Novel acetohydroxy acid synthase variant, and method for producing l-isoleucine using same

Abstract

The present disclosure relates to a novel acetohydroxy acid synthase (AHAS) variant improving L-isoleucine producing ability, a microorganism including the same, and a method of producing L-isoleucine using the microorganism.

Description

Novel acetohydroxy acid synthase variant and method for producing L-isoleucine using the same

[0001] The present application relates to a novel acetohydroxy acid synthase (AHAS) variant having improved L-isoleucine production capacity, a microorganism comprising the same, and a method for producing L-isoleucine using the microorganism.

[0002]

[0003] L-isoleucine is a branched-chain amino acid among the 20 amino acids. Classified as an essential amino acid, it is used in animal feed, food additives, and pharmaceuticals. Because it plays a role in post-metabolism energy production, hemoglobin production, blood sugar regulation, muscle growth, and repair, its use is increasing not only in fluids, nutritional supplements, and sports nutrition, but also in animal feed.

[0004] Based on this trend, various microorganisms and their variants are used for the production of L-amino acids (US Patent No. 1,011,3190). Even in these cases, many by-products other than L-isoleucine are generated, and since these are substances that greatly affect the purity of L-isoleucine during the purification step, a method for removing the by-products is necessary. In this regard, L-isoleucine purification methods developed to increase the purity of L-isoleucine have the disadvantage of requiring a separate additional purification process (US Patent No. 6,072,083), and therefore, there is a need for the development of a method for increasing the purity of L-isoleucine.

[0005]

[0006] The present inventors completed the present application by identifying a mutant of acetohydroxy acid synthase (AHAS), one of the proteins in the L-isoleucine production pathway, and confirming that the mutant improves the L-isoleucine production ability of the strain.

[0007]

[0008] One object of the present application is to provide an acetohydroxy acid synthase (AHAS) variant in which the amino acid corresponding to the 17th position in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0009] Another object of the present application is to provide a polynucleotide encoding a variant of the present application.

[0010] Another object of the present application is to provide a strain of the genus Corynebacterium comprising a variant of the present application; or a polynucleotide encoding the variant.

[0011] Another object of the present application is to provide a method for producing L-isoleucine, comprising the step of culturing a strain of the genus Corynebacterium comprising a variant of the present application; or a polynucleotide encoding the variant; in a medium.

[0012]

[0013] The microorganism expressing the acetohydroxy acid synthase mutant described in this application significantly enhances L-isoleucine production compared to a strain that does not express it, thereby enabling effective production of L-isoleucine. Therefore, L-isoleucine is expected to find wide-ranging industrial applications in foods, feeds, and pharmaceuticals.

[0014]

[0015] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated into this specification in their entirety by reference to more clearly explain the level of the technical field to which this application belongs and the contents of this application.

[0016]

[0017] One aspect of the present application provides an acetohydroxy acid synthase (AHAS) variant, wherein the amino acid corresponding to position 17 in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0018] In one embodiment, the other amino acid may be alanine.

[0019]

[0020] The variant of the present application may include an amino acid sequence in which asparagine, which is an amino acid corresponding to the 17th position based on the amino acid sequence described in SEQ ID NO: 1, which is the parent sequence, is substituted with alanine, and has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.7% and less than 100% homology or identity with the amino acid sequence described in SEQ ID NO: 1. In addition, it is obvious that a variant having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the variant of the present application.

[0021] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the variant of the present application at the N-terminus, C-terminus and / or within the amino acid sequence.

[0022] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0023]

[0024] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Furthermore, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The above term "variant" may be used interchangeably with terms such as variant, modification, variant polypeptide, variant protein, variant and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited thereto if the term is used in the meaning of variant.

[0025] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.

[0026]

[0027] In the present application, the term "parent sequence" refers to a reference sequence into which a modification is introduced to become a mutant polypeptide. That is, the parent sequence may be a starting sequence and may be a target for introducing mutations such as substitutions, insertions, and / or deletions. The parent sequence may be a naturally occurring or wild type, or a variant in which one or more substitutions, insertions, or deletions have occurred in the natural or wild type, or may be an artificially synthesized sequence.

[0028]

[0029] In this application, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.

[0030] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can hybridize, typically over at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its entire length, under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0031] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ET AL / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information database.

[0032] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0033]

[0034] The variant of the present application may have acetohydroxy acid synthase (AHAS) activity. Furthermore, the variant of the present application may have an activity that increases L-isoleucine production compared to a wild-type polypeptide having acetohydroxy acid synthase activity.

[0035] In this application, the term "acetohydroxy acid synthase (AHAS)" refers to the first enzyme in L-valine biosynthesis, also called acetolactate synthase. Acetohydroxy acid synthase can catalyze the decarboxylation of pyruvate and the condensation reaction with another pyruvate molecule to produce acetolactate, a precursor of valine, or catalyze the decarboxylation of pyruvate and the condensation reaction with 2-ketobutyrate to produce acetohydroxybutyrate, a precursor of isoleucine.

[0036] The above acetohydroxy acid synthase is encoded by two genes, ilvB and ilvN, wherein the ilvB gene encodes the large subunit of acetohydroxy acid synthase, and the ilvN gene encodes the small subunit of acetohydroxy acid synthase, respectively. Among these, the small subunit encoded by the ilvN gene is thought to be significantly involved in feedback inhibition. The above "feedback inhibition" means that the end product of an enzyme system inhibits a reaction at an early stage of the enzyme system. For the purposes of the present application, the acetohydroxy acid synthase may be the acetohydroxy acid synthase encoded by the ilvN gene.

[0037] The acetohydroxy acid synthase encoded by the above ilvN gene can obtain its sequence from the NCBI's GenBank, a known database, and may specifically have the amino acid sequence of sequence number 1, but is not limited thereto.

[0038]

[0039] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0040] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0041] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0042]

[0043] The variant of the present application may additionally include at least one substitution selected from the following: a substitution of the amino acid corresponding to position 42 with another amino acid based on the amino acid sequence described in SEQ ID NO: 1; a substitution of the amino acid corresponding to position 47 with another amino acid; or a combination thereof.

[0044] In one embodiment, the amino acid corresponding to the 42nd position may be substituted with valine.

[0045] In another embodiment, the amino acid corresponding to the 47th position may be substituted with leucine.

[0046]

[0047] Specifically, the variant of the present application may have, comprise, consist of, or consist essentially of an amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6.

[0048] Specifically, based on the amino acid sequence described in SEQ ID NO: 1, SEQ ID NO: 3 may be an amino acid sequence in which asparagine, an amino acid corresponding to the 17th position, is substituted with alanine, SEQ ID NO: 4 may be an amino acid sequence in which asparagine, an amino acid corresponding to the 17th position, is substituted with alanine, and an amino acid corresponding to the 42nd position is substituted with valine, SEQ ID NO: 5 may be an amino acid sequence in which asparagine, an amino acid corresponding to the 17th position, is substituted with alanine, and an amino acid corresponding to the 47th position is substituted with leucine, and SEQ ID NO: 6 may be an amino acid sequence in which asparagine, an amino acid corresponding to the 17th position, is substituted with alanine, an amino acid corresponding to the 42nd position is substituted with valine, and an amino acid corresponding to the 47th position is substituted with leucine.

[0049]

[0050] Another aspect of the present application provides a polynucleotide encoding a variant of the present application.

[0051] In this application, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.

[0052] A polynucleotide encoding a variant of the present application may include a base sequence encoding an amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6. As an example of the present application, the polynucleotide of the present application may have or include a sequence of SEQ ID NO: 23 or SEQ ID NO: 24 or SEQ ID NO: 25 or SEQ ID NO: 26. In addition, the polynucleotide of the present application may consist of, or consist essentially of, a sequence of SEQ ID NO: 23 or SEQ ID NO: 24 or SEQ ID NO: 25 or SEQ ID NO: 26.

[0053] The polynucleotide of the present application may have various modifications made to the coding region within a range that does not change the amino acid sequence of the variant of the present application, taking into account the degeneracy of the codon or the codon preferred in the organism that is intended to express the variant of the present application. Specifically, the polynucleotide of the present application has or includes a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, or at least 98% and less than 100% homology or identity with the sequence of SEQ ID NO: 2, or may consist of or consist essentially of a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, or at least 98% and less than 100% homology or identity with the sequence of SEQ ID NO: 2, but is not limited thereto. At this time, in the sequence having the above homology or identity, the codon encoding the amino acid corresponding to the 17th position of sequence number 1 may be one of the codons encoding alanine, the codon encoding the amino acid corresponding to the 42nd position may be one of the codons encoding valine, and the codon encoding the amino acid corresponding to the 47th position may be one of the codons encoding lysine.

[0054] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or conditions in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1XSSC, 0.1% SDS, specifically 60°C, 0.1XSSC, 0.1% SDS, and more specifically 68°C, 0.1XSSC, 0.1% SDS, which are washing conditions of typical southern hybridization, are performed.

[0055] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0056] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0057] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0058]

[0059] Another aspect of the present application provides a vector comprising the polynucleotide of the present application. The vector may be, but is not limited to, an expression vector for expressing the polynucleotide in a host cell.

[0060] The vector of the present application may comprise a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may comprise a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. The vector may be capable of replicating or functioning independently of the host genome after being transformed into a suitable host cell, or may be integrated into the genome itself.

[0061] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.

[0062] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0063] The term "transformation" in this application refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0064] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target variant of the present application.

[0065]

[0066] Another aspect of the present application provides a strain of the genus Corynebacterium comprising a variant of the present application or a polynucleotide of the present application.

[0067] The strain of the present application may comprise a variant polypeptide of the present application, a polynucleotide encoding the polypeptide, or a vector comprising the polynucleotide of the present application.

[0068] In this application, the term "strain (or microorganism)" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product, as a microorganism whose specific mechanism has been weakened or strengthened due to causes such as the insertion of an external gene or the enhancement or inactivation of the activity of an endogenous gene.

[0069] The strain of the present application may be, but is not limited to, a strain comprising at least one of the variant of the present application, the polynucleotide of the present application, and a vector comprising the polynucleotide of the present application; a strain modified to express the variant of the present application or the polynucleotide of the present application; a strain (e.g., a recombinant strain) expressing the variant of the present application or the polynucleotide of the present application; or a strain (e.g., a recombinant strain) having the activity of the variant of the present application.

[0070] The strain of the present application may be a strain having L-isoleucine production ability.

[0071] The strain of the present application may be a microorganism that naturally has acetohydroxy acid synthase or L-isoleucine production ability, or a parent strain that does not have acetohydroxy acid synthase or L-isoleucine production ability, into which the variant of the present application or a polynucleotide encoding the same (or a vector including the polynucleotide) is introduced and / or the L-isoleucine production ability is conferred, but is not limited thereto.

[0072] For example, the strain of the present application is a cell or microorganism that is transformed with a vector containing a polynucleotide encoding the polynucleotide of the present application or a variant of the present application, and expresses the variant of the present application. For the purpose of the present application, the strain of the present application may include all microorganisms capable of producing L-isoleucine, including the variant of the present application. For example, the strain of the present application may be a recombinant strain in which a polynucleotide encoding the variant of the present application is introduced into a natural wild-type microorganism or a microorganism that produces L-isoleucine, thereby expressing an acetohydroxy acid synthase variant, thereby increasing the L-isoleucine production ability. The recombinant strain with increased L-isoleucine production ability may be a microorganism with increased L-isoleucine production ability compared to a natural wild-type microorganism or a non-modified acetohydroxy acid synthase microorganism (i.e., a microorganism expressing wild-type acetohydroxy acid synthase (SEQ ID NO: 1) or a microorganism that does not express a mutant (SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6) protein), but is not limited thereto. For example, the target strain for comparing the increase in L-isoleucine production ability, the acetohydroxy acid synthase non-modified microorganism, may be, but is not limited to, Corynebacterium glutamicum ATCC13032 strain (CA10-3101, KCCM12739P) that has introduced hom (R407H) and ilvA (T381A, F383A) mutations, or KCJI-38 strain (KCCM11248P, Republic of Korea Patent No. 10-1335789), which is an L-isoleucine-producing strain treated with NTG (N-Methyl-N'-nitro-N-nitrosoguanidine).

[0073] For example, the recombinant strain with increased productivity has an L-isoleucine productivity of about 1% or more, specifically, about 2% or more, about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 30% or more, about 32% or more, about 34% or more, about 35% or more, about 39% or more, about 40% or more, about 45% or more, about 46% or more, about 47% or more, about 50% or more, about 53% or more, about 54% or more, about 55% or more, about 57% or more, about 59% or more, about 60% or more, about 62% or more, about 63% or more, about 64% or more, or about 73% or more (the upper limit is not particularly limited, for example, about 200% or less, about It may be increased by 150% or less, about 100% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 15% or less), but is not limited thereto, as long as it has a positive increase compared to the productivity of the parent strain or unmodified microorganism before the mutation. In another example, the recombinant strain with increased productivity has an L-isoleucine productivity of about 1.01 times or more, about 1.02 times or more, about 1.05 times or more, about 1.10 times or more, about 1.15 times or more, about 1.20 times or more, about 1.25 times or more, about 1.30 times or more, about 1.32 times or more, about 1.34 times or more, about 1.35 times or more, about 1.39 times or more, about 1.40 times or more, about 1.45 times or more, about 1.46 times or more, about 1.47 times or more, about 1.50 times or more, about 1.53 times or more, about 1.54 times or more, about 1.55 times or more, about 1.57 times or more, about 1.59 times or more, or about 1.60 times, compared to the parent strain before mutation or the unmodified microorganism. Ideally, about 1.62 times or more, about 1.63 times or more, about 1.64 times or more, or about 1.It may be increased by 73 times or more (the upper limit is not particularly limited, for example, it may be about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less), but is not limited thereto.

[0074] In this application, the term "unmodified microorganism" does not exclude a strain that contains a mutation that can occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. For example, the unmodified microorganism may refer to a strain that has not been introduced or before the acetohydroxy acid synthase variant described herein is introduced. The "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism."

[0075] In another example of the present application, the microorganism of the present application is Corynebacterium stationis, Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium It may be Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens, and specifically, but not limited to, Corynebacterium glutamicum.

[0076]

[0077] In this application, the term "enhancement" of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The "intrinsic activity" refers to the activity of a specific polypeptide that was originally present in a parent strain or unmodified microorganism before the trait change, when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "pre-modification activity." "Enhanced," "upregulated," "overexpressed," or "increased" the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0078] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0079] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0080] Specifically, the enhancement of the polypeptide of the present application is

[0081] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0082] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;

[0083] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0084] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0085] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0086] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0087] 7) Codon optimization of a polynucleotide encoding a polypeptide;

[0088] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or

[0089] 9) It may be a combination of two or more of the above 1) to 8), but is not particularly limited thereto.

[0090] More specifically,

[0091] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0092] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0093] Examples of known strong promoters include, but are not limited to, the cj1 to cj7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0094] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0095] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not the chromosome has been inserted. The selection marker is as described above.

[0096] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0097] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0098] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0099] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0100]

[0101] In the microorganism of the present application, modification of part or all of the polynucleotide may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosome insertion into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.

[0102]

[0103] In the microorganism of the present application, the mutant, polynucleotide, L-isoleucine, etc. are as described in the other aspects above.

[0104]

[0105] Another aspect of the present application provides a method for producing L-isoleucine, comprising the step of culturing a strain of the genus Corynebacterium comprising a variant of the present application or a polynucleotide of the present application in a medium.

[0106] The method for producing L-isoleucine of the present application may include a step of culturing a Corynebacterium spp. strain comprising a variant of the present application, a polynucleotide of the present application, or a vector of the present application in a medium.

[0107] In this application, the term "cultivation" refers to growing the Corynebacterium strain of this application under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. Such culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0108] In this application, the term "medium" means a material containing nutrients as a main component necessary for culturing the Corynebacterium strain of this application, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the Corynebacterium strain of this application may be any medium used for culturing general microorganisms without particular limitation, but the Corynebacterium strain of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0109] Specifically, culture media for strains of the genus Corynebacterium can be found in the "Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981).

[0110] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0111] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0112] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0113] In addition, during the cultivation of the Corynebacterium spp. strain of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0114] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0115] L-isoleucine produced by the culture of the present invention may be secreted into the medium or remain within the cells.

[0116]

[0117] The method for producing L-isoleucine of the present application may additionally include a step of preparing a Corynebacterium spp. strain of the present application, a step of preparing a medium for culturing the strain, or a combination thereof (regardless of order), for example, before the culturing step.

[0118] The method for producing L-isoleucine of the present application may further include a step of recovering L-isoleucine from a culture medium (a medium in which culture is performed) or a Corynebacterium spp. strain according to the above-described cultivation. The recovering step may be additionally included after the above-described culturing step.

[0119] The above recovery may be performed by collecting the target L-isoleucine using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target L-isoleucine may be recovered from the medium or microorganism using a suitable method known in the art.

[0120] Additionally, the L-isoleucine production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the L-isoleucine production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0121] In the method of the present application, the variant, polynucleotide, vector, strain, etc. are as described in the other aspects above.

[0122]

[0123] Another aspect of the present application provides a composition for producing L-isoleucine, comprising a variant of the present application, a polynucleotide encoding the variant, a vector comprising the polynucleotide, or a Corynebacterium strain comprising the polynucleotide of the present application; a medium for culturing the same; or a combination of two or more thereof.

[0124] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing amino acids, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0125] In the composition of the present application, the variant, polynucleotide, vector, strain, medium, and L-isoleucine, etc. are as described in the other embodiments above.

[0126]

[0127] Another aspect of the present application provides a use of a variant of the present application; a polynucleotide encoding the variant; or a strain of the genus Corynebacterium comprising the variant or a polynucleotide encoding the variant for producing L-isoleucine.

[0128]

[0129] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0130]

[0131] Example 1: Production of L-isoleucine producing strain

[0132] Wild-type Corynebacterium glutamicum has the ability to produce L-isoleucine, but does not produce excessive amounts. Therefore, to identify genetic traits that increase L-isoleucine production, a strain with increased L-isoleucine production compared to the wild-type was created.

[0133] First, in order to eliminate feedback inhibition of threonine, a precursor of isoleucine, in the L-isoleucine biosynthetic pathway of wild-type Corynebacterium glutamicum ATCC13032, the gene hom encoding homoserine dehydrogenase was mutated to substitute arginine, the 407th amino acid of homoserine dehydrogenase, with histidine (Korean Patent No. 10-1996769).

[0134] Specifically, to construct a vector for introducing the hom(R407H) mutation into the chromosome, PCR was performed using the chromosome of wild-type Corynebacterium glutamicum ATCC13032 as a template and the primer pairs of SEQ ID NO: 14 and SEQ ID NO: 15 or the primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, respectively. The primer sequences are as shown in Table 1 below.

[0135]

[0136] Sequence number name sequence 14primer 1TCGAGCTCGGTACCCCGCTTTTGCACTCATCGAGC15primer 2CACGATCAGATGTGCATCATCAT16primer 3ATGATGATGCACATCTGATCGTG17primer 4CTCTAGAGGATCCCCGAGCATCTTCCAAAACCTTG

[0137]

[0138] PfuUltra is used as a polymerase for PCR reaction. TM High-fidelity DNA polymerase (Stratagene) was used, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. Denaturation, annealing, and polymerization under these conditions were repeated 28 times to obtain a 1000 bp DNA fragment at the 5' upper region and a 1000 bp DNA fragment at the 3' lower region, respectively, centered on the mutation of the hom gene.

[0139] Using the two amplified DNA fragments as templates, PCR was performed using the primer pairs of SEQ ID NO: 14 and SEQ ID NO: 17. The PCR conditions included denaturation at 95°C for 5 minutes, followed by 28 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.

[0140] As a result, a 2 kb DNA fragment (SEQ ID NO: 13) containing a mutation in the hom gene encoding a homoserine dehydrogenase mutant in which the 407th arginine is substituted with histidine was amplified. The amplified product was purified using a PCR purification kit (PCR Purification kit, QUIAGEN) and used as an insert DNA fragment for vector construction.

[0141] The purified amplification product was treated with the restriction enzyme smaI, and then heat-treated at 65°C for 20 minutes. The molar concentration (M) ratio of the pDCM2 vector (Korean Patent Publication No. 10-2020-0136813) and the amplification product, the inserted DNA fragment, was set to 1:2, and the vector pDCM2-R407H was constructed to introduce the hom (R407H) mutation into the chromosome by cloning according to the provided manual using the Infusion Cloning Kit (TaKaRa).

[0142]

[0143] The constructed vector was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a strain containing the hom(R407H) mutation on the chromosome was obtained through a second crossover process, and this was named Corynebacterium glutamicum ATCC13032 hom(R407H).

[0144]

[0145] In order to increase the feedback release and activity for L-isoleucine in the ATCC13032 hom (R407H) strain produced, ilvA, a gene encoding L-threonine dehydratase, was mutated so that threonine, the 381st amino acid of L-threonine dehydratase, was substituted with alanine, and phenylalanine, the 383rd amino acid, was substituted with alanine.

[0146] Specifically, in order to produce a vector for introducing the above ilvA (T381A, F383A) mutation onto the chromosome, PCR was performed using the chromosome of wild-type Corynebacterium glutamicum ATCC13032 as a template, using the primer pair of SEQ ID NO: 19 and SEQ ID NO: 20 or the primer pair of SEQ ID NO: 21 and SEQ ID NO: 22. The primer sequences are as shown in Table 2 below.

[0147]

[0148] Sequence number name sequence 19primer 5TCGAGCTCGGTACCCATGAGTGAAACATACGTGTC20primer 6GCGCTTGAGGTACTCtgcCAGCGcGATGTCATCATCCGG21primer 7CCGGATGATGACATCgCGCTGgcaGAGTACCTCAAGCGC22primer 8CTCTAGAGGATCCCCCGTCACCGACACCTCCACA

[0149]

[0150] PfuUltra is used as a polymerase for PCR reaction. TM High-fidelity DNA polymerase (Stratagene) was used, and the PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. Denaturation, annealing, and polymerization under these conditions were repeated 28 times to obtain a 1126 bp DNA fragment at the 5' upper region and a 286 bp DNA fragment at the 3' lower region, respectively, centered on the mutation in the ilvA gene.

[0151] Using the two amplified DNA fragments as templates, PCR was performed using the primer pairs of SEQ ID NO: 19 and SEQ ID NO: 22. The PCR conditions were denaturation at 95°C for 5 minutes, followed by 28 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.

[0152] As a result, a 1.4 kb DNA fragment (SEQ ID NO: 18) containing a mutation of the ilvA gene encoding an L-threonine dehydratase mutant in which the 381st threonine was substituted with alanine and the 383rd phenylalanine was substituted with alanine was amplified. The amplified product was purified using a PCR purification kit and used as an insert DNA fragment for vector construction. After treating the purified amplified product with the restriction enzyme smaI, the molar (M) ratio of pDCM2, which was heat-treated at 65°C for 20 minutes, and the amplified product, the insert DNA fragment, was made 1:2, and the vector pDCM2-ilvA (T381A, F383A) was constructed to introduce the ilvA (T381A, F383A) mutation into the chromosome using the Infusion Cloning Kit from TaKaRa according to the provided manual.

[0153]

[0154] The constructed vector was transformed into Corynebacterium glutamicum ATCC13032 hom (R407H) by electroporation, and a strain containing the ilvA (T381A, F383A) mutation on the chromosome was obtained through a second crossover process, and this was named Corynebacterium glutamicum CA10-3101.

[0155] The above strain CA10-3101 was deposited internationally with the Korea Center for Microbiological Cultures (KCCM), an international depository under the Budapest Treaty, on May 27, 2020 and assigned the accession number KCCM12739P.

[0156]

[0157] Next, in order to confirm whether introducing the above ilvA (T381A, F383A) mutation into an L-isoleucine producing strain actually increases L-isoleucine production by increasing feedback release and activity for L-isoleucine, the following experiment was performed.

[0158] Specifically, the ilvA (T381A, F383A) mutation was introduced into the KCJI-38 strain (KCCM11248P, Republic of Korea Patent No. 10-1335789), an L-isoleucine producing strain treated with NTG (N-Methyl-N'-nitro-N-nitrosoguanidine), by an electric pulse method to produce the KCCM11248P / pECCG117-ilvA (T381A, F383A) strain. Then, the fermentation activity was evaluated using the following method.

[0159] After inoculating the parent strain and the mutant strain into a 250 ml corner-bottom flask containing 25 ml of isoleucine production medium, L-isoleucine was produced by shaking and culturing at 200 rpm for 60 hours at 32°C. The composition of the production medium is as follows.

[0160]

[0161] <Production medium>

[0162] Glucose 10%, yeast extract 0.2%, ammonium sulfate 1.6%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.1%, iron sulfate heptahydrate 10 mg / ℓ, manganese sulfate monohydrate 10 mg / ℓ, biotin 200 μg / ℓ, pH 7.2

[0163]

[0164] After the culture was completed, the concentrations of L-isoleucine and L-threonine in the culture solution for each strain tested were measured using high-performance liquid chromatography (HPLC), and the results are shown in Table 3 below.

[0165]

[0166] Strain name L-isoleucine (g / L) L-threonine (g / L) KCCM11248P (parent strain) 1.5 0.5 KCCM11248P / pECCG117-ilvA (T381A, F383A) 4.0 0.0

[0167]

[0168] As shown in Table 3 above, the KCCM11248P / pECCG117-ilvA(T381A, F383A) strain, which introduced the ilvA(T381A, F383A) mutation, showed a significantly increased L-isoleucine production ability and a higher L-threonine degradation rate compared to the parent strain KCCM11248P. Accordingly, it was confirmed that when the ilvA(T381A, F383A) mutation was introduced into the strain, the feedback release and activity for L-isoleucine were increased.

[0169]

[0170] Example 2: Construction of a mutant ilvN library vector

[0171] A mutant library of the ilvN gene, encoding the small subunit of acetohydroxy acid synthase (AHAS), was constructed. The library was constructed using an error-prone PCR kit (clontech Diversify® PCR Random Mutagenesis Kit), and PCR reactions were performed using the chromosome of wild-type Corynebacterium glutamicum ATCC13032 as a template and the primer pairs of SEQ ID NO: 7 and SEQ ID NO: 8. The primer sequences are shown in Table 4 below.

[0172]

[0173] Sequence number name sequence 7 primer 9 CGAGCTCGGTACCCATGGCTAATTCTGACG 8 primer 10 TAGAGGATCCCCTTAGATCTTGGCCGGAGC

[0174]

[0175] Specifically, under the condition that 0 to 3 mutations occur per 1000 bl, the process of 30 seconds at 94°C, 30 seconds at 94°C, and 1 minute 30 seconds at 68°C was repeated 25 times. At this time, the obtained product was treated with DpnI and transformed into E. coli DH5α, and plated on LB solid medium containing kanamycin (25 mg / L). After selecting 20 transformed colonies, the plasmid was obtained and the polynucleotide sequence was analyzed, and it was confirmed that mutations were introduced at different positions at a frequency of 2 mutations / kb. Approximately 20,000 transformed E. coli colonies were taken, the plasmid was extracted, and it was named pTOPO-ilvN-library.

[0176]

[0177] Example 3: Construction of an L-isoleucine-producing strain with the ilvN library introduced.

[0178] The pTOPO-ilvN-library produced in the above Example 2 was transformed into CA10-3101 (KCCM12739P), an L-isoleucine producing strain produced in the above Example 1, by electroporation, and then spread on a nutrient medium containing 25 mg / L of kanamycin to obtain 5,000 colonies of strains with inserted mutant genes, and each colony was named CA10-3101 / pTOPO-ilvNm1 to CA10-3101 / pTOPO-ilvNm5000.

[0179] To identify colonies with increased L-isoleucine production among the 5,000 colonies secured, fermentation activity was evaluated for each colony using the following method. Specifically, the parent strain and the mutant strain were inoculated into a 250 ml corner-bottom flask containing 25 ml of isoleucine production medium, and then cultured with shaking at 200 rpm at 32°C for 60 hours to produce L-isoleucine. The composition of the production medium is as follows.

[0180]

[0181] <Production medium>

[0182] Glucose 10%, yeast extract 0.2%, ammonium sulfate 1.6%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.1%, iron sulfate heptahydrate 10 mg / ℓ, manganese sulfate monohydrate 10 mg / ℓ, biotin 200 μg / ℓ, pH 7.2

[0183]

[0184] After the culture was completed, the concentration of L-isoleucine in the culture solution for each strain tested was measured using high-performance liquid chromatography (HPLC), and the results are shown in Table 5 below.

[0185]

[0186] Strain name L-isoleucine concentration (g / L) L-isoleucine concentration increase rate (%) CA10-3101 (parent strain) 2.32-CA10-3101 / pTOPO-ilvNm29913.2339

[0187]

[0188] As shown in Table 5 above, the mutant strain CA10-3101 / pTOPO-ilvNm2991 was confirmed to have increased L-isoleucine production ability compared to the parent strain Corynebacterium glutamicum CA10-3101 having ilvNWT. Sequencing of the mutant strain was performed and compared with the ilvN gene of the wild-type Corynebacterium glutamicum ATCC13032. As a result, it was confirmed that the mutant strain contains a mutation in which the 17th asparagine in the amino acid sequence of ilvN is substituted with alanine (D17A).

[0189] Based on the above results, it was confirmed that the ilvN (D17A) mutant strain can produce L-isoleucine at a higher yield than the parent strain, and its L-isoleucine concentration increase rate was confirmed to be approximately 39% compared to the parent strain.

[0190]

[0191] Example 4: Production of L-isoleucine-producing strain with introduced mutant ilvN

[0192] The ilvN (D17A) mutation confirmed in Example 3 was introduced into the Corynebacterium glutamicum CA10-3101 strain produced in Example 1.

[0193] Specifically, to produce a vector for introducing the mutant ilvN gene (D17A) onto the chromosome, PCR was performed using the chromosome of CA10-3101 / pTOPO-ilvNm2991 (D17A) as a template and the primer pairs of SEQ ID NO: 7 and SEQ ID NO: 8. PfuUltra was used as the polymerase for the PCR reaction. TM High-fidelity DNA polymerase (Stratagene) was used, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. These denaturation, annealing, and polymerization reactions were repeated 28 times, yielding three 545-bp DNA fragments, each containing the mutant ilvN gene (D17A). The amplified products were purified using a PCR purification kit from QUIAGEN and used as insert DNA fragments for vector construction. The purified amplification product was treated with the restriction enzyme SmaI, and then heat-treated at 65°C for 20 minutes. The molar concentration (M) ratio of the pDCM2 vector and the inserted DNA fragment amplified through the PCR was 1:2. By cloning according to the provided manual using the Infusion Cloning Kit from TaKaRa, the vector pDCM2-ilvN (D17A) was constructed to introduce the mutant ilvN gene of Corynebacterium glutamicum onto the chromosome.

[0194]

[0195] The vector constructed above was transformed into Corynebacterium glutamicum CA10-3101 by electroporation, and a strain with a mutant ilvN substitution on the chromosome was obtained through a second crossover process, and CA10-3101::ilvN(D17A) was named CA10-3128.

[0196]

[0197] In order to confirm the effect of increasing L-isoleucine production capacity for the parent strain (CA10-3101) and the mutant strain CA10-3128 produced in this example, the fermentation activity of each strain was evaluated using the following method.

[0198] After inoculating the parent strain and the mutant strain into a 250 ml corner-bottom flask containing 25 ml of isoleucine production medium, L-isoleucine was produced by shaking and culturing at 200 rpm for 60 hours at 32°C. The composition of the production medium is shown below.

[0199]

[0200] <Production medium>

[0201] Glucose 10%, yeast extract 0.2%, ammonium sulfate 1.6%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.1%, iron sulfate heptahydrate 10 mg / ℓ, manganese sulfate monohydrate 10 mg / ℓ, biotin 200 μg / ℓ, pH 7.2

[0202]

[0203] After the culture was completed, the concentration of L-isoleucine in the culture solution for each strain tested was measured using high-performance liquid chromatography (HPLC), and the results are shown in Table 6 below.

[0204]

[0205] Strain name L-isoleucine concentration (g / L) L-isoleucine concentration increase rate (%) CA10-31012.12-CA10-3128 (D17A introduced strain) 3.2553

[0206]

[0207] As shown in Table 6 above, it was confirmed that the concentration of L-isoleucine increased in the CA10-3128 strain into which ilvN(D17A) was introduced compared to the parent strain (CA10-3101), which is an L-isoleucine producing strain with ilvNWT, and the increase rate of L-isoleucine concentration in the strain into which ilvN(D17A) was introduced was confirmed to be approximately 53% compared to the parent strain.

[0208]

[0209] Example 5: Construction of a combinatorial mutant ilvN plasmid

[0210] In order to introduce the combination mutation including the ilvN mutation identified in Example 3 above into the L-isoleucine strain, a vector was constructed to introduce the combination mutation ilvN onto the chromosome.

[0211] Specifically, PCR was performed using the primer pair of SEQ ID NO: 7 and SEQ ID NO: 9 or the primer pair of SEQ ID NO: 10 and SEQ ID NO: 8 using pDCM2-ilvN (D17A) as a template, and PCR was performed using the primer pair of SEQ ID NO: 7 and SEQ ID NO: 11 or the primer pair of SEQ ID NO: 12 and SEQ ID NO: 8 using pDCM2-ilvN (H47L) as a template. The primer sequences are as shown in Table 7 below.

[0212]

[0213] Sequence number name sequence 9primer 11TTCGGTCTTAACAGACACGAGGGACACGAG10primer 12GTGTCCCTCGTGTCTGTTAAGACCGAAACA11primer 13CGGTTGATGCCgagTGTTTCGGTCTTTGCA12primer 14AAGACCGAAACActcGGCATCAACCGCATC

[0214]

[0215] PfuUltra is used as a polymerase for PCR reaction. TMHigh-fidelity DNA polymerase (Stratagene) was used, and the PCR conditions were as follows: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. These denaturation, annealing, and polymerization reactions were repeated 28 times to obtain 149 bp and 423 bp DNA fragments and 166 bp and 405 bp DNA fragments, respectively. The amplified products were purified using a PCR purification kit from QUIAGEN and used as insert DNA fragments for vector construction. The purified amplification product was treated with the restriction enzyme smaI, and then heat-treated at 65°C for 20 minutes. The molar concentration (M) ratio of pDCM2 and the amplification product, the inserted DNA fragment, was set to 1:2. By cloning according to the provided manual using the Infusion Cloning Kit from TaKaRa, vectors pDCM2-ilvN (D17A, A42V) and pDCM2-ilvN (D17A, H47L) were constructed to introduce the mutant ilvN into the chromosome.

[0216] Additionally, PCR was performed using pDCM2-ilvN (D17A, H47L) as a template and primer pairs of SEQ ID NO: 7 and SEQ ID NO: 9, and primer pairs of SEQ ID NO: 10 and SEQ ID NO: 8, to obtain 149 bp and 423 bp DNA fragments. The amplified products were purified using a PCR purification kit from QUIAGEN and used as insert DNA fragments for vector construction. The purified amplification product was treated with the restriction enzyme smaI, and then heat-treated at 65°C for 20 minutes. The molar concentration (M) ratio of the pDCM2 vector and the inserted DNA fragment amplified through the PCR was 1:2. The vector pDCM2-ilvN (D17A, A42V, H47L) was constructed to introduce the mutant ilvN of Corynebacterium glutamicum into the chromosome using the TaKaRa Infusion Cloning Kit according to the provided manual.

[0217]

[0218] Example 6: Production of L-isoleucine-producing strain with introduced combinatorial mutant ilvN

[0219] The vector produced in Example 5 was transformed into the Corynebacterium glutamicum CA10-3101 strain produced in Example 1 by electroporation, and a strain with a combined mutant ilvN substituted on the chromosome was obtained through a second crossing process. CA10-3101::ilvN(D17A, A42V) was designated CA10-3131, CA10-3101::ilvN(D17A, H47L) was designated CA10-3133, and CA10-3101::ilvN(D17A, A42V, H47L) was designated CA10-3134.

[0220] To confirm the effect of increasing L-isoleucine productivity of the three strains produced, fermentation activity was evaluated using the following method.

[0221] After inoculating the parent strain and the mutant strain into a 250 ml corner-bottom flask containing 25 ml of isoleucine production medium, L-isoleucine was produced by shaking and culturing at 200 rpm for 60 hours at 32°C. The composition of the production medium is as follows.

[0222]

[0223] <Production medium>

[0224] Glucose 10%, yeast extract 0.2%, ammonium sulfate 1.6%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.1%, iron sulfate heptahydrate 10 mg / ℓ, manganese sulfate monohydrate 10 mg / ℓ, biotin 200 μg / ℓ, pH 7.2

[0225]

[0226] After the culture was completed, the concentration of L-isoleucine in the culture medium for each strain tested was measured, and the results are shown in Table 8 below.

[0227]

[0228] Strain name L-isoleucine concentration (g / L) L-isoleucine concentration increase rate (%) CA10-3101 (parent strain) 2.03 CA10-3128 (D17A) 3.2259 CA10-3131 (D17A, A42V) 3.5173 CA10-3133 (D17A, H47L) 3.3364 CA10-3134 (D17A, A42V, H47L) 3.1857

[0229]

[0230] As shown in Table 8 above, it was confirmed that the L-isoleucine concentration increased in the mutant strains in which the ilvN single mutation (ilvN(D17A)) or the ilvN combination mutation (ilvN(D17A, A42V), ilvN(D17A, H47L), ilvN(D17A, A42V, H47L)) was introduced compared to the parent strain (CA10-3101), which is an L-isoleucine producing strain having ilvNWT.

[0231] From the above results, it was confirmed that ilvN mutation alone or in combination can increase the L-isoleucine production ability of the strain.

[0232]

[0233] Example 7: Production of a mutant ilvN substitution strain in the L-isoleucine-producing strain Corynebacterium glutamicum KCCM11248P strain.

[0234] In Example 6, one ilvN single mutant and three combined mutants confirmed to be effective in increasing L-isoleucine production were introduced into the L-isoleucine-producing strain KCJI-38 (KCCM11248P, Republic of Korea Patent No. 10-1335789) treated with NTG (N-Methyl-N'-nitro-N-nitrosoguanidine) by electric pulse method, and then transformed by spreading on a selection medium containing 25 mg / L of kanamycin, and through a second crossing process, mutant ilvN with a substitution on the chromosome and combined mutant ilvN substitution strains were obtained. Then, fermentation activity was evaluated using the following method.

[0235] After inoculating the parent strain and the mutant strain into a 250 ml corner-bottom flask containing 25 ml of isoleucine production medium, L-isoleucine was produced by shaking and culturing at 200 rpm for 60 hours at 32°C. The composition of the production medium is as follows.

[0236]

[0237] <Production medium>

[0238] Glucose 10%, yeast extract 0.2%, ammonium sulfate 1.6%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.1%, iron sulfate heptahydrate 10 mg / ℓ, manganese sulfate monohydrate 10 mg / ℓ, biotin 200 μg / ℓ, pH 7.2

[0239]

[0240] After the culture was completed, the concentration of L-isoleucine in the culture solution for each strain tested was measured using high-performance liquid chromatography (HPLC), and the results are shown in Table 9 below.

[0241]

[0242] Strain name L-isoleucine concentration (g / L) Increase rate of L-isoleucine concentration (%) KCCM11248P (parent strain) 1.3-KCCM11248P△ilvN::ilvN (D17A) 2.162 KCCM11248P△ilvN::ilvN (D17A, A42V) 2.054 KCCM11248P△ilvN::ilvN (D17A, H47L) 1.946 KCCM11248P△ilvN::ilvN (D17A, A42V, H47L) 1.838

[0243]

[0244] As shown in Table 9 above, it was confirmed that the concentration of L-isoleucine increased in the mutant strains in which the ilvN single mutation (ilvN(D17A)) or the ilvN combination mutation (ilvN(D17A, A42V), ilvN(D17A, H47L), ilvN(D17A, A42V, H47L)) was introduced compared to the parent strain (KCCM11248P), which is an L-isoleucine producing strain having ilvNWT. In particular, the KCCM11248P△ilvN::ilvN(D17A) strain showed a higher increase rate in L-isoleucine concentration compared to the parent strain, and it was confirmed that the KCCM11248P△ilvN::ilvN(D17A, A42V), KCCM11248P△ilvN::ilvN(D17A, H47L), and KCCM11248P△ilvN::ilvN(D17A, A42V, H47L) strains all showed increased L-isoleucine production compared to the parent strain.

[0245]

[0246] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

[0247]

[0248]

[0249] [Sequence 1] ilvN

[0250] ​MANSDVTRHILSVLVQDVDGIISRVSGMFTRRAFNLVSLVSAKTETHGINRITVVVDADELNIEQITKQLNKLIPVLKVVRLDEETTIARAIMLVKVSADSTNRPQIVDAANIFRARVVDVAPDSVVIESTGTPGKLRALLDVMEPFGIRELIQSGQIALNRGPKTMAPAKI

[0251]

[0252] [서열 2] ilvN

[0253] ATGGCTAATTCTGACGTCACCCGCCACATCCTGTCCGTACTCGTTCAGGACGTAGACGGAATCATTTCCCGCGTATCAGGTATGTTCACCCGACGCGCATTCAACCTCGTGTCCCTCGTGTCTGCAAAGACCGAAACACACGGCATCAACCGCATCACGGTTGTTGTCGACGCCGACGAGCTCAACATTGAGCAGATCACCAAGCAGCTCAACAAGCTGATCCCCGTGCTCAAAGTCGTGCGACTTGATGAAGAGACCACTATCGCCCGCGCAATCATGCTGGTTAAGGTCTCTGCGGACAGCACCAACCGTCCGCAGATCGTCGACGCCGCGAACATCTTCCGCGCCCGAGTCGTCGACGTGGCTCCAGACTCTGTGGTTATTGAATCCACAGGCACCCCAGGCAAGCTCCGCGCACTGCTTGACGTGATGGAACCATTCGGAATCCGCGAACTGATCCAATCCGGACAGATTGCACTCAACCGCGGTCCGAAGACCATGGCTCCGGCCAAGATCTAA

[0254]

[0255] [서열 3] ilvN(D17A)

[0256] MANSDVTRHILSVLVQAVDGIISRVSGMFTRRAFNLVSLVSAKTETHGINRITVVVDADELNIEQITKQLNKLIPVLKVVRLDEETTIARAIMLVKVSADSTNRPQIVDAANIFRARVVDVAPDSVVIESTGTPGKLRALLDVMEPFGIRELIQSGQIALNRGPKTMAPAKI

[0257]

[0258] [서열 4] ilvN(D17A, A42V)

[0259] MANSDVTRHILSVLVQAVDGIISRVSGMFTRRAFNLVSLVSVKTETHGINRITVVVDADELNIEQITKQLNKLIPVLKVVRLDEETTIARAIMLVKVSADSTNRPQIVDAANIFRARVVDVAPDSVVIESTGTPGKLRALLDVMEPFGIRELIQSGQIALNRGPKTMAPAKI

[0260]

[0261] [서열 5] ilvN(D17A, H47L)

[0262] MANSDVTRHILSVLVQAVDGIISRVSGMFTRRAFNLVSLVSAKTETLGINRITVVVDADELNIEQITKQLNKLIPVLKVVRLDEETTIARAIMLVKVSADSTNRPQIVDAANIFRARVVDVAPDSVVIESTGTPGKLRALLDVMEPFGIRELIQSGQIALNRGPKTMAPAKI

[0263]

[0264] [서열 6] ilvN(D17A, A42V, H47L)

[0265] MANSDVTRHILSVLVQAVDGIISRVSGMFTRRAFNLVSLVSVKTETLGINRITVVVDADELNIEQITKQLNKLIPVLKVVRLDEETTIARAIMLVKVSADSTNRPQIVDAANIFRARVVDVAPDSVVIESTGTPGKLRALLDVMEPFGIRELIQSGQIALNRGPKTMAPAKI

[0266]

[0267] [Sequence 7] primer 9

[0268] CGAGCTCGGTACCCATGGCTAATTCTGACG

[0269]

[0270] [Sequence 8] primer 10

[0271] TAGAGGATCCCCTTAGATCTTGGCCGGAGC

[0272]

[0273] [Sequence 9] primer 11

[0274] TTCGGTCTTTAACAGACACGAGGGACACGAG

[0275]

[0276] [Sequence 10] primer 12

[0277] GTGTCCCTCGTGTCTGTTAAGACCGAAACA

[0278]

[0279] [Sequence 11] primer 13

[0280] CGGTTGATGCCgagTGTTTCGGTCTTTGCA

[0281]

[0282] [Sequence 12] primer 14

[0283] AAGACCGAAACActcGGCATCAACCGCATC

[0284]

[0285] [Sequence 13] hom(R407H)

[0286] TGCACGGTGGCCGTGCTCCAGGTGAGTCCACCTACGCTAACCTGCCGATCGCTGATTTCGGTGAGACCACCACTCGTTACCACCTCGACATGGATGTGGAAGATCGCGTGGGGGTTTTGGCTGAATTGGCTAGCCTGTTCTCTGAGCAAGGAATCTCCCTGCGTACAATCCGACAGGAAGAGCGCGATGATGATGCACATCTGATCGTGGTCACCCACTCTGCGCTGGAATCTGATCTTTCCCGCACCGTTGAACTGCTGAAGGCTAAGCCTGTTGTTAAGGCAATCAACAGTGTGATCCGCCTCGAAAGGGACTAA

[0287]

[0288] [서열 14] primer 1

[0289] TCGAGCTCGGTACCCCGCTTTTGCACTCATCGAGC

[0290]

[0291] [서열 15] primer 2

[0292] CACGATCAGATGTGCATCATCAT

[0293]

[0294] [서열 16] primer 3

[0295] ATGATGATGCACATCTGATCGTG

[0296]

[0297] [서열 17] primer 4

[0298] CTCTAGAGGATCCCCGAGCATCTTCCAAAACCTTG

[0299]

[0300] [서열 18] ilvA(T381A, F383A)

[0301] TCGCTGAGCGCTCCTTGGTGCACCGCGGTTTGAAGCACTACTTCTTGGTGAACTTCCCGCAAAAGCCTGGTCAGTTGCGTCACTTCCTGGAAGATATCCTGGGACCGGATGATGACATCgCGCTGgcaGAGTACCTCAAGCGCAACAACCGTGAGACCGGTACTGCGTTGGTGGGTATTCACTTGAGTGAAGCATCAGGATTGGATTCTTTGCTGGAACGTATGGAGGAATCGGCAATTGATTCCCGTCGCCTCGAGCCGGGCACCCCTGAGTACGAATACTTGACCTAA

[0302]

[0303] [서열 19] primer 5

[0304] TCGAGCTCGGTACCCATGAGTGAAACATACGTGTC

[0305]

[0306] [서열 20] primer 6

[0307] GCGCTTGAGGTACTCtgcCAGCGcGATGTCATCATCCGG

[0308]

[0309] [서열 21] primer 7

[0310] CCGGATGATGACATCgCGCTGgcaGAGTACCTCAAGCGC

[0311]

[0312] [서열 22] primer 8

[0313] CTCTAGAGGATCCCCCGTCACCGACACCTCCACA

[0314]

[0315] [서열 23] ilvN(D17A)

[0316] ATGGCTAATTCTGACGTCACCCGCCACATCCTGTCCGTACTCGTTCAGGCCGTAGACGGAATCATTTCCCGCGTATCAGGTATGTTCACCCGACGCGCATTCAACCTCGTGTCCCTCGTGTCTGCAAAGACCGAAACACACGGCATCAACCGCATCACGGTTGTTGTCGACGCCGACGAGCTCAACATTGAGCAGATCACCAAGCAGCTCAACAAGCTGATCCCCGTGCTCAAAGTCGTGCGACTTGATGAAGAGACCACTATCGCCCGCGCAATCATGCTGGTTAAGGTCTCTGCGGACAGCACCAACCGTCCGCAGATCGTCGACGCCGCGAACATCTTCCGCGCCCGAGTCGTCGACGTGGCTCCAGACTCTGTGGTTATTGAATCCACAGGCACCCCAGGCAAGCTCCGCGCACTGCTTGACGTGATGGAACCATTCGGAATCCGCGAACTGATCCAATCCGGACAGATTGCACTCAACCGCGGTCCGAAGACCATGGCTCCGGCCAAGATCTAA

[0317]

[0318] [서열 24] ilvN(D17A, A42V)

[0319] ATGGCTAATTCTGACGTCACCCGCCACATCCTGTCCGTACTCGTTCAGGCCGTAGACGGAATCATTTCCCGCGTATCAGGTATGTTCACCCGACGCGCATTCAACCTCGTGTCCCTCGTGTCTGTTAAGACCGAAACACACGGCATCAACCGCATCACGGTTGTTGTCGACGCCGACGAGCTCAACATTGAGCAGATCACCAAGCAGCTCAACAAGCTGATCCCCGTGCTCAAAGTCGTGCGACTTGATGAAGAGACCACTATCGCCCGCGCAATCATGCTGGTTAAGGTCTCTGCGGACAGCACCAACCGTCCGCAGATCGTCGACGCCGCGAACATCTTCCGCGCCCGAGTCGTCGACGTGGCTCCAGACTCTGTGGTTATTGAATCCACAGGCACCCCAGGCAAGCTCCGCGCACTGCTTGACGTGATGGAACCATTCGGAATCCGCGAACTGATCCAATCCGGACAGATTGCACTCAACCGCGGTCCGAAGACCATGGCTCCGGCCAAGATCTAA

[0320]

[0321] [서열 25] ilvN(D17A, H47L)

[0322] ATGGCTAATTCTGACGTCACCCGCCACATCCTGTCCGTACTCGTTCAGGCCGTAGACGGAATCATTTCCCGCGTATCAGGTATGTTCACCCGACGCGCATTCAACCTCGTGTCCCTCGTGTCTGCAAAGACCGAAACACTCGGCATCAACCGCATCACGGTTGTTGTCGACGCCGACGAGCTCAACATTGAGCAGATCACCAAGCAGCTCAACAAGCTGATCCCCGTGCTCAAAGTCGTGCGACTTGATGAAGAGACCACTATCGCCCGCGCAATCATGCTGGTTAAGGTCTCTGCGGACAGCACCAACCGTCCGCAGATCGTCGACGCCGCGAACATCTTCCGCGCCCGAGTCGTCGACGTGGCTCCAGACTCTGTGGTTATTGAATCCACAGGCACCCCAGGCAAGCTCCGCGCACTGCTTGACGTGATGGAACCATTCGGAATCCGCGAACTGATCCAATCCGGACAGATTGCACTCAACCGCGGTCCGAAGACCATGGCTCCGGCCAAGATCTAA

[0323]

[0324] [서열 26] ilvN(D17A, A42V, H47L)

[0325] ATGGCTAATTCTGACGTCACCCGCCACATCCTGTCCGTACTCGTTCAGGCCGTAGACGGAATCATTTCCCGCGTATCAGGTATGTTCACCCGACGCGCATTCAACCTCGTGTCCCTCGTGTCTGTTAAGACCGAAACACTCGGCATCAACCGCATCACGGTTGTTGTCGACGCCGACGAGCTCAACATTGAGCAGATCACCAAGCAGCTCAACAAGCTGATCCCCGTGCTCAAAGTCGTGCGACTTGATGAAGAGACCACTATCGCCCGCGCAATCATGCTGGTTAAGGTCTCTGCGGACAGCACCAACCGTCCGCAGATCGTCGACGCCGCGAACATCTTCCGCGCCCGAGTCGTCGACGTGGCTCCAGACTCTGTGGTTATTGAATCCACAGGCACCCCAGGCAAGCTCCGCGCACTGCTTGACGTGATGGAACCATTCGGAATCCGCGAACTGATCCAATCCGGACAGATTGCACTCAACCGCGGTCCGAAGACCATGGCTCCGGCCAAGATCTAA

Claims

1. Acetohydroxy acid synthase mutant in which the amino acid corresponding to position 17 in the amino acid sequence of sequence number 1 is replaced with a different amino acid.

2. A mutant in claim 1, wherein the amino acid corresponding to the 17th position is substituted with alanine.

3. A mutant in the first paragraph, wherein the amino acid corresponding to the 17th position is asparagine.

4. In the first paragraph, the variant further comprises at least one substitution selected from the group consisting of substitution of an amino acid corresponding to position 42 in the amino acid sequence of SEQ ID NO: 1 with a different amino acid; substitution of an amino acid corresponding to position 47 with a different amino acid; or a combination thereof.

5. A mutant in claim 4, wherein the amino acid corresponding to the 42nd position is substituted with valine.

6. A mutant in claim 4, wherein the amino acid corresponding to the 47th position is substituted with leucine.

7. A mutant in claim 4, wherein the amino acid corresponding to the 42nd position is alanine.

8. A mutant in paragraph 4, wherein the amino acid corresponding to the 47th position is histidine.

9. A polynucleotide encoding a mutant of any one of claims 1 to 8.

10. A strain of the genus Corynebacterium, comprising a mutant of any one of claims 1 to 8; or a polynucleotide encoding the mutant.

11. In claim 10, the strain has increased L-isoleucine productivity compared to a Corynebacterium strain comprising a wild-type acetohydroxy acid synthase having the amino acid sequence of sequence number 1 or a polynucleotide encoding the same.

12. A strain according to claim 10, wherein the strain is Corynebacterium glutamicum.

13. A method for producing L-isoleucine, comprising the step of culturing a strain of the genus Corynebacterium comprising a mutant of any one of claims 1 to 8; or a polynucleotide encoding the mutant; in a medium.

14. A composition for producing L-isoleucine, comprising a variant of any one of claims 1 to 8, a polynucleotide encoding the variant, a vector comprising the polynucleotide, or a Corynebacterium strain comprising the polynucleotide of the present application; a medium culturing the same; or a combination of two or more of them.

15. A use of a variant of any one of claims 1 to 8; a polynucleotide encoding the variant; or a strain of the genus Corynebacterium comprising the variant or a polynucleotide encoding the variant for producing L-isoleucine.