Method for Simultaneously Detecting Serum Blood Cells in Brucella Infection and Application Thereof
Patent Information
- Application Number
- NL2041038
- Authority / Receiving Office
- NL · NL
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-08-21
- Publication Date
- 2026-05-07
- Estimated Expiration
- 2045-08-20
AI Technical Summary
Current diagnostic methods for brucellosis, such as serological examination and bacterial culture, are cumbersome and prone to missed or misdiagnosis, while real-time fluorescent PCR lacks standardized reagents and procedures, hindering rapid and accurate detection of Brucella infection.
A primer pair (SEQ ID NO.2-3) is designed for detecting Brucella infection, integrated into a kit with specific solutions and reagents, enabling synchronous detection of Brucella DNA in serum and blood cells through a PCR process.
The kit efficiently and accurately detects Brucella infection with high specificity and stability, providing a rapid and reliable diagnostic tool for brucellosis.
Abstract
Description
TECHNICAL FIELD The present invention relates to the technical field of bacterial detection, in particular to a . BACKGROUND Brucellosis (referred to as "brucellosis") is an infectious-allergic disease caused by bacteria of the genus Brucella invading the body. Human infection is mainly caused by contact with infected animals or consumption of food contaminated by Bruce / la. After being infected with this disease, humans may suffer from multi-organ damage, and it is easy to turn into chronic patients that are difficult to cure; severe cases may be disabled, seriously affecting the quality of life. At present, the diagnosis of brucellosis relies on serological examination combined with etiological bacterial isolation experiments, which is cumbersome to operate and difficult to meet the needs of rapid diagnosis. Common serological examination methods include Rose Bengal Plate Agglutination Test, Tube Agglutination Test, etc. At present, rapid detection technologies have made certain progress, and detection methods such as indirect enzyme-linked immunosorbent assay and colloidal gold immunochromatography have gradually been used, but the existing technologies still have certain defects, resulting in a high rate of missed diagnosis and misdiagnosis in clinical diagnosis. Real-time fluorescent PCR is internationally recognized as the most widely used and stable molecular diagnostic technology in pathogen detection, and has an irreplaceable position and role in the laboratory confirmation of new and emerging infectious disease pathogens. However, there are still prominent problems in the field of pathogen molecular detection: there is no standardized reagent for Brucella fluorescent PCR detection products, and no standardized operating procedures. In response to the major demand for emergency disposal of highly pathogenic infectious diseases, it is urgent to establish a technical platform for the development of new diagnostic methods for emerging infectious diseases, emergency research and development of diagnostic reagents, and industrialization, so as to form a rapid response system. The PCR method has higher sensitivity than serological methods and bacterial culture. Because bacteria and bacterial fragments appear in blood cells earlier than specific antibodies, the PCR method for detecting brucellosis may produce results in a short time. Moreover, this method is independent of the route of bacterial infection and the virulence of the strain, so it has incomparable advantages in early diagnosis. SUMMARY The purpose of the present invention is to provide a , so as to solve the problems existing in the prior art. The kit provided by the present invention may efficiently and accurately detect the presence of Brucella infection in serum and blood cells, with outstanding specificity and stability. To achieve the above purpose, the present invention provides the following schemes: The present invention provides a primer pair for detecting Brucella infection, including an upstream primer with a nucleotide sequence as shown in SEQ ID N02 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.3. The present invention also provides the use of the above primer pair in the preparation of a product for detecting Brucella infection. Further, the product is a kit. The present invention also provides a kit for detecting Brucella infection, including the above primer pair. Further, it also includes a sodium chloride solution, reagent 1, reagent 2, Triton X-100 solution and double-distilled water. Further, the concentration of sodium chloride in the sodium chloride solution is 9 g / L; the mass fraction of the Triton X-100 solution is 0.01%; the reagent 1 contains 8 g / L of sodium chloride, 0.2 g / L of potassium chloride, 1.42 g / L of disodium hydrogen phosphate and 0.27 g / L of potassium dihydrogen phosphate; the reagent 2 contains 1.2 g / L of tris(hydroxymethyl)aminomethane, 9 g / L of sodium chloride and 3 g / L of ethylenediaminetetraacetic acid. Further, the kit is used for synchronously detecting Brucella DNA in serum and Brucella DNA in blood cells. Further, the detection of Brucella DNA in serum includes the following steps: taking serum into a centrifuge tube, centrifuging, discarding the supernatant, adding 0.2 mL of double-distilled water, shaking, centrifuging, discarding the supernatant, adding 0.02 mL of double-distilled water, shaking, instant centrifuging, heating at 100°C for 10 min, freezing at - 20°C for 2 min, centrifuging for 10 s, and sucking the supernatant as a template for PCR reaction. Further, the detection of Brucella DNA in blood cells includes the following steps: taking peripheral blood, adding 1 mL of the sodium chloride solution, mixing uniformly, spreading onto a 6-well cell culture plate, and incubating at 37°C for 1 h; after incubation, discarding the supernatant, washing the cell culture plate with the reagent 1, adding 1 mL of the reagent 1, repeatedly pipetting to wash off the precipitate at the bottom of the well, collecting into a centrifuge tube, centrifuging at 500 x g at 4°C, discarding the supernatant, adding 0.8 mL of the reagent 2, mixing uniformly, adding 8 uL of Triton X-100 solution, fully mixing, incubating at 55°C for 1 h, centrifuging, discarding the supernatant, adding 0.8 mL of double-distilled water, fully mixing, centrifuging at 8000 rpm for 10 min; discarding the supernatant; adding 0.02 mL of double-distilled water, shaking, fully mixing, heating at 100°C for 10 min; centrifuging at 15000 x g for 10 s; sucking the supernatant as a template for PCR reaction. Further, the procedure of the PCR reaction includes: pre-denaturation at 90°C for 5 min; denaturation at 90°C for 1 min, annealing at 53°C for 1 min, extension at 72°C for 1 min, 40 cycles; final extension at 72°C for 10 min; cooling at 4°C. The present invention discloses the following technical effects: the present invention provides a primer pair for detecting Brucella infection, including primers with nucleotide sequences as shown in SEQ ID NO.2-3; based on the primer pair, the present invention develops a kit for synchronously detecting Brucella infection in serum and blood cells, including sodium chloride solution, Triton X-100 solution, reagent 1, reagent 2, PCR reaction reagents and DNA electrophoresis reagents. Experimental results show that the kit provided by the present invention may efficiently and accurately detect the presence of Brucella infection in serum and blood cells, with outstanding specificity and stability. The present invention provides a new product for detecting Brucella infection, which has prominent application value and broad application prospects. DESCRIPTION OF THE INVENTION The various exemplary embodiments of the present invention will now be described in detail. The detailed description should not be construed as a limitation of the present invention, but rather as a more detailed description of certain aspects, features and embodiments of the present invention. It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in a stated range and any other stated value or intermediate value in the stated range is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail. Without departing from the scope or spirit of the present invention, various modifications and changes may be made to the specific embodiments of the present invention described in the specification, which will be obvious to those skilled in the art. Other embodiments obtained from the description of the present invention will be obvious to those skilled in the art. The description and examples of the present invention are only exemplary. The terms "comprising", "including", "having", "containing" and the like used herein are open-ended terms, meaning including but not limited to. Embodiment 1 1. Primer design The present invention designs an upstream primer F and a downstream primer R for the nucleotide sequence of Brucella sp. with the accession number GenBank: PQ140467.1 and a length of 773 bp. The primer sequences are as shown in SEQ ID NO.2-3, and the sequence of the expected amplification product is as shown in SEQ ID NO.1, with a length of 685 bp. SEQ ID NO.1: ATAGGCGTCCAGCGCACCATCTTTCAGCCTCTCGCCTGCCGGTCCCGGCTTCAGGTG TTCAGCCTTGATATCGTCTTCCGTGAGGCCGTAGGCTTCAAGAACGATACGCGCATCGAC GATGGTGCCAGAACCCGGCTCATCCAGCGAAACGCGCTTGCCTTTCAGGTCTGCGACCGA TTTGATGTTTGCATCCTTACGCGCAACGATATGGATCGTTTCCGGGTAAAGCGTCGCCAGA AGGCGCAAATCTTCCACCTTGCCCTTGCCATCATAAAGGCCGGTGCCGTTATAGGCCCAAT AGGCAACGTCTGACTGCGTAAAGCCGGACTCCAGAGCGCCCGACTTGATCGCATTGATAT TGGCAACCGAGCCATTCGACGAAACGGCCGTCGCGACGAGACCCGGCACGCCCTTTTCG CCTGCGCCGGAAATCGCGTTCGCGATCAGACCACCAATCGGATAATAGGTTCCGGCTGTG CCGCCAGTGCCGATACGGAAAAATGTCGGGGCCTGTGCAACCGCAAAGCTCGCTCCCAAC GCAATCGCGCCCGCCACCGCCGCAACAGCCAAGCGACGGATTTTGCTTCCGAATTTCATA ATACCAGTCCTCTTCCCGCATAGATTATGCCGAAAACCATAGGAAGCTTGAGGCCGATTGT CAACCACCGCATTCCATTATTCTGGA. F: 5-ATAGGCGTCCAGCGCACCATCT-3 (SEQ ID NO.2); R: 5-TCCAGAATAATGGAATGCGGTG-3 (SEQ ID NO.3). 2. Kit design The above primers F and R are prepared into 20 pmol / L solutions, a sodium chloride solution with a concentration of 9 g / L is prepared; Triton X-100 with a mass fraction of 0.01% is prepared; double-distilled water is prepared; and reagent 1 and reagent 2 are prepared respectively, with the formulas as follows: reagent 1 contains 8 g / L of sodium chloride, 0.2 g / L of potassium chloride, 1.42 g / L of disodium hydrogen phosphate and 0.27 g / L of potassium dihydrogen phosphate; reagent 2 contains 1.2 g / L of tris(hydroxymethyl)aminomethane, 9 g / L of sodium chloride and 3 g / L of ethylenediaminetetraacetic acid. A commercially available PCR reaction kit and agarose gel electrophoresis kit (purchased from Takara) are used to form the kit for detecting Brucella infection of the present invention. Embodiment 2 Using the kit provided by the present invention to synchronously detect Brucella DNA in serum and blood cells. 1. Detection of Brucella DNA in serum Take 0.2 mL of serum into a 1.5 mL centrifuge tube; centrifuge at 15000 x g at room temperature for 15 min; add 0.2 mL of double-distilled water into the 1.5 mL centrifuge tube; shake; centrifuge at 15000 x g at room temperature for 10 min; discard the supernatant; add 20 uL of double-distilled water into the 1.5 mL centrifuge tube; shake and centrifuge instantly; heat at 100°C for 10 min; place in a -20°C refrigerator for freezing for 2 min; centrifuge at 15000 x g at room temperature for 10 s; suck 15 uL of supernatant as a template for PCR reaction. 2. Detection of Brucella DNA in blood cells Take 1 mL of peripheral blood; add 1 mL of 9 g / L sodium chloride solution and mix uniformly; spread onto a 6well cell culture plate; incubate at 37°C for 1 h; wash with reagent 1 until no red color remains, and pour off the supernatant; add 1 mL of reagent 1 into the well of the cell culture plate, repeatedly pipette to wash off the precipitate (monocytes) at the bottom of the well into a 1.5 mL centrifuge tube; centrifuge at 500 x g at 4°C for 5 min; discard the supernatant; add 800 pL of reagent 2 and fully mix; add 8 uL of Triton X-100, fully mix; incubate at 55°C for 1 h; centrifuge at 8000 rpm at room temperature for 10 min; discard the supernatant; add 800 uL of double-distilled water and fully mix; centrifuge at 8000 rpm at room temperature for 10 min; discard the supernatant; add 20 pL of double-distilled water, shake and fully mix; heat at 100°C for 10 min; centrifuge at 15000 x g at room temperature for 10 s; suck 15 uL of supernatant as a template for PCR reaction. 3. PCR reaction PCR reaction system: 0.5 uL of primer F; 0.5 uL of primer R; 2 uL of dNTP mixture (2.5 mmol / L each of dATP, dTTP, dGTP and dCTP); 2.5 uL of 10 x Buffer (Mgz+); 0.125 uL of Taq DNA polymerase (5 U / uL); 15 uL of template DNA (from serum or blood cells); make up to 25 uL with double-distilled water. PCR reaction procedure: pre-denaturation at 90°C for 5 min; denaturation at 90°C for 1 min, annealing at 53°C for 1 min, extension at 72°C for 1 min, 40 cycles; final extension at 72°C for 10 min; cooling at 4°C. 4. Electrophoresis Take the PCR amplification product, configure the gel and perform DNA electrophoresis according to the instructions of the agarose gel electrophoresis kit (purchased from Takara), read the bands. lf there is a 685 bp electrophoresis band, it is judged as positive for Bruce / la detection; otherwise, it is judged as negative for Bruce / la detection. Embodiment 3 53 brucellosis patients (confirmed by serological methods) and 12 healthy volunteers are selected, blood is collected, and detected using the kit for detecting Bruce / la infection provided by the present invention. In addition, Tyzzer's bacillus, Campylobacter jejuni, Helicobacter hepaticus and Helicobacter pylori are cultured respectively, and their genomic DNAs are extracted as DNA templates to be detected using the kit provided by the present invention. The results showed that the detection results of serum and blood cell samples of 12 healthy volunteers are all negative; the detection results of genomic DNA samples of Tyzzer's bacillus, Campylobacter jejuni, Helicobacter hepaticus and Helicobacter pylori are all negative; the detection results of 53 brucellosis patients are all positive. This indicates that the kit provided by the present invention has outstanding specificity and stability for synchronous detection of Bruce / la infection in serum and blood cells. The above embodiments are only for describing the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Various modifications and improvements made to the technical solution of the present invention by those of ordinary skill in the art without departing from the design spirit of the present invention shall fall within the protection scope defined by the claims of the present invention. multaneously Detecting Serum Blood Cells in Brucella Infection and Application hereof 3 685 DNA PAT source 1..685 mol_type other DNA organism synthetic nstruct aggcgtccagcgcaccatctttcagcctctcgcctgccggtcccggcttcaggtgttcagccttgatatcgtcttccgt aggccgtaggcttcaagaacgatacgcgcatcgacgatggtgccagaacccggctcatccagcgaaacgcgcttg cctttcaggtctgcgaccgatttgatgtttgcatccttacgcgcaacgatatggatcgtttccgggtaaagcgtcgccag aaggcgcaaatcttccaccttgcccttgccatcataaaggccggtgccgttataggcccaataggcaacgtctgactgc aaagccggactccagagcgcccgacttgatcgcattgatattggcaaccgagccattcgacgaaacggccgtcgc acgagacccggcacgcccttttcgcctgcgccggaaatcgcgttcgcgatcagaccaccaatcggataataggttcc gctgtgccgccagtgccgatacggaaaaatgtcggggcctgtgcaaccgcaaagctcgctcccaacgcaatcgcgc ccgccaccgccgcaacagccaagcgacggattttgcttccgaatttcataataccagtcctcttcccgcatagattatgc aaaaccataggaagcttgaggccgattgtcaaccaccgcattccattattctgga 22 DNA PAT source .22 mol_type other DNA organism synthetic construct ataggcgtccagcgcaccatct 22 NA PAT source 1..22 mol_type other DNA organism synthetic construct ccagaataatggaatgcggtg
Claims
1. A primer pair for detecting a Bruce / Ia infection, that an upstream primer with a nucleotide sequence as shown in SEQ ID N02 and a downstream primer with a nucleotide sequence as shown in SEQ ID No. 3 includes 2. Application of the primer pair pursuant to Claim 1 in the preparation of a product for detecting a Bruce / Ia infection.
3. The application under claim 2, where the product is a composite set.
4. A composite set for detecting Bruce / Ia infection, containing the primer pair according to conclusion 1 includes.
5. The composite set within claim 4, further consisting of a sodium chloride solution, a reagent 1, a reagent 2, a Triton X-100 solution and double distilled water, where reagent 1 consists of 8 g / l sodium chloride, 0.2 g / l potassium chloride, 1.42 g / l disodium hydrogen phosphate and 0.27 g / l potassium dihydrogen phosphate, and reagent 2 1.2 g / l tris(hydroxymethyl)aminomethane, 9 g / l sodium chloride and 3 g / l ethylenediaminetetraacetic acid.
6. The composite set according to claim 5, where the concentration of sodium chloride in the sodium chloride solution amounts to 9 g / l and the mass fraction of the Triton X-100 solution amounts to 0.01%.
7. The composite set according to claim 6, where the composite set is applied for the simultaneous detection of Bruce / Ia DNA in serum and Bruce / Ia DNA in blood cells.
8. The composite set according to claim 7, involving the detection of Bruce / Ia DNA in serum The following steps involve: placing serum in a centrifuge tube, centrifuging, discarding the above liquid, adding 0.2 ml double distilled, shaking, centrifuging, discarding the supernatant liquid, the add 0.02 ml of double distilled water, shake, centrifuge immediately, Heat to 100 °C for 10 minutes, freeze at -20 °C for 2 minutes, Centrifuge for 10 seconds and suck up the liquid above as Template for PCR reaction.
9. The composite set according to claim 7, whereby the detection of Bruce / Ia DNA in blood cells the following steps include: drawing peripheral blood, adding 1 ml of sodium chloride solution, the mix evenly, spread over a cell culture plate with 6 wells, and incubate. at 37 °C for 1 hour; and after incubation discarding the supernatant liquid, washing the cell culture plate with reagent 1 by adding 1 ml of reagent 1, repeatedly pipette to rinse away the precipitate at the bottom of the wells, collect in a centrifuge tube, and centrifuge at 500 xg at 4 °C and discarding the above liquid; add 0.8 ml of reagent 2, mix evenly, the addition of 8 µl Triton X-100 solution, mix thoroughly, incubate for 1 hour at 55 °C, centrifuging, discarding the supernatant liquid, adding 0.8 ml double distilled water, mix thoroughly, centrifuge for 10 minutes at 8000 rpm; the discarding the above liquid; adding 0.02 ml double distilled water, shake, mix thoroughly, heat at 100°C for 10 minutes; during Centrifuge for 10 seconds at 15,000 xg; and suction up the supernatant liquid as template for PCR reaction..
10. The composite set according to claim 8 or 9, where the procedure of the PCR reaction includes: pre-denaturation at 90 °C for 5 minutes; denaturation at 90 °C for 1 minute, primer binding at 53 °C for 1 minute, extend at 72 °C for 1 minute, 40 cycles; and final extension at 72 °C for 10 minutes; cooling at 4 °C. PATENT APPLICATION NO.: NO 200051 RESEARCH REPORT CONCERNING THE RESULT OF THE STATE OF THE ART RESEARCH RELEVANT LITERATURE 1 Literature with, where necessary, indication of of particular importance for Classification (IPC) Category text sections or figures. conclusion(s) no: X CN 116 377 092 A (YUNNAN KECAN 1-10 INV. BIOTECHNOLOGY CO LTD) C12Q1 / 686 4 juli 2023 (2023-07-04) C12Q1 / 689 * see whole doc., esp. claims, Table 2 * ----- X ZEYBEK HASAN ET AL: "Optimization and 1-10 validation of a real-time polymerase chain reaction protocol for the diagnosis of human brucellosis", FOLIA MICROBIOLOGICA, SPRINGER NETHERLANDS, NL, deel 65, nr. 2, 31 juli 2019 (2019-07-31), bladzijden 353-361, XP037042931, ISSN: 0015-5632, DOI: 10.1007 / S12223-019-00731-1 [gevonden op 2019-07-31] * see whole doc., esp. Figures 2-4 * ----- X DAL TUBA ET AL: "Comparison of Two 1-10 Commercial DNA Extraction Kits and PCR Onderzochte gebieden Master Mixes for the Detection of Brucella van de techniek from Blood Samples and Blood Culture Bottles", C12Q MIKROBIYOLOJI BULTENI = BULLETIN OF MICROBIOLOGY, part 2018, no. 2, April 1, 2018 (2018-04-01), pages 135-146, XP093370691, Ankara ISSN: 0374-9096, DOI: 10.5578 / mb.66742 * see whole doc., esp. Table 1 * ----- - / -- If amended conclusions have been submitted, this report relates to the conclusions submitted on: Place of investigation: Date on which the investigation was conducted Competent official: completed: Munich February 26, 2026 Mueller, Frank 1 CATEGORY OF THE SIGNED LITERATURE X: the conclusion is deemed not new or not inventive T: after the filing date or the priority date considered in relation to this literature published literature that is not detrimental to the patent application, but is mentioned for clarification of Y: the conclusion is considered non-inventive at 1 the theory or principle that underlies the in relation to the combination of this literature with other cited literature of the same category, invention where the combination is obvious to the skilled person E: earlier patent (application), published on or after the is deemed to be the filing date on which the same invention is described A: literature not belonging to category X or Y that the D: stated in the patent application describes the state of the art O: non-written state of the art L: literature mentioned for other reasons P: between the priority date and the filing date &: member of the same patent family or corresponding published literature patent publication page 1 of 2 EOB FORM 02.83 (P0414B) NO 200051 RELEVANT LITERATURE 1 Literature with, where necessary, an indication of of particular interest. Of importance to Category text sections or figures. conclusion(s) no: X COSTA DA M ET AL: “SPECIFICITY OF SIX 1-10 GENE SEQUENCES FOR THE DETECTION OF THE GENUS BRUCELLA BY DNA AMPLIFICATION", JOURNAL OF APPLIED MICROBIOLOGY, BLACKWELL PUBLISHING LTD , OXFORD, GB, part 81, no. 3, January 1, 1996 (1996-01-01), pages 267-275, XP008039602, ISSN: 0021-8847 * see whole doc., esp. Table 4 and discussion * ----- X CN 109 439 727 A (INNER MONGOLIA HUAXING 1-10 KANGWEI BIOTECHNOLOGY CO LTD) March 8, 2019 (2019-03-08) * see whole doc., esp. claims and par. 213, examples 4 and 5 * ----- 1 CATEGORY OF THE REFERENCED LITERATURE 1 X: the conclusion is deemed not new or not inventive T: after the filing date or the priority date published literature that is not objectionable to the considered in relation to this literature Y: the claim is considered non-inventive for the patent application, but is included for the clarification of in relation to the combination of this literature with the theory or principle underlying the other cited literature of the same category, invention where the combination is obvious to the skilled person E: earlier patent (application), published on or after the filing date, on which the same invention is is considered to be lying down A: literature not belonging to category X or Y that the described state of the art describes D: stated in the patent application O: non-written state of the art L: literature mentioned for other reasons P: between the priority date and the filing date &: member of the same patent family or corresponding patent publication published literature page 2 of 2 EOB FORM 02.83 (P0414C) APPENDIX TO THE REPORT CONCERNING THE RESEARCH INTO THE STATE OF THE ART, NO 200051 CARRIED OUT IN PATENT APPLICATION NO. The appendix contains a list of patent applications or patents published elsewhere (so-called members of the same patent family), that correspond to patent specifications mentioned in the report. The statement has been compiled based on data from the European Patent Office's computer file as of The accuracy and completeness of this statement is guaranteed neither by the European Patent Office nor by the Industrial Office. Property guaranteed; the data is provided for informational purposes. 26-02-2026 In the report Date of Corresponding Date of mentioned patent document publication document(s) publication CN 116377092 A 04-07-2023 NONE ----------------------------------------------------------------------- CN 109439727 A 08-03-2019 CN 108517352 A 11-09-2018 CN 109439727 A 08-03-2019 WO 2019205764 A1 31-10-2019 ----------------------------------------------------------------------- General information regarding this appendix has been published in the 'Official Journal' of the European Patent Office No. 12 / 82, pp. 448 et seq.