Novel biaryl derivative useful as diacylglycerol acyltransferase 2 inhibitor, and use thereof
Patent Information
- Application Number
- NZ797318
- Authority / Receiving Office
- NZ · NZ
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-09-04
- Filing Date
- 2021-09-03
- Publication Date
- 2026-07-28
- Estimated Expiration
- 2041-09-03
AI Technical Summary
Current treatments for metabolic diseases such as obesity, hyperlipidemia, and diabetes are inadequate due to the lack of effective inhibitors for diacylglycerol acyltransferase 2 (DGAT2), a key enzyme in triglyceride biosynthesis, which contributes to excessive fat accumulation and related health issues.
Development of novel biaryl derivative compounds that act as DGAT2 inhibitors, specifically represented by formula (1), which can be used in pharmaceutical compositions to treat metabolic diseases by reducing triglyceride synthesis and improving insulin responsiveness and cholesterol profiles.
The biaryl derivative compounds effectively inhibit DGAT2 activity, leading to reduced triglyceride levels, improved insulin sensitivity, and enhanced metabolic health outcomes, providing a potential treatment for obesity, fatty liver, and related metabolic disorders.
Smart Images

Figure 1_ABST
Abstract
Description
Novel biaryl derivatives useful as diacylglycerol acyltransferase 2 inhibitors and uses thereof
[0001] The present invention relates to a biaryl derivative compound represented by chemical formula (1) exhibiting diacylglycerol acyltransferase 2 (DGAT2) inhibitor activity, a pharmaceutical composition containing the same as an active ingredient, and a use thereof.
[0002] Economic development has led to improved living standards, the frequent consumption of instant foods, and a shift toward a meat-centric diet, which has led to the accumulation of excessive caloric energy in the body. These changes in modern eating habits, coupled with a decrease in caloric energy expenditure due to lack of exercise, have led to a serious increase in the prevalence of metabolic diseases such as obesity, hyperlipidemia, diabetes, cardiovascular disease, and coronary artery disease. In particular, obesity, one of the rapidly increasing diseases, is reported to be a cause of metabolic diseases such as diabetes. Therefore, the development of treatments for metabolic diseases by modulating the function of enzymes involved in the biosynthetic pathway of triglycerides, a major cause of obesity, is attracting attention.
[0003] Neutral fats such as triglycerides (TG) play a very important role in the storage function as an energy source in the body, but if they are excessively accumulated in organs or tissues, they can cause obesity, hypertriglyceridemia, fatty liver, etc., which in turn induce serious diseases such as diabetes, arteriosclerosis, metabolic disorders, and organ dysfunction. Diacylglycerol acyltransferase, a crucial enzyme in the biosynthesis of triglycerides, is found in various tissues of mammals, and is an enzyme that synthesizes TG by attaching fatty acyl-CoA to the hydroxyl group of diacylglycerol in the final step of the glycerol phosphate pathway, the main route for neutral fat synthesis. Currently, two isoforms, DGAT1 and DGAT2, are known. Although their biochemical functions are similar, they differ in that DGAT1 is expressed primarily in the small intestine and adipose tissue, while DGAT2 is expressed primarily in the liver and adipose tissue. In addition, they belong to different gene families: DGAT1 belongs to the ACAT family, and DGAT2 belongs to the MGAT family, so it is expected that their roles in TG biosynthesis will also be different.
[0004] Several studies, including animal experiments, have shown that DGAT2 is a major contributor to TG biosynthesis in vivo. Unlike DGAT2 knockout mice, which synthesize almost no TG and die shortly after birth due to abnormal skin layers, DGAT1 knockout mice showed only a slight decrease in TG levels and no problem in mouse survival (Stone SJ et al., 2000. Nat. Genet. 25: 87-90). In addition, when the expression levels of DGAT1 or DGAT2 were reduced using antisense oligonucleotides (ASOs) in a fatty liver animal model, fatty liver symptoms were alleviated and hepatic glucose production was significantly reduced only when the amount of DGAT2 was reduced (Choi CS et al., 2007. Hepatology. 45: 1366-74).
[0005] Although the underlying molecular mechanism is not fully understood, inhibition of DGAT2 was thought to downregulate the expression of multiple genes encoding proteins involved in lipogenesis, including sterol regulatory element-binding proteins 1c (SREBP1c) and stearoyl CoA-desaturase 1 (SCD1). Simultaneously, oxidative pathways were thought to be induced by upregulation of genes such as carnitine palmitoyl transferase 1 (CPT1). These changes ultimately led to a decrease in hepatic DAG and TAG lipid levels, and thus improved insulin responsiveness in the liver. In addition, inhibition of DGAT2 inhibited hepatic VLDL TAG secretion and reduced circulating cholesterol levels. Finally, plasma apolipoprotein B (APOB) levels were suppressed, which was thought to be due to a reduced supply of TAG for lipidation of newly synthesized APOB proteins. Therefore, inhibition of DGAT2 resulted in beneficial effects on both glycemic control and plasma cholesterol profiles, suggesting that DGAT2 inhibition could be applied to the treatment of metabolic diseases.
[0006] The purpose of the present invention is to provide a novel biaryl derivative compound represented by chemical formula (1) exhibiting diacylglycerol acyltransferase 2 (DGAT2) inhibitor activity.
[0007] Another object of the present invention is to provide a method for producing the above-described biaryl derivative compound.
[0008] Another object of the present invention is to provide a pharmaceutical composition for treating metabolic diseases related to DGAT2, comprising the compound as an active ingredient, and a method for preparing the same.
[0009] Another object of the present invention is to provide a method for treating a metabolic disease related to DGAT2 in a subject with improved efficacy and convenience of administration, as well as improved efficacy in an animal model of a disease by using the compound as an active ingredient and improving physical and chemical properties compared to conventional compounds.
[0010] To achieve the above purpose, the present invention provides a compound of the following chemical formula (1), or a pharmaceutically acceptable salt or isomer thereof:
[0011] [Chemical formula (1)]
[0012]
[0013]
[0014] In the above chemical formula (1),
[0015] A, D and E are each independently CH or N;
[0016] R1 is alkyl, cycloalkyl or haloalkyl;
[0017] R2 is -GJL;
[0018] Here, G is -C(=O)- or a direct bond;
[0019] J is alkylene, alkenylene, alkylene-arylene, alkenylene-arylene, alkoxylene-arylene, arylene, heteroarylene-heterocycloalkylene, heteroarylene-arylene or heteroarylene-oxy-cycloalkylene;
[0020] L is hydrogen, halo, amino, nitro, carboxy(-COOH), carboxyalkyl, carboxyalkoxy, cycloalkyl or aryl;
[0021] The above alkyl, alkylene, carboxyalkyl, carboxyalkoxy or aryl may be optionally substituted, and the substituent is at least one selected from hydroxy, halo, alkyl and alkoxy;
[0022] The above heterocycloalkylene or heteroarylene contains one or more heteroatoms selected from N, O and S.
[0023]
[0024] The compound of formula (1) according to the present invention can form a pharmaceutically acceptable salt. Pharmaceutically acceptable salts include acid addition salts formed by acids that form non-toxic acid addition salts containing pharmaceutically acceptable anions, such as inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, hydroiodic acid, etc.; organic acids such as tartaric acid, formic acid, citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid, etc.; sulfonic acids such as methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc. In addition, pharmaceutically acceptable carboxylic acid salts include alkali metal or alkaline earth metal salts formed by, for example, lithium, sodium, potassium, calcium, magnesium, etc.; amino acid salts such as lysine, arginine, guanidine, etc.; Organic salts such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, diethanolamine, choline, triethylamine, etc. are included. The compound of formula (1) according to the present invention can be converted into its salt by a conventional method.
[0025] Meanwhile, the compounds according to the present invention may have an asymmetric carbon center and an asymmetric axis or asymmetric plane, and thus may exist as E or Z isomers, R or S isomers, racemates, diastereomeric mixtures, and individual diastereoisomers, and all of these isomers and mixtures are included in the scope of the present invention.
[0026] In this specification, for convenience, unless otherwise specified, the compound of formula (1) is used to mean the compound of formula (1), pharmaceutically acceptable salts and isomers thereof.
[0027] In defining the compound of chemical formula (1) throughout this specification, the following concepts defined for substituents are used.
[0028] The term "halogen" or "halo" refers to fluorine (F), chlorine (Cl), bromine (Br), or iodine (I).
[0029] The term "alkyl" or "alkylene" refers to a straight-chain or branched hydrocarbon group, which may contain single, double or triple bonds, and is C1-C 10 Alkyl or C1-C 10 Alkylene, or C1-C7 alkyl or C1-C7 alkylene is preferred. For example, the alkyl includes, but is not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, tert-butyl, acetylene, vinyl, trifluoromethyl, and the like.
[0030] The term "alkenyl" or "alkenylene" refers to a branched or unbranched hydrocarbon having at least one carbon-carbon double bond, C2-C 10 Alkenyl or C2-C 10 Alkenylene, or C2-C7 alkenyl or C2-C7 alkenylene is preferred. For example, the alkenyl includes, but is not limited to, vinyl, allyl, butenyl, isopropenyl, or isobutenyl.
[0031] The term "cycloalkyl" refers to a partially or fully saturated single or fused ring hydrocarbon, C3-C 10 Cycloalkyl is preferred. Examples include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cyclohexynyl.
[0032] The term "alkoxy" means alkyloxy having 1 to 10 carbon atoms, unless otherwise defined.
[0033] The term “aryl” or “arylene” means an aromatic hydrocarbon, preferably C5-C 12Aryl or C5-C 12 Arylene, more preferably C6-C 10 Aryl or C6-C 10 It is an arylene. Examples of the aryl include, but are not limited to, phenyl, naphthyl, etc.
[0034] The term “heteroaryl” or “heteroarylene” means a 3 to 12 membered, more preferably 5 to 12 membered aromatic hydrocarbon containing one or more heteroatoms selected from N, O and S as a reducing group, and forming a single or fused ring which may be fused with benzo or C3-C8 cycloalkyl. For example, the heteroaryl is pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, oxadiazolyl, isoxadiazolyl, tetrazolyl, triazolyl, indolyl, indazolyl, isoxazolyl, oxazolyl, thiazolyl, isothiazolyl, furanyl, benzofuranyl, imidazolyl, thiophenyl, benzthiazole, benzimidazole, quinolinyl, indolinyl, 1,2,3,4-tetrahydroisoquinolyl, 3,4-dihydroisoquinolyl, thiazolopyridyl, 2,3-dihydrobenzofuran, 2,3-dihydrothiophene, 2,3-dihydroindole, benzo[1,3]dioxane, chroman, thiochroman, Including, but not limited to, 1,2,3,4-tetrahydroquinoline, 4H-benzo[1,3]dioxin, 2,3-dihydrobenzo[1,4]dioxin, 6,7-dihydro-5H-cyclopenta[d]pyrimidine, etc.
[0035] The term “heterocycloalkyl” or “heterocycloalkylene” means a partially or fully saturated hydrocarbon group containing one or more heteroatoms selected from N, O and S as a reducing agent and forming a single or fused cyclic ring, preferably having 3 to 12 members or 5 to 12 members. Examples include, but are not limited to, pyrrolidinyl, piperidinyl, morpholinyl, imidazolinyl, piperazinyl, tetrahydrofuran, tetrahydrothiofuran, and the like.
[0036]
[0037] According to one specific example of the present invention, in the chemical formula (1)
[0038] A, D and E are each independently CH or N;
[0039] R1 is C1-C7 alkyl, C3-C 10 Cycloalkyl or halo-C1-C7alkyl;
[0040] R2 is -GJL;
[0041] Here, G is -C(=O)- or a direct bond;
[0042] J is C1-C7 alkylene, C2-C7 alkenylene, C1-C7 alkylene-C6-C 10 Arylene, C2-C7 alkenylene-C6-C 10 Arylene, C1-C7 alkoxylene-C6-C 10 Arylene, C6-C 10 Arylene, 5 to 12 membered heteroarylene-5 to 12 membered heterocycloalkylene, 5 to 12 membered heteroarylene-C6-C 10 Arylene or 5 to 12 membered heteroarylene-oxy-C3-C 10 is cycloalkylene;
[0043] L is hydrogen, halo, amino, nitro, carboxy, carboxy-C1-C7 alkyl, carboxy-C1-C7 alkoxy, C3-C 10 Cycloalkyl or C6-C 10 It is aryl;
[0044] The above alkyl, alkylene, carboxyalkyl, carboxyalkoxy or aryl may be optionally substituted, and the substituents are 1 to 4 selected from hydroxy, halo, C1-C7 alkyl and C1-C7 alkoxy;
[0045] The above heterocycloalkylene or heteroarylene contains 1 to 4 heteroatoms selected from N, O and S.
[0046]
[0047] Representative compounds of the chemical formula (1) according to the present invention may include, but are not limited to, the following compounds:
[0048] N-(6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)-3-phenylpropanamide;
[0049] Methyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetate;
[0050] 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid;
[0051] 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid;
[0052] Methyl 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoate;
[0053] Ethyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-difluoroacetate;
[0054] 3-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid;
[0055] (R)-1-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid;
[0056] 3-(3-(6-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid;
[0057] N-(6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)-3-phenylpropanamide;
[0058] 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid;
[0059] 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid;
[0060] 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenoxy)-2-methylpropanoic acid;
[0061] 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl-2,2-difluoroacetic acid;
[0062] 3-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid;
[0063] 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoic acid;
[0064] (E)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxoprop-1-phen-1-yl)phenyl)-2-methylpropanoic acid;
[0065] 3-(4-(1-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid;
[0066] 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenoxy-2-methylpropanoic acid;
[0067] 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)phenyl)acetic acid;
[0068] (1r, 4r)-4-((2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid;
[0069] N-(6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)-3-phenylpropanamide;
[0070] 3-(4-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid;
[0071] (R)-1-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid;
[0072] 3-(3-(6-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid;
[0073] 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoic acid;
[0074] 3-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid;
[0075] 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenoxy)-2-methylpropanoic acid;
[0076] 3-(4-(1-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid;
[0077] 2-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenoxy)-2-methylpropanoic acid;
[0078] (R)-1-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid
[0079] 3-(3-(6-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid; and
[0080] (1r,4r)-4-((2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid.
[0081]
[0082] Terms and abbreviations used in this specification have their original meanings unless otherwise defined.
[0083] The present invention also provides a method for preparing a compound of formula (1). Hereinafter, a method for preparing a compound of formula (1) will be described based on an exemplary reaction scheme to help understand the present invention. However, those skilled in the art to which the present invention pertains can prepare the compound of formula (1) by various methods based on the structure of formula (1), and all such methods should be construed as being included in the scope of the present invention. That is, the compound of formula (1) can be prepared by arbitrarily combining various synthetic methods described in the present specification or disclosed in the prior art, and this is understood to fall within the scope of the present invention, and the method for preparing a compound of formula (1) is not limited to that described below.
[0084] The compound of chemical formula (1) of the present invention can be prepared by directly introducing a substituted amine group into compound (2) according to the method of the following reaction scheme 1, or by introducing a protected amine into compound (2), removing the protecting group, and then performing an amidation reaction on compound (3) to prepare the desired compound of chemical formula (1).
[0085] [Reaction Formula 1]
[0086]
[0087]
[0088] Compound (2) can be prepared using 2-ethoxyphenol as a starting material according to the method of the following reaction scheme 2.
[0089] [Reaction Formula 2]
[0090]
[0091]
[0092] In addition, compound (3) can be prepared according to the method of the following reaction scheme 3.
[0093] [Reaction Formula 3]
[0094]
[0095]
[0096] Among the compounds of formula (4), amide derivatives can be obtained by treating an appropriate acid with thionyl chloride or oxalyl chloride and then treating with aqueous ammonia. For example, methyl 4-(3-amino-3-oxopropyl)benzoate can be prepared according to the method of Scheme 4 below. Among the compounds of formula (4), amine derivatives can be synthesized by introducing an amino group into a compound obtained through a cross-coupling reaction of a dioxaborolane core intermediate and various kinds of chloro aryl compounds to synthesize amino aryl intermediates. For example, ethyl 2-(4-(2-aminopyrimidin-4-yl)phenyl)acetate can be prepared according to the method of Scheme 5 below.
[0097] [Reaction Formula 4]
[0098]
[0099]
[0100] [Reaction Formula 5]
[0101]
[0102]
[0103] Compounds not specifically described in the manufacturing method of this specification are compounds known in themselves, or compounds that can be easily synthesized from known compounds using known synthetic methods or similar methods.
[0104] The compound of chemical formula (1) obtained through the above method can be separated or purified from the reaction product by various methods such as recrystallization, iontophoresis, silica gel column chromatography, or ion exchange resin chromatography.
[0105] As described above, the compound according to the present invention, the starting material or intermediate for its production, etc. can be synthesized by various methods, and these methods should be construed as being included in the scope of the present invention with respect to the production of the compound of formula (1).
[0106]
[0107] The compound of formula (1) according to the present invention has a diacylglycerol acyltransferase 2 (DGAT2) inhibitory effect. Accordingly, the present invention provides a pharmaceutical composition for treating a DGAT2-related disease, comprising the compound of formula (1), or a pharmaceutically acceptable salt or isomer thereof, together with a pharmaceutically acceptable carrier. In addition, various forms of prodrugs that are converted into the compound of formula (1) in vivo, depending on the purpose, are also included within the scope of the present invention.
[0108] DGAT2-related diseases that can be treated with the pharmaceutical composition according to the present invention may be selected from the group consisting of, but not limited to, fatty liver, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), diabetes, obesity, hyperlipidemia, atherosclerosis, and hypercholesterolemia.
[0109] In the present invention, the "pharmaceutical composition" may include other chemical components, such as carriers, diluents, excipients, etc., in addition to the active compound according to the present invention. Accordingly, the pharmaceutical composition may include pharmaceutically acceptable carriers, diluents, excipients, or combinations thereof, as needed. The pharmaceutical composition facilitates administration of the active compound into a living organism. Various techniques exist for administering the compound, including, but not limited to, oral, injection, aerosol, parenteral, and topical administration.
[0110] As used herein, the term "carrier" refers to a compound that facilitates the introduction of a compound into cells or tissues. For example, dimethyl sulfoxide (DMSO) is a common carrier that facilitates the introduction of many organic compounds into the cells or tissues of living organisms.
[0111] As used herein, a "diluent" is defined as a compound that not only stabilizes the biologically active form of the target compound but also dilutes the compound in water to dissolve it. Salts dissolved in buffers are used as diluents in the art. A commonly used buffer is phosphate-buffered saline, which mimics the salt form of human body fluids. Because buffer salts can control the pH of a solution at low concentrations, buffering diluents rarely alter the biological activity of a compound.
[0112] As used herein, “pharmaceutically acceptable” means a property that does not impair the biological activity and physical properties of the compound.
[0113] The compound of the present invention can be formulated into various pharmaceutical dosage forms, depending on the intended purpose. When preparing a pharmaceutical composition according to the present invention, the active ingredient, specifically the compound of formula (1) or a pharmaceutically acceptable salt or isomer thereof, is mixed with various pharmaceutically acceptable carriers, which can be selected depending on the desired formulation. For example, the pharmaceutical composition according to the present invention can be formulated into an injectable formulation, an oral formulation, etc., depending on the intended purpose.
[0114] The compound of the present invention may be formulated by a known method using known pharmaceutical carriers and excipients and placed in unit-dose or multi-dose containers. The formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, and may contain conventional dispersing agents, suspending agents, or stabilizers. Furthermore, it may be in the form of a dry powder, for example, dissolved in sterile, pyrogen-free water before use. The compound of the present invention may also be formulated in suppository form using a conventional suppository base such as cocoa butter or other glycerides. Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules, with capsules and tablets being particularly useful. Tablets and pills are preferably prepared with enteric coatings. Solid dosage forms can be prepared by mixing the compound of the present invention with one or more inert diluents such as sucrose, lactose, starch, etc. and carriers such as lubricants, disintegrants, binders, etc. such as magnesium stearate.
[0115] If necessary, the compound according to the present invention or a pharmaceutical composition containing the same may be administered in combination with other drugs, for example, other antidiabetic agents.
[0116] The dosage of the compound of formula (1) of the present invention is determined by a physician's prescription based on factors such as the patient's weight, age, and the specific nature and severity of the disease. However, the dosage required for adult treatment is typically in the range of about 0.3 to 500 mg per day, depending on the frequency and intensity of administration. When administered intramuscularly or intravenously to adults, a total daily dosage of about 1 to 300 mg, divided into single doses, is usually sufficient; however, a higher daily dosage may be desirable for some patients.
[0117] As used herein, “treatment” means stopping, delaying or alleviating the progression of a disease when applied to a subject exhibiting symptoms of the disease.
[0118] The novel biaryl derivative compound represented by chemical formula (1) according to the present invention can be usefully used for the prevention, improvement, or treatment of metabolic diseases related to diacylglycerol acyltransferase 2 (DGAT2) by inhibiting DGAT2. In addition, the novel biaryl derivative compound represented by chemical formula (1) according to the present invention exhibits increased lipophilicity and liver selectivity, thereby not only improving efficacy through increased exposure in the liver, but also providing an advantage of convenient administration for patients due to a relatively long half-life in disease animal models and clinical trials.
[0119] The present invention is described in more detail through the following manufacturing examples and examples. However, these examples are merely illustrative of the present invention and the scope of the present invention is not limited by them.
[0120] In the examples below, M represents molar concentration and N represents normal concentration. In addition, the explanations of abbreviations and terms used in the reaction formulas, manufacturing examples, and examples of this specification are as follows:
[0121] DCM: Dichloromethane
[0122] DIPEA:N, N-diisopropylethylamine
[0123] DMF:N, N-dimethylformamide
[0124] DMSO: dimethyl sulfoxide
[0125] NMP:N-methylpyrrolidone
[0126] Pd(dppf)Cl2.CH2Cl2: [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) dichloromethane complex (1:1)
[0127] TEA: Triethylamine
[0128] THF: Tetrahydrofuran
[0129] PyBroP: Bromotripyrrolidinophosphonium hexafluorophosphate
[0130]
[0131] Manufacturing Example 1: Synthesis of 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine
[0132]
[0133]
[0134] Step 1: Synthesis of 3-bromo-5-(2-ethoxyphenoxy)pyridine
[0135] At 0℃, 60% sodium hydride (1.82 g, 46 mmol) was added to NMP (100 ml), and 2-ethoxyphenol (6.1 g, 44 mmol) was slowly added dropwise under nitrogen. The reaction solution was stirred at room temperature for 1 hour, 3,5-dibromopyridine (7.2 g, 30.4 mmol) was added dropwise, and the mixture was stirred at 150℃ for 72 hours. After the reaction was completed, it was cooled to room temperature, diluted with water (120 ml), 5N sodium hydroxide aqueous solution (15 ml) was added, and extraction was performed with ether. After drying over magnesium sulfate, the solvent was removed under reduced pressure, and the residue was purified by column chromatography to obtain the desired product (yield 19.5%).
[0136] 1H NMR (500 MHz, CHLOROFORM-D): δ 8.32 (d, J = 1.2 Hz, 1H), 8.26 (d, J = 2.4 Hz, 1H), 7.28 (s, 1H), 7.20 (s, 1H), 7.09 (d, J = 7.9 Hz, 1H), 7.04-6.87 (m, 2H), 4.01 (t, J = 7.0 Hz, 2H), 1.24 (t, J = 7.0 Hz, 3H)
[0137]
[0138] Step 2: Synthesis of (5-(2-ethoxyphenoxy)pyridin-3-yl)boronic acid
[0139] 3-Bromo-5-(2-ethoxyphenoxy)pyridine (1.74 g, 5.92 mmol) obtained in step 1,
[0140] 4,4,4',4',5,5,5',5'-Octamethyl-2,2'-bi(1,3,2-dioxaborolane) (2.25 g, 8.87 mmol, 1.5 eq), potassium acetate (2.32 g, 23.66 mmol), and Pd(dppf)Cl2.CH2Cl2 (48 mg, 0.06 mmol) were added to toluene (30 mL) and stirred under reflux at 120°C for 12 h. After the reaction was completed, the mixture was filtered through a celite pad, washed with toluene, and the solvent was removed under reduced pressure. The mixture was then moved to the next reaction without any separate purification process.
[0141] m / z(M+H) + calculated for C 13 H 14 BNO4: 259.0, found 260.1
[0142]
[0143] Step 3: Synthesis of 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine
[0144] (5-(2-Ethoxyphenoxy)pyridin-3-yl)boronic acid (1.53 g, 5.92 mmol) obtained in step 2, 2,6-dichloropyrazine (0.97 g, 6.5 mmol, 1.1 eq), sodium carbonate (1.25 g, 11.81 mmol), and Pd(dppf)Cl2.CH2Cl2 (48 mg, 0.06 mmol) were added to 1,4-dioxane (20 mL) / water (1 ml) and refluxed at 120°C for 12 h. After completion of the reaction, the mixture was filtered through a pad of Celite, washed with toluene, and the solvent was removed under reduced pressure. The residue was purified by column chromatography to obtain the desired product (yield in two steps: 39%).
[0145] 1 H-NMR (400 MHz, CHLOROFORM-D) δ8.90 (s, 2H), 8.57 (s, 1H), 8.41 (d, j = 4 Hz, 1H), 7.81 (d, J = 4 Hz, 1H), 7.20 (m, 1H), 7.13 (m, 1H), 7.02 (m, 2H), 4.06 (q, 2H), 1.24 (t, 3H)
[0146]
[0147] Manufacturing Example 2: Synthesis of 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine
[0148]
[0149]
[0150] Step 1: Synthesis of 1-(3-bromophenoxy)-2-ethoxybenzene
[0151] 2-Ethoxyphenol (4.33 g, 31.4 mmol), 1-bromo-3-iodobenzene (6 ml, 47.1 mmol), copper(I) chloride (1.553 g, 15.69 mmol), 2,2,6,6-tetramethyl-3,5-heptadione (1.310 ml, 6.27 mmol), and cesium carbonate (10.22 g, 31.4 mmol) were dissolved in 70 ml of NMP and heated to 120°C. The mixture was stirred for 16 hours and then cooled to room temperature. The reaction was quenched with 1 N aqueous hydrochloric acid and extracted with diethyl ether. The organic layer was washed with brine, dried over magnesium sulfate, and the organic solvent was removed under reduced pressure. The desired product was obtained by purification using a silica gel column (ethyl acetate: hexane = 1:5) (yield 96%).
[0152] 1 H-NMR (500 MHz, CHLOROFORM-D) δ: 7.14-7.12 (m, 3H), 7.04-7.03 (m, 2H), 7.00-6.98 (m, 1H), 6.97-6.93 (m, 1H), 6.88-6.86 (m, 1H), 4.03 (q, 2H, J = 7.35 Hz), 1.26 (t, 3H, J = 7.03 Hz)
[0153]
[0154] Step 2: Synthesis of 2-(3-(2-ethoxyphenoxyphenyl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane
[0155] 1-(3-Bromophenoxy)-2-ethoxybenzene (1.74 g, 5.94 mmol) obtained in Step 1, 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (2.26 g, 8.90 mmol, 1.5 eq), potassium acetate (2.33 g, 23.74 mmol), and Pd(dppf)Cl2.CH2Cl2 (48 mg, 0.06 mmol) were added to toluene (30 mL) and refluxed at 120°C for 12 h. After the reaction was completed, the mixture was filtered through a pad of Celite, washed with toluene, and the solvent was removed under reduced pressure. The resulting mixture was purified by column chromatography to obtain the desired product (yield: 45%).
[0156] 1 H-NMR (500 MHz, CHLOROFORM-D): δ7.48 (d, 1H), 7.43 (s, 1H), 7.28 (t, 1H), 7.09 (t, 1H), 6.94 ~ 7.03 (m, 4H), 4.06 (q, 2H), 1.32 (s, 12H), 1.28 (t, 3H)
[0157]
[0158] Step 3: Synthesis of 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine
[0159] 2-(3-(2-ethoxyphenoxyphenyl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (0.9 g, 2.65 mmol), 2,6-dichloropyrazine (0.43 g, 2.91 mmol, 1.1 eq), sodium carbonate (0.56 g, 5.29 mmol), and Pd(dppf)Cl2.CH2Cl2 (22 mg, 0.03 mmol) obtained in step 2 were added to 1,4-dioxane (20 mL) / water (1 ml) and stirred under reflux at 120°C for 12 h. After the reaction was completed, the mixture was filtered through a pad of Celite, washed with toluene, and the solvent was removed under reduced pressure. The mixture was purified by column chromatography to obtain the desired product (yield 75%).
[0160] 1H-NMR (500 MHz, CHLOROFORM-D) δ8.85 (s, 1H), 8.49 (s, 1H), 7.68 (d, 1H), 7.61 (s, 1H), 7.40 (t, 1H), 7.14 (t, 1H), 7.05 (d, J = 6 Hz, 1H), 7.02 (d, J = 6 Hz, 2H), 6.95 (t, 1H), 4.05 (q, 2H), 1.26 (t, 3H)
[0161]
[0162] Manufacturing Example 3: Synthesis of 2-chloro-6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazine
[0163]
[0164]
[0165] The desired product was obtained (yield 44.9%) in a similar manner to Preparation Example 2 using 2-ethoxyphenol (1.5 g, 10.86 mmol) and 2,6-dibromopyridine (3.86 g, 16.28 mmol).
[0166] m / z(M+H)+ calculated for C 17 H 14 ClN3O2: 327.77, found 328.0
[0167]
[0168] Manufacturing Example 4: Synthesis of 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine
[0169]
[0170]
[0171] Step 1: Synthesis of 3-ethoxypyridine 1-oxide
[0172] 3-Ethoxypyridine (1.683 g, 13.67 mmol) was dissolved in DCM (32.5 mL), m-chloroperoxybenzoic acid (3.07 g, 17.77 mmol) was added at 10°C, and the mixture was stirred at room temperature for 22 h. Sodium thiosulfate was added, and the mixture was stirred at 15°C for 3 h. After the reaction was completed, extraction was performed with DCM. The solvent was removed under reduced pressure, and the mixture was purified by column chromatography to obtain the desired product (yield 87%).
[0173] 1H-NMR (500 MHz, CHLOROFORM-D) δ7.96 (t, J = 2.0 Hz, 1H), 7.92-7.83 (m, 1H), 7.15 (dd, J = 8.7, 6.3 Hz, 1H), 6.86 (dd, J = 8.5, 2.1 Hz, 1H), 4.05 (q, J = 7.0 Hz, 2H), 1.44 (t, J = 6.9 Hz, 3H)
[0174]
[0175] Step 2: Synthesis of 2-(3-bromophenoxy)-3-ethoxypyridine
[0176] 3-Ethoxypyridine 1-oxide (825 mg, 5.93 mmol) and 3-bromophenol (1.02 g, 5.93 mmol) obtained in Step 1 were dissolved in THF (19 mL), DIPEA (3.83 mL, 21.94 mmol) and PyBroP (3.59 g, 7.71 mmol) were added, and the mixture was stirred at room temperature for 17 h. After the reaction was completed, the mixture was concentrated under reduced pressure, diluted with DCM, and the organic layer was washed with 1 N aqueous sodium hydroxide solution. The mixture was dried over magnesium sulfate, the organic solvent was removed under reduced pressure, and the mixture was purified by silica gel column chromatography to obtain the desired product (yield 88%).
[0177] 1H-NMR (400 MHz, CHLOROFORM-D): δ7.73 (dd, J = 5.0, 1.4 Hz, 1H), 7.28 (td, J = 3.4, 1.8 Hz, 2H), 7.24-7.19 (m, 2H), 7.12-7.02 (m, 2H), 7.02-6.91 (m, 1H), 6.82-6.66 (m, 1H), 4.13 (q, J = 7.0 Hz, 2H), 1.46 (td, J = 7.1, 4.6 Hz, 3H)
[0178]
[0179] Step 3: Synthesis of 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine
[0180] The desired product was obtained (yield 24.4%) in a similar manner to steps 2 and 3 of Preparation Example 2 using 2-(3-bromophenoxy)-3-ethoxypyridine (1.54 g, 5.24 mmol) obtained in step 2.
[0181] 1 H-NMR (400 MHz, CHLOROFORM-D): δ8.90 (s, 1H), 8.49 (s, 1H), 7.84 (dd, J = 8.7, 1.4 Hz, 2H), 7.71 (dd, J = 4.8, 1.6 Hz, 1H), 7.52 (t, J = 7.8 Hz, 1H), 7.33-7.26 (m, 1H), 7.24-7.15 (m, 1H), 6.98 (dd, J = 7.8, 5.0 Hz, 1H), 4.17 (q, J = 7.0 Hz, 2H), 1.48 (t, J = 7.1 Hz, 3H)
[0182]
[0183] Manufacturing Example 5: Synthesis of 3-phenylpropanamide
[0184]
[0185]
[0186] 3-Phenylpropanoyl chloride (4.5 ml, 30.3 mmol) dissolved in THF (46 mL) was added dropwise to ammonia water (189 mL) at 0°C and stirred for 1 hour. The organic solvent was removed under reduced pressure, diluted with water, and extracted with ethyl acetate. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. The desired product was obtained by purification using a silica gel column (yield 100%).
[0187] 1 H-NMR (500 MHz, CHLOROFORM-D): δ 7.29-7.25 (m, 2H), 7.22-7.20 (m, 3H), 5.44 (s, 1H), 5.35 (s, 1H), 2.97 (t, J = 7.6 Hz, 2H), 2.53 (t, J = 7.6 Hz, 2H)
[0188]
[0189] Manufacturing Example 6: Synthesis of methyl 2-(4-(2-amino-2-oxoethyl)phenyl)acetate
[0190]
[0191]
[0192] Step 1: Synthesis of dimethyl 2,2'-(1,4-phenylene)diacetate
[0193] Acetyl chloride (2.9 mL, 40.8 mmol) was slowly added dropwise to methanol (20 mL) at 0°C. 1,4-Phenylenediacetic acid (4.0 g, 20.6 mmol) was then dissolved and the mixture was refluxed for 5 hours. After confirming the completion of the reaction by TLC, the mixture was cooled to room temperature and the organic solvent was removed under reduced pressure. The reaction mixture was diluted with 100 mL of ethyl acetate, washed with an aqueous sodium bicarbonate solution and brine, dried over magnesium sulfate, and then removed under reduced pressure to obtain the desired product.
[0194] 1H-NMR (500 MHz, CHLOROFORM-D): δ7.24 (s, 2H), 3.68 (s, 3H), 3.61 (s, 2H)
[0195]
[0196] Step 2: Synthesis of 2-(4-(2-methoxy-2-oxoethyl)phenyl)acetic acid
[0197] Dimethyl 2,2'-(1,4-phenylene) diacetate (4.58 g, 20.6 mmol) obtained in Step 1 was dissolved in THF (30 mL) and methanol (10 mL). 10 mL of 2N sodium hydroxide was slowly added dropwise, followed by stirring at room temperature for 3 hours. The organic solvent was removed under reduced pressure, diluted with water, and acidified with 2N hydrochloric acid solution. After extraction with ethyl acetate, the organic solvent was dried over magnesium sulfate, and removed under reduced pressure. The desired product was obtained through recrystallization (yield 30%).
[0198] 1 H-NMR (500 MHz, CHLOROFORM-D): δ7.25 (d, J = 4.9 Hz, 4H), 3.68 (s, 3H), 3.66-3.62 (2H), 3.61 (s, 2H)
[0199]
[0200] Step 3: Synthesis of methyl 2-(4-carbamoylphenoxy)-2-methylpropanoate
[0201] 2-(4-(2-methoxy-2-oxoethyl)phenyl)acetic acid (1.0 g, 4.8 mmol) obtained in Step 2 was dissolved in 30 mL of dichloromethane, and thionyl chloride (0.7 ml, 9.6 mmol) was slowly added dropwise at room temperature. After stirring at room temperature for 4 hours, the organic solvent was removed under reduced pressure, and the mixture was dissolved in 5 mL of THF, followed by slow dropwise addition to 25% aqueous ammonia solution at 0°C. After stirring for 1 hour, the resulting solid was filtered to obtain the desired product (yield 74%).
[0202] 1H-NMR (500 MHz, DMSO-D6): δ7.42 (s, 1H), 7.15 (dd, J = 12.2, 7.9 Hz, 4H), 6.83 (s, 1H), 3.60 (s, 2H), 3.57 (d, J = 4.3 Hz, 3H), 3.30 (s, 2H)
[0203]
[0204] Manufacturing Example 7: Synthesis of methyl 2-(4-(3-amino-3-oxopropyl)phenyl)acetate
[0205]
[0206]
[0207] Step 1: Synthesis of tert-butyl (E)-3-(4-(2-methoxy-2-oxoethyl)phenyl)acrylate
[0208] Methyl 2-(4-bromophenyl)acetate (16.4 g, 71.56 mmol), tert-butyl acrylate (18.0 g, 143.0 mmol), and triethylamine (50 mL, 0.35 mol) were dissolved in 200 mL of dimethylformamide, and dissolved oxygen was removed by bubbling nitrogen. Bis(triphenylphosphine)palladium dichloride (2.5 g, 3.58 mmol) was added dropwise and stirred at 75°C for 12 h. The organic solvent was removed under reduced pressure, diluted with ethyl acetate, washed with brine, dried over magnesium sulfate, and then the organic solvent was removed under reduced pressure. The desired product was obtained by purification using a silica gel column (ethyl acetate: hexane = 1:3) (yield 79%).
[0209] 1 H-NMR (500 MHz, CHLOROFORM-D): δ7.56 (d, J = 15.9 Hz, 1H), 7.46 (d, J = 8.7 Hz, 2H), 7.28 (d, J = 7.9 Hz, 2H), 6.34 (d, J = 15.9 Hz, 1H), 3.70 (s, 3H), 3.64 (s, 2H), 1.53 (s, 9H)
[0210]
[0211] Step 2: Synthesis of tert-butyl 3-(4-(2-methoxy-2-oxoethyl)phenyl)propanoate
[0212] Tert-Butyl (E)-3-(4-(2-methoxy-2-oxoethyl)phenyl)acrylate (5.0 g, 18.0 mmol) obtained in Step 1 was dissolved in 50 mL of methanol, and pallatium charcoal (0.5 g, 0.452 mmol) was added dropwise, followed by reduction using a hydrogen balloon. After confirming the completion of the reaction, the residue was filtered through a celite pad and the organic solvent was removed under reduced pressure to obtain the desired product (yield 93%).
[0213] 1 H-NMR (500 MHz, CHLOROFORM-D): δ7.17 (dd, J = 18.3, 7.9 Hz, 4H), 3.68 (s, 3H), 3.59 (s, 2H), 2.88 (t, J = 7.9 Hz, 2H), 2.52 (t, J = 7.6 Hz, 2H), 1.41 (s, 9H)
[0214]
[0215] Step 3: Synthesis of 3-(4-(2-methoxy-2-oxoethyl)phenyl)propanoic acid
[0216] Tert-Butyl 3-(4-(2-methoxy-2-oxoethyl)phenyl)propanoate (4.67 g, 16.8 mmol) obtained in step 2 was dissolved in 100 mL of a 20% trifluoroacetic acid / dichloromethane solution and stirred at room temperature for 2 hours. After confirming the completion of the reaction, the organic solvent was removed under reduced pressure, and the desired product was obtained through recrystallization (yield 100%).
[0217] 1H-NMR (500 MHz, CHLOROFORM-D): δ9.58 (s, 2H), 7.18 (dd, J = 19.0, 7.9 Hz, 4H), 3.70 (s, 3H), 3.61 (s, 2H), 2.95 (t, J = 7.6 Hz, 2H), 2.69 (t, J = 7.9 Hz, 2H)
[0218]
[0219] Step 4: Synthesis of methyl 2-(4-(3-amino-3-oxopropyl)phenyl)acetate
[0220] The desired product was obtained through an amidation reaction using 3-(4-(2-methoxy-2-oxoethyl)phenyl)propanoic acid (3.73 g, 16.8 mmol) obtained in step 3 in a similar manner to step 3 of Preparation Example 6 (yield 65%).
[0221] 1 H-NMR (500 MHz, CHLOROFORM-D): δ7.18 (q, J = 7.7 Hz, 4H), 5.41 (s, 2H), 3.66 (d, J = 15.9 Hz, 3H), 3.59 (s, 2H), 3.02-2.87 (2H), 2.51 (t, J = 7.6 Hz, 2H)
[0222]
[0223] Manufacturing Example 8: Synthesis of methyl 2-(4-(3-amino-3-oxopropyl)phenyl-2-methylpropanoate
[0224]
[0225]
[0226] Step 1: Synthesis of tert-butyl (E)-3-(4-(1-methoxy-2-methyl-1-oxopropan-2-yl)phenyl)acrylate
[0227] The desired product was obtained (yield 79%) in a similar manner to step 1 of Preparation Example 7 using methyl 2-(4-bromophenyl)-2-methylpropanoate (1.0 g, 3.89 mmol) and tert-butyl acrylate (0.98 g, 7.8 mmol).
[0228] 1 H-NMR (500 MHz, CHLOROFORM-D): δ7.56 (dd, J = 15.9, 4.3 Hz, 1H), 7.51-7.42 (2H), 7.41-7.31 (m, 2H), 6.34 (dd, J = 15.9, 4.9 Hz, 1H), 3.66 (d, J = 4.9 Hz, 3H), 1.58 (d, J = 4.9 Hz, 6H), 1.53 (d, J = 4.9 Hz, 9H)
[0229]
[0230] Step 2: Synthesis of methyl 2-(4-(3-(tert-butoxy)-3-oxopropyl)phenyl)-2-methylpropanoate
[0231] The desired product was obtained through a reduction reaction in a similar manner to step 2 of Preparation Example 7 using tert-butyl (E)-3-(4-(1-methoxy-2-methyl-1-oxopropan-2-yl)phenyl)acrylate (0.93 g, 3.06 mmol) obtained in step 1 (yield 96%).
[0232] 1 H-NMR (500 MHz, CHLOROFORM-D): δ7.23 (s, 2H), 7.15 (d, J = 7.9 Hz, 2H), 3.63 (s, 3H), 2.87 (t, J = 7.9 Hz, 2H), 2.52 (t, J = 7.9 Hz, 2H), 1.55 (s, 6H), 1.40 (s, 9H)
[0233]
[0234] Step 3: Synthesis of 3-(4-(1-methoxy-2-methyl-1-oxopropan-2-yl)phenyl)propanoic acid
[0235] The desired product was obtained (yield 96%) in a similar manner to step 3 of Preparation Example 7 using methyl 2-(4-(3-(tert-butoxy)-3-oxopropyl)phenyl)-2-methylpropanoate (0.90 g, 2.92 mmol) obtained in step 2.
[0236] 1 H-NMR (500 MHz, CHLOROFORM-D): δ7.26 (d, J = 7.3 Hz, 2H), 7.16 (d, J = 7.9 Hz, 2H), 3.66 (s, 3H), 3.03-2.84 (2H), 2.82-2.55 (2H), 1.56 (s, 6H)
[0237]
[0238] Step 4: Synthesis of methyl 2-(4-(3-amino-3-oxopropyl)phenyl)-2-methylpropanoate
[0239] The desired product was obtained through an amidation reaction in a similar manner to step 3 of Preparation Example 6 using 3-(4-(1-methoxy-2-methyl-1-oxopropan-2-yl)phenyl)propanoic acid (0.7 g, 2.8 mmol) obtained in step 3 (yield 99%).
[0240] 1 H-NMR (500 MHz, CHLOROFORM-D): δ7.25 (dd, J = 6.4, 2.1 Hz, 2H), 7.17 (d, J = 7.9 Hz, 2H), 5.36 (s, 2H), 3.64 (s, 3H), 3.00-2.90 (2H), 2.52 (t, J = 7.6 Hz, 2H), 1.56 (d, J = 4.3 Hz, 6H)
[0241]
[0242] Manufacturing Example 9: Synthesis of 2-(4-(2-ethoxy-1,1-difluoro-2-oxoethyl)phenyl)acetic acid
[0243]
[0244]
[0245] Step 1: Synthesis of tert-butyl 2-(4-iodophenyl)acetate
[0246] 2-(4-Iodophenyl)acetic acid (13.0 g, 49.6 mmol) was mixed with tert-butanol (130 mL) and stirred under nitrogen bubbling until transparent. Di-tert-butyl dicarbonate (10.83 g, 49.6 mmol) was added and stirred until dissolved. 4-dimethylaminopyridine (6.06 g, 49.6 mmol) was added and stirred at room temperature for 1 hour. The organic solvent was concentrated under reduced pressure and purified using a silica gel column (ethyl acetate:n-hexane = 1:9) to obtain the desired product (yield 68.9%).
[0247] 1 H-NMR (500 MHz, CHLOROFORM-D): δ 7.63 (d, J = 7.95 Hz, 2H), 7.01 (d, J = 8.55 Hz, 2H), 3.45 (s, 2H), 1.42 (s, 9H)
[0248]
[0249] Step 2: Synthesis of ethyl 2-(4-(2-(tert-butoxy)-2-oxoethyl)phenyl)-2,2-difluoroacetate
[0250] Tert-Butyl 2-(4-iodophenyl)acetate (8.4 g, 26.4 mmol) and 2-bromo-2,2-difluoroacetate (5.36 g, 26.4 mmol) obtained in Step 1 were added to activated copper powder (4.37 g, 68.6 mmol) dissolved in DMSO (80 mL). The mixture was stirred at 60°C for 12 h, poured onto ice and aqueous ammonium chloride solution, and extracted with diethyl ether. The organic layer was washed with aqueous ammonium chloride solution and brine, and then dried over magnesium sulfate. The organic layer was concentrated under reduced pressure and purified using a silica gel column (ethyl acetate: n-hexane = 1:9) to obtain the desired product (yield 60%).
[0251] 1H-NMR (400 MHz, CHLOROFORM-D): δ 7.56 (d, J = 8 Hz, 2H), 7.36 (d, J = 8 Hz, 2H), 4.31 (q, J = 8 Hz, 2H), 1.44 (s, 9H), 1.30 (t, J = 8 Hz, 3H)
[0252]
[0253] Step 3: Synthesis of 2-(4-(2-ethoxy-1,1-difluoro-2-oxoethyl)phenyl)acetic acid
[0254] Ethyl 2-(4-(2-(tert-butoxy)-2-oxoethyl)phenyl)-2,2-difluoroacetate (5 g, 15.91 mmol) obtained in Step 2 was dissolved in DCM (10 mL), then trifluoroacetic acid (15 mL) dissolved in DCM (50 mL) was added, and the mixture was stirred at room temperature for 1 h. Toluene was added, and the solvent was removed under reduced pressure to obtain the desired product without further purification (yield 100%).
[0255] 1 H-NMR (500 MHz, CHLOROFORM-D): δ 7.58 (d, J = 7.95 Hz, 2H), 7.37 (d, J = 7.95 Hz, 2H), 4.28 (q, J = 6.7 Hz, 2H), 3.69 (s, 2H), 1.30 (t, J = 7.03) Hz, 3H)
[0256]
[0257] Manufacturing Example 10: Synthesis of tert-butyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate
[0258]
[0259]
[0260] Step 1: Synthesis of 2-(4-(3-tert-butoxy-2,2-dimethyl-3-oxopropyl)phenyl)acetic acid
[0261] Diisopropylamine (14.0 ml, 98 mmol) was added to anhydrous tetrahydrofuran (164 mL), and 2.5Mn-butyllithium (39.3 ml, 98 mmol) was slowly added dropwise at -78°C. The reaction solution was stirred at the same temperature for 20 minutes. The temperature was raised to room temperature and stirred for 10 minutes, then lowered to -78°C and stirred for 10 minutes. tert-Butyl isobutyrate (14.16 g, 98 mmol) dissolved in anhydrous tetrahydrofuran (163 mL) was added dropwise to the reaction solution. The reaction solution was stirred at -78°C for 1 hour, and 2-(4-(bromomethyl)phenyl)acetic acid (7.5 g, 32.7 mmol) dissolved in anhydrous tetrahydrofuran (163 mL) was slowly added dropwise. The reaction solution was warmed to room temperature and stirred for 20 minutes. 1N aqueous hydrochloric acid solution (100 mL) was added to the reaction solution to quench the reaction, and the mixture was extracted with diethyl ether. The organic layer was concentrated under reduced pressure and then purified using a silica gel column (methanol:dichloromethane = 1:9) to obtain the desired product (yield 92%).
[0262] 1 H-NMR (500 MHz, CHLOROFORM-D): δ7.20 (d, J = 7.9 Hz, 2H), 7.14 (d, J = 7.9 Hz, 2H), 3.64 (s, 2H), 2.83 (s, 2H), 1.63-1.40 (m, 9H), 1.18-1.06 (6H)
[0263]
[0264] Step 2: Synthesis of tert-butyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate
[0265] The desired product was obtained (yield 52.7%) in a similar manner to step 3 of Preparation Example 6 using 2-(4-(3-tert-butoxy-2,2-dimethyl-3-oxopropyl)phenyl)acetic acid (6.82 g, 23.33 mmol) obtained in step 1.
[0266] 1 H-NMR (400 MHz, CHLOROFORM-D): δ7.20-7.09 (m, 4H), 5.33 (d, J = 36.1 Hz, 2H), 3.54 (s, 2H), 2.80 (s, 2H), 1.42 (s, 9H), 1.11 (s, 6H)
[0267]
[0268] Manufacturing Example 11: Synthesis of ethyl (R)-1-(2-aminopyrimidin-4-yl)piperidine-3-carboxylate
[0269]
[0270]
[0271] Step 1: Synthesis of ethyl (R)-1-(2-chloropyrimidin-4-yl)piperidine-3-carboxylate
[0272] 2,4-Dichloropyrimidine (0.5 g, 3.36 mmol) was dissolved in ethanol (6.71 mL), and ethyl (R)-piperidine-3-carboxylate (0.621 mL, 4.03 mmol) and TEA (0.187 mL, 1.343 mmol) were added. The mixture was stirred at 85°C for 3 h. The solvent was removed under reduced pressure, and the residue was dissolved in ethyl acetate and washed with water. The desired product was obtained by purification using a silica gel column (yield 86%).
[0273] 1 H-NMR (500 MHz, CHLOROFORM-D): δ 8.05 (d, J = 6.1 Hz, 1H), 6.47 (d, J = 6.4 Hz, 1H), 4.51-4.11 (m, 3H), 4.06 (s, 1H), 3.43 (dd, J = 13.4, 9.5 Hz, 1H), 3.36-3.21 (m, 1H), 2.67-2.46 (m, 1H), 2.22-2.03 (m, 1H), 1.96-1.79 (m, 2H), 1.69-1.59 (m, 1H), 1.33-1.23 (m, 3H)
[0274]
[0275] Step 2: Synthesis of ethyl (R)-1-(2-((tert-butoxycarbonyl)amino)pyrimidin-4-yl)piperidine-3-carboxylate
[0276] Ethyl (R)-1-(2-chloropyrimidin-4-yl)piperidine-3-carboxylate (0.78 g, 2.89 mmol), tert-butyl carbamate (0.407 g, 3.47 mmol), cesium carbonate (2.36 g, 7.23 mmol), 4,5-bis(diphenylphosphino)-9,9-dimethylxanthine (0.201 g, 0.347 mmol), and tris(dibenzylideneacetone)dipalladium(0) (0.265 g, 0.289 mmol) obtained in Step 1 were dissolved in 50 mL of 1,4-dioxane, and dissolved oxygen was removed by bubbling nitrogen while stirring, and then the outside air was blocked in a sealed vessel. The reaction mass was stirred at 145°C for 6 hours and then cooled to room temperature. After filtration through a pad of Celite and removal of the organic solvent under reduced pressure, the residue was dissolved in ethyl acetate and washed with brine. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. The desired product was obtained by purification using a silica gel column (yield 11.8%).
[0277] m / z(M+H)+ calculated for C17H26N4O4: 350.42, found 351.2
[0278]
[0279] Step 3: Synthesis of ethyl (R)-1-(2-aminopyrimidin-4-yl)piperidine-3-carboxylate
[0280] Ethyl (R)-1-(2-((tert-butoxycarbonyl)amino)pyrimidin-4-yl)piperidine-3-carboxylate (0.120 g, 0.342 mmol) obtained in Step 2 was dissolved in DCM (3 mL), then trifluoroacetic acid (0.3 mL) dissolved in DCM was added, and the mixture was stirred at room temperature for 2 h. The solvent was removed under reduced pressure, the mixture was dissolved in DCM, and the mixture was washed with water. The desired product was obtained by purification using a silica gel column (yield 58.3%).
[0281] 1 H-NMR (500MHz, CHLOROFORM-D): δ7.68 (d, J = 6.7 Hz, 1H), 6.49-6.21 (1H), 6.07 (d, J = 6.7 Hz, 1H), 4.31 (d, J = 13.1 Hz, 1H), 4.16 (q, J = 7.1 Hz, 2H), 4.01 (d, J = 13.1 Hz, 1H), 3.43-3.30 (1H), 3.30-3.16 (1H), 2.63-2.47 (m, 1H), 2.19-2.03 (m, 1H), 1.91-1.76 (m, 2H), 1.65-1.46 (m, 1H), 1.26 (t, J = 7.0 Hz, 3H)
[0282]
[0283] Manufacturing Example 12: Synthesis of tert-butyl 3-(3-(6-aminopyridin-2-yl)phenyl)-2,2-dimethylpropanoate
[0284]
[0285]
[0286] Step 1: Synthesis of tert-butyl 3-(3-bromophenyl)-2,2-dimethylpropanoate
[0287] The desired product was obtained (yield 77%) in a similar manner as in step 1 of Preparation Example 10 using 1-bromo-3-(bromomethyl)benzene (20.0 g, 80 mmol).
[0288] 1H-NMR (400 MHz, CHLOROFORM-D): δ7.37-7.30 (m, 2H), 7.16-7.04 (m, 2H), 2.78 (s, 2H), 1.44 (s, 9H), 1.13 (s, 6H)
[0289]
[0290] Step 2: Synthesis of tert-butyl 2,2-dimethyl-3-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl-propanoate
[0291] Tert-Butyl 3-(3-bromophenyl)-2,2-dimethylpropanoate (19.3 g, 61.6 mmol) obtained in Step 1, 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (18.78 g, 73.9 mmol), potassium acetate (18.14 g, 185 mmol), and Pd(dppf)Cl2.CH2Cl2 (2.52 g, 3.08 mmol) were dissolved in 616 mL of 1,4-dioxane, and the mixture was stirred, bubbling nitrogen to remove dissolved oxygen, and then the outside air was blocked in a sealed vessel. The reaction mixture was stirred at 110°C for 16 hours and then cooled to room temperature. After filtration through a celite pad and removal of the organic solvent under reduced pressure, the desired product was obtained by purification with a silica gel column (ethyl acetate:hexane) (yield 69.8%).
[0292] 1 H-NMR (400 MHz, CHLOROFORM-D): δ7.72-7.55 (m, 2H), 7.26-7.17 (m, 2H), 2.83 (s, 2H), 1.45 (s, 9H), 1.33 (s, 12H), 1.13 (s, 6H)
[0293]
[0294] Step 3: Synthesis of tert-butyl 3-(3-(6-aminopyridin-2-yl)-phenyl)-2,2-dimethylpropanoate
[0295] 6-Chloropyridin-2-amine (5.53 g, 43 mmol) and tert-butyl 2,2-dimethyl-3-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl-propanoate (15.5 g, 43 mmol) synthesized in step 2, 2 M sodium carbonate aqueous solution (64.5 ml, 129 mmol) and bis(triphenylphosphino)dichloropalladium (3.02 g, 4.30 mmol) were dissolved in 358 mL of dimethoxyethane, and dissolved in nitrogen bubbling to remove dissolved oxygen while stirring, and then the outside air was blocked in a sealed vessel. The reaction mixture was stirred at 100°C for 16 h and then cooled to room temperature. After filtration through a Celite pad and removal of the organic solvent under reduced pressure, the residue was dissolved in ethyl acetate. Washed with brine. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. Purification using a silica gel column (ethyl acetate:hexane) yielded the desired product (yield 41.6%).
[0296] m / z(M+H)+ calculated for C 20 H 26 N2O2: 326.44, found 327.2
[0297]
[0298] Manufacturing Example 13: Synthesis of tert-butyl 2-(4-(3-amino-3-oxopropyl)phenoxy)-2-methylpropanoate
[0299]
[0300]
[0301] Step 1: Synthesis of tert-butyl 2-(4-(3-methoxy-3-oxopropyl)phenoxy)-2-methylpropanoate
[0302] Methyl 3-(4-hydroxyphenyl)propanoate (2.17 g, 12.04 mmol), magnesium sulfate (0.29 g, 2.41 mmol), and potassium carbonate (6.66 g, 48.2 mmol) were dissolved in DMF (30.1 mL), and tert-butyl 2-bromo-2-methylpropanoate (9.40 g, 42.1 mmol) was further added. The reaction mixture was stirred at 75°C for 16 h and then cooled to room temperature. The mixture was filtered through a pad of Celite, and the organic solvent was removed under reduced pressure. The residue was dissolved in ethyl acetate and washed with brine. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. The desired product was obtained by purification using a silica gel column (ethyl acetate:hexane) (yield 62%).
[0303]
[0304] Step 2: Synthesis of 3-(4-((1-(tert-butoxy)-2-methyl-1-oxopropan-2-yl)oxy)phenyl)propanoic acid
[0305] tert-Butyl 2-(4-(3-methoxy-3-oxopropyl)phenoxy)-2-methylpropanoate (2.4 g, 7.44 mmol) was dissolved in THF (15 mL) and methanol (15 mL), 1N sodium hydroxide (15 mL) was added, and the mixture was stirred at room temperature for 6 h. The reaction mixture was acidified with aqueous hydrochloric acid, extracted with ethyl acetate, and washed with brine. The organic solvent was dried over magnesium sulfate and removed under reduced pressure (yield 100%).
[0306]
[0307] Step 3: Synthesis of tert-butyl 2-(4-(3-amino-3-oxopropyl)phenoxy)-2-methylpropanoate
[0308] 3-(4-((1-(tert-butoxy)-2-methyl-1-oxopropan-2-yl)oxy)phenyl)propanoic acid (2.30 g, 7.46 mmol) was dissolved in DCM (37 mL), and oxalyl chloride (1.31 mL, 14.92 mmol) and DMF (0.058 mL, 0.75 mmol) were further added at room temperature. The reaction mixture was stirred at room temperature for 30 min, the solvent was removed under reduced pressure, and THF (19 mL) was added. The temperature was lowered to 0°C, and 25% ammonium hydroxide (8.71 mL, 224 mmol) was slowly added dropwise. The reaction mixture was extracted with ethyl acetate after removing the organic solvent under reduced pressure, and washed with brine. The organic solvent was dried over magnesium sulfate and removed under reduced pressure to obtain the desired product (yield 87%).
[0309] 1 H-NMR (400 MHz, CHLOROFORM-D): δ7.11-7.01 (m, 2H), 6.77 (dt, J = 9.3, 2.5 Hz, 2H), 5.33 (s, 2H), 2.89 (t, J = 7.5 Hz, 2H), 2.53-2.44 (m, 2H), 1.53 (s, 6H), 1.43 (s, 9H)
[0310]
[0311] Manufacturing Example 14: Synthesis of benzyl 2-(4-(3-amino-3-oxopropyl)phenyl)-2-methylpropanoate
[0312]
[0313]
[0314] 2-(4-Bromophenyl)-2-methylpropanoic acid (5.00 g, 20.57 mmol) and benzyl bromide (4.22 g, 24.68 mmol) were sequentially prepared in a similar manner to Step 1 of Preparation Example 13, Steps 1, 3, and 4 of Preparation Example 7 to obtain the desired product (yield 60%).
[0315] 1H-NMR (400 MHz, CHLOROFORM-D): δ7.66-7.59 (m, 1H), 7.54-7.40 (m, 2H), 7.40-7.25 (m, 5H), 7.19-7.10 (m, 2H), 6.47-6.40 (m, 1H), 5.61 (s, 2H), 5.09 (s, 2H), 1.59 (s, 6H)
[0316]
[0317] Manufacturing Example 15: Synthesis of tert-butyl 3-(4-(1-amino-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate
[0318]
[0319]
[0320] Step 1: Synthesis of tert-butyl 3-(4-(1-methoxy-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate
[0321] Methyl 2-(4-(bromomethyl)phenyl)-2-methylpropanoate (5.40 g, 19.91 mmol) and tert-butyl isobutyrate (3.45 g, 23.90 mmol) were prepared in a similar manner to step 1 of Preparation Example 10 to obtain the desired product (yield 78%).
[0322] 1 H-NMR (400 MHz, CHLOROFORM-D): δ7.20 (d, J = 8.2 Hz, 2H), 7.09 (d, J = 8.2 Hz, 2H), 3.63 (s, 3H), 2.78 (s, 2H), 1.54 (s, 6H), 1.41 (s, 9H), 1.11 (s, 6H)
[0323]
[0324] Step 2: Synthesis of tert-butyl 3-(4-(1-amino-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate
[0325] Tert-butyl 3-(4-(1-methoxy-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.50 g, 1.50 mmol) obtained in step 1 was sequentially processed in a similar manner to steps 2 and 3 of Preparation Example 13 to obtain the desired product (yield 76%).
[0326] 1 H-NMR (400 MHz, CHLOROFORM-D): δ7.25 (d, J = 8.2 Hz, 2H), 7.11 (d, J = 8.2 Hz, 2H), 5.85 (s, 1H), 5.31 (s, 1H), 2.78 (s, 2H), 1.53 (s, 6H), 1.41 (s, 9H), 1.10 (s, 6H)
[0327]
[0328] Manufacturing Example 16: Synthesis of tert-butyl 2-(4-(2-amino-2-oxoethyl)phenoxy)-2-methylpropanoate
[0329]
[0330]
[0331] The desired product was obtained (yield 54%) using a method similar to Preparation Example 13 using methyl 2-(4-hydroxyphenyl)acetate (2.00 g, 12.04 mmol) and tert-butyl 2-bromo-2-methylpropanoate (9.40 g, 42.1 mmol).
[0332] 1 H-NMR (400 MHz, CHLOROFORM-D): δ7.12 (dd, J = 11.4, 2.7 Hz, 2H), 6.83 (td, J = 5.7, 3.7 Hz, 2H), 5.43 (d, J = 26.5 Hz, 2H), 3.50 (s, 2H), 1.57-1.50 (m, 6H), 1.45-1.37 (m, 9H)
[0333]
[0334] Manufacturing Example 17: Synthesis of ethyl 2-(4-(2-aminopyrimidin-4-yl)phenyl)acetate
[0335]
[0336]
[0337] The desired product was obtained (yield 17.2%) in a similar manner to steps 2 and 3 of Preparation Example 12 and steps 2 and 3 of Preparation Example 11 using ethyl 2-(4-bromophenyl)acetate (27.6 g, 114 mmol).
[0338] m / z(M+H) + calculated for C 14 H 15 N3O2: 257.29, found 258.1
[0339]
[0340] Manufacturing Example 18: Synthesis of methyl (1r,4r)-4-((2-aminopyrimidin-4-yl)oxy)cyclohexane-1-carboxylate
[0341]
[0342]
[0343] Step 1: Synthesis of methyl (1r,4r)-4-hydroxycyclohexane-1-carboxylate
[0344] (1r,4r)-4-Hydroxycyclohexane-1-carboxylic acid (0.300 g, 2.081 mmol) was dissolved in methanol (10 mL), and sulfuric acid (0.017 mL, 0.312 mmol) was added. After stirring at 60°C for 16 h, the organic solvent was removed under reduced pressure, and the mixture was purified using a silica gel column to obtain the desired product (yield 100%).
[0345] 1H-NMR (400 MHz, CHLOROFORM-D): δ8.25 (d, J = 5.9 Hz, 1H), 6.64-6.50 (m, 1H), 5.16-5.05 (1H), 3.73-3.62 (m, 3H), 2.35 (tt, J = 11.4, 3.7 Hz, 1H), 2.18 (dt, J = 12.8, 3.5 Hz, 2H), 2.07 (dd, J = 14.2, 3.7 Hz, 2H), 1.74-1.56 (m, 2H), 1.49 (ddd, J = 23.0, 12.7, 3.5 Hz, 2H)
[0346]
[0347] Step 2: Synthesis of methyl (1r,4r)-4-((2-chloropyrimidin-4-yl)oxy)cyclohexane-1-carboxylate
[0348] 2,4-Dichloropyrimidine (0.28 g, 1.91 mmol) was dissolved in DMF (10 mL), and methyl (1r,4r)-4-hydroxycyclohexane-1-carboxylate (0.33 g, 2.10 mmol) and cesium carbonate (2.56 g, 4.78 mmol) obtained in Step 1 were added. After stirring at 80°C for 3 h, the mixture was diluted with diethyl ether and washed with water. The organic solvent was dried over magnesium sulfate and purified using a silica gel column to obtain the desired product (yield 39.8%).
[0349] 1 H-NMR (400 MHz, CHLOROFORM-D): δ8.25 (d, J = 5.9 Hz, 1H), 6.64-6.50 (m, 1H), 5.16-5.05 (1H), 3.73-3.62 (m, 3H), 2.35 (tt, J = 11.4, 3.7 Hz, 1H), 2.18 (dt, J = 12.8, 3.5 Hz, 2H), 2.07 (dd, J = 14.2, 3.7 Hz, 2H), 1.74-1.56 (m, 2H), 1.49 (ddd, J = 23.0, 12.7, 3.5 Hz, 2H)
[0350]
[0351] Step 3: Synthesis of methyl (1r,4r)-4-((2-aminopyrimidin-4-yl)oxy)cyclohexane-1-carboxylate
[0352] The desired product was obtained (yield 69%) in a similar manner to step 2 of Preparation Example 11 using methyl (1r,4r)-4-((2-chloropyrimidin-4-yl)oxy)cyclohexane-1-carboxylate (0.21 g, 0.76 mmol) obtained in step 2.
[0353] 1 H-NMR (400 MHz, CHLOROFORM-D) δ 7.98 (d, J = 5.9 Hz, 1H), 6.01 (d, J = 5.5 Hz, 1H), 5.02-4.89 (m, 1H), 4.82 (s, 2H), 3.68 (dd, J = 7.3, 2.7 Hz, 5H), 2.44-2.26 (m, 1H), 2.20-1.99 (m, 4H), 1.71-1.57 (m, 2H), 1.52 (s, 1H), 1.41 (dd, J = 12.6, 3.4 Hz, 1H)
[0354]
[0355] Example 1: Synthesis of N-(6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)-3-phenylpropanamide
[0356]
[0357]
[0358] 2-Chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.1 g, 0.305 mmol) obtained in Preparation Example 1, 3-phenylpropanamide (0.055 g, 0.366 mmol) obtained in Preparation Example 5, cesium carbonate (0.249 g, 0.763 mmol), 4,5-bis(diphenylphosphino)-9,9-dimethylxanthine (21 mg, 0.037 mmol) and tris(dibenzylideneacetone)dipalladium(0) (28 mg, 0.031 mmol) were dissolved in 15 mL of 1,4-dioxane, and then dissolved oxygen was removed by bubbling nitrogen while stirring, and then the mixture was sealed in a sealed container to block the inflow of external air. The reaction mixture was stirred at 110°C for 16 hours and then cooled to room temperature. After filtration through a celite pad and removal of the organic solvent under reduced pressure, the residue was dissolved in ethyl acetate and washed with brine. The organic solvent was dried over magnesium sulfate and removed under reduced pressure. The residue was purified using a silica gel column (ethyl acetate: hexane = 1:2) to obtain the desired product (yield 67%).
[0359] m / z(M+H) + calculated for C 26 H 24 N4O3: 440.50, found 441.1
[0360]
[0361] Example 2: Synthesis of methyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetate
[0362]
[0363]
[0364] The desired product was obtained in a similar manner as in Example 1 using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.32 g, 0.976 mmol) obtained in Preparation Example 1 and methyl 2-(4-(2-amino-2-oxoethyl)phenyl)acetate (0.243 g, 1.172 mmol) obtained in Preparation Example 6 (yield 22.6%).
[0365] 1 H NMR (500 MHz, CHLOROFORM-D): δ 9.50 (s, 1H), 8.86 (s, 1H), 8.67 (s, 1H), 8.61 (s, 1H), 8.33 (s, 1H), 7.67 (d, J = 1.8 Hz, 1H), 7.27 (4H), 7.17 (1H), 7.08 (d, J = 7.3 Hz, 1H), 7.00-6.94 (m, 2H), 3.99 (q, J = 6.7 Hz, 2H), 3.76 (s, 2H), 3.67 (s, 3H), 3.62 (s, 2H), 1.19 (t, J = 6.7 Hz, 3H)
[0366]
[0367] Example 3: Synthesis of 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid
[0368]
[0369]
[0370] Methyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetate (110 mg, 0.221 mmol) obtained in Example 2 was dissolved in THF (6 mL) and methanol (2 mL). Sodium hydroxide (44 mg, 1.103 mmol) dissolved in water (2 mL) was added and stirred at room temperature for 4 hours. After cooling the reaction to room temperature, the pH was adjusted to 4.5 using 1 N aqueous hydrochloric acid solution, diluted with ethyl acetate, the aqueous layer was removed, the reactant was dried over magnesium sulfate, and the organic solvent was removed under reduced pressure. The desired product was obtained by purification using a silica gel column (ethyl acetate: hexane = 1: 1) (yield 33.6%).
[0371] m / z(M+H) + calculated for C 27 H 24 N4O5: 484.51, found 485.1
[0372]
[0373] Example 4: Synthesis of 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid
[0374]
[0375]
[0376] Step 1: Synthesis of methyl 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)amino)-3-oxopropyl)phenyl)acetate
[0377] The desired product was obtained in a similar manner to Example 1 using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.20 g, 0.61 mmol) prepared in Preparation Example 1 and methyl 2-(4-(3-amino-3-oxopropyl)phenyl)acetate (0.14 g, 0.61 mmol) prepared in Preparation Example 7 (yield 35%).
[0378] 1H-NMR (400 MHz, CHLOROFORM-D): δ9.51 (s, 1H), 8.87 (s, 1H), 8.70 (s, 1H), 8.36 (d, J = 10 Hz, 2H), 7.68 (s, 1H), 7.25 (m, 5H), 7.10 (d, 1H), 6.94 ~ 7.02 (m, 2H), 4.02 (q, 2H), 3.66 (s, 3H), 3.58 (s, 2H), 3.06 (t, 2H), 2.77 (t, 2H), 1.21 (t, 3H)
[0379]
[0380] Step 2: Synthesis of 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid
[0381] The ester compound (0.11 g, 2.39 mmol) obtained in step 1 was hydrolyzed in a similar manner to Example 3 to obtain the desired product (yield 28%).
[0382] 1 H-NMR (400 MHz, DMSO-D6): δ10.87 (s, 1H), 9.34 (s, 1H), 9.00 (s, 2H), 8.33 (s, 1H), 7.89 (s, 1H), 7.17 (m, 7H), 7.02 (t, 1H), 4.03 (t, 2H), 3.51 (s, 2H), 2.92 (t, 2H), 2.78 (t, 2H), 1.10 (t, 3H)
[0383]
[0384] Example 5: Synthesis of methyl 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoate
[0385]
[0386]
[0387] The desired product was obtained in a similar manner to Example 1 using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.25 g, 0.76 mmol) prepared in Manufacturing Example 1 and methyl 2-(4-(3-amino-3-oxopropyl)phenyl-2-methylpropanoate (0.19 g, 0.76 mmol) prepared in Manufacturing Example 8 (yield 51%).
[0388] 1 H NMR (400 MHz, CHLOROFORM-D): δ 9.51 (s, 1H), 8.86 (s, 1H), 8.72 (s, 1H), 8.37 (d, J = 4 Hz, 1H), 7.99 (s, 1H), 7.70 (s, 1H), 7.25 (m, 3H), 7.20 (m, 2H), 7.12 (m, 1H), 7.03 (m, 2H), 4.03 (q, 2H), 3.06 (t, 2H), 2.78 (t, 2H), 1.55 (s, 6H), 1.22 (t, 3H)
[0389]
[0390] Example 6: Synthesis of ethyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-difluoroacetate
[0391]
[0392]
[0393] Step 1: Synthesis of 6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-amine
[0394] In Example 3, 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid was obtained as a by-product during the manufacturing process.
[0395] m / z(M+H) + calculated for C 17 H 16 N4O2: 308.3, found 309.1
[0396]
[0397] Step 2: Synthesis of ethyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-difluoroacetate
[0398] 2-(4-(2-Ethoxy-1,1-difluoro-2-oxoethyl)phenyl)acetic acid (0.02 g, 0.077 mmol) obtained in Preparation Example 9 was dissolved in DCM (0.4 mL), oxalyl chloride (0.02 g, 0.155 mmol) was added, and 1 drop of DMF was added. The reaction mixture was stirred at room temperature for 1 h, and the solvent was removed under reduced pressure. The concentrate was dissolved in THF (0.2 mL), and the temperature was lowered to 0°C. Then, 6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-amine (0.02 g, 0.065 mmol) obtained in Step 1 was dissolved in THF (0.2 mL) and added, followed by TEA (0.022 g, 0.216 mmol). The mixture was stirred at room temperature for 16 hours, water was added, and extraction with ethyl acetate was performed. After washing with water and brine, the organic layer was dried over magnesium sulfate and concentrated under reduced pressure. The desired product was obtained by purification using column chromatography (yield 13%).
[0399] 1 H-NMR (500 MHz, CHLOROFORM-D): δ 9.49 (s, 1H), 8.84 (s, 1H), 8.74 (s, 1H), 8.38 (s, 1H), 7.91 (s, 1H), 7.67 (s, 1H), 7.66 (d, J = 7.9 Hz, 2H), 7.46 (d, J = 7.9 Hz, 2H), 7.21 (1H), 7.11 (1H), 7.03-6.99 (2H), 4.30 (q, J = 7.95 Hz, 2H), 4.03 (q, J = 6.15 Hz, 2H), 3.86 (s, 2H), 1.31 (t, J = 6.15 Hz, 3H), 1.22 (t, J = 7.95 Hz, 3H)
[0400]
[0401] Example 7: Synthesis of 3-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid
[0402]
[0403]
[0404] The desired product was obtained (yield 12%) in a similar manner to step 3 of Example 1, Preparation Example 11 using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.1 g, 0.305 mmol) obtained in Preparation Example 1 and tert-butyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.081 g, 0.277 mmol) obtained in Preparation Example 10.
[0405] 1 H-NMR (400 MHz, METHANOL-D4): δ9.34 (s, 1H), 8.89 (s, 1H), 8.85-8.74 (m, 1H), 8.23 (d, J = 2.7 Hz, 1H), 7.91 (q, J = 1.4 Hz, 1H), 7.33-7.19 (m, 3H), 7.19-7.06 (m, 4H), 7.01 (t, J = 7.5 Hz, 1H), 3.99 (q, J = 7.0 Hz, 2H), 3.72 (s, 2H), 2.82 (s, 2H), 1.18-1.01 (m, 9H)
[0406]
[0407] Example 8: Synthesis of (R)-1-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid
[0408]
[0409]
[0410] The desired product was obtained in a similar manner as in Examples 1 and 3 using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.1 g, 0.305 mmol) obtained in Preparation Example 1 and ethyl (R)-1-(2-aminopyrimidin-4-yl)piperidine-3-carboxylate (0.069 g, 0.277 mmol) obtained in Preparation Example 11 (yield 49%).
[0411] 1 H-NMR (400 MHz, METHANOL-D4): δ9.45 (s, 1H), 8.88 (d, J = 1.8 Hz, 1H), 8.64 (s, 1H), 8.21 (d, J = 2.7 Hz, 1H), 7.96 (d, J = 6.4 Hz, 1H), 7.92 (t, J = 2.3 Hz, 1H), 7.31-7.21 (m, 1H), 7.21-7.16 (1H), 7.16-7.09 (m, 1H), 7.06-6.95 (m, 1H), 6.42 (d, J = 6.4 Hz, 1H), 4.50-4.06 (1H), 4.01 (q, J = 7.0 Hz, 2H), 3.53-3.33 (m, 1H), 3.23 (s, 1H), 2.62-2.40 (1H), 2.19-2.01 (1H), 1.81 (d, J = 12.3 Hz, 2H), 1.68-1.44 (1H), 1.14 (t, J = 6.9 Hz, 3H)
[0412]
[0413] Example 9: Synthesis of 3-(3-(6-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid
[0414]
[0415]
[0416] The desired product was obtained in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazine (0.1 g, 0.305 mmol) obtained in Preparation Example 1 and tert-butyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.091 g, 0.277 mmol) obtained in Preparation Example 10 (yield 26.9%).
[0417] 1H-NMR (400 MHz, METHANOL-D4): δ9.36 (s, 1H), 8.89 (d, J = 1.8 Hz, 1H), 8.65-8.50 (1H), 8.25 (d, J = 2.7 Hz, 1H), 7.99-7.88 (m, 2H), 7.84 (d, J = 7.8 Hz, 1H), 7.65 (t, J = 7.8 Hz, 1H), 7.40 (d, J = 7.3 Hz, 1H), 7.34 (dd, J = 8.0, 5.7 Hz, 2H), 7.30-7.24 (m, 1H), 7.20 (dd, J = 8.0, 1.6 Hz, 2H), 7.15 (d, J = 8.2 Hz, 1H), 7.11-6.95 (m, 1H), 4.04-3.91 (2H), 2.95 (s, 2H), 1.19 (s, 6H), 1.13 (t, J = 7.1 Hz, 3H)
[0418]
[0419] Example 10: Synthesis of N-(6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)-3-phenylpropanamide
[0420]
[0421]
[0422] The desired product was obtained in a similar manner as in Example 1 using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.1 g, 0.306 mmol) obtained in Preparation Example 2 and 3-phenylpropanamide (0.055 g, 0.367 mmol) obtained in Preparation Example 5 (yield 60%).
[0423] 1 H NMR (500 MHz, CHLOROFORM-D): δ 9.44 (s, 1H), 8.70 (s, 1H), 8.00 (s, 1H), 7.57 (1H), 7.50 (s, 1H), 7.36 (1H), 7.28-7.25 (2H), 7.21-7.19 (3H), 7.10 (1H), 7.05-6.98 (3H), 6.90 (1H), 4.30 (q, J = 7.3 Hz, 2H), 3.04 (t, J = 7.65 Hz, 2H), 2.69 (t, J = 7.95 Hz, 2H), 1.23 (3H)
[0424]
[0425] Example 11: Synthesis of 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid
[0426]
[0427]
[0428] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.250 g, 0.765 mmol) obtained in Preparation Example 2 and methyl 2-(4-(2-amino-2-oxoethyl)phenyl)acetate (0.190 g, 0.918 mmol) obtained in Preparation Example 6, a similar method as in Examples 1 and 3 was sequentially performed to obtain the desired product (yield 34.1%).
[0429] 1 H NMR (300 MHz, Methanol-D): δ 9.35 (s, 1H), 8.61 (s, 1H), 8.52 (s, 1H), 7.45 (1H), 7.40 (d, J = 1.25 Hz, 1H), 7.26 (1H), 7.13 (m, 4H), 7.02 (1H), 6.94-6.89 (3H), 6.81 (1H), 3.95 (2H), 3.59 (s, 2H), 3.39 (s, 2H), 1.18 (3H)
[0430]
[0431] Example 12: Synthesis of 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid
[0432]
[0433]
[0434] Step 1: Synthesis of methyl 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetate
[0435] The desired product was obtained in a similar manner to Example 1 using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.10 g, 0.31 mmol) prepared in Manufacturing Example 4 and methyl 2-(4-(3-amino-3-oxopropyl)phenyl)acetate (0.07 g, 0.31 mmol) prepared in Manufacturing Example 11 (yield 75%).
[0436] 1 H-NMR (400 MHz, CHLOROFORM-D): δ9.45 (s, 1H), 8.71 (s, 1H), 8.11 (s, 1H), 7.51 (d, J = 12 Hz, 1H), 7.51 (s, 1H), 7.36 (t, 1H), 7.16 (d, J = 8 Hz, 2H), 7.14 (d, J = 8 Hz, 2H), 7.09 (t, 1H), 6.90 ~ 6.98 (m, 3H), 6.89 (t, 1H), 4.06 (t, 2H), 3.67 (s, 3H), 3.59 9s, 2H), 3.01 (t, 2H), 2.65 (t, 2H), 1.24 (t, 3H)
[0437]
[0438] Step 2: Synthesis of 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid
[0439] The ester compound (0.11 g, 2.39 mmol) obtained in step 1 was hydrolyzed in a similar manner to Example 3 to obtain the desired product (yield 69%).
[0440] 1 H-NMR (400 MHz, CHLOROFORM-D): δ 9.49 (s, 1H), 8.91 (s, 1H), 8.67 (s, 1H), 7.47 (d, 1H), 7.43 (s, 1H), 7.35 9t, 1H), 7.11 ~ 7.26 (m, 5H), 6.97 ~ 7.05 (m, 3H), 6.91 (t, 1H), 4.06 (t, 2H), 3.61 (s, 2H), 3.00 (t, 2H), 2.68 (t, 2H), 1.26 (t, 3H)
[0441]
[0442] Example 13: Synthesis of 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenoxy)-2-methylpropanoic acid
[0443]
[0444]
[0445] The desired product was obtained (yield 64%) in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.080 g, 0.245 mmol) obtained in Preparation Example 2 and tert-butyl 2-(4-(3-amino-3-oxopropyl)phenoxy)-2-methylpropanoate (0.075 g, 0.245 mmol) obtained in Preparation Example 13.
[0446] 1H-NMR (400 MHz, CHLOROFORM-D): δ 9.43 (s, 1H), 8.65-8.52 (m, 2H), 7.51-7.41 (m, 2H), 7.36-7.27 (m, 1H), 7.10-6.91 (m, 6H), 6.91-6.76 (m, 3H), 4.01 (q, J = 6.9 Hz, 2H), 2.93 (t, J = 6.9 Hz, 2H), 2.63 (d, J = 5.0 Hz, 2H), 1.56 (s, 6H), 1.23 (t, J = 7.1 Hz, 3H)
[0447]
[0448] Example 14: Synthesis of 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl-2,2-difluoroacetic acid
[0449]
[0450]
[0451] Step 1: Synthesis of 6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-amine
[0452] In Example 11, 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid was obtained as a by-product during the manufacturing process.
[0453] m / z(M+H) + calculated for C 18 H 17 N3O2: 307.3, found 308.1
[0454]
[0455] Step 2: Synthesis of 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl-2,2-difluoroacetic acid
[0456] Using 2-(4-(2-ethoxy-1,1-difluoro-2-oxoethyl)phenyl)acetic acid (0.046 g, 0.178 mmol) obtained in Preparation Example 9 and 6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-amine (0.061 g, 0.199 mmol) obtained in Step 1, a similar method as in Example 6 and Example 3 was sequentially applied to obtain the desired product (yield 5.7%).
[0457] 1 H-NMR (500 MHz, METHANOL-D4): δ 9.19 (s, 1H), 8.66 (s, 1H), 7.65 (1H), 7.54-7.52 (3H), 7.35-7.33 (3H), 7.10 (1H), 7.04-6.98 (2H), 6.90-6.88 (2H), 3.94 (q, J = 7.3 Hz, 2H), 3.74 (s, 1H), 1.10 (t, J - 6.7 Hz, 3H)
[0458]
[0459] Example 15: Synthesis of 3-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid
[0460]
[0461]
[0462] The desired product was obtained (yield 74%) in a similar manner to Example 1 and Step 3 of Preparation Example 11 using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.10 g, 0.306 mmol) obtained in Preparation Example 2 and tert-butyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.089 g, 0.306 mmol) obtained in Preparation Example 10.
[0463] 1H NMR (400 MHz, CHLOROFORM-D): δ 9.43 (s, 1H), 8.68 (s, 1H), 8.19 (s, 1H), 7.56-7.47 (m, 2H), 7.34 (t, J = 8.0 Hz, 1H), 7.18 (td, J = 7.8, 5.6 Hz, 4H), 7.13-7.05 (m, 1H), 7.05-6.93 (m, 3H), 6.90 (t, J = 7.8 Hz, 1H), 4.03 (q, J = 7.0 Hz, 2H), 3.76-3.69 (m, 2H), 2.88 (s, 2H), 1.29-1.16 (m, 9H)
[0464]
[0465] Example 16: Synthesis of 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoic acid
[0466]
[0467]
[0468] The desired product was obtained (yield 31%) in a similar manner to step 2 of Example 1 and Preparation Example 7 using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.10 g, 0.306 mmol) obtained in Preparation Example 2 and benzyl 2-(4-(3-amino-3-oxopropyl)phenyl)-2-methylpropanoate (0.099 g, 0.306 mmol) obtained in Preparation Example 14.
[0469] 1H NMR (400 MHz, CHLOROFORM-D): δ 9.44 (s, 1H), 8.68 (s, 1H), 8.34 (s, 1H), 7.58-7.45 (m, 2H), 7.39-7.27 (m, 3H), 7.17 (d, J = 8.2 Hz, 2H), 7.10 (td, J = 7.8, 1.5 Hz, 1H), 7.06-6.94 (m, 3H), 6.94-6.85 (m, 1H), 4.03 (q, J = 7.0 Hz, 2H), 3.10-2.95 (m, 2H), 2.70 (t, J = 7.5 Hz, 2H), 1.57 (s, 6H), 1.24 (t, J = 6.6 Hz, 3H)
[0470]
[0471] Example 17: Synthesis of (E)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxoprop-1-phen-1-yl)phenyl)-2-methylpropanoic acid
[0472]
[0473]
[0474] In the process of obtaining Example 16, the title compound was obtained as a by-product (yield 41%).
[0475] 1 H NMR (400 MHz, CHLOROFORM-D): δ 9.60 (s, 1H), 8.92 (d, J = 31.1 Hz, 1H), 8.70 (d, J = 0.9 Hz, 1H), 7.84-7.72 (m, 1H), 7.61-7.42 (m, 6H), 7.38 (td, J = 7.9, 2.4 Hz, 1H), 7.19-7.10 (m, 1H), 7.10-6.97 (m, 3H), 6.97-6.87 (m, 1H), 6.59 (d, J = 15.6 Hz, 1H), 4.08-3.99 (m, 2H), 1.63 (s, 6H), 1.33-1.19 (m, 3H)
[0476]
[0477] Example 18: Synthesis of 3-(4-(1-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid
[0478]
[0479]
[0480] The desired product was obtained (yield 77%) in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.10 g, 0.306 mmol) obtained in Preparation Example 2 and tert-butyl 3-(4-(1-amino-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.098 g, 0.306 mmol) obtained in Preparation Example 15.
[0481] 1 H NMR (400 MHz, CHLOROFORM-D): δ 9.46 (s, 1H), 8.69-8.60 (m, 1H), 7.57 (s, 1H), 7.53-7.44 (m, 2H), 7.36-7.26 (m, 3H), 7.19 (d, J = 8.7 Hz, 2H), 7.15-7.06 (m, 1H), 6.98 (ddd, J = 8.0, 5.0, 1.6 Hz, 2H), 6.94-6.85 (m, 2H), 4.01 (q, J = 7.0 Hz, 2H), 2.88 (s, 2H), 1.66 (s, 6H), 1.28-1.13 (m, 9H)
[0482]
[0483] Example 19: Synthesis of 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenoxy-2-methylpropanoic acid
[0484]
[0485]
[0486] The desired product was obtained (yield 62%) in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.08 g, 0.245 mmol) obtained in Preparation Example 2 and tert-butyl 2-(4-(2-amino-2-oxoethyl)phenoxy)-2-methylpropanoate (0.072 g, 0.245 mmol) obtained in Preparation Example 16.
[0487] 1 H-NMR (400 MHz, CHLOROFORM-D): δ 9.42 (s, 1H), 8.67 (s, 1H), 8.40 (d, J = 12.3 Hz, 1H), 7.54-7.42 (m, 2H), 7.32 (td, J = 7.9, 2.0 Hz, 1H), 7.20 (q, J = 4.0 Hz, 2H), 7.16-7.05 (m, 1H), 7.04-6.84 (m, 6H), 4.02 (qd, J = 7.0, 1.5 Hz, 2H), 3.69 (d, J = 2.7 Hz, 2H), 1.59 (d, J = 15.1 Hz, 6H), 1.30-1.16 (m, 3H)
[0488]
[0489] Example 20: Synthesis of 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)phenyl)acetic acid
[0490]
[0491]
[0492] The desired product was obtained in a similar manner as in Examples 1 and 3 using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.140 g, 0.428 mmol) obtained in Preparation Example 2 and ethyl 2-(4-(2-aminopyrimidin-4-yl)phenyl)acetate (0.1 g, 0.389 mmol) obtained in Preparation Example 17 (yield 0.69%).
[0493] m / z(M+H) + calculated for C30 H 25 N5O4: 519.56, found 520.1
[0494]
[0495] Example 21: Synthesis of (1r,4r)-4-((2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid
[0496]
[0497]
[0498] Using 2-chloro-6-(3-(2-ethoxyphenoxy)phenyl)pyrazine (0.100 g, 0.306 mmol) obtained in Preparation Example 2 and methyl (1r,4r)-4-((2-aminopyrimidin-4-yl)oxy)cyclohexane-1-carboxylate (0.085 g, 0.337 mmol) obtained in Preparation Example 18, a similar method as in Examples 1 and 3 was sequentially applied to obtain the desired product (yield 22.8%).
[0499] 1 H-NMR (400 MHz, DMSO-D6): δ 10.09 (s, 1H), 9.38 (s, 1H), 8.75 (s, 1H), 8.25 (d, J = 5.9 Hz, 1H), 7.78 (d, J = 8.2 Hz, 1H), 7.70 (t, J = 2.1 Hz, 1H), 7.41 (t, J = 8.0 Hz, 1H), 7.21-7.10 (m, 2H), 7.08-7.01 (m, 1H), 7.00-6.91 (m, 1H), 6.85 (dd, J = 7.8, 2.3 Hz, 1H), 6.43-6.33 (m, 1H), 4.95 (dd, J = 10.3, 4.3 Hz, 1H), 4.00 (q, J = 6.9 Hz, 2H), 2.18 (s, 1H), 2.11 (d, J = 7.8 Hz, 2H), 1.93 (d, J = 9.6 Hz, 2H), 1.55-1.34 (m, 4H), 1.12 (t, J = 7.1 Hz, 3H)
[0500]
[0501] Example 22: Synthesis of N-(6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)-3-phenylpropanamide
[0502]
[0503]
[0504] The desired product was obtained in a similar manner as in Example 1 using 2-chloro-6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazine (0.1 g, 0.305 mmol) obtained in Preparation Example 3 and 3-phenylpropanamide (0.059 g, 0.397 mmol) obtained in Preparation Example 5 (yield 52.1%).
[0505] m / z(M+H) + calculated for C 26 H 24 N4O3: 440.50, found 441.1
[0506]
[0507] Example 23: 3-(4-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid
[0508]
[0509]
[0510] The desired product was obtained in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazine (0.070 g, 0.214 mmol) obtained in Preparation Example 3 and tert-butyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.056 g, 0.194 mmol) obtained in Preparation Example 10 (yield 74.4%).
[0511] 1H-NMR (500 MHz, METHANOL-D4): δ9.32 (s, 1H), 8.75 (s, 1H), 8.05 (d, J = 7.6 Hz, 1H), 7.99-7.85 (1H), 7.30 (d, J = 8.2 Hz, 2H), 7.28-7.23 (m, 1H), 7.23-7.16 (3H), 7.13 (d, J = 6.7 Hz, 1H), 7.10-6.96 (m, 2H), 3.99 (q, J = 6.9 Hz, 2H), 3.79 (s, 2H), 2.87 (s, 2H), 1.17 (s, 7H), 1.09 (t, J = 6.9 Hz, 4H)
[0512]
[0513] Example 24: Synthesis of (R)-1-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid
[0514]
[0515]
[0516] The desired product was obtained in a similar manner as in Examples 1 and 3 using 2-chloro-6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazine (0.070 g, 0.214 mmol) obtained in Preparation Example 3 and ethyl (R)-1-(2-aminopyrimidin-4-yl)piperidine-3-carboxylate (0.048 g, 0.194 mmol) obtained in Preparation Example 11 (yield 20%).
[0517] 1H-NMR (400 MHz, METHANOL-D4): δ9.40 (s, 1H), 8.54 (s, 1H), 8.00 (d, J = 7.8 Hz, 1H), 7.93 (d, J = 6.4 Hz, 1H), 7.85 (t, J = 7.8 Hz, 1H), 7.19 (t, J = 8.0 Hz, 1H), 7.15 (dd, J = 7.8, 1.4 Hz, 1H), 7.07 (d, J = 6.9 Hz, 1H), 6.98 (t, J = 7.1 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 6.36 (d, J = 6.4 Hz, 1H), 4.61-4.32 (1H), 4.29-4.04 (1H), 3.94 (q, J = 7.0 Hz, 2H), 3.26-3.01 (m, 2H), 2.41 (t, J = 3.9 Hz, 1H), 2.08 (t, J = 4.8 Hz, 1H), 1.87-1.68 (m, 2H), 1.52 (d, J = 12.8 Hz, 1H), 1.04 (t, J = 6.9 Hz, 3H)
[0518]
[0519] Example 25: Synthesis of 3-(3-(6-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid
[0520]
[0521]
[0522] The desired product was obtained (yield 16%) in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazine (0.140 g, 0.427 mmol) obtained in Preparation Example 3 and tert-butyl 3-(3-(6-aminopyridin-2-yl)phenyl)-2,2-dimethylpropanoate (0.127 g, 0.388 mmol) obtained in Preparation Example 12.
[0523] 1H-NMR (400 MHz, METHANOL-D4) δ9.40 (s, 1H), 8.57-8.44 (1H), 8.06 (d, J = 6.9 Hz, 1H), 7.98-7.89 (m, 2H), 7.89-7.82 (m, 1H), 7.76 (t, J = 8.0 Hz, 1H), 7.43 (dd, J = 10.5, 7.8 Hz, 2H), 7.35 (t, J = 7.5 Hz, 1H), 7.30-7.20 (m, 2H), 7.20-7.14 (m, 1H), 7.11 (d, J = 8.2 Hz, 1H), 7.01 (t, J = 7.5 Hz, 1H), 6.96 (d, J = 8.2 Hz, 1H), 4.54 (s, 1H), 3.97 (q, J = 7.0 Hz, 2H), 3.46 (s, 0H), 2.95 (s, 2H), 1.19 (s, 7H), 1.06 (t, J = 6.9 Hz, 3H)
[0524]
[0525] Example 26: Synthesis of 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoic acid
[0526]
[0527]
[0528] The desired product was obtained (yield 16%) in a similar manner to step 2 of Example 1 and Preparation Example 7 using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and benzyl 2-(4-(3-amino-3-oxopropyl)phenyl)-2-methylpropanoate (0.079 g, 0.244 mmol) obtained in Preparation Example 14.
[0529] 1H-NMR (400 MHz, CHLOROFORM-D): δ 9.41 (s, 1H), 8.68 (s, 1H), 8.25 (d, J = 8.2 Hz, 1H), 7.73 (d, J = 5.0 Hz, 1H), 7.64 (q, J = 2.1 Hz, 2H), 7.48-7.38 (m, 1H), 7.30-7.09 (m, 6H), 6.97 (dd, J = 7.8, 5.0 Hz, 1H), 4.19-4.11 (m, 2H), 3.01 (t, J = 7.5 Hz, 2H), 2.71 (t, J = 7.5) Hz, 2H), 1.52 (s, 6H), 1.46 (t, J = 7.1 Hz, 3H)
[0530]
[0531] Example 27: Synthesis of 3-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid
[0532]
[0533]
[0534] The desired product was obtained (yield 62%) in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and tert-butyl 3-(4-(2-amino-2-oxoethyl)phenyl)-2,2-dimethylpropanoate (0.071 g, 0.244 mmol) obtained in Preparation Example 10.
[0535] 1H-NMR (400 MHz, CHLOROFORM-D): δ 9.42 (s, 1H), 8.70 (s, 1H), 8.37 (s, 1H), 7.76-7.69 (m, 1H), 7.68-7.61 (m, 2H), 7.43 (t, J = 8.2 Hz, 1H), 7.23-7.10 (m, 6H), 6.97 (dd, J = 7.8, 5.0 Hz, 1H), 4.18-4.07 (m, 2H), 3.72 (s, 2H), 2.85 (s, 2H), 1.49-1.41 (m, 3H), 1.19 (s, 6H)
[0536]
[0537] Example 28: Synthesis of 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenoxy)-2-methylpropanoic acid
[0538]
[0539]
[0540] The desired product was obtained (56% yield) in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and tert-butyl 2-(4-(3-amino-3-oxopropyl)phenoxy)-2-methylpropanoate (0.075 g, 0.244 mmol) obtained in Preparation Example 13.
[0541] 1H-NMR (400 MHz, DMSO-D6): δ 10.74 (s, 1H), 9.26 (s, 1H), 8.93 (s, 1H), 7.92 (d, J = 7.8 Hz, 1H), 7.81 (t, J = 1.8 Hz, 1H), 7.60 (dd, J = 5.0, 1.4 Hz, 1H), 7.56-7.41 (m, 2H), 7.18 (dd, J = 7.5, 2.1 Hz, 1H), 7.13-7.00 (m, 3H), 6.78-6.65 (m, 2H), 4.11 (q, J = 7.0 Hz, 2H), 2.87-2.76 (m, 2H), 2.69 (t, J = 7.5 Hz, 2H), 1.42 (s, 6H), 1.33 (t, J = 7.1 Hz, 3H)
[0542]
[0543] Example 29: Synthesis of 3-(4-(1-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid
[0544]
[0545]
[0546] The desired product was obtained (59% yield) in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and tert-butyl 3-(4-(1-amino-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoate (0.078 g, 0.244 mmol) obtained in Preparation Example 15.
[0547] 1H NMR (400 MHz, CHLOROFORM-D): δ 9.43 (s, 1H), 8.68 (s, 1H), 7.72-7.59 (m, 3H), 7.56 (s, 1H), 7.41 (t, J = 8.2 Hz, 1H), 7.29 (d, J = 8.2 Hz, 2H), 7.23-7.07 (m, 4H), 7.00-6.88 (m, 1H), 4.18-4.05 (m, 2H), 2.84 (s, 2H), 1.65 (s, 6H), 1.44 (t, J = 6.9 Hz, 3H), 1.16 (s, 6H)
[0548]
[0549] Example 30: Synthesis of 2-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenoxy)-2-methylpropanoic acid
[0550]
[0551]
[0552] The desired product was obtained (yield 35%) in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and tert-butyl 2-(4-(2-amino-2-oxoethyl)phenoxy)-2-methylpropanoate (0.072 g, 0.244 mmol) obtained in Preparation Example 16.
[0553] 1H-NMR (400 MHz, DMSO-D6): δ 10.94 (s, 1H), 9.23 (s, 1H), 8.94 (s, 1H), 7.93 (d, J = 8.2 Hz, 1H), 7.83 (t, J = 1.8 Hz, 1H), 7.61 (dd, J = 5.0, 1.4 Hz, 1H), 7.58-7.43 (m, 2H), 7.19 (d, J = 8.7 Hz, 3H), 7.07 (dd, J = 8.0, 4.8 Hz, 1H), 6.74 (d, J = 8.7 Hz, 2H), 4.20-4.07 (m, 2H), 3.66 (s, 2H), 1.45 (s, 6H), 1.33 (t, J = 7.1 Hz, 3H)
[0554]
[0555] Example 31: Synthesis of (R)-1-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid
[0556]
[0557]
[0558] The desired product was obtained in a similar manner as in Examples 1 and 3 using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and ethyl (R)-1-(2-aminopyrimidin-4-yl)piperidine-3-carboxylate (0.055 g, 0.222 mmol) obtained in Preparation Example 11 (yield 20%).
[0559] 1H-NMR (400 MHz, METHANOL-D4): δ9.36 (s, 1H), 8.61 (s, 1H), 7.96 (d, J = 6.4 Hz, 1H), 7.86 (d, J = 7.8 Hz, 1H), 7.77 (t, J = 2.1 Hz, 1H), 7.66 (dd, J = 4.8, 1.6 Hz, 1H), 7.51 (d, J = 7.8 Hz, 1H), 7.46 (dd, J = 8.5, 2.1 Hz, 1H), 7.11 (dd, J = 8.0, 4.8 Hz, 2H), 6.41 (d, J = 6.4 Hz, 1H), 4.48-4.29 (1H), 4.29-4.17 (1H), 4.13 (q, J = 7.0 Hz, 2H), 3.35 (d, J = 9.1 Hz, 1H), 3.23-2.96 (1H), 2.52-2.39 (1H), 2.07 (s, 1H), 1.80 (d, J = 10.5 Hz, 2H), 1.57 (d, J = 3.7 Hz, 1H), 1.37 (t, J = 7.1 Hz, 3H)
[0560]
[0561] Example 32: Synthesis of 3-(3-(6-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid
[0562]
[0563]
[0564] The desired product was obtained in a similar manner to step 3 of Example 1 and Preparation Example 11 using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.08 g, 0.244 mmol) obtained in Preparation Example 4 and tert-butyl 3-(3-(6-aminopyridin-2-yl)phenyl)-2,2-dimethylpropanoate (0.072 g, 0.222 mmol) obtained in Preparation Example 12 (yield 26%).
[0565] 1H-NMR (400 MHz, METHANOL-D4): δ9.40 (s, 1H), 8.62-8.47 (1H), 7.91 (s, 1H), 7.86 (t, J = 8.5 Hz, 2H), 7.80 (d, J = 2.3 Hz, 1H), 7.76-7.59 (m, 2H), 7.58-7.43 (m, 2H), 7.43-7.27 (m, 3H), 7.21 (d, J = 8.2 Hz, 1H), 7.13 (td, J = 5.1, 2.7 Hz, 2H), 4.22-4.10 (m, 2H), 2.96 (s, 2H), 1.36 (t, J = 6.9 Hz, 3H), 1.20 (s, 7H)
[0566]
[0567] Example 33: Synthesis of (1r,4r)-4-((2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid
[0568]
[0569]
[0570] Using 2-chloro-6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazine (0.10 g, 0.305 mmol) obtained in Preparation Example 4 and methyl (1r,4r)-4-((2-aminopyrimidin-4-yl)oxy)cyclohexane-1-carboxylate (0.084 g, 0.336 mmol) obtained in Preparation Example 18, a similar method as in Examples 1 and 3 was sequentially applied to obtain the desired product (yield 42.2%).
[0571] 1H-NMR (400 MHz, DMSO-D6): δ 10.09 (s, 1H), 9.40 (s, 1H), 8.82 (s, 1H), 8.26 (d, J = 5.5 Hz, 1H), 7.94 (d, J = 7.8 Hz, 1H), 7.86 (t, J = 2.1 Hz, 1H), 7.61 (dd, J = 5.0, 1.4 Hz, 1H), 7.55-7.43 (m, 2H), 7.16 (dd, J = 7.5, 2.1 Hz, 1H), 7.07 (dd, J = 8.0, 4.8 Hz, 1H), 6.36 (d, J = 5.9 Hz, 1H), 4.96 (t, J = 4.8 Hz, 1H), 4.12 (q, J = 7.0 Hz, 2H), 2.24-2.05 (m, 3H), 1.93 (d, J = 9.6 Hz, 2H), 1.56-1.37 (4H), 1.33 (t, J = 7.1 Hz, 3H)
[0572]
[0573] Experimental example: Measurement of DGAT2 enzyme activity inhibition effect
[0574] The following experiment was conducted on compounds of chemical formula (1) according to the present invention to investigate their inhibitory effect on DGAT2 enzyme activity.
[0575]
[0576] 1. Preparation of DGAT2 expression vector
[0577] To prepare the DGAT2 expression vector pBacPAK9-DGAT2, the human DGAT2 gene amplified by polymerase chain reaction (PCR) was cloned into the EcoR1 and Xho1 sites of the pBacPAK9 (clonctech) vector. The base sequences of the primers used in PCR were forward primer 5' CTATAAATACGGATCCCGGGAATTCATGGACTACAAGGACGACGATGACAAGCTTAAGACCCTCATAGCCGCC and reverse primer 5' TAAGCGGCCGCCCTGCAGGCCTCGAGTCAGTTCACCTCCAGGAC. The composition of the reaction solution included 50 ng of cDNA clone (OriGene), 200 μM of dATP, dCTP, dTTP, and dGTP, 200 nM of each primer, 1 unit of Tag DNA polymerase (Toyobo), and 1x PCR buffer, and the final volume was adjusted to 20 μl. The reaction conditions were denaturation at 95°C for 5 minutes, followed by 30 cycles of 94°C for 20 seconds, 60°C for 20 seconds, and 72°C for 90 seconds, and then an additional 72°C for 7 minutes.
[0578]
[0579] 2. DGAT2 expression and membrane protein production
[0580] Recombinant human DGAT2 protein was expressed in insect Sf-21 cells using the BacPack baculovirus expression system (Clontech). The brief manufacturing process is as follows. First, the pBacPAK9-DGAT2 expression vector was transfected together with BacPAK6 virus DNA (Bsu36I digest) into sf21 cells using Bacfectin to produce a recombinant DGAT2-expressing baculovirus. Sf-21 cells were infected with the baculovirus produced in this way at a multiplicity of infection (MOI) of 10, and after 72 hours, the infected insect cells were collected and membrane proteins were isolated. For membrane protein isolation, the cell pellet was dissolved in a sucrose solution containing 250 mM sucrose, 10 mM Tris (pH 7.4), and 1 mM ethylenediamine-tetraacetic acid (EDTA), homogenized using a dounce homogenizer, centrifuged at 600 × g for 15 min, the supernatant was collected, and centrifuged at 100,000 × g for 1 h. The supernatant was discarded, and the remaining pellet was resuspended in 20 mM HEPES buffer (pH 7.4). The prepared DGAT2 overexpressed membrane protein was aliquoted into 100 μl and stored at -80°C until use. The protein concentration was quantified using a BCA protein assay kit (Thermo Scientific).
[0581]
[0582] 3. Measurement of DGAT2 enzyme activity inhibition effect
[0583] In vitro DGAT2 analysis was performed using a phospholipid flash plate (Phospholipid Flash Plate, PerkinElmer) based on the scintillation proximity assay (SPA) principle. First, DGAT2 inhibitory compounds, serially diluted 5-fold from 3 nM to 10 μM (final concentration, 1% DMSO), were mixed with 2 μg DGAT2 membrane protein in a final volume of 90 μL buffer containing 20 mM HEPES, 20 mM MgCl2, 1 mg / mL BSA, and 50 μM 1,2 sn-oleoyl glycerol (Sigma), placed in a 96-well FlashPlate, and incubated at 37°C for 20 min. Then, 1 μM [14C]oleoyl CoA (PerkinElmer, NEC651050UC) was added to a final volume of 100 μL, and the mixture was further incubated at 37°C for 15 min. After the enzyme reaction was completed, 100 μL isopropanol was added, the plate was sealed with film, and then slowly shaken on a plate shaker. The next day, the amplified scintillation signal (cpm) was measured using a Topcounter (Packard) to determine the degree of production of [14C]-labeled triacylglycerol (TG), a reaction product. The measurement value in the case of no compound treatment was used as a positive control, and the measurement value of the compound-treated group was calculated as a relative % to determine the inhibitory effect of the compound on TG production. IC is the concentration of the compound that inhibits TG production by 50%. 50 The values were determined by processing the response values according to compound concentration into a nonlinear regression curve using PRISM (Graphpad Inc.).
[0584] As a result of measuring the inhibitory effect on DGAT2 enzyme activity of the compound of chemical formula (1), the specific IC of individual example compounds 50The values were as shown in Table 1 below.
[0585]
Claims
1. A compound of the following chemical formula (1), or a pharmaceutically acceptable salt or isomer thereof: [Chemical formula (1)] In the above chemical formula (1), A, D and E are each independently CH or N; R 1 is alkyl, cycloalkyl or haloalkyl; R 2 is -GJL; Here, G is -C(=O)- or a direct bond; J is alkylene, alkenylene, alkylene-arylene-, alkenylene-arylene, alkoxylene-arylene, arylene, heteroarylene-heterocycloalkylene, heteroarylene-arylene or heteroarylene-oxy-cycloalkylene; L is hydrogen, halo, amino, nitro, carboxy(-COOH), carboxyalkyl, carboxyalkoxy, cycloalkyl or aryl; The above alkyl, alkylene, carboxyalkyl, carboxyalkoxy or aryl may be optionally substituted, and the substituent is at least one selected from hydroxy, halo, alkyl and alkoxy; The above heterocycloalkylene or heteroarylene contains one or more heteroatoms selected from N, O and S.
2. In paragraph 1, A, D and E are each independently CH or N; R 1 Silver C 1 -C 7 Alkyl, C 3 -C 10 Cycloalkyl or halo-C 1 -C 7 It is alkyl; R 2 is -GJL; Here, G is -C(=O)- or a direct bond; J is C 1 -C 7 Alkylene, C 2 -C 7 Alkenylene, C 1 -C 7 Alkylene-C 6 -C 10 Arylene, C 2 -C 7 Alkenylene-C 6 -C 10 Arylene, C 1 -C 7 Alkoxylene-C 6 -C 10 Arylene, C 6 -C 10 Arylene, 5 to 12 membered heteroarylene-5 to 12 membered heterocycloalkylene, 5 to 12 membered heteroarylene-C 6 -C 10 Arylene or 5 to 12 membered heteroarylene-oxy-C 3 -C 10 is cycloalkylene; L is hydrogen, halo, amino, nitro, carboxy, carboxy-C 1 -C 7 Alkyl, carboxy-C 1 -C 7 Alkoxy, C 3 -C 10 Cycloalkyl or C 6 -C 10 It is aryl; The above alkyl, alkylene, carboxyalkyl, carboxyalkoxy or aryl may be optionally substituted, and the substituents are hydroxy, halo, C 1 -C 7 Alkyl and C 1 -C 7 1 to 4 selected from alkoxy; The above heterocycloalkylene or heteroarylene is a compound containing 1 to 4 heteroatoms selected from N, O and S, or a pharmaceutically acceptable salt or isomer thereof.
3. In paragraph 1, a compound selected from the following: N-(6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)-3-phenylpropanamide; Methyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetate; 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid; 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid; Methyl 2-(4-(3-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoate; Ethyl 2-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-difluoroacetate; 3-(4-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid; (R)-1-(2-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid; 3-(3-(6-((6-(5-(2-ethoxyphenoxy)pyridin-3-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid; N-(6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)-3-phenylpropanamide; 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)acetic acid; 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)acetic acid; 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenoxy)-2-methylpropanoic acid; 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl-2,2-difluoroacetic acid; 3-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid; 2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoic acid; (E)-2-(4-(3-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-3-oxoprop-1-phen-1-yl)phenyl)-2-methylpropanoic acid; 3-(4-(1-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid; 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenoxy-2-methylpropanoic acid; 2-(4-(2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)phenyl)acetic acid; (1r,4r)-4-((2-((6-(3-(2-ethoxyphenoxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid; N-(6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)-3-phenylpropanamide; 3-(4-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid; (R)-1-(2-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid; 3-(3-(6-((6-(6-(2-ethoxyphenoxy)pyridin-2-yl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid; 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenyl)-2-methylpropanoic acid; 3-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenyl)-2,2-dimethylpropanoic acid; 2-(4-(3-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-3-oxopropyl)phenoxy)-2-methylpropanoic acid; 3-(4-(1-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-methyl-1-oxopropan-2-yl)phenyl)-2,2-dimethylpropanoic acid; 2-(4-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)-2-oxoethyl)phenoxy)-2-methylpropanoic acid; (R)-1-(2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)piperidine-3-carboxylic acid; 3-(3-(6-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyridin-2-yl)phenyl)-2,2-dimethylpropanoic acid; and (1r,4r)-4-((2-((6-(3-((3-ethoxypyridin-2-yl)oxy)phenyl)pyrazin-2-yl)amino)pyrimidin-4-yl)oxy)cyclohexane-1-carboxylic acid, Or a pharmaceutically acceptable salt or isomer thereof.
4. A pharmaceutical composition for treating a disease associated with diacylglycerol acyltransferase 2 (DGAT2), comprising a compound of formula (1) defined in any one of claims 1 to 3 as an active ingredient, or a pharmaceutically acceptable salt or isomer thereof, together with a pharmaceutically acceptable carrier.
5. A pharmaceutical composition according to claim 4, wherein the DGAT2-related disease is selected from the group consisting of fatty liver, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), diabetes, obesity, hyperlipidemia, atherosclerosis, and hypercholesterolemia.