Method and kit for simultaneously detecting a plurality of mutations on HBA1 / 2 and HBB loci

MY214494AActive Publication Date: 2026-07-29BERRYGENOMICS CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
MYPI2023005943
Authority / Receiving Office
MY · MY
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-03-29
Filing Date
2022-03-25
Publication Date
2026-07-29
Estimated Expiration
2042-03-25

AI Technical Summary

Technical Problem

Existing technology cannot accurately detect multiple mutations of HBA1/2 and HBB genes at the same time, especially deletion and non-deletion mutations. It cannot distinguish rare structural variations, resulting in missed detection and misdetection, and it is impossible to achieve multiple mutations in the same system. Detection of mutations.

Method used

Multiplex PCR amplification combined with a third-generation long-read sequencing platform was used to simultaneously amplify the mutant fragments of HBA1/2 and HBB genes in a single reaction tube through a specific primer combination, and the third-generation sequencing platform was used for high-throughput and accurate detection.

Benefits of technology

Achieved simultaneous detection of 903 point mutations and 33 structural variations on the HBA1/2 gene locus, and 1135 point mutations and 2 structural variations on the HBB gene locus, reducing the false detection rate, expanding the detection range, and improving Improved detection accuracy and ability to distinguish complex mutation types.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

Disclosed in the present invention are a primer combination, kit, and method for simultaneously detecting a plurality of mutations on HBA1 / 2 and HBB loci. The kit comprises the following reagents: (1) a reagent for multiplex PCR amplification; and (2) a reagent for constructing a third-generation sequencing library. The method comprises the following steps: (1) preparing a subject sample; (2) using multiplex PCR to simultaneously amplify HBA1 / 2 and HBB gene segments in the sample; (3) constructing the third-generation sequencing library; and (4) sequencing and analyzing the types of the HBA1 / 2 and HBB gene mutations.
Need to check novelty before this filing date? Find Prior Art

Description

Method and kit for simultaneous detection of multiple mutations in HBA1 / 2 and HBB gene loci Technical Field

[0001] The present invention relates to a primer combination and method for simultaneously detecting multiple mutations of HBA1 / 2 and HBB genes using a third-generation long-read sequencing platform, as well as a kit suitable for this method. Background Art

[0002] Hemoglobin (Hb for short) is a special protein that transports oxygen in red blood cells. Adult hemoglobin (HbA for short) is a tetramer composed of two pairs of α-globin and two pairs of β-globin. The lack or deficiency of the synthesis of α-globin or β-globin can lead to thalassemia, also known as thalassemia. The lack or deficiency of α-globin caused by mutation of the α-globin gene is called α-thalassemia (abbreviated as α-thalassemia); the lack or deficiency of β-globin caused by mutation of the β-globin gene is called β-thalassemia (abbreviated as β-thalassemia). Thalassemia is the most common single gene genetic disease in the world. It is an autosomal recessive inheritance. High-incidence areas include southern China, Southeast Asia, the Mediterranean region, India, the Middle East and Africa. [1,2] .

[0003] The human α-globin gene cluster is located on chromosome 16 and contains a total of 7 gene loci: 5'-zeta-pseudozeta-mu-psedudoalpha-1-alpha-2-alpha-1-theta-3'. Among them, only two genes, HBA1 (alpha-1) and HBA2 (alpha-2), have the ability to encode globin in embryos and adults. The others are pseudogenes or predicted genes, or are only translated and expressed in the early embryonic development. Mutations in the HBA1 and HBA2 genes include deletion mutations and non-deletion mutations. The most common deletion mutations in the HBA1 and HBA2 genes in my country are -α3.7, -α4.2, and --SEA. The non-deletion mutations are HBA2:c.369C>G, HBA2:c.377T>C, and HBA2:c.427T>C. These six gene mutations account for 98% of the total number of α-thalassemia in the Chinese population, so the existing routine clinical molecular diagnosis mainly targets the above mutations. [3,4]. As the pathogenic mechanism of α-thalassemia continues to be elucidated, more and more mutation types are being discovered. Based on the Ithanet, HbVar, LOVD and LOVD-China thalassemia databases, approximately 50 deletions in the α-globin gene cluster region and more than 900 non-deletion mutations in the HBA1 and HBA2 genes have been found worldwide, which can lead to reduced or absent α-globin expression. To date, 104 α-globin gene mutations have been found in the Chinese population, including 28 deletion mutations and 76 non-deletion mutations. [5] . In addition, there are some rare structural variations, such as the 3.7 triplet type αααanti3.7, the 4.2 triplet type αααanti4.2, HKαα and antiHKαα, etc. The production of HKαα is due to the deletion of -α3.7 and the recombination of αααanti4.2, while the production of antiHKαα is due to the deletion of -α4.2 and the recombination of αααanti3.7. The traditional Gap-PCR method cannot distinguish between HKαα and -α3.7, nor can it distinguish between antiHKαα and -α4.2, which will lead to misdiagnosis during screening. [9] Accurately distinguishing these genotypes requires the use of different PCR systems, and simultaneous detection cannot be achieved within the same system. This indicates that α-thalassemia has a wide spectrum of genetic mutations. Increasing the current screening scope for α-thalassemia gene defects will effectively avoid missing abnormal genotypes.

[0004] The human β-globin gene cluster is located on chromosome 11 and contains a total of five gene loci: 5'-epsilon-gamma-G-gamma-A-delta-beta-3'. Among them, only the HBB (beta) gene encodes globin in adults, and the other four genes are expressed during embryonic development or at very low levels in adults. The genetic variations that lead to β-thalassemia are mainly point mutations or small deletions of the HBB gene, and a few are large deletions. [6,7]Based on the Ithanet, HbVar, LOVD and LOVD-China thalassemia databases, more than 1,000 non-deletion mutations of the HBB gene have been found worldwide. To date, 129 non-deletion mutations of the β-globin gene have been found in the Chinese population, but the main tests currently focus on 19 mutations at 17 known common sites, including c.-82C>A, c.-80T>C, c.-79A>G, c.-78A>G, c.-78A>C, c.-11_-8delAAAC, c.79G>A, c.92+1G>T, c.92+5G>C, c.316-197C>T, c.2T>G, c.45_46insG, c.84_85insG, c.52A>T, c.94delC, c.126_129delCTTT, c.130G>T, c.216_217insA, c.216_217insT [8] Currently, there is no feasible method to detect all HBB gene mutations at one time.

[0005] Currently, most kits for detecting HBA1 / 2 gene deletion mutations are based on multiplex gap-PCR methods. For example, the α-thalassemia detection kits developed by Yaneng Biotechnology (Shenzhen) Co., Ltd., Shenzhen Yishengtang Biotechnology Co., Ltd., and Guangzhou Daan Gene are only able to detect three to four common deletion thalassemia mutations (-α3.7, -α4.2, --SEA, and --THAI). Currently, the diagnostic kits for non-deletion α- and β-thalassemia are all based on the PCR-RDB method, primarily detecting three common HBA2 and 17 HBB gene mutation sites. These detection kits have the following limitations:

[0006] 1. It is not possible to simultaneously detect deletion-type and non-deletion-type α- and β-thalassemia-related mutations in the same system;

[0007] 2. It only detects common thalassemia mutations, which has limited coverage and is prone to missed detection, such as rare HBA1 / 2 and HBB gene point mutations, and structural variations such as αααanti3.7 and αααanti4.2;

[0008] 3. Conventional Gap-PCR cannot distinguish between -α3.7 deletion and ΗKαα structural variation of α-thalassemia, nor can it distinguish between -α4.2 deletion and anti-ΗKαα structural variation, which will cause a certain degree of false detection. [9] ;

[0009] 4. When two or more mutations exist simultaneously at the HBA1 / 2 or HBB gene loci, existing methods cannot distinguish between cis and trans mutations.

[0010] Summary of the Invention

[0011] In light of this, the present invention provides a method based on multiplex PCR amplification and third-generation sequencing for the simultaneous detection of multiple mutations in the HBA1 / 2 and HBB gene regions. Multiplex PCR amplification enables the simultaneous amplification of both deletion- and non-deletion-type mutations in the HBA1 / 2 and HBB genes in a single reaction tube. The third-generation sequencing platform, with its advantages of high read length measurement, high calibration accuracy, and high throughput, enables accurate, rapid, and high-throughput detection of HBA1 / 2 and HBB gene mutations. The method disclosed herein is simple to operate, and the multiplex PCR and third-generation library quality are reliable and highly reproducible, facilitating the application of third-generation sequencing technology in clinical testing.

[0012] The present invention aims to address the current challenges of HBA1 / 2 and HBB gene mutation detection, including low accuracy, inability to simultaneously detect multiple deletion and non-deletion mutations, uncertainty about mutation linkage, inability to detect uncommon mutations, and clinical omissions and false positives. By simultaneously amplifying HBA1 / 2 and HBB gene mutation fragments through multiplex PCR and preparing third-generation sequencing libraries, the goal is to accurately and rapidly detect multiple HBA1 / 2 and HBB gene mutations in multiple samples.

[0013] First, according to a first aspect of the present invention, the present invention relates to a primer set for simultaneously amplifying HBA1 / 2 and HBB gene mutations, the primer set comprising one or more primer pairs of the following 8 primers (positions as shown in FIG1 ):

[0014] four forward primers: HBA-F1, HBA-F2, HBA-F3, and HBA-F4;

[0015] Two reverse primers HBA-R1 and HBA-R2; and

[0016] HBB-F, HBB-R.

[0017] The HBA-F1 primer is located between genome hg38 chr16:165401-169817; the HBA-F2 primer is located between genome hg38 chr16:163801-165400; the HBA-F3 primer is located between genome hg38 chr16:158801-163800; the HBA-F4 primer is located upstream of genome hg38 chr16:149801; the HBA-R1 primer is located between genome hg38 chr16:178388-186641; the HBA-R2 primer is located downstream of genome hg38 chr16:184801; and the HBB-F and HBB-R primers are located upstream and downstream of genome hg38 chr11:5224302-5228938, respectively.

[0018] The primers can amplify the complete sequence of HBA1 / 2 and HBB genes, including any type of mutant sequence within the primer range. Preferably, the amplification product of each primer is less than 15Kb. Preferably, if there is a SNP at the primer position, degenerate base primers are used.

[0019] In a preferred embodiment, the primer set includes the following primer pairs: HBA-F1 and HBA-R1 primer pair; and HBB-F and HBB-R primer pair.

[0020] In a specific embodiment, the primer sequences are shown in SEQ ID NO: 1-8 in Table 1.

[0021] Table 1: Detection primer sequences

[0022] Primer sequence number Primer name Primer sequence (5'-3') SEQ ID NO: 1 HBA-F1ACCCAGGCAACATCAGGGAGAGCTTT SEQ ID NO: 2 HBA-F2CGGAGCGATCTGGGCTCTGTGTTCTCAG SEQ ID NO: 3 HBA-F3CATACCCTTTGCAAGCACACGTACTAAC SEQ ID NO: 4 HBA-F4CACGAGTAAAACATCAAGTACACTCCAGC SEQ ID NO: 5 HBA-R1CTGAAGCAGCAGGARTGGAGAAGGAAAT SEQ ID NO: 6 HBA-R2ATTCCTCCCGTGTCCGTATTCCTTAC SEQ ID NO: 7 HBB-FCRTGACTGAATTTTACCTTCACACCTAA SEQ ID NO: 8 HBB-RTTGACACCAYGGCCCACTTAATGAGG

[0023] In a preferred embodiment, the primer set capable of simultaneously amplifying HBA1 / 2 and HBB gene mutations can simultaneously detect at least 903 known point mutations and 33 structural variations at the HBA1 / 2 gene locus (including --SEA, -α3.7, -α4.2, --THAI, --FIL, αααanti3.7, αααanti4.2, HKαα, antiHKαα, --MED-I, --MED-II, -α6.3, -α5.6, --11.1, -αMAL3.5, -α3.8, -α2.7, -α2.4, -α2.8, -α1.2, -α0.8, -9.7, Qinzhou type deletion, --BRIT, -α3.5, --SA, -α20.5, --NOR, --CANT, --SPAN, --GEO, 5.3kb deletion and -α5.2), 1135 known point mutations and 2 structural variations (including 3.5kb deletion and Taiwanese) at the HBB gene locus (see Tables 9-12).

[0024] Among them, the 903 point mutations and 33 structural variations at the HBA1 / 2 gene loci and the 1135 point mutations and 2 structural variations at the HBB gene loci described in this article are all point mutations or structural variations known in the prior art and can be queried in the LOVD-China, HbVar, Ithanet, and LOVD thalassemia databases; detailed mutation information can be found in Tables 9-12.

[0025] In a preferred embodiment, the primer set of the present invention can simultaneously detect and distinguish three mutation types: -α3.7, αααanti4.2 and HKαα, and can also simultaneously detect and distinguish three mutation types: -α4.2, αααanti3.7 and antiHKαα.

[0026] In one embodiment, a DNA barcode of 5-50 nt of different sequence can be added to the 5' end of the primer to distinguish different samples; preferably, the 5' end barcodes of the F and R primers can be the same or different, and those skilled in the art can choose according to needs.

[0027] In a preferred experimental scheme, the primer set is used for multiplex PCR amplification of HBA1 / 2 and HBB gene fragments; and can also be used to detect whether different mutations of HBA1 / 2 and HBB genes are linked.

[0028] In one experimental scheme, the four HBA forward primers (HBA-F1, HBA-F2, HBA-F3 and HBA-F4) and two HBA reverse primers (HBA-R1 and HBA-R2) can detect different HBA1 / 2 gene mutation types in different combinations.

[0029] In a preferred embodiment, the primer pairs for detecting different HBA1 / 2 gene mutation types in different combinations are different primer pairs consisting of four HBA forward primers (HBA-F1, HBA-F2, HBA-F3, and HBA-F4) and two HBA reverse primers (HBA-R1 and HBA-R2), selected from one or more of the following primer pairs:

[0030] HBA-F1 and HBA-R1 primer pairs;

[0031] HBA-F1 and HBA-R2 primer pairs;

[0032] HBA-F2 and HBA-R1 primer pair;

[0033] HBA-F2 and HBA-R2 primer pairs;

[0034] HBA-F3 and HBA-R1 primer pair;

[0035] HBA-F3 and HBA-R2 primer pairs;

[0036] HBA-F4 and HBA-R1 primer pair; and

[0037] HBA-F4 and HBA-R2 primer pairs;

[0038] In a specific experimental scheme, the primer pair is the HBA-F1 and HBA-R1 primer pair; the HBA-F1 and HBA-R1 primer pair can detect 903 HBA1 / 2 gene site mutations and 17 structural variations (including -α3.7, -α4.2, αααanti3.7, αααanti4.2, HKαα, antiHKαα, -α6.3, -α5.6, -αMAL3.5, -α3.8, -α2.7, -α2.4, -α2.8, -α1.2, -α0.8, 5.3kb deletion and -α5.2).

[0039] In a specific embodiment, the HBA-F1 and HBA-R1 primer pairs of the present invention can simultaneously detect and distinguish three mutation types: -α3.7, αααanti4.2 and HKαα, and can also simultaneously detect and distinguish three mutation types: -α4.2, αααanti3.7 and antiHKαα.

[0040] The primer set of the present invention can be used for multiplex PCR amplification of HBA1 / 2 and HBB gene segments encompassing all mutation types within the primer range. Combined with subsequent PacBio sequencing platforms, all mutation types within the primer range can be detected for HBA1 / 2 and HBB gene segments.

[0041] According to a second aspect of the present invention, a kit for simultaneously detecting multiple mutations in the HBA1 / 2 and HBB genes is provided, comprising the following reagents:

[0042] (1) Reagents for multiplex PCR amplification of HBA1 / 2 and HBB gene fragments; and

[0043] (2) Reagents used to construct third-generation sequencing libraries.

[0044] In one embodiment, the reagents for multiplex PCR amplification include DNA polymerase, reaction buffer and primer sets.

[0045] In a preferred embodiment, the primer set in the kit is selected from one or more primer pairs of the following 8 primers (positions as shown in FIG1 ):

[0046] four forward primers: HBA-F1, HBA-F2, HBA-F3, and HBA-F4;

[0047] Two reverse primers HBA-R1 and HBA-R2; and

[0048] HBB-F, HBB-R.

[0049] The HBA-F1 primer is located between genome hg38 chr16:165401-169817; the HBA-F2 primer is located between genome hg38 chr16:163801-165400; the HBA-F3 primer is located between genome hg38 chr16:158801-163800; the HBA-F4 primer is located upstream of genome hg38 chr16:149801; the HBA-R1 primer is located between genome hg38 chr16:178388-186641; the HBA-R2 primer is located downstream of genome hg38 chr16:184801; and the HBB-F and HBB-R primers are located upstream and downstream of genome hg38 chr11:5224302-5228938, respectively. The primers can amplify the complete sequences of HBA1 / 2 and HBB genes, including any type of mutant sequences within the primer range.

[0050] Preferably, the amplification product of each primer is less than 15 Kb. Preferably, if there is a SNP at the primer position, a degenerate base primer is used.

[0051] In a preferred embodiment, the primers HBA-F1, HBA-F2, HBA-F3, HBA-F4, HBA-R1, HBA-R2, HBB-F and HBB-R in the primer set in the kit have sequences as shown in SEQ ID NOs: 1-8 in Table 1.

[0052] In a preferred embodiment, the primer set of the kit includes the following primer pairs: HBA-F1 and HBA-R1 primer pair; and HBB-F and HBB-R primer pair.

[0053] In a preferred embodiment, 5-50 nt of DNA (Barcode) with different sequences can be added to the 5' end of the primers in the kit to distinguish different samples; preferably, the 5' end Barcodes of the F and R primers can be the same or different, and those skilled in the art can choose according to needs.

[0054] In a preferred embodiment, the primers in the kit, four HBA forward primers HBA-F1, HBA-F2, HBA-F3 and HBA-F4, and two HBA reverse primers HBA-R1 and HBA-R2, can be used to detect different HBA1 / 2 gene mutation types through different combinations.

[0055] In one embodiment, for the kit, the PCR amplification product may be purified or not before proceeding to the next reaction, and those skilled in the art can choose according to needs.

[0056] In another embodiment, in the kit, the reagents for constructing a third-generation sequencing library include end-repair enzymes, adapters, ligases, DNA purification magnetic beads, reaction buffers, and exonucleases.

[0057] In one embodiment, the kit can simultaneously detect 903 point mutations and 33 structural variations on the HBA1 / 2 gene locus (including --SEA, -α3.7, -α4.2, --THAI, --FIL, αααanti3.7, αααanti4.2, HKαα, antiHKαα, --MED-I, --MED-II, -α6.3, -α5.6, --11.1, -αMAL3.5, -α3.8, -α2.7, -α2.4, -α2.8, -α1.2, -α0.8, -9.7, Qinzhou type deletion, --BRIT, -α3.5, --SA, -α20.5, --NOR, --CANT, --SPAN, --GEO, 5.3kb deletion and -α5.2), 1135 point mutations and 2 structural variations (including 3.5kb deletion and Taiwanese) at the HBB gene locus (see Tables 9-12).

[0058] In a preferred embodiment, the kit can simultaneously detect and distinguish three mutation types: -α3.7, αααanti4.2 and HKαα, and can also simultaneously detect and distinguish three mutation types: -α4.2, αααanti3.7 and antiHKαα.

[0059] In a specific embodiment, the primer set in the kit is used for multiplex PCR amplification of HBA1 / 2 and HBB gene fragments; further, the primer set can be used to detect whether different mutations of HBA1 / 2 and HBB genes are linked.

[0060] In a specific embodiment, wherein for the kit, multiplex PCR amplification is performed in a single reaction tube.

[0061] In a preferred embodiment, the third-generation sequencing is selected from PacBio sequencing of Pacific Biosciences or Nanopore sequencing of ONT.

[0062] In a specific embodiment, PacBio library adapter ligation can be performed using blunt-end ligation or TA ligation.

[0063] In one specific embodiment, the PacBio universal blunt-end adapter sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT-3' (SEQ ID NO: 9), which is annealed to form a blunt-end stem-loop adapter adapter. Different barcoded adapter adapters can be created by adding 5-50 nt of DNA (barcode) to the stem. PacBio libraries with different barcodes can be pooled for sequencing.

[0064] In one specific embodiment, the PacBio universal TA adapter sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGATT-3' (SEQ ID NO: 10), which is annealed to form a blunt-ended stem-loop adapter adapter. Different barcoded adapter adapters can be constructed by adding 5-50 nt of DNA (barcode) to the stem. PacBio libraries with different barcodes can be pooled for sequencing.

[0065] In one embodiment, the PacBio connector may or may not have a barcode. Preferably, the PacBio connector has a barcode designed by PacBio or a barcode designed by the company itself, and those skilled in the art can choose according to their needs.

[0066] In a preferred embodiment, the PacBio library is compatible with the Pacific Biosciences sequencing platform.

[0067] In a preferred embodiment, the reagents used to construct the third-generation Nanopore library include end-repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol, and reaction buffer.

[0068] In one embodiment, Nanopore library adapter ligation can be performed using blunt-end ligation or TA ligation.

[0069] In one embodiment, the Nanopore connector may or may not have a barcode. Preferably, the Nanopore connector has a barcode designed by ONT or a self-designed barcode, and those skilled in the art can choose according to their needs.

[0070] In a preferred embodiment, the Nanopore library is compatible with the sequencing platform of ONT.

[0071] A third aspect of the present invention provides a method for detecting or simultaneously detecting multiple mutations in the HBA1 / 2 and HBB genes of a subject, comprising the following steps:

[0072] (1) Prepare subject samples;

[0073] (2) Multiplex PCR simultaneously amplifies HBA1 / 2 and HBB gene mutation fragments in samples;

[0074] (3) Construction of third-generation sequencing library;

[0075] (4) Sequencing and analysis of HBA1 / 2 and HBB gene mutation types.

[0076] In one embodiment, the multiplex PCR primer set used in the method of the present invention is selected from the primers described above. Preferably, a DNA barcode of 5-50 nt with different sequences can be added to the 5' end of the primers described above to distinguish different samples.

[0077] In a preferred embodiment, the 5' end barcodes of the F and R primers may be the same or different, and those skilled in the art can select as needed.

[0078] In a preferred embodiment, the method can detect, and can simultaneously detect, multiple mutations in the HBA1 / 2 and HBB gene loci, including one or more of the following:

[0079] 903 point mutations and 33 structural variations at the HBA1 / 2 gene locus (including --SEA, -α3.7, -α4.2, --THAI, --FIL, αααanti3.7, αααanti4.2, HKαα, antiHKαα, --MED-I, --MED-II, -α6.3, -α5.6, --11.1, -αMAL3.5, -α3.8, -α2.7, -α2.4, -α2.8, -α1.2, -α0.8, -9.7, Qinzhou type deletion, --BRIT, -α3.5, --SA, -α20.5, --NOR, --CANT, --SPAN, --GEO, 5.3kb deletion and -α5.2).

[0080] There were 1135 point mutations and 2 structural variations (including 3.5kb deletion and Taiwanese) at the HBB gene locus (Tables 9-12).

[0081] In a preferred embodiment, the method can simultaneously detect and distinguish three mutation types: -α3.7, αααanti4.2 and HKαα, and can also simultaneously detect and distinguish three mutation types: -α4.2, αααanti3.7 and antiHKαα.

[0082] In a preferred embodiment, the method is used to detect whether different mutations in HBA1 / 2 and HBB genes are linked.

[0083] In a preferred embodiment, in the method, multiplex PCR amplification is performed in a single reaction tube.

[0084] In one embodiment, the sample is selected from a biological sample or gDNA extracted from the sample, wherein the biological sample is selected from cultured cell lines, blood, amniotic fluid, chorionic villi, gametes, blastocysts, joint fluid, urine, sweat, saliva, feces, cerebrospinal fluid, ascites, pleural effusion, bile, or pancreatic fluid.

[0085] In a specific embodiment, the third-generation sequencing in the method is selected from PacBio sequencing of Pacific Biosciences or Nanopore sequencing of ONT.

[0086] In one embodiment, PacBio library adapter ligation can be performed using blunt-end ligation or TA ligation.

[0087] In one embodiment, the PacBio universal blunt-end adapter sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT-3' (SEQ ID NO: 9), which is annealed to form a blunt-end stem-loop adapter adapter. Different barcoded adapter adapters can be created by adding 5-50 nt of DNA (barcode) to the stem. PacBio libraries with different barcodes can be pooled for sequencing.

[0088] In one embodiment, the PacBio universal TA adapter sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGATT-3' (SEQ ID NO: 10), which is annealed to form a blunt-ended stem-loop adapter adapter. Different barcoded adapter adapters can be created by adding 5-50 nt of DNA (barcode) to the stem. PacBio libraries with different barcodes can then be pooled for sequencing.

[0089] In one embodiment, the PacBio connector may or may not have a barcode. In a preferred embodiment, the PacBio connector has a barcode designed by PacBio or a barcode designed by the company. Those skilled in the art can choose as needed.

[0090] In a preferred embodiment, the PacBio library is compatible with the Pacific Biosciences sequencing platform.

[0091] In a preferred embodiment, the reagents used to construct the third-generation Nanopore library include end-repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol, and reaction buffer.

[0092] In one embodiment, Nanopore library adapter ligation can be performed using blunt-end ligation or TA ligation.

[0093] In one embodiment, the Nanopore connector may be with or without a barcode, which can be selected by those skilled in the art as needed. Preferably, the Nanopore connector has a barcode designed by ONT or a self-designed barcode, which can be selected by those skilled in the art as needed.

[0094] In a preferred embodiment, the Nanopore library is compatible with the sequencing platform of ONT.

[0095] The method of the present invention based on a specific combination of PCR amplification and third-generation high-throughput sequencing can achieve high specificity, accuracy and rapidity in simultaneously detecting multiple mutations in HBA1 / 2 and HBB genes in multiple samples.

[0096] The excellent technical effects of the method and kit of the present invention are mainly in the following aspects:

[0097] (1) Wide detection range. The present invention can simultaneously detect 903 point mutations and 33 structural variations at the HBA1 / 2 gene loci, and 1135 point mutations and 2 structural variations at the HBB gene loci.

[0098] (2) Single-tube detection of multiple mutation types. Traditional methods require a separate detection system for each mutation type. However, the present invention uses a single reaction primer system to simultaneously detect multiple deletion and non-deletion thalassemia mutations, including rare structural variants such as HKαα, antiHKαα, αααanti3.7, and αααanti4.2.

[0099] (3) Low false positive rate. Conventional Gap-PCR cannot distinguish between the -α3.7 deletion and HKαα structural variation of α-thalassemia, nor can it distinguish between the -α4.2 deletion and the αντιHKαα structural variation, resulting in a certain degree of false positives. However, the present invention can effectively distinguish these deletion mutations from rare structural variations.

[0100] (4) Sample diversification: The template used for PCR can be extracted genomic DNA, human cell lines, or specific tissues.

[0101] (5) High-throughput detection. Third-generation sequencing can achieve 384 types of barcode adapters, and more barcode adapters can be designed as needed. Alternatively, a dual-barcode system with primers and adapters can be used to achieve more barcode combinations. The high-throughput characteristics of the third-generation sequencing platform determine that high-throughput sample detection can be achieved.

[0102] (6) High accuracy. PacBio's dumbbell-shaped library can undergo multiple rounds of interpretation during sequencing, and the base accuracy of the sequencing results after correction is greater than 99%. Moreover, PacBio sequencing errors are random, and the base accuracy is greater than 99.9% after correction through sequencing depth. Therefore, it can accurately interpret deletion and non-deletion HBA1 / 2 and HBB gene mutations within the primer detection range. At the same time, due to the PacBio read length measurement characteristics, the method of the present invention can also detect whether different mutations are linked.

[0103] (7) Flexible detection time. The Nanopore platform can generate data within minutes, and data analysis can be started within minutes or hours depending on the actual data volume. When the detection timeliness requirement is relatively high, the Nanopore platform has a time advantage. BRIEF DESCRIPTION OF THE DRAWINGS

[0104] FIG1 is a schematic diagram of multiplex PCR primer design, wherein FIG1A represents HBA1 / 2 gene mutation, and FIG1B represents HBB gene mutation.

[0105] FIG2 is a DNA gel image of samples with different HBA1 / 2 gene mutations amplified using the multiplex PCR method in Example 1.

[0106] Figure 3 shows representative PacBio sequencing results for HBA1 / 2 and HBB gene mutation samples. In Figure 3, A (left) shows the αα / αααanti3.7 sample, and A (right) shows the αα / HKαα sample. In Figure 3, B (left) shows the HBA1:χ.95+1Γ>Α heterozygous mutation sample, B (center) shows the HBA2:c.123delG heterozygous mutation sample, and B (right) shows the HBB:c.91A>G heterozygous mutation sample.

[0107] FIG4 is a result verification diagram of the inconsistency between the present invention and the traditional detection method due to the wider or more accurate detection range of the present invention. [9] The primer design method was validated and differentiated αα, -α3.7, -α4.2, αααanti3.7, αααanti4.2, and HKαα. Figure 4B shows the Sanger sequencing validation of three representative samples. DETAILED DESCRIPTION

[0108] Example 1: Amplification of different HBA1 / 2 and HBB gene mutations using the multiplex PCR method of the present invention

[0109] Prepare the reaction system according to Table 2 below to amplify peripheral blood samples with different types of HBA1 / 2 and HBB gene mutations:

[0110] Table 2:

[0111]

[0112] On a PCR instrument, perform pre-amplification according to the conditions shown in Table 3 below:

[0113] Table 3:

[0114]

[0115] After amplification, 20 μl of each sample was taken and tested on a 1% DNA gel. The results are shown in FIG2 . Different deletion mutations of the HBA1 / 2 gene and the HBB gene were effectively amplified.

[0116] Example 2: Construction of a PacBio sequencing library using the multiplex PCR method of the present invention

[0117] Step 1: Multiplex PCR amplification

[0118] Prepare the reaction system according to Table 4 below to amplify peripheral blood samples with different types of HBA1 / 2 and HBB gene mutations:

[0119] Table 4:

[0120]

[0121] On a PCR instrument, perform pre-amplification according to the conditions shown in Table 5 below:

[0122] Table 5:

[0123]

[0124]

[0125] After amplification, place the amplified product in a centrifuge at 10,000 rpm for 20 minutes. After centrifugation, place it horizontally and still, and take 4 μL of the supernatant and add it to a new tube.

[0126] Step 2: Construction of PacBio sequencing library

[0127] Prepare the reaction system according to Table 6 below:

[0128] Table 6:

[0129]

[0130] The reaction was performed on a PCR instrument under the following conditions: 37°C for 20 min; 25°C for 15 min; and 65°C for 10 min. After completion, 0.5 μL of Exonuclease III (NEB, Cat#M0206L) and 0.5 μL of Exonuclease VII (NEB, Cat#M0379L) were added, and the reaction was continued at 37°C for 1 hour. DNA was purified twice using 0.6x Ampure PB magnetic beads (PacBio, Cat#100-265-900) according to the manufacturer's instructions, and finally eluted with 10 μL of Elution Buffer. The resulting DNA eluate constituted the target DNA PacBio sequencing library. DNA concentration was determined using Qubit dsDNA HS reagent (ThermoFisher, Cat# Q32851) on a Qubit 3 Fluorometer (ThermoFisher, Cat# Q33216). When there are multiple sample PacBio sequencing libraries, equal amounts of libraries can be mixed together to prepare a pooled library.

[0131] Step 3: PacBio sequencing and analysis

[0132] Based on the total concentration and molarity of the library, an appropriate volume of the library was reacted with binding reagents (PacBio, Cat#101-820-200) and primers (PacBio, Cat#100-970-100) to prepare the final library ready for sequencing. Representative sequencing results are shown in Figure 3. The results of the two samples in Figure A detected by the method of the present invention were αα / αααanti3.7 and αα / HKαα, respectively. The results of the three samples in Figure B detected by the method of the present invention were HBA1:c.95+1G>A heterozygous mutation, HBA2:c.123delG heterozygous mutation, and HBB:c.91A>G heterozygous mutation, which were consistent with the Sanger sequencing results.

[0133] Example 3: Detection and Verification of HBA1 / 2 and HBB Gene Mutations

[0134] Peripheral blood samples from 1,759 subjects were collected from Changsha Maternal and Child Health Hospital, the First Affiliated Hospital of Chongqing Medical University, the First Affiliated Hospital of Guangxi Medical University, the People's Hospital of Guangxi Tibetan Autonomous Region, the Third Affiliated Hospital of Guangzhou Medical University, the People's Hospital of Guizhou Province, Hainan Women and Children's Medical Center, Hunan Jiahui Genetics Hospital, Jiangxi Provincial Maternal and Child Health Hospital, Suining Central Hospital, Xiamen Maternal and Child Health Hospital, and Yunnan Maternal and Child Health Hospital as 1,759 validation samples. Referring to Example 2, the method (and kit) of the present invention was used to simultaneously detect multiple mutations in the HBA1 / 2 and HBB gene loci. The α-thalassemia gene detection kit (Gap-PCR method) from Yaneng Biotechnology (Shenzhen) Co., Ltd. was used to detect three deletion mutations in the HBA1 / 2 genes: -α3.7, -α4.2, and -SEA. The non-deletion α-thalassemia gene detection kit (PCR-reverse dot blot method) was used to detect three point mutations: HBA2: c.369C>G, HBA2: c.377T>C, and HBA2: c.427T>C. The β-thalassemia gene detection kit (PCR-reverse dot blot method) was used to detect 19 mutations at 17 sites in the HBB gene. The results are shown in Tables 7 and 8.

[0135] The results obtained using the present invention and the control results showed that among the 1759 samples, the results of 1726 samples were completely consistent (Table 7), and the other 33 samples were inconsistent (Table 8). Among them, three samples (AC077, AD020, AK166) were detected as -α3.7 mutations by the sub-PCR-based method, while the traditional Gap-PCR method could not distinguish between -α3.7 and HKαα mutations. These three samples were detected as HKαα mutations by the method of the present invention; seven samples (AA160, AD044, AD125, AF048, AI129, AJ034) were not detected by the sub-PCR-based method for structural variation, while the method of the present invention detected αααanti3.7, αααanti4.2 or -THAI structural variation; In the other 33 samples, the method of the present invention detected HBA1 / 2 and HBB gene point mutations that were not included in the detection range of the sub-PCR-reverse dot hybridization method. PCR or PCR-Sanger sequencing was performed on 33 inconsistent samples, as shown in FIG4 , and the results were consistent with the method of the present invention.

[0136] Table 7:

[0137]

[0138]

[0139]

[0140] Table 8:

[0141]

[0142]

[0143] Therefore, the results of the detection method of the present invention, compared with control kits and verified by PCR or PCR-Sanger sequencing, both showed specificity and sensitivity of 100%. Moreover, compared with traditional Gap-PCR and PCR-DRB detection techniques, the detection accuracy was improved by 1.88% (33 / 1759). Therefore, the present invention utilizes a multiplex PCR method combined with PacBio sequencing to accurately and efficiently detect multiple mutations in the HBA1 / 2 and HBB genes simultaneously.

[0144] Tables 9-12 below show the point mutations and structural variations that can be detected by the primer sets, kits, and methods of the present invention.

[0145] Table 9: Detectable HBA1 point mutations

[0146]

[0147]

[0148]

[0149] Table 10: Detectable HBA2 point mutations

[0150]

[0151]

[0152]

[0153] Table 11: Detectable HBB point mutations

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161] Table 12: Some structural variations of HBA1 / 2 and HBB

[0162]

[0163]

[0164] It should be noted that while the above examples illustrate some features of the present invention, they are not intended to limit the present invention. Those skilled in the art will appreciate that the present invention is susceptible to various modifications and variations. The reagents, reaction conditions, and the like involved in the multiplex PCR reaction and third-generation sequencing library construction can be adjusted and modified accordingly based on specific needs. Therefore, those skilled in the art will appreciate that several simple substitutions can be made without departing from the concepts and principles of the present invention, all of which are intended to be within the scope of protection of the present invention.

[0165] References

[0166] [1]Modell B, Darlison M.Bull World Health Organ.Global epidemiology of haemoglobin disorders and derived service indicators.2008Jun;86(6):480-7.Doi:10.2471 / blt.06.036673.

[0167] [2] Chui DH. Alpha-thalassaemia and population health in Southeast Asia. Ann Hum Biol. 2005Mar-Apr; 32(2):123-30.doi:10.1080 / 03014460500075084.

[0168] [3]Xu Xiangmin. Guidelines for the prevention and control of thalassemia[M]. Beijing: People’s Military Medical Publishing House, 2011.

[0169] [4]Zhang L, Zhang Q, Tang Y, Cong P, Ye Y, Chen S, Zhang X, Chen Y, Zhu B, Cai W, Chen S, Cai R, Guo X, Zhang C, Zhou Y, Zou J, Liu Y, Chen B, Yan S, Chen Y, Zhou Y, Ding H, Li X.Hum Mutat.2019Dec;40(12):2221-2229.LOVD-DASH:A comprehensive LOVD database coupled with diagnosis and an at-risk assessment system for hemoglobinopathies.doi:10.1002 / humu.23863.Epub 2019 Sep 11.

[0170] [5] Chinese Medical Association Medical Genetics Branch Genetic Disease Clinical Practice Guidelines Writing Group. Authors: Shang Xuan, Zhang Xinhua, Yang Fang, Xu Xiangmin. Clinical Practice Guidelines for α-thalassemia. Chinese Journal of Medical Genetics. March 2020, Vol. 37, No. 3.

[0171] [6]Thein SL.Molecular basis of β thalassemia and potential therapeutic targets.Blood Cells Mol Dis.2018 May;70:54-65.doi:10.1016 / j.bcmd.2017.06.001.Epub 2017 Jun 20.

[0172] [7]Shang X, Xu

[0173] [8] Chinese Medical Association Medical Genetics Branch, Clinical Practice Guidelines for Genetic Diseases Writing Group. Authors: Shang Xuan, Wu Xuedong, Zhang Xinhua, Feng Xiaoqin, Xu Xiangmin. Clinical Practice Guidelines for β-thalassemia. Chinese Journal of Medical Genetics. March 2020, Vol. 37, No. 3.

[0174] [9] Shang X, Li Q, Cai R, Huang J, Wei X, Xu

Claims

1. A primer set for simultaneously amplifying HBA1 / 2 and HBB gene mutations, the primer set comprising one or more of the following primers: Four HBA forward primers: HBA-F1, HBA-F2, HBA-F3, and HBA-F4; Two HBA reverse primers HBA-R1, HBA-R2; and HBB primers: HBB-F, HBB-R; in, The HBA-F1 primer is located between genome hg38 chr16:165401-169817; the HBA-F2 primer is located between genome hg38 chr16:163801-165400; the HBA-F3 primer is located between genome hg38 chr16:158801-163800; the HBA-F4 primer is located upstream of genome hg38 chr16:149801; the HBA-R1 primer is located between genome hg38 chr16:178388-186641; the HBA-R2 primer is located downstream of genome hg38 chr16:184801; and the HBB-F and HBB-R primers are respectively located upstream and downstream of genome hg38 chr11:5224302-5228938.

2. The primer set according to claim 1, It is characterized in that The primer set can simultaneously detect multiple mutations at HBA1 / 2 and HBB gene loci, and the mutations at least include: As shown in Tables 9 and 10, there are 903 point mutations and 33 structural variations at the HBA1 / 2 locus, among which the structural variations include --SEA, -α3.7, -α4.2, --THAI, --FIL, αααanti3.7, αααanti4.2, HKαα, antiHKαα, --MED-I, --MED-II, -α6.3, -α5.6, --11.1, -α MAL3.5 , -α3.8, -α2.7, -α2.4, -α2.8, -α1.2, -α0.8, -9.7, Qinzhou type deletion, --BRIT, -α3.5, --SA, -α20.5, --NOR, --CANT, --SPAN, --GEO, 5.3kb deletion, and -α5.2; and As shown in Table 11, there are 1135 point mutations and 2 structural variations at the HBB gene locus, among which the structural variations include 3.5kb deletion and Taiwanese.

3. The primer set according to claim 1, wherein the sequences of the primers HBA-F1, HBA-F2, HBA-F3, HBA-F4, HBA-R1, HBA-R2, HBB-F and HBB-R are shown in SEQ ID NOs: 1-8, respectively.

4. The primer set according to any one of claims 1-3, wherein the four HBA forward primers HBA-F1, HBA-F2, HBA-F3 and HBA-F4, and the two HBA reverse primers HBA-R1 and HBA-R2, detect different HBA1 / 2 gene mutation types through different combinations.

5. The primer set according to any one of claims 1 to 3, wherein the primers are added with 5-50 nt of DNA with different sequences at the 5' end, i.e., DNA barcodes, for distinguishing different samples.

6. The primer set according to any one of claims 1 to 3, wherein the primer set is used for multiplex PCR amplification of HBA1 / 2 and HBB gene fragments.

7. The primer set according to any one of claims 1 to 3, wherein the primer set can be used to detect whether different mutations of HBA1 / 2 and HBB genes are linked.

8. A kit for simultaneously detecting multiple mutations of HBA1 / 2 and HBB genes, comprising the following reagents: 1) Reagents for multiplex PCR amplification of HBA1 / 2 and HBB gene fragments; and 2) Reagents for constructing third-generation sequencing libraries.

9. The kit according to claim 8, wherein the reagents for multiplex PCR amplification comprise DNA polymerase, a reaction buffer and a primer set. 10 . The kit according to claim 9 , wherein the primer set is the primer set according to any one of claims 1 to 7 .

11. The kit according to claim 8, wherein the kit is used to simultaneously detect mutations of HBA1 / 2 and HBB genes or whether different mutations of common HBA1 / 2 and HBB genes are linked.

12. The kit according to claim 8, wherein the reagents for constructing a third-generation sequencing library include adapters, ligases, DNA purification magnetic beads, reaction buffers and exonucleases.

13. The kit according to claim 8, wherein the multiple mutations of the HBA1 / 2 and HBB genes are at least include: As shown in Tables 9 and 10, there are 903 point mutations and 33 structural variations at the HBA1 / 2 gene locus, wherein the structural variations include --SEA, -α3.7, -α4.2, --THAI, --FIL, αααanti3.7, αααanti4.2, HKαα, antiHKαα, --MED-I, --MED-II, -α6.3, -α5.6, --11.1, -αMAL3.5, -α3.8, -α2.7, -α2.4, -α2.8, -α1.2, -α0.8, -9.7, Qinzhou type deletion, --BRIT, -α3.5, --SA, -α20.5, --NOR, --CANT, --SPAN, --GEO, 5.3kb deletion, and -α5.2; and As shown in Table 11, there are 1135 point mutations and 2 structural variations at the HBB gene locus, among which the structural variations include 3.5kb deletion and Taiwanese.

14. The kit according to claim 13, wherein the kit can simultaneously detect and distinguish three mutation types: -α3.7, αααanti4.2 and HKαα; and / or can simultaneously detect and distinguish three mutation types: -α4.2, αααanti3.7 and antiHKαα.

15. The kit according to claim 8, wherein the multiplex PCR amplification is performed in a single reaction tube.

16. The kit according to claim 8, wherein the third generation sequencing is selected from PacBio sequencing of Pacific Biosciences or Nanopore sequencing of Oxford Nanopore Technologies (ONT).

17. A method for simultaneously detecting HBA1 / 2 and HBB gene mutations in a subject, The following steps are involved: 1) Prepare subject samples; 2) multiplex PCR to simultaneously amplify HBA1 / 2 and HBB gene fragments in the sample; 3) Construction of third-generation sequencing library; 4) Sequence and analyze the mutation types of HBA1 / 2 and HBB genes.

18. The method according to claim 17, wherein the primer set for multiplex PCR comprises the primer set according to any one of claims 1 to 7.

19. The method according to claim 17, wherein the HBA1 / 2 and HBB gene mutations include at least one or more of the following mutations: As shown in Tables 9 and 10, there are 903 point mutations and 33 structural variations at the HBA1 / 2 gene locus, wherein the structural variations include --SEA, -α3.7, -α4.2, --THAI, --FIL, αααanti3.7, αααanti4.2, HKαα, antiHKαα, --MED-I, --MED-II, -α6.3, -α5.6, --11.1, -αMAL3.5, -α3.8, -α2.7, -α2.4, -α2.8, -α1.2, -α0.8, -9.7, Qinzhou type deletion, --BRIT, -α3.5, --SA, -α20.5, --NOR, --CANT, --SPAN, --GEO, 5.3kb deletion and -α5.2; and As shown in Table 11, there are 1135 point mutations and 2 structural variations at the HBB gene locus, among which the structural variations include 3.5kb deletion and Taiwanese.

20. The method according to claim 17, wherein the method can simultaneously detect and distinguish three mutation types: -α3.7, αααanti4.2 and HKαα; and can simultaneously detect and distinguish three mutation types: -α4.2, αααanti3.7 and antiHKαα.

21. The method according to claim 17, wherein the method is used to detect whether different mutations of HBA1 / 2 and HBB genes are linked.

22. The method according to claim 17, wherein the sample is selected from a biological sample or gDNA extracted from the sample.

23. The method of claim 22, wherein the biological sample is selected from cultured cell lines, blood, amniotic fluid, chorionic villi, gametes, blastocyst cells, joint fluid, urine, sweat, saliva, feces, cerebrospinal fluid, ascites, pleural effusion, bile or pancreatic fluid.

24. The method of claim 17, wherein the multiplex PCR amplification is performed in a single reaction tube.

25. The method according to claim 17, wherein the third generation sequencing is selected from PacBio sequencing of Pacific Biosciences or Nanopore sequencing of Oxford Nanopore Technologies.