and OsSWEET14 double-site edited seedlings to acesulfame potassium. The leftmost image shows the wild-type Huai rice 5 water treatment control, while the second to fourth images show the results of treatment with 2 grams of acesulfame potassium per acre for the wild-type Huai rice 5 and the RNP gene gun-transformed T1 generation W548L edited lines QY360-7-2 and QY360-7-11. It is evident that the edited lines developed resistance to acesulfame potassium. Figure 29 shows the continuous targeting protocol for the HBB gene in 293T cells. In this figure, A represents the target site design for continuous HBB gene targeting in 293T cells; B represents the transformation efficiency of each editing vector after 48 hours of transformation in 293T cells; C represents the ratio of gene editing types produced by continuous and single-site targeting of the HBB gene in 293T cells; WT: wild type; indel: deleted or inserted genotype; C->T SNP: genotype producing a C-to-T base substitution at the nick site. Sequence Description The main sequences involved in this invention are summarized below, and the relevant sequences are provided in the sequence listing. SEQ ID NO: Sequence Description 1. Amino acid sequence of Arabidopsis thaliana ALS protein 2. Arabidopsis thaliana ALS gene DNA sequence 3. Alopecurus Amino acid sequence of myosuroides AmACCase protein 4. DNA sequence of AmACCase gene in wheatgrass 5. Amino acid sequence of rice OsHPPD protein 6. Genomic DNA sequence of rice OsHPPD protein 7. Amino acid sequence of rice OsPPO1 protein 8. Genomic DNA sequence of rice OsPPO1 protein 9. Amino acid sequence of rice OsTIR1 protein 10. Genomic DNA sequence of rice OsTIR1 protein 11. Amino acid sequence of rice ALS protein 12. DNA sequence of rice ALS gene 13. Amino acid sequence of rice ACCase2 protein 14. Genomic DNA sequence of rice ACCase2 15. DNA sequence of spCas9 protein optimized by plant codons 16. DNA sequence of NGA-Cas9 protein optimized by plant codons 17. Genomic DNA sequence of rice OsBADH2 18. Genomic DNA sequence of rice OsSWEET14 19. Amino acid sequence of potato StALS2 protein 20. DNA sequence of potato StALS2 gene 21. Hemoglobin subunit in human embryonic kidney cells 293T beta gene DNA sequence; HBB gene CDS sequence in 22 human embryonic kidney cells 293T; HBB gene amino acid sequence in 23 human embryonic kidney cells 293T. Detailed Implementation The present invention will be further illustrated below with examples. The following description is by way of example, but the scope of protection of the present invention should not be limited thereto. Unless otherwise specified, the experimental methods in the following examples are methods described in commonly used molecular biology, tissue culture techniques, and agronomic handbooks. For example, specific steps can be found in: *Molecular Cloning: A Laboratory Manual (3rd edition)* (Sambrook, J., Russell, David W., 2001, Cold Spring Harbor), and *Plant Propagation by Tissue Culture* (Edwin F. George, Michael A. Hall, Geert-Jan De Klerk, 2008, Springer). Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available. Example 1: Design of predictable base substitutions for cyclic targeting of the W574 and S653 sites of the Arabidopsis ALS gene. A. Experimental Materials 1. Arabidopsis thaliana materials Arabidopsis thaliana Col-0 wild type is a dicotyledonous plant type variety. The original seeds were provided by the Department of Weed Science, College of Plant Protection, China Agricultural University. Our laboratory propagated and preserved the seeds according to standard methods in this field. 2. Carrier pCBC-dT1T2 (Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ 2014. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. Nov29;14(1):327 For details, see https: / / www.addgene.org / 50590 / ), pHEE401E (For details, see Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC, Chen QJ Genome Biol. 2015 Jul 21;16:144. doi:10.1186 / s13059-015-0715-0. https: / / www.addgene.org / 71287 / ), pHEE401E-NG (Nishimasu et al. 2018 Engineered The mutation reported in CRISPR-Cas9 nuclease with expanded targeting space.Science361(6408):1259-1262.doi:10.1126 / science.aas9129 was introduced into pHEE401E to construct a vector that recognizes NG PAM (pHEE401E-NG). The vector plasmid can be obtained commercially from Addgene or constructed by our laboratory according to conventional molecular biology methods and preserved by our laboratory. 3. Main instruments and equipment Pipettes, water baths, PCR instruments (Bio-rad T100), electrophoresis apparatus (WIX-EP600), gel imaging systems, electric hot air dryers, centrifuges (Eppendorf 5424R), high-throughput tissue homogenizers, shakers, electronic balances, pH meters, etc. 4. Main reagents High-fidelity DNA polymerase (purchased from Tsingke Biotechnology), agarose gel extraction kit and plasmid extraction kit (purchased from Cisco), BsaI and T4 DNA ligase (purchased from NEB), Trans5α competent cells and EHA105 competent cells (purchased from Beijing TransGen Biotech), GV3101 Agrobacterium competent cells (purchased from Shanghai Angyu Biotechnology), Tris, EDTA, kanamycin, cephalosporin antibiotics, hygromycin, agarose, yeast extract, tryptone, NaCl (purchased from Sangon Biotech), MS powder, sucrose, Silwet-77, hygromycin (purchased from Solarbio), nucleic acid dye (Dured), anhydrous ethanol (purchased from Sinopharm), etc. 5. Preparation of main solutions 1) Seed disinfection solution: 4 mL 10% SDS, 20 mL NaClO, add water to make up to 200 mL. 2) SDS extraction buffer: 40 mL 1M Tris·HCl (pH 8.0), 50 mL 0.1M EDTA, 10 mL 5M NaCl, 10 mL 10% SDS, add water to make up to 200 mL. 3) Infection solution: 1.5g sucrose, 9μL Silwet-77, added to 30mL ultrapure water. 4) LB solid medium: 5g yeast extract, 10g tryptone, 10g NaCl, 15g agar, add water to make up to 1L, sterilize at 121℃ for 15 minutes and then pour into plates for later use. 5) 50×TAE stock solution: Tris 242g, Na2EDTA·2H2O 37.2g, add 800mL ultrapure water, stir thoroughly to dissolve, add 57.1mL acetic acid, stir thoroughly, and finally dilute to 1L with deionized water and store at room temperature. 6) MS solid medium: Weigh 4.42g MS powder and 10g sucrose, add 800mL ultrapure water, adjust pH to 5.8, add water to make up to 1L, add 10g plant gel, sterilize at 121℃ for 15 minutes, and then pour into plates for later use. B. Experimental Methods 1. Design and construction of CRISPR / Cas9 dual-target vectors 1.1 Target Design The Arabidopsis ALS gene sequence is shown in SEQ ID NO:2. A 19-base target sequence gRNA1:5'-GCATGGTTATGCAATGGGA-3' was designed using AGA near the 574 site of Arabidopsis ALS as the PAM. It is predicted that after editing, a G base will be deleted between the first 3-4 positions of the PAM. Then, a second target sequence gRNA2:5'-GGCATGGTTATGCAATGGA-3' was designed using the deleted sequence. It is predicted that after the second editing, a T base will be inserted, thereby achieving the TGG-TTG conversion, as shown in Figure 2. Similarly, a 19-base target sequence gRNA3:5'-TGCCGATGATCCCGAGTGG-3' was designed using TGG near the ALS653 site in Arabidopsis thaliana as the PAM. It was predicted that after editing, a base G would be deleted between the first 3-4 positions of the PAM. Then, a second target sequence gRNA4:5'-TTGCCGATGATCCCGATGG-3' was designed using the deleted sequence. It was predicted that after the second editing, a base A would be inserted, thereby achieving the AGT-AAT conversion, as shown in Figure 2. 1.2 Carrier Construction The procedure was performed according to the method described in Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ 2014. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. Nov 29; 14(1):327. Specifically, the dual-target fragments at ALS574 and 653 sites were amplified using the dT1T2 plasmid as a template to construct an sgRNA expression cassette. The pHEE401E and pHEE401E-NG vector backbones were digested with BsaI, and the fragments were recovered from the gel. The target fragments were directly used for ligation after digestion. The vector backbone and the target fragments were ligated using T4 DNA ligase. The ligation products were transformed into Trans5α competent cells, and different single clones were picked for sequencing. After correct sequencing, the plasmids were extracted using the Cisco high-purity plasmid mini-extraction kit to obtain recombinant plasmids, which were named pQY743 and pQY745, respectively. 2. Design of primers for target detection The target detection primers are centered around ALS574 and ALS653 targets. The upstream detection primer is approximately 100 bp from the ALS574 target, and the downstream detection primer is approximately 280 bp from the ALS653 target. Primer sequences: 574 / 653checking-F: 5'AT-TGACGGAGATGGAAGCTT3', 574 / 653checking-R: 5'CCAAACTGAGCCAGTCACAA3'. 3. Establishment of a genetic transformation system for Arabidopsis thaliana 3.1 Agrobacterium-mediated transformation The constructed recombinant plasmid was transformed into Agrobacterium GV3101 competent cells to obtain recombinant Agrobacterium. 3.2 Preparation of Agrobacterium infection solution 1) Pick activated Agrobacterium and inoculate it into 30ml of YEP liquid medium (containing 25mg / L Rif and 50mg / L Kan), and culture overnight at 28℃ with shaking at 200 rpm until the OD600 value is about 1.0-1.5. 2) Centrifuge at 6000 rpm for 10 minutes to collect the bacterial cells and discard the supernatant. 3) Resuspend the bacterial cells in the infection solution (no pH adjustment required) until the OD600 is about 0.8 for later use. 3.3 Arabidopsis transformation 1) Before conversion, check if the plant is growing well, has abundant inflorescences, and shows no signs of stress. The first conversion can be carried out when the plant height reaches 20 cm. If the soil is dry, water it appropriately. The day before conversion, use scissors to cut off the siliques that have already grown. 2) Immerse the inflorescence of the plant to be transformed in the above solution for 30 seconds to 1 minute, stirring gently during the process. After immersion, there should be a liquid film on the plant. 3) After the transformation is complete, the plants are placed in a dark environment for 24 hours for dark culture, and then taken out and placed in a normal light environment for growth. 4) The second conversion can be carried out using the same method after one week. 3.4 Seed Harvesting Once the seeds are mature, they can be harvested. After harvesting, the seeds should be dried in a 37℃ oven for about a week. 4. Screening of transgenic plants After being treated with disinfectant for 5 minutes and washed 5 times with deionized water, the seeds were evenly spread on MS selection medium (containing 30 μg / mL hygromycin and 100 μg / mL cephalosporin). The medium was then placed in a light incubator (temperature 22℃, 16 hours light, 8 hours dark, light intensity 100-150 μmol / m²). 2 / s, humidity 75%), and after one week, select positive seedlings to be transplanted into the soil. 5. Detection of T1 mutant plants 5.1 Genomic DNA Extraction 1) Cut about 2 mL of Arabidopsis thaliana leaves into a centrifuge tube, add steel balls, and grind the leaves using a high-throughput tissue homogenizer. 2) After grinding is complete, add 400 μL of SDS extraction buffer, mix by inverting, and incubate in a 65°C water bath for 15 minutes, inverting and mixing once every 5 minutes. 3) Centrifuge at 13,000 rpm for 5 minutes. 4) Transfer 300 μL of supernatant to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol pre-cooled to -20 °C, and place the centrifuge tube at -20 °C for 1 hour or overnight. 5) Centrifuge at 13,000 rpm for 10 minutes and remove the supernatant. 6) Add 500 μL of 70% ethanol to the centrifuge tube to wash the precipitate. After centrifugation, discard the washing solution (do not discard the precipitate). Let it air dry at room temperature, then add 30 μL of ultrapure water to dissolve the DNA. Store the DNA at -20℃. 5.2 PCR Amplification Using the extracted T1 plant genome as a template, target fragments were amplified using detection primers. 5 μL of the amplification product was detected by 1% agarose gel electrophoresis and imaged using a gel imaging system. The remaining product was sent to a sequencing company for direct sequencing. 6. Detection of T2 mutant plants After harvesting seeds of the T1 line from a single plant, seeds from two different vector lines were selected and spread on methyl nicotinic acid screening medium (MS medium + 0.24 μg / mL methyl nicotinic acid) for screening. One week later, positive seedlings were transplanted into the soil and molecular detection was performed, using the same method as step 5. Primers and sequences used: C. Test Results 1. Genotyping of T1 plants T1 seeds were screened on MS hygromycin resistance medium. The pQY743 vector yielded 32 positive seedlings, and the pQY745 vector yielded 18 positive seedlings. Genomic DNA was extracted from leaves of 10 seedlings from each vector to detect target sites. It was found that no editing occurred at the ALS574 site in the T1 generation, while editing events at the ALS653 site occurred as expected. The results are shown in Table 1. Table 1 Mutation types of T1 plants 2. Results of T2 generation seed screening After harvesting T2 generation seeds from individual plants, they were screened on nicotinic acid-resistant medium. It was observed that wild-type Col-0 could not grow on the resistant medium, while the mutant positive plants could grow normally on the resistant medium, as shown in Figure 3. For each vector, 10 seedlings were selected, and genomic DNA was extracted from leaves for molecular analysis. Six seedlings using the pQY743 vector showed the expected homozygous mutation, changing from TGG to TTG, as shown in Figure 4. One seedling showed a heterozygous mutation, and three showed chimeric mutations. The results are shown in Table 2. Table 2 Mutation types of T2 plants The above results show that the sequential targeting technique of this invention can achieve the design and realization of the expected mutation at the target site, and can achieve base substitution mutation with only Cas9 protein by designing a combination of sgRNAs in a specific order. Example 2: Multiple mutation types were achieved by cyclically targeting the W574 and S653 sites of the Arabidopsis ALS gene. The vector design, construction, and Arabidopsis transformation screening procedures were performed according to Example 1. For the AtALS W574 site, the vector design was the same as in Example 1 (see Figure 5 for a schematic diagram). The W574L mutation was expected to be achieved by first -G and then +T at a specific position. No editing events were detected in the T1 generation of transgenic Arabidopsis transformed with the vector. The T2 generation of transgenic Arabidopsis was screened using 0.24 mg / L imidacloprid, resulting in a large number of herbicide-resistant plants, as shown on the left side of Figure 6. Molecular analysis of these resistant plants and sequencing of the PCR products showed that the W574 site not only exhibited the expected W574L mutation but also another resistance mutation, W574M, as shown on the right side of Figure 6. For the AtALS S653 site, the vector was designed in the same way as in Example 1, and a schematic diagram of the vector is shown in Figure 7. By first -G and then +A at a specific position, the S653N mutation was expected to be achieved. The vector was transformed into Arabidopsis thaliana, and the expected S653N editing event was detected in the T1 generation. The T2 generation of transgenic Arabidopsis thaliana was further screened with 0.24 mg / L imidacloprid, and a large number of herbicide-resistant plants were obtained, as shown on the left side of Figure 8. Molecular detection was performed on these resistant plants, and the sequencing results of the PCR products showed that not only did the expected S653N mutation appear at the S653 site, but also two other resistance mutations, S653R and S653R / G654D, appeared, as shown on the right side of Figure 8. The above results indicate that by using the sequential targeting technique of this invention, and by designing a combination of sgRNAs in a specific order, only the Cas9 protein is needed to achieve the expected mutations at the target site, and a variety of functional mutation types can be generated, making it suitable as a tool for creating new functional mutations. Example 3: Circular targeting with different PAMs near the W574 locus of the Arabidopsis ALS gene induced the W574M resistance mutation. The vector design, construction, and Arabidopsis transformation and screening procedures were performed according to Example 1. The difference from Example 1 is that, for the AtALS W574 site sequence 5'CTTGGCATGGTTATGCAATGgg3', the GG, which is closer to the W574 site, was used as the PAM to design sgRNA1: 5'CTTGGCATGGTTATGCAATG3'. The underlined part represents the W574 site, and the italic part represents the NG PAM. It was predicted that the cleavage repair would result in a new sequence 5'CTTGGCATGGTTATGCAAATGGGAag3' after +A. Using AG as the new PAM site, sgRNA2: 5'CTTGGCATGGTTATGCAAATGGGA3' was designed. After spontaneous cell repair, the -G genotype was formed, resulting in W574M. That is, different PAM sites were used for the two cleavages in this scheme. The vector schematic diagram is shown in Figure 9. Using this vector to transform Arabidopsis thaliana, genotyping of the T1 generation transgenic lines revealed the expected editing event W574M, and the plants exhibited resistance to nicotinic acid treatment. The results show that by using the technical solution of the present invention and employing different PAMs for cyclic targeting and editing, editing can be performed over a wider sequence range to achieve amino acid substitution. Example 4: Design of predictable base substitutions targeting the D350 and W548 sites of the rice ALS gene The mutation reported by Nishimasu et al. 2018 Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 361(6408):1259-1262. doi:10.1126 / science.aas9129 was introduced into pHUE411 (A CRISPR / Cas9 toolkit for multiplex genome editing in plants. Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014 Nov 29;14(1):327.10.1186 / s12870-014-0327-y For details, see https: / / www.addgene.org / 71287 / ) to construct the vector pHUE411-NG that recognizes NG PAM. The rice ALS gene sequence is shown in SEQ ID NO:12. Using 5'GGCGTGCGGTTTGATGATCG3' (underlined to correspond to the OsALS-D350 site of Arabidopsis ALS-D376) and the predicted new sequence 5'GGCGTGCGGTTTGATGACG3' generated after editing as targets, a dual-target vector was constructed according to the method described in Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014. It is expected to achieve GAT-GAA conversion and generate the OsALS D350E mutation. Using 5'GGTATGGTTGTGCAATGGGA3' (underlined to represent the OsALS-W548 site corresponding to Arabidopsis ALS-W574) and the predicted new sequence 5'GGTATGGTTGTGCAATGGA 3' generated after editing as targets, a dual-target vector was constructed, which is expected to achieve TGG-TTG conversion and generate the OsALS W548L mutation. The two vectors were then transferred into rice to obtain transgenic plants, and the plants that were intended to replace D350E and W548L were identified. Field bioassays of herbicide resistance showed that the D350E and W548L mutants acquired resistance to ALS inhibitor herbicides. Example 5: Design of predictable base substitutions and screening of various mutation types targeting the W2038 site of the rice ACCase2 gene. The rice ACCase2 gene sequence is shown in SEQ ID NO:14. The OsACCase2 W2038 site corresponds to the ACCase W2027 site of *Alopecurus aequalis*. Using AGG as the PAM near this site, sgRNA1: 5'TTCATCCTCGCTAAC-TGGAG3' was designed. It was predicted that the cleavage repair would result in a -G genotype and form a new sequence. sgRNA2: 5'CTTC-ATCCTCGCTAACTGAG3' was designed using AGG as the PAM. After another cleavage repair, a +T genotype was formed, resulting in the W2038L mutation. sgRNA1 and sgRNA2 were constructed into the pHUE411 vector to form an editing vector. A schematic diagram of the vector is shown in Figure 10. The edited vector was used to transform callus tissue of the rice variety Huai Dao 5. After screening with 50 μg / L hygromycin and 50 μg / L quizalofop-P-ethyl for 3 weeks, a large number of resistant callus tissues appeared, as shown on the left side of Figure 11. Genotyping of the resistant callus tissues revealed that not only the expected W2038L mutation appeared, but also the W2038C mutation appeared, as shown on the right side of Figure 11. The above results of gene cycling targeting in rice demonstrate that the technical solution of this invention is applicable to both monocot and dicotyledonous plants. Example 6 Expression and purification of SpCas9 and NGA-Cas9 proteins 1. Experimental instruments and reagents Table 3 Test Instruments Table 4 Test Instruments 2. Test Methods 2.1 Construction of pET15b-Cas9 expression vector The DNA sequences of SpCas9 and NGA-Cas9 proteins after plant codon optimization are shown in SEQ ID NO: 15 and SEQ ID NO: 16, respectively. These sequences were used as template DNA by GenScript synthesis. After amplifying the NG-Cas9 and NGA-Cas9 sequences respectively, the two fragments were ligated into the pET15b expression vector using the infusion method, transformed into DH5α, and sequenced after verification. Table 5 PCR validation amplification system and primers 2.2 Protein Expression and Purification The constructed expression vector was transformed into E. coli Rosetta(DE3), induced with IPTG, and purified using a Ni-NTA column after bacterial lysis. The specific method is as follows: a) Transform the recombinant expression vector into Rosetta (DE3) strain, pick single clones into 10 ml LB medium, and culture overnight at 37°C and 200 rpm with CmR+Amp (pET15b) or CmR+Kana (pET28a) resistance. Transfer to a 2 L shake flask containing 1 L LB medium and culture at 37°C and 200 rpm until the OD600 reaches 0.6-0.8. Cool to 18°C and induce expression overnight with 0.5 mM IPTG. Centrifuge at 4000 g to collect the bacteria. b) The collected bacterial cells were resuspended in Ni-buffer A: 50mM HEPES pH7.4, 500mM NaCl, 20mM imidazole, and 5mM β-mercaptoethanol. Then, 1mM PMSF and 250ul Cocktail inhibitor were added to the final concentration and mixed well. c) After resuspending the bacterial cells, they were disrupted by an ultrasonic disruptor, centrifuged at 40,000g and 4℃ for 30 minutes, and the supernatant was passed through a Ni-NTA column. d) Ni-NTA column purification: After binding the lysis supernatant with resin for 20 minutes, wash with buffer A containing 50 mM imidazole, and finally elute with elution buffer containing 400 mM imidazole. e) SDS-PAGE gel electrophoresis was used to detect the protein purification effect. f) Dialysis: Change the buffer to 50 mM HEPES pH 7.5, 150 mM KCl, 1 mM DTT, and 3% glycerol. h) The final sample was analyzed by SDS-PAGE gel electrophoresis to detect the protein purification effect. After ultrafiltration concentration, it was frozen at -80℃ for later use. 2.3 Results of Cas9 fusion protein expression and purification The purification results of SpCas9 and NGA-Cas9 proteins are shown in Figure 12. The arrows indicate the Cas9 protein band, which has achieved high purity. Example 7: Detection of in vitro enzymatic activity of SpCas9 and NGA Cas9 proteins at the OsACCase2 W2038 and OsALS W548 target sites, respectively. 1. The DNA sequences of the OsALS and OsACCase2 genes were input into the CRISPOR online tool (http: / / crispor.tefor.net / ). sgRNAs were designed targeting amino acid W548 (the 548th amino acid of OsALS, the amino acid sequence of rice ALS protein is shown in SEQ ID NO:11) at amino acid position 574 of the Arabidopsis thaliana ALS protein and amino acid W2038 (the 2038th amino acid of OsACCase2, the amino acid sequence of rice ACCase2 protein is shown in SEQ ID NO:13) at amino acid position 2027 of the Alopecurus aequalis indica protein. These sgRNAs were then synthesized by GenScript. >sgRNA1-548-G: 5'GGGUAUGGUUGUGCAAUGGGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc3' >sgRNA1-2038-G: 5'GUUCAUCCUCGCUAACUGGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc3' 2. The fragment containing the OsALS W548 target site was amplified using specific detection primers OsALS265AA-F: 5'ggtcttgcgtctggttggc3' and OsALS-end-R: 5'ccatgccaagcacatcaaacaag 3'. The PCR product length was 1200bp. Using specific detection primers OsACC1750AA-F: 5'gcgaagaagactatgctcgtattgg3' and OsACC2196AA-R: 5'cttaatcacacctttcgcagcc3', a fragment containing the OsACCase W2038 target site was amplified, and the PCR product length was 1500bp. The PCR system is shown in the table below: 3. Establish the PCR reaction under the following conditions: 4. The PCR products were detected by agarose gel electrophoresis and sent for further sequencing verification. After verification, the DNA fragments were recovered by gel cutting, dissolved in 30 μL of RNase-free ultrapure water, and the concentration was tested. 5. Use the following detection system to detect Cas9 protein activity. After adding the system, incubate at 37°C for 1 hour. 6. After the reaction is complete, treat at 65℃ for 10 minutes, add 4ul of 6×DNA loading buffer, and use a 2% agarose gel to detect the band size. The results are shown in Figure 13. It can be seen that the purified Cas9 protein can cleave the DNA double strand at the designed target site only when sgRNA is added. Example 8: Transformation of rice protoplasts with two different targeted RNP complexes to achieve the W548L mutation at the OsALS548 site. 1. The preparation of rice protoplasts and PEG-mediated transformation were modified based on the previously published method (Bart et al., 2006). The specific preparation steps are as follows: (1) First, prepare rice seedlings for protoplast preparation. The variety is Nipponbare. The rice seeds are first dehulled, then rinsed with 75% ethanol for 1 minute, treated with 5% (v / v) sodium hypochlorite for 20 minutes, washed with sterile water at least 5 times, dried in a laminar flow hood, and placed in tissue culture flasks containing 1 / 2 MS medium, with 20 seeds per flask. Culture at 26℃ for approximately 12 hours under light for about 10 days, then remove the seedlings to prepare protoplasts. (2) Select the leaf sheath of the seedling and cut it into pieces of about 1 mm with a sharp Gillette razor blade. Place it in 0.6M mannitol and MES culture medium (formulation: 0.6M mannitol, 0.4M MES, pH 5.7) for later use. After cutting all the materials, transfer them to 20mL of enzymatic hydrolysis solution (formulation: 1.5% cellulase R10 / RS (YaKult Honsha), 0.5% Mecerozyme R10 (YaKult Honsha), 0.5M mannitol, 20mM KCl, 20mM MES, pH 5.7, 10mM CaCl2, 0.1% BSA, 5mM β-mercaptoethanol), wrap it with aluminum foil and place it in a shaker at 28℃. Enzymatically hydrolyze at 50rpm in the dark for about 4 hours. Increase the speed to 100rpm in the last 2 minutes. (3) After enzymatic hydrolysis, add an equal volume of W5 solution (formula: 154mM NaCl, 125mM CaCl2, 5mM KCl, 15mM MES), shake horizontally for 10 seconds to release protoplasts. After enzymatic hydrolysis, filter the cells through a 300-mesh sieve and collect the protoplasts by centrifugation at 150g for 5 minutes. (4) Rinse the cells twice with W5 solution, and collect the protoplasts by centrifuging at 150g for 5 minutes; (5) Resuspend the protoplasts in an appropriate amount of MMG solution (formulation: 3.05 g / L MgCl2, 1 g / L MES, 91.2 g / L mannitol), the protoplast concentration is approximately 2 × 10⁻⁶. 6 Cells / mL. 2. Preparation of RNP complex: Based on the OsALS548 target site sequence GGGTATGGTTGTGCAATGGGAgga (underlined portion represents the OsALS W548 site corresponding to Arabidopsis ALS W574, and italicized lowercase portions represent the PAM sites recognized by the Cas9 protein), the RNP complex was prepared using purified NGA-Cas9 protein. Using GGA as the PAM, the sequence >CrRNA1-548-G:5'-GGGUAUGGUUGUGCAAUGGGAguuuuagagcuaugcu-3' was designed. It was predicted that after editing, a G base would be deleted between the first 3-4 positions of the PAM. Then, using the deleted sequence, a second sequence >CrRNA2-548+T:5'-UGGGUAUGGUUGUGCAAUGGAguuuuagagcuaugcu-3' was designed. It was predicted that after the second editing, a T base would be inserted, thus achieving the TGG-TTG conversion. >CrRNA1-548-G and >CrRNA1-548+T were synthesized by Genscript Biotech, along with sgRNA. >sgRNA1-548-G: 5'GGGUAUGGUUGUGCAAUGGGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc3' >sgRNA2-548+T: 5'UGGGUAUGGUUGUGCAAUGGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc3'. The synthesized crRNA was mixed in equimolar amounts with GenCRISPR tracrRNA (GenScript SC1933), and then annealed with crRNA & tracrRNA annealing buffer (GenScript SC1957-B) according to the instructions to prepare gRNA. The tracrRNA sequence is 5'-agcauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuu-3'. Prepare the RNP reaction system according to the table below. After addition, incubate at 25°C for 10 minutes. 3. Protoplast transformation (1) Take 200 μl of the protoplast resuspended in MMG and add it to the RNP complex (Cas9 protein 20 μg, sgRNA 20 μg) after incubation and gently mix. (2) Add an equal volume of 40% (w / v) PEG solution (formulation: 40% (w / v) PEG, 0.5M mannitol, 100mM CaCl2), mix gently, and let stand at 28°C in the dark for 15 minutes. (3) After the induction and transformation is complete, slowly add 1.5 mL of W5 solution, gently tap to mix the cells, centrifuge at 150 g for 3 minutes to collect the cells, and repeat this step once. (4) Add 1.5 mL of W5 solution to resuspend the cells and incubate them in a 28°C incubator in the dark for 12-16 hours. If the cells are to be used to extract protoplast genomic DNA, they need to be incubated for 48-60 hours. 4. Detection of genome target editing events (1) Extract protoplast DNA using the CTAB method with some modifications. The specific method is as follows: After centrifuging the protoplasts, discard the supernatant, add 500 μL of DNA extraction buffer, vortex to mix, and incubate in a 65℃ water bath for 1 hour; after cooling the sample after the water bath, add an equal volume of chloroform, invert to mix, and centrifuge at 10,000 rpm for 10 minutes; take 400 μL of supernatant and transfer it to a new 1.5 mL centrifuge tube, add 1 mL of 70% (v / v) ethanol, and precipitate at -20℃ for 20 minutes; centrifuge at 12,000 rpm for 15 minutes to precipitate the DNA, and after the precipitate is dried, add 50 μL of ultrapure water to dissolve it and store at -20℃ for later use. (2) Using gene-specific primers, the fragment containing the W548 target site was amplified. Detection primers were designed targeting the target: OsALS500AA-F: 5'GGCTAACCCAGGTGTCACAG3', OsALS-3'UTR-R: 5'CCATGCCAAG-CACATCAAACAAG3' The PCR reaction system is shown in the table below: (3) Establishing a PCR reaction, the general reaction conditions are: (4) Agarose gel electrophoresis detection, recovery of PCR fragments and sequencing. 5. Test Results: GRNA prepared by annealing synthetic crRNA and tracrRNA, or directly using synthetic sgRNA with purified NGA-Cas9 protein, can form an active RNP complex. Sequencing of the OsALS548 target site can detect the TGG to TTG mutation, demonstrating that the RNP complex, in conjunction with crRNA or sgRNA in sequence, can achieve targeted mutation at the target site within the cell. As shown in Figure 14, in the protoplast OsALS548 target site sequencing peak diagram, the arrow points to the location where, in addition to the original G base signal peak, there is also a mutated T base signal peak, resulting in the W548L mutation at the OsALS548 site. Example 9: Using two different targeted RNP complexes to bombard rice callus to achieve the W2038L mutation at the W2038 site of OsACCase2. 1. Preparation of RNP complex: Based on the OsACCase2 W2038 target site sequence GTTCATCCTCGCTAACTGGAGagg, where the underlined part represents the OsACCase2 W2038 site corresponding to the OsACCase2 W2027 site in *Alopecurus aequalis*, and the italicized lowercase part represents the PAM site recognized by the Cas9 protein, the RNP complex was prepared using purified SpCas9 protein. Using GGA as the PAM, the sequence >CrRNA1-2038-G:5'-GUUCAUCCUCGCUAACUGGAGguuuuagagcuaugcu-3' was designed. It was predicted that after editing, a G base would be deleted between the first 3-4 positions of the PAM. Then, using the deleted sequence, a second sequence >CrRNA2-2038+T:5'-UGUUCAUCCUCGCUAACUGAGguuuuagagcuaugcu-3' was designed. It was predicted that after the second editing, a T base would be inserted, thus achieving the TGG-TTG conversion. >CrRNA1-2038-G and >CrRNA2-2038+T were synthesized by Genscript Biotech, along with sgRNA. >sgRNA1-2038-G: 5'GUUCAUCCUCGCUAACUGGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc 3' >sgRNA2-2038+T: 5'UGUUCAUCCUCGCUAACUGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc 3'. The synthesized crRNA was mixed with an equimolar amount of GenCRISPR tracrRNA (GenScript SC1933), and crRNA & tracrRNA annealing buffer (GenScript SC1957-B) was added. The mixture was then annealed according to the instructions to prepare gRNA. The RNP complex was prepared by incubation in the same reaction system as in Example 8. Taking the amount of material used for 10 bombardments by gene gun transformation as an example: 20 μg of Cas9 protein, 20 μg of gRNA or sgRNA, 10 μl of 10×Cas9 reaction buffer, and RNase-free ultrapure water to make up to 100 μl. Incubate at 25°C for 10 minutes and mix gently. 2. Rice callus induction Select mature and plump rice seeds, remove the husks, and disinfect them according to the following steps: (1) Peel the rice seeds. The rice variety is Huai Dao No. 5, which was purchased from the seed market. (2) Wash the seeds with sterile water until the water becomes clear, as many times as you like. (3) Disinfect with 70% alcohol for 1 minute, then place 10% sodium hypochlorite in a horizontal shaker and shake for 25 minutes. (4) After disinfection with sodium hypochlorite, rinse five times with sterile water. Inoculate into callus induction medium (formulation: MS powder (4.42 g / L) + 2,4-D (2 mg / L) + sucrose (30 g / L) + plant gel (4 g / L)) and incubate in the dark at 28°C to induce callus. 3. Gene Gun RNP Bombardment: (1) Hyperosmolar culture Transfer well-formed callus tissue to hypertonic medium (formulation: MS powder (4.42 g / L) + 2,4-D (2 mg / L) + sucrose (30 g / L) + D-mannitol (0.4 M) + plant gel (4 g / L)), and incubate under sterile conditions in a laminar flow hood at 25°C for 4-6 hours in the dark. (2) Preparation of gold powder suspension: Weigh 30 mg of gold powder (0.6 μm in diameter) into a 1.5 mL imported EP tube; add 1 mL of 70% ethanol, vortex thoroughly, and let stand on ice for 10 minutes. Centrifuge for 1 minute and discard the supernatant; add 1 mL of sterile water, vortex thoroughly, centrifuge for 1 minute, discard the supernatant, and repeat the operation 3 times. Add 500 μL of sterile glycerol (50%), vortex thoroughly, and prepare a gold powder suspension with a concentration of 60 μg / μl. Store at -20℃. (3) Take 50 μl of gold powder suspension (60 μg / ml), add 100 μL of the prepared RNP complex, and mix gently. (4) Take 15 μl of RNP gold powder mixture into the center of the ruptureable membrane of PDS-1000 desktop gene gun (Bio-Rad), blow it dry, and bombard it according to the instrument operation instructions. Bombardment parameters: vacuum level of 26-28, distance of 6 cm, and air pressure of 1100 psi or 1350 psi. (5) After bombardment, the callus was cultured overnight in the dark at 25°C for 16 hours on a hypertonic medium. 4. Selection, differentiation, and rooting: (1) After overnight culture of the callus following bombardment, it was transferred to induction medium and cultured at 28°C for one week. (2) After one week of recovery, the callus was transferred to a selection medium (formulation: 4.1 g / L N6 powder + 0.3 g / L hydrolyzed casein + 2.8 g / L proline + 2 mg / L 2,4-D + 3% sucrose + 50 ug / L quizalofop-P-ethyl + 500 mg / L Cef (cephalosporin) + 0.1 g / L inositol + 0.35% plant gel, pH 5.8) and screened for 3-4 weeks. For the expected editing of OsACCase2 W2038, quizalofop-P-ethyl 50 ug / L was used for screening, as shown in Figure 15. (3) The resistant callus with good growth status selected was transferred into differentiation medium (formulation: MS powder (4.42 g / L) + KT (1 mg / L) + sucrose (30 g / L) + plant gel (4.5 g / L) + 50 ug / L quizalofop-p-ethyl, pH 5.8) and cultured at 28℃ under light to induce differentiation for 2-4 weeks. (4) The differentiated seedlings were transferred to rooting medium (formulation: 1 / 2MS powder (2.3g / L) + sucrose (30g / L) + plant gel (4.5g / L)) for rooting culture. After the seedlings were rooted, they were hardened off and then transferred to flower pots filled with soil and placed in a greenhouse for cultivation. 5. Detection of target editing events in resistant callus and T0 tissue culture seedlings: Eleven resistant calluses were obtained during the screening phase. DNA was extracted using the CTAB method, and detection primers were designed targeting the target site: OsACC2038test-F: 5'CTGTAGGCATTTGAAACTGCAGTG3', and OsACC2038test-R: 5'GCAATCCTGGAGTTCCT-CTGACC3'. PCR fragments containing the OsACCase2 W2038 site were amplified and sequenced. Sequencing detected a TGG to TTG mutation at the OsACCase2 W2038 site in 10 of these calluses, with 3 samples showing homozygous mutations. DNA was extracted from T0 generation tissue culture seedlings obtained from resistant callus differentiation to detect the editing target sequence. A homozygous mutation from TGG to TTG was also found at the OsACCase2W2038 site, as shown in Figure 16. 6. Resistance test of T1 generation seedlings to ACCase inhibitor herbicides After the T0 line with the W2038L mutation was propagated, the T1 generation mutant seedlings were tested for herbicide resistance using field concentrations of quizalofop-P-ethyl and haloxyfop-R-methyl. It was found that the OsACCase2 W2038L mutant line showed significant resistance to both of these ACCase inhibitor herbicides, as shown in Figures 17-18. In summary, gRNA prepared by annealing synthetic crRNA and tracrRNA, or directly using synthetic sgRNA with purified SpCas9 protein, can form an active RNP complex. This complex enables the screening of callus bombarded by gene guns using quizalofop-P-ethyl during the tissue culture stage. Sequencing of the OsACCase2 W2038 target site in T0 generation tissue culture seedlings revealed a homozygous mutation from TGG to TTG. This mutation can be inherited by the T1 generation and exhibits resistance to ACCase inhibitor herbicides. This further demonstrates that the RNP complex, in conjunction with sequential crRNA or sgRNA targeting, can achieve targeted mutations at the target site within cells and guide the generation of endogenous selection markers for tissue culture screening, thus creating herbicide-resistant crops. Example 10: Editing the OsACCase2 W2038 site on rice callus using different targeted RNP complexes, while simultaneously editing the OsBADH2 gene. The RNP complex preparation method is the same as in Example 8, and the gene gun bombardment and tissue culture steps are the same as in Example 9. In addition to the crRNA or sgRNA targeting the OsACCase2 W2038 site, crRNA or sgRNA targeting the OsBADH2 gene is also added. It is incubated with SpCas9 protein to form a targeted RNP complex targeting the second target gene OsBADH2. Gene gun bombardment is then performed, followed by recovery culture, screening, differentiation, and rooting to obtain T0 generation tissue culture seedlings, which are then propagated to T1 generation. The rice OsBADH2 genome sequence is shown in SEQ ID NO:17. Target site sequences CCAAGTACCTCCGCGCAATCGcgg were selected using the CRISPOR online tool (http: / / crispor.tefor.net / ), with italics indicating the PAM sites recognized by the Cas9 protein. Purified SpCas9 protein was used to prepare the RNP complex. Using CGG as the PAM, the design >CrRNA1-OsBADH2:5'-CCAAGUACCUCCGCGCAAUCGguuuuagagcuaugcu-3' was used to predict the simultaneous detection of the OsACCase2 W2038L resistance mutation and the OsBADH2 knockout mutation in resistant callus obtained through quizalofop-P-ethyl selection. >CrRNA1-OsBADH2 was synthesized by Genscript Biotech, along with sgRNA. >OsBADH2-sgRNA:5'CCAAGUACCUCCGCGCAAUCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc3'. Resistant callus was screened according to the transformation steps in Example 9, as shown in Figure 19. Resistant callus was selected to differentiate into seedlings. Sequences of the OsACCase2 and OsBADH2 target sites were performed on the callus and T0 generation tissue culture seedlings. The primers for OsBADH2 target detection were: OsBADH2-check F: 5'CATCGGTACCTCCTCTTC3' OsBADH2-check R: 5'ATCGATCGATTTGGGGCTCA3' A total of 13 resistant calluses were obtained through screening, of which 11 showed the OsACCase2 W2038L mutation. OsBADH2 target sequences were detected in these 11 callus samples, and 8 of them simultaneously contained editing events at the OsBADH2 target site. In the differentiated T0 generation tissue culture seedlings, homozygous mutations of OsACCase2 W2038L and OsBADH2+A were detected, as shown in Figures 20-21. In summary, using sequentially targeted crRNA or sgRNA to target the RNP complex for targeted editing of OsACCase2 W2038, and simultaneously adding a targeted RNP complex targeting the second target gene OsBADH2, followed by gene gun bombardment of rice callus, allowed for selection of callus using quizalofop-P-ethyl during the tissue culture stage. 61% of the resistant callus simultaneously exhibited both OsACCase2 W2038 mutation and targeted knockout of OsBADH2. Homozygous mutations in OsBADH2 were detected in T0 generation tissue culture seedlings. This demonstrates that sequential targeting combined with RNP transformation for site-specific editing of resistance genes can generate endogenous selection markers. Adding corresponding selection pressure can simultaneously screen for editing events of the second target gene, achieving site-specific genome editing without transgenic methods. Example 11: Editing the OsALS548 site of rice callus and simultaneously editing the OsSWEET14 gene using RNP complexes with different targets. The preparation method of the targeted RNP complex for the OsALS548 site is the same as in Example 8, and the crRNA and sgRNA sequences are the same as in Example 8, as follows: >CrRNA1-548-G:5'-GGGUAUGGUUGUGCAAUGGGAguuuuagagcuaugcu-3', >CrRNA2-548+T:5'-UGGGUAUGGUUGUGCAAUGGAguuuuagagcuaugcu-3', >sgRNA1-548-G: 5'GGGUAUGGUUGUGCAAUGGGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuau caacuugaaaaaguggcaccgagucggugc3', >sgRNA2-548+T: 5'UGGGUAUGGUUGUGCAAUGGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc3'. Referring to Example 8, gRNA or sgRNA was incubated with NGA-Cas9 to prepare an RNP complex targeting the OsALS548 site. In addition to the RNP complex targeting the OsALS548 site, crRNA or sgRNA targeting the OsSWEET14 gene was also added. Incubation with SpCas9 protein formed a targeting RNP complex targeting the second target gene, OsSWEET14. Gene gun bombardment was then performed, followed by recovery culture, selection, differentiation, and rooting to obtain T0 generation tissue culture seedlings, which were then propagated to the T1 generation. The selection pressure was 5 mg / L of acesulfame potassium. The rice OsSWEET14 genome sequence is shown in SEQ ID NO:18. The target site sequence GAGCTTAGCACCTGGTTGGAGggg was selected using the CRISPOR online tool (http: / / crispor.tefor.net / ). The italicized lowercase letters represent the PAM sites recognized by the SpCas9 protein. The purified SpCas9 protein was used to prepare the RNP complex. GGG was used as the PAM design element. >CrRNA1-OsSWEET14: 5'-GAGCUUAGCACCUGGUUGGAGguuuuagagcuaugcu-3' predicts that the OsALS W548L resistance mutation and the OsSWEET14 knockout mutation can be detected simultaneously in resistant callus obtained by screening with pyrazosulfanilamide. >CrRNA1-Os SWEET14 was synthesized by Genscript Biotech, along with sgRNA. >Os SWEET14-sgRNA: 5'GAGCUUAGCACCUGGUUGGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc3'. Following the gene gun bombardment and tissue culture steps described in Example 9, resistant callus was screened, as shown in Figure 22. Resistant callus was selected to differentiate into seedlings. The screening medium formula was: 4.1 g / L N6 powder + 0.3 g / L hydrolyzed casein + 2.8 g / L proline + 2 mg / L 2,4-D + 3% sucrose + 5 mg / L pyrazosulfan + 500 mg / L Cef (cephalosporin) + 0.1 g / L inositol + 0.35% plant gel, pH 5.8. Sequencing was performed on the OsALS548 site and the OsSWEET14 target site in callus and T0 generation tissue culture seedlings. The primers for detecting the OsSWEET14 target site were: OsSWEET14-check F: 5'ATGGGTGCTGATGATTATCTTGTAT3' OsSWEET14-check R: 5'TGAAGAGACATGCCAGCCATTG3' Nine resistant calluses were obtained through screening, eight of which tested positive for the OsALS W548L mutation. The OsSWEET14 target sequence was detected in these eight callus samples, and five of them simultaneously contained an editing event at the OsSWEET14 target site. In the differentiated T0 generation tissue culture seedlings, homozygous mutations of both OsALS W548L and OsSWEET14-C were detected, as shown in Figures 23-24. After the T0 line with the OsALS W548L mutation was propagated, the T1 generation mutant seedlings were tested for herbicide resistance using field concentrations of acesulfame potassium, methyl imidacloprid, nicosulfuron, and fluazolidone. It was found that the OsALS W548L mutant line showed significant resistance to all four ALS inhibitor herbicides, as shown in Figures 25-28. In summary, gRNA prepared by annealing synthetic crRNA and tracrRNA, or directly using synthetic sgRNA with purified NGA Cas9 protein, can form an active RNP complex. Combined with sequentially targeted crRNA or sgRNA, this complex enables targeted mutation at the target site within cells. It allows for the use of sulfadiazine to screen callus bombarded by gene guns during the tissue culture stage. Sequencing of the OsALS548 target site in T0 generation tissue culture seedlings revealed a TGG to TTG mutation, which can be inherited by the T1 generation and exhibits resistance to ALS inhibitor herbicides. Simultaneously, a targeting RNP complex targeting the second target gene OsSWEET14 was added. Using the SpCas9 protein that recognizes NGG PAM, rice callus was bombarded with a gene gun. During the tissue culture stage, the callus was screened using sulfadiazine. 55% of the resistant callus simultaneously showed the OsALS W548L mutation and the targeted knockout of OsSWEET14. Homozygous mutations in OsSWEET14 could be detected in T0 generation tissue culture seedlings. This further demonstrates that sequential targeting combined with RNP transformation for site-specific editing of resistance genes can generate endogenous selection markers. Furthermore, Cas9 proteins that recognize different PAM sites can be used simultaneously to introduce corresponding selection pressures and screen for editing events of the second target gene, achieving site-specific genome editing without transgenic methods. Example 12: Achieving the W561L mutation at the StALS561 site by bombarding potato explants with two different targeted RNP complexes. The amino acid sequence of the potato StALS2 protein is shown in SEQ ID NO:19, and the potato StALS2 gene sequence is shown in SEQ ID NO:20. The RNP complex preparation and gene gun bombardment methods are as described in Examples 8-9. The following sgRNAs targeting the StALS2W561 site (corresponding to the Arabidopsis ALS574 site) of potato StALS2 were designed for both the original and edited sequences: >StALS561-G: 5'GGGAAUGGUGGUUCAGUGGGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc3' >StALS561+T: 5'UGGGAAUGGUGGUUCAGUGGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc3', The RNP complex was prepared according to the method described in Example 8. The recipient potato varieties were Atlantic or Freiwuta, and leaves, stem segments, and axillary buds were used as explants, respectively. The gene gun bombardment and selection differentiation methods are as follows: (1) Leaves: Cut off whole leaves and lay them flat on hypertonic M6 medium (formulation: 4.42 g / L MS powder + 1 ml / L B5 vitamins (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L 2,4-D + 0.8 mg / L zeatin nucleoside + 0.2 M mannitol + 250 mg / L Cef), about 5-6 leaves per shot. After pre-culturing for 24 hours, bombard with gold powder. After bombardment, the samples were incubated in the dark on hypertonic M6 medium for 2 days. Then, they were transferred to M6 medium (4.42 g / L MS powder + 1 ml / L B5 vitamins (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L 2,4-D + 0.8 mg / L zeatin + 250 mg / L Cef) and incubated for another week. After one week, they were transferred to M6 medium with selection pressure at 20 μg / L chlorsulfuron (formulation: 4.42 g / L MS powder + 1 ml / L B5 vitamins (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L 2,4-D + 0.8 mg / L zeatin + 250 mg / L Cef). Resistant callus was screened using Cef + 20 μg / L chlorsulfuron. After 4 weeks, the callus was transferred to bud-inducing medium R4 (formulation: 4.42 g / L MS powder + 1 ml / L B5 vitamins (Phytotechlab, G219) + 30 g / L sucrose + 8 g / L agar + 2 mg / L GA3 + 0.8 mg / L zeatin nucleoside + 250 mg / L Cef + 20 μg / L chlorsulfuron) under screening pressure until emergence. (2) Stem segments: Take potato stem segments (excluding axillary buds), cut the stem segments longitudinally with the cut side facing up, and place them on CIMI medium (4.42 g / L MS powder + 20 g / L sucrose + 8 g / L agar + 0.5 mg / L zeatin nucleoside + 2 mg / L 2,4-D + 250 mg / L Cef + 20 μg / L chlorsulfuron). Then, perform gene gun bombardment and culture in the dark for 1 day. Transfer the stem segments to fresh CIMI medium and continue to culture for 1 week. Then, transfer the stem segments to SIMI medium with selection pressure (formula: 4.42 g / L MS powder + 20 g / L sucrose + 8 g / L agar + 1 mg / L zeatin nucleoside + 0.1 mg / L GA3 + 250 mg / L Cef + 20 μg / L chlorsulfuron) for screening of resistant buds until seedlings emerge. (3) Axillary buds: Take axillary buds from potato stem segments, cut them longitudinally, and transfer them to CIMI medium with the cut side facing up. Place them on CIMI medium and then bombard them with a gene gun. After bombardment, culture them in the dark for 1 day. Transfer the stem segments to fresh CIMI medium and continue to culture for 1 week. Then transfer the stem segments to SIMI medium containing selection pressure for screening of resistant buds until seedlings emerge. The primers for detecting the StALS2 W561 site are: StALS561-Check F:5'GTGGATTAGGAGCAATGGGATTT3' StALS561-Check R: 5'TTATTTTAGATAATACAATGCCTCG3' The test results showed that the StALS2 W561L editing event occurred at the W561 site in the T0 generation potato tissue culture seedlings selected for resistance, indicating that the non-transgenic transient gene editing method provided by this invention is applicable to crops such as potatoes, which are difficult to remove exogenous transgenic elements through self-pollination or hybridization. Example 13: The cyclic targeting protocol successfully performed base substitution in human 293T cells. The HBB (hemoglobin subunit beta) gene (its DNA sequence is shown in SEQ ID NO:21, its CDS sequence in SEQ ID NO:22, and its amino acid sequence in SEQ ID NO:23) from human embryonic kidney cells 293T were selected. Target sites for sequential sgRNA targeting were designed in the first exon region. The first target site is catggtgcaCctgactcctgAGG, and the sgRNA recognizing this target site is named sgHBB. It is predicted that the sgRNA cleavage at this site may produce a sequence with one less C base. The second target site is ccatggtgcatctgactctgAGG, and the sgRNA recognizing the sequence with one less C base produced after targeting the first target is named sgHBB-c. An sgRNA without a target site in 293T cells was also designed and named sgNOTAR, which was used as a completion plasmid for transfection in the experiment. Based on the above design, complementary single-stranded DNA fragments were synthesized. After annealing, they were ligated into the px458 (addgene: 48138) plasmid digested with BBSI. The resulting fragments were then transformed into E. coli DH5α competent cells. After the obtained E. coli single clones were verified to be correct by sequencing, the plasmids were extracted and purified using an endotoxin-free plasmid extraction kit (Tiangen Biotech). Vigorously growing 293T cells were isolated by digestion with 0.05% trypsin (Gibico). The cells were diluted in DMEM medium (10% fetal bovine serum; penicillin + streptomycin) and seeded into 24-well plates. The plates were incubated overnight in a CO2 incubator. The following day, cells were transformed using the following methods: continuous targeting: 0.5 μg each of sgHBB and sgHBB-c plasmids; single-target targeting: 0.5 μg each of sgHBB and sgNOTAR plasmids; target-free control: 1 μg of pEGFP-c1 plasmid. Each group was divided into triplicate. Forty-eight hours after transformation, the transformation efficiency was recorded by photographing with a fluorescence microscope. Total DNA was then extracted from the cells in each well using a nucleic acid extraction kit (Omega). The Hi-tom sequencing primers were designed as follows: Hi-HBB-F: ggagtgagtacggtgtgcGCTTACATTTGCTTCTGACACAACT; Hi-HBB-R:gagttggatgctggatggTCTATTGGTCTCCTTAAACCTGTCTTG. The primers were used to perform PCR on each DNA sample. The PCR products were sequenced using the Hi-tom method (Sci China Life Sci. 2019 Jan; 62(1): 1-7. doi: 10.1007 / s11427-018-9402-9). The statistical data of the sequencing results are shown in Tables 6 and 7. These data indicate that the continuous targeting method at the HBB site produced approximately 1.67% of C-to-T editing results (resulting in P6S mutations), while single-target targeting could not produce such base substitution mutations. Table 6 shows the editing types produced by different sgRNA combinations in the continuous HBB gene targeting experiment in 293T cells, and the readings of different genotypes detected by Hi-Tom sequencing. Table 7 shows the combined statistics of the proportions of different sgRNA combinations resulting from continuous HBB gene targeting experiments in 293T cells. Note: WT represents wild type; Deletion represents the deleted genotype; Insertion represents the inserted genotype; C->T SNP represents the genotype that produces a C to T base substitution at the cut; total represents the total number of genotypes. Furthermore, sickle cell anemia and β-thalassemia are both hereditary anemias caused by mutations in the HBB gene, which encodes the β subunit of human hemoglobin. Patients with these diseases may require lifelong blood transfusions or other treatments. The results of the above experiments demonstrate that the cyclic targeting technique provided by this invention can design crRNA or sgRNA combinations at the mutation site of the HBB gene to induce the desired repair at the mutation site, enabling cells to produce active hemoglobin, restore function, and achieve a therapeutic effect. In other words, the composition provided by this invention has therapeutic uses. Furthermore, after various tests, since this new method is entirely based on the existing functions of Cas9, the method of this invention will be fully applicable in other organisms (plants, animals, fungi, or bacteria, etc.) where Cas9 works well, enabling new functions such as base substitution, deletion, and insertion of specific fragments. All publications and patent applications mentioned in the specification are incorporated herein by reference as if each publication or patent application were individually and specifically incorporated herein by reference. Although the invention has been described in considerable detail by way of example and embodiments for clarity, it will be apparent that certain changes and modifications may be made within the scope of the appended claims, and all such changes and modifications are within the scope of the invention.
Claims
1. A method for generating novel mutations in an organism, comprising the following steps: At specific locations in an organism's genome, two or more DNA breaks occur sequentially and are spontaneously repaired. The later DNA break is based on the new sequence generated after the repair of the earlier DNA break.
2. The method according to claim 1, characterized in that, The "DNA break" is achieved by delivering a nuclease with targeting properties into the cells of an organism to contact a specific location on the genomic DNA.
3. The method according to claim 2, characterized in that, The "nuclease with targeting properties" mentioned is a ZFN, TALEN, or CRISPR / Cas system.
4. The method according to any one of claims 1-3, characterized in that, The phrase "generating two or more DNA breaks sequentially at a specific location" refers to designing new ZFN or TALEN proteins to cut the site again, targeting the new sequence formed by the prior DNA break repair event generated by ZFN or TALEN editing.
5. The method according to any one of claims 1-3, characterized in that, The phrase "generating two or more DNA breaks sequentially at a specific location" refers to designing new target RNAs for new sequences formed by prior DNA break repair events generated by the CRISPR / Cas system, and then cutting that site again.
6. The method according to any one of claims 1-4, characterized in that, The "two or more DNA breaks" are generated by delivering different targeted nucleases sequentially to recipient cells of different generations, so that the mutated cells that were edited first can act as recipients to receive the delivery of the targeted nucleases that were edited later, and perform secondary editing to produce site-directed mutations.
7. The method according to any one of claims 1-3 and 5, characterized in that, The "two or more DNA breaks" are caused by delivering different targeted nucleases to the same recipient cell.
8. The method according to any one of claims 1-3, 5, and 7, characterized in that, The "two or more DNA breaks" are generated by the same CRISPR / Cas nuclease forming an RNP complex with different gRNAs or sgRNAs, which cut the corresponding target sequences in sequence.
9. The method according to any one of claims 1-3, 5, and 7, characterized in that, The "two or more DNA breaks" are generated by two or more CRISPR / Cas nucleases that recognize different PAM sequences, which, together with the corresponding gRNA or sgRNA, form RNP complexes that cut the corresponding target sequences in sequence.
10. The method according to claim 7, characterized in that, The targeted nuclease is any CRISPR / Cas nuclease capable of genome editing.
11. The method according to claim 6 or 7, characterized in that, The targeted nuclease exists in the form of DNA.
12. The method according to any one of claims 7-9, characterized in that, The targeted nuclease exists in the form of mRNA or protein, rather than DNA.
13. The method according to claim 6 or 7, characterized in that, Methods for delivering targeted nucleases into cells include: 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun bombardment; or 6) Agrobacterium-mediated transformation.
14. A novel mutation obtained by the method described in any one of claims 1-13.
15. A protein having the novel mutation of claim 14 or a biologically active fragment thereof.
16. A nucleic acid comprising a nucleic acid sequence or its complementary sequence encoding the protein of claim 15 or a biologically active fragment thereof.
17. A nucleic acid comprising: (a) The nucleotide sequence encoding the target RNA, wherein, The RNA comprises at least two RNAs, the first of which targets the DNA, causing it to break, and the second targeting RNA which cuts the sequence formed by the previous break repair event again.
18. The nucleic acid according to claim 17, characterized in that, It also includes (b) the nucleotide sequence encoding the Cas polypeptide.
19. The nucleic acid according to claim 17 or 18, characterized in that, The target RNA is either sgRNA or gRNA.
20. The nucleic acid according to any one of claims 17-19, characterized in that, The Cas polypeptide and the target RNA are in vitro or in vitro cells.
21. A recombinant expression vector comprising the nucleic acid of any one of claims 16-20, and a promoter operatively linked thereto.
22. An expression cassette comprising the nucleic acid according to any one of claims 16-20.
23. A host cell comprising the expression cassette of claim 22.
24. An organism that uses the host cell regeneration method described in claim 23.
25. A method for lysing target DNA, comprising contacting the target DNA with a complex, the complex comprising: (a) Cas polypeptide; and (b) At least two target RNAs, the first of which targets DNA and causes it to break, and the second of which targets the sequence formed by the previous break repair event and cuts it again.
26. The method according to claim 25, characterized in that, The target RNA is either sgRNA or gRNA.
27. The method according to claim 25 or 26, characterized in that, The target DNA is present in bacterial cells, eukaryotic cells, plant cells, or animal cells.
28. The method according to any one of claims 25-27, characterized in that, The target DNA is chromosomal DNA.
29. The method according to any one of claims 25-28, characterized in that, The Cas polypeptide and the target RNA are in vitro or in vitro cells.
30. The method according to any one of claims 25-29, characterized in that, The contact includes introducing the following into the cell: (a) the Cas polypeptide or a polynucleotide encoding the Cas polypeptide, and (b) the target RNA or a DNA polynucleotide encoding the target RNA.
31. A composition comprising: (a) a Cas polypeptide, or a polynucleotide encoding the Cas polypeptide; and (b) at least two target RNAs, or DNA polynucleotides encoding said target RNAs, wherein, The first RNA targets DNA, causing it to break, and the second RNA targets the sequence formed by the previous break repair event and cuts it again.
32. The composition according to claim 31, characterized in that, The target RNA is either sgRNA or gRNA.
33. The composition according to claim 31 or 32, characterized in that, The Cas polypeptide and the target RNA are in vitro or in vitro cells.
34. Use of the composition according to any one of claims 31-33 in the preparation of a medicament for treating diseases.
35. A reagent kit comprising: (a) a Cas polypeptide, or a nucleic acid containing a nucleotide sequence encoding said Cas polypeptide; and (b) At least two target RNAs, or a nucleic acid containing a nucleotide sequence encoding said target RNA, wherein, The first RNA targets the DNA, causing it to break, and the second RNA targets the sequence formed by the previous break repair event and cuts it again. (a) and (b) are in the same or separate containers.
36. The reagent kit according to claim 35, characterized in that, The target RNA is either sgRNA or gRNA.
37. The kit according to claim 35 or 36, characterized in that, (b) The target RNA is in the same or a separate container.
38. A method for screening edit events without relying on exogenous transgenic markers, comprising the following steps: 1) Two or more DNA breaks are generated sequentially at a specific location of the first target gene in the recipient cell and are spontaneously repaired. The later DNA break is generated based on the new sequence generated after the repair of the earlier DNA break. 2) Certain editing events that occur after sequential cutting and repair of a specific location of the first target gene can confer resistance to a certain selection pressure on mutant cells, produce phenotypic selectable traits, apply corresponding selection pressure to select for the trait, and isolate cells, tissues, organs or complete organisms containing such editing events. 3) Optionally, in addition to the first target gene, other targets are edited simultaneously using a targeted nuclease targeting at least one second target gene. By screening for selectable traits generated by mutations in the first target gene, the editing events of the second target gene are enriched and screened simultaneously, and cells, tissues, organs or complete organisms containing both the first target gene and at least one second target gene editing event are isolated.
39. The method according to claim 38, characterized in that, The "first target gene" is a gene locus that encodes at least one phenotypic selectable trait, wherein the at least one phenotypic selectable trait is a resistance / tolerance trait or a growth advantage trait.
40. The method according to claim 38 or 39, characterized in that, The "specific location of the first target gene" refers to certain mutation types generated after sequential cutting and repair at the location, which can confer resistance to a certain selection pressure on the recipient cell, producing at least one phenotypic selectable resistance / tolerance trait or growth advantage trait.
41. The method according to claim 40, characterized in that, The "certain mutation types" include single base substitutions, multiple base substitutions, or an unspecified number of base insertions or deletions.
42. The method according to any one of claims 38-41, characterized in that, The "certain screening pressure" is environmental pressure or added compound pressure; the environmental pressure is preferably high temperature, low temperature or low oxygen; the added compound pressure is preferably salt ion concentration, antibiotic, cytotoxic or herbicide.
43. The method according to any one of claims 38-42, characterized in that, The "DNA break" is achieved by delivering a nuclease with targeting properties into the cells of an organism to contact a specific location on the genomic DNA.
44. The method according to claim 43, characterized in that, The "nuclease with targeting properties" mentioned refers to all CRISPR / Cas nucleases capable of genome editing.
45. The method according to any one of claims 38-44, characterized in that, The phrase "generating two or more DNA breaks sequentially at a specific location" refers to designing new target RNAs for new sequences formed by prior DNA break repair events generated by the CRISPR / Cas system, and then cutting that site again.
46. The method according to any one of claims 38-45, characterized in that, The "two or more DNA breaks" mentioned above are generated by the same CRISPR / Cas nuclease forming an RNP complex with different gRNAs or sgRNAs, which cut the corresponding target sequences in sequence.
47. The method according to any one of claims 38-45, characterized in that, The "two or more DNA breaks" are generated by two or more CRISPR / Cas nucleases that recognize different PAM sequences, which, together with the corresponding gRNA or sgRNA, form RNP complexes that cut the corresponding target sequences in sequence.
48. The method according to any one of claims 38-47, characterized in that, The "second target gene" refers to a gene that encodes a different gene than the first target gene.
49. The method according to any one of claims 38-48, characterized in that, The "targeting nuclease for at least one second target gene" may be the same as or different from the CRISPR / Cas nuclease used to generate DNA breaks at a specific location in the first target gene.
50. The method according to any one of claims 38-45 and 48-49, characterized in that, The targeted nuclease exists in the form of DNA.
51. The method according to any one of claims 38-49, characterized in that, The targeted nuclease exists in the form of mRNA or protein, rather than DNA.
52. The method according to any one of claims 43-51, characterized in that, Methods for delivering targeted nucleases into cells include: 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation transformation; 4) microinjection; 5) gene gun bombardment; or 6) Agrobacterium-mediated transformation.
53. A method for non-transgenic transient editing of an organism's genome, comprising the following steps: 1) Design and synthesize at least two crRNA fragment combinations or at least two sgRNA fragment combinations at a specific location of the first target gene in the recipient cell. The crRNA combination combined with tracrRNA or the sgRNA combination alone can guide the corresponding Cas protein to generate two or more DNA breaks in sequence at a specific location of the first target gene in the recipient cell and repair them spontaneously. The subsequent DNA break is generated based on the new sequence generated after the repair of the previous DNA break. 2) Mix an appropriate amount of CRISPR / Cas protein or its corresponding mRNA with the above-mentioned pre-designed and synthesized crRNA fragment combination and tracrRNA fragment or sgRNA fragment combination that can guide the first target gene to produce endogenous selection markers. Optionally, at least one artificially synthesized crRNA and tracrRNA fragment or artificially synthesized sgRNA fragment targeting the second, third or more target genes is further added, and incubated in vitro to form an RNP complex. 3) The above-mentioned RNP complex is delivered to recipient cells and comes into contact with specific sites on the genomic DNA to achieve gene editing; 4) Based on the phenotypic selectable traits generated by the site-specific editing of the first target gene by the RNP complex, apply corresponding selection pressure to select for the phenotypic traits and isolate cells, tissues, organs or whole organisms containing such editing events, and optionally, isolate cells, tissues, organs or whole organisms containing editing events of both the first target gene and at least one second, third or more target genes.
54. The method according to claim 53, characterized in that, The "first target gene" is a gene locus that encodes at least one phenotypic selectable trait, wherein the at least one phenotypic selectable trait is a resistance / tolerance trait or a growth advantage trait.
55. The method according to claim 53 or 54, characterized in that, The "specific location of the first target gene" refers to certain mutation types generated after sequential cutting and repair at the location, which can confer resistance to a certain selection pressure on the recipient cell, producing at least one phenotypic selectable resistance / tolerance trait or growth advantage trait.
56. The method according to claim 55, characterized in that, The "certain mutation types" include single base substitutions, multiple base substitutions, or an unspecified number of base insertions or deletions.
57. The method according to claim 55 or 56, characterized in that, The "certain screening pressure" is environmental pressure or added compound pressure; the environmental pressure is preferably high temperature, low temperature or low oxygen; the added compound pressure is preferably salt ion concentration, antibiotic, cytotoxic or herbicide.
58. The method according to any one of claims 53-57, characterized in that, The CRISPR / Cas proteins mentioned are all CRISPR / Cas nucleases capable of genome editing.
59. The method according to any one of claims 53-58, characterized in that, The phrase "generating two or more DNA breaks sequentially at a specific location" refers to designing new target RNAs for new sequences formed by prior DNA break repair events generated by the CRISPR / Cas system, and then cutting that site again.
60. The method according to any one of claims 53-59, characterized in that, The "two or more DNA breaks" are generated by the same CRISPR / Cas protein and different gRNAs or sgRNAs forming an RNP complex that cuts the corresponding target sequences in sequence.
61. The method according to any one of claims 53-59, characterized in that, The "two or more DNA breaks" are generated by two or more CRISPR / Cas proteins that recognize different PAM sequences, together with their corresponding gRNAs or sgRNAs, forming RNP complexes that cleave the corresponding target sequences in sequence.
62. The method according to any one of claims 53-61, characterized in that, The "second, third or more target genes" refer to other genes that encode different genes from the first target gene.
63. The method according to any one of claims 53-62, characterized in that, The "at least one synthetic crRNA and tracrRNA fragment or synthetic sgRNA fragment targeting a second, third or more target genes" shares the same Cas protein with the crRNA or sgRNA targeting the first target gene.
64. The method according to any one of claims 53-62, characterized in that, The "at least one synthetic crRNA and tracrRNA fragment or synthetic sgRNA fragment targeting a second, third or more target genes" uses a Cas protein that recognizes different PAM sequences, similar to the crRNA or sgRNA targeting the first target gene.
65. The method according to any one of claims 53-64, characterized in that, The method for delivering the RNP complex into cells is selected from 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electroporation. 4) Microinjection; or 5) Gene gun bombardment.
66. A method for non-transgenic transient editing of a plant genome, comprising the following steps: 1) Design and synthesize at least two crRNA fragment combinations or at least two sgRNA fragment combinations at a specific location of the first target gene in the recipient plant cell or tissue. The crRNA combination, in combination with tracrRNA or using the sgRNA combination alone, can guide the corresponding Cas protein to generate two or more DNA breaks sequentially at a specific location of the first target gene in the recipient cell and repair them spontaneously. The subsequent DNA break is generated based on the new sequence generated after the repair of the previous DNA break. 2) Mix an appropriate amount of CRISPR / Cas protein or its corresponding mRNA with the above-mentioned pre-designed and synthesized crRNA fragment combination and tracrRNA fragment or sgRNA fragment combination that can guide the first target gene to produce endogenous selection markers. Optionally, at least one artificially synthesized crRNA and tracrRNA fragment or artificially synthesized sgRNA fragment targeting the second, third or more target genes is further added, and incubated in vitro to form an RNP complex. 3) The above-mentioned RNP complex is delivered to recipient plant cells or tissues and comes into contact with specific sites of genomic DNA to achieve gene editing; 4) Based on the phenotypic selectable traits generated by the site-specific editing of the first target gene by the RNP complex, apply corresponding selection pressure to select for the phenotypic traits and isolate cells, tissues, organs or whole plants containing such editing events, and optionally, isolate cells, tissues, organs or whole plants containing editing events that simultaneously contain the first target gene and at least one second, third or more target genes.
67. The method according to claim 66, characterized in that, The "first target gene" is a gene locus that encodes at least one phenotypic selectable trait, wherein the at least one phenotypic selectable trait is a resistance / tolerance trait or a growth advantage trait.
68. The method according to claim 66 or 67, characterized in that, The "specific location of the first target gene" refers to certain mutation types generated after sequential cutting and repair at the location, which can confer resistance to a certain selection pressure on the recipient cell, producing at least one phenotypic selectable resistance / tolerance trait or growth advantage trait.
69. The method according to claim 68, characterized in that, The "certain mutation types" include single base substitutions, multiple base substitutions, or an unspecified number of base insertions or deletions.
70. The method according to claim 68 or 69, characterized in that, The "certain screening pressure" is environmental pressure or added compound pressure; the environmental pressure is preferably high temperature, low temperature or low oxygen; the added compound pressure is preferably salt ion concentration, antibiotic, cytotoxic or herbicide.
71. The method according to any one of claims 66-70, characterized in that, The "recipient plant cell or tissue" is any cell or tissue that can transiently express the receptor and can be regenerated into a complete plant through tissue culture; the cell is preferably a protoplast cell or a suspension cell; the tissue is preferably a callus, immature embryo, mature embryo, leaf, stem tip, young spike or hypocotyl.
72. The method according to any one of claims 66-71, characterized in that, The CRISPR / Cas proteins mentioned are all CRISPR / Cas nucleases capable of genome editing.
73. The method according to any one of claims 66-72, characterized in that, The phrase "generating two or more DNA breaks sequentially at a specific location" refers to designing new target RNAs for new sequences formed by prior DNA break repair events generated by the CRISPR / Cas system, and then cutting that site again.
74. The method according to any one of claims 66-73, characterized in that, The "two or more DNA breaks" are generated by the same CRISPR / Cas protein and different gRNAs or sgRNAs forming an RNP complex that cuts the corresponding target sequences in sequence.
75. The method according to any one of claims 66-73, characterized in that, The "two or more DNA breaks" are generated by two or more CRISPR / Cas proteins that recognize different PAM sequences, together with their corresponding gRNAs or sgRNAs, forming RNP complexes that cleave the corresponding target sequences in sequence.
76. The method according to any one of claims 66-75, characterized in that, The "second, third or more target genes" refer to other genes that encode different genes from the first target gene.
77. The method according to any one of claims 66-76, characterized in that, The "at least one synthetic crRNA and tracrRNA fragment or synthetic sgRNA fragment targeting a second, third or more target genes" shares the same Cas protein with the crRNA or sgRNA targeting the first target gene.
78. The method according to any one of claims 66-76, characterized in that, The "at least one synthetic crRNA and tracrRNA fragment or synthetic sgRNA fragment targeting a second, third or more target genes" uses a Cas protein that recognizes different PAM sequences, similar to the crRNA or sgRNA targeting the first target gene.
79. The method according to any one of claims 66-78, characterized in that, The method for delivering the RNP complex into plant cells is selected from 1) PEG-mediated protoplast transformation; 2) microinjection; 3) gene gun bombardment; 4) silicon carbide fiber-mediated delivery; or 5) vacuum infiltration or any other instantaneous delivery method.
80. The method according to any one of claims 66-79, characterized in that, The "first target gene" is at least one endogenous gene encoding at least one phenotypic selectable trait selected from herbicide resistance / tolerance, wherein the herbicide resistance / tolerance is selected from resistance / tolerance to EPSPS inhibitors, resistance / tolerance to glutamine synthesis inhibitors, resistance / tolerance to ALS or AHAS inhibitors, resistance / tolerance to ACCase inhibitors, resistance / tolerance to carotenoid biosynthesis inhibitors, resistance / tolerance to cellulose inhibitors, resistance / tolerance to lipid synthesis inhibitors, resistance / tolerance to long-chain fatty acid inhibitors, resistance / tolerance to microtubule assembly inhibitors, resistance / tolerance to photosystem I electron shunting agents, resistance / tolerance to photosystem II inhibitors, or resistance / tolerance to PPO inhibitors and resistance / tolerance to synthetic auxins; preferably, the "first target gene" is selected from PsbA, ALS, EPSPS, ACCase, PPO, HPPD, PDS, GS, DOXPS, TIR1, or AFB5.
81. The method according to claim 80, characterized in that, The "first target gene" is ALS, and the "specific location of the gene" refers to the amino acid sequence sites A122, P197, R198, D204, A205, D376, R377, W574, S653, or G654 of the Arabidopsis thaliana AtALS protein, as well as the corresponding amino acid sites of the ALS proteins of other plants using the AtALS amino acid sequence as a reference standard; or The crRNA or sgRNA targets a target sequence comprising sequences selected from amino acid sequence sites A122, P197, R198, D204, A205, D376, R377, W574, S653, G654 or any combination thereof encoding the AtALS protein, as well as target sequences corresponding to the above amino acid sites and any combinations thereof in the ALS proteins of other plants using the AtALS amino acid sequence as a reference standard.
82. The method according to claim 80, characterized in that, The "first target gene" is ACCase, and the "specific location of the gene" refers to the amino acid sequence sites I1781, E1874, N1878, W1999, W2027, I2041, D2078, C2088, or G2096 of the AmACCase protein in *Alopecurus aequalis*, as well as the corresponding amino acid sites in the ACCase proteins of other monocotyledonous plants using the AmACCase amino acid sequence as a reference standard; or The crRNA or sgRNA targets a sequence comprising a sequence selected from amino acid sequence sites I1781, E1874, N1878, W1999, W2027, I2041, D2078, C2088, G2096 or any combination thereof encoding the AmACCase gene, as well as a target sequence corresponding to the above-mentioned amino acid sites and any combination thereof in ACCase proteins of other monocotyledonous plants using the AmACCase amino acid sequence as a reference standard.
83. The method according to claim 80, characterized in that, The "first target gene" is HPPD, and the "specific location of the gene" refers to the amino acid sequence sites H141, L276, P277, N338, G342, R346, D370, P386, K418, or G419 of the rice OsHPPD protein, as well as the corresponding amino acid sites of the above-mentioned amino acid sites in the HPPD proteins of other plants using the OsHPPD amino acid sequence as a reference standard; or The crRNA or sgRNA targets a target sequence comprising sequences selected from amino acid sequence sites H141, L276, P277, N338, G342, R346, D370, P386, K418, G419 or any combination thereof encoding the OsHPPD gene, as well as target sequences corresponding to the above amino acid sites and any combinations thereof in HPPD proteins of other plants using the OsHPPD amino acid sequence as a reference standard.
84. The method according to claim 80, characterized in that, The "first target gene" is PPO, and the "specific location of the gene" refers to the amino acid sequence sites S128, V217, S223, V364, K373, L423, Y425, or W470 of the rice OsPPO1 protein, as well as the corresponding amino acid sites of the above-mentioned amino acid sites in the PPO proteins of other plants using the OsPPO1 amino acid sequence as a reference standard; or The crRNA or sgRNA targets a target sequence comprising sequences selected from amino acid sequence sites S128, V217, S223, V364, K373, L423, Y425, W470 or any combination thereof encoding the OsPPO1 gene, as well as target sequences corresponding to the above amino acid sites and any combinations thereof in PPO proteins of other plants using the OsPPO1 amino acid sequence as a reference standard.
85. The method according to claim 80, characterized in that, The "first target gene" is TIR1, and the "specific location of the gene" refers to amino acid sequence sites F93, F357, C413, or S448 of the rice OsTIR1 protein, as well as the corresponding amino acid sites of the TIR1 protein in other plants using the OsTIR1 amino acid sequence as a reference standard; or The crRNA or sgRNA targets a target sequence comprising a sequence selected from amino acid sequence sites F93, F357, C413, S448 or any combination thereof encoding the OsTIR1 gene, as well as a target sequence comprising the above-mentioned amino acid sites and any combination thereof corresponding to the TIR1 protein of other plants with the OsTIR1 amino acid sequence as a reference standard.
86. A non-GMO instantaneous editing system employing the method of any one of claims 53-85.
87. Use of the non-GMO instantaneous editing system as described in claim 86 as a screening marker, a disease treatment, or a biological breeding system.
88. A genetically modified plant obtained by the method of any one of claims 66-85, wherein its genome contains: 1) The editing event of the first target gene; 2) An editing event of the first target gene and an editing event of at least one second target gene; or 3) At least one editing event of a second target gene, wherein the editing event of the first target gene has been removed through genetic segregation; in, The genetically modified plants were obtained through non-GMO methods.
89. A novel plant gene mutation obtained by the method described in any one of claims 66-85.
90. A novel mutation produced in a plant that includes one or more of the following types: The substitutions are aspartic acid at position 376 of Arabidopsis thaliana with any other amino acid, tryptophan at position 574 of Arabidopsis thaliana with any other amino acid, serine at position 653 of Arabidopsis thaliana with any other amino acid, or serine at position 654 of Arabidopsis thaliana with any other amino acid; or tryptophan at position 2027 of Alopecurus aequalis indica with any other amino acid.
91. The mutation according to claim 90, characterized in that, The substitutions are as follows: aspartic acid at position 376 in Arabidopsis thaliana is replaced by glutamic acid; tryptophan at position 574 in Arabidopsis thaliana is replaced by leucine or methionine; serine at position 653 in Arabidopsis thaliana is replaced by asparagine or arginine; or glycine at position 654 in Arabidopsis thaliana is replaced by aspartic acid; or tryptophan at position 2027 in Alopecurus aequalis indica is replaced by leucine or cysteine.
92. The mutation according to claim 90, characterized in that, The aspartic acid at position 350 of rice ALS is replaced by any other amino acid; the tryptophan at position 548 of rice ALS is replaced by any other amino acid; or the tryptophan at position 561 of potato ALS2 is replaced by any other amino acid; or the tryptophan at position 2038 of rice ACCase2 is replaced by any other amino acid.
93. The mutation according to any one of claims 90-92, characterized in that, Aspartic acid at position 350 in rice ALS is replaced by glutamic acid; tryptophan at position 548 in rice ALS is replaced by leucine or methionine; or tryptophan at position 2561 in potato ALS is replaced by leucine or methionine; or tryptophan at position 2038 in rice ACCase2 is replaced by leucine or cysteine.
94. A protein having the novel mutation as described in any one of claims 89-93, or a biologically active fragment thereof.
95. A nucleic acid comprising a nucleic acid sequence or its complementary sequence encoding the protein of claim 94 or a biologically active fragment thereof.
96. A recombinant expression vector comprising the nucleic acid of claim 95, and a promoter operatively linked thereto.
97. An expression cassette comprising the nucleic acid of claim 95.
98. A plant cell comprising the expression cassette of claim 97.
99. A plant using the plant cell regeneration method described in claim 98.
100. A method for producing plants with enhanced resistance or tolerance to herbicides, comprising transforming or transfecting plant cells with the recombinant expression vector of claim 96 or the expression cassette of claim 97, and regenerating plants from the transformed or transfected plant cells.
101. A method for controlling weeds in a plant cultivation site, wherein the plant comprises the plant of claim 88 or 99 or the plant prepared by the method of claim 100, the method comprising applying to the cultivation site an effective amount of one or more herbicides for weed control.
102. The use of the novel mutation of any one of claims 89-93, the protein or its bioactive fragment of claim 94, the nucleic acid of claim 95, the recombinant expression vector of claim 96, or the expression cassette of claim 97 in improving herbicide resistance or tolerance in plant cells, plant tissues, plant parts, or plants.