PLANT CULTIVATION METHOD, USE AND PRODUCT
Patent Information
- Application Number
- PE2026000370
- Authority / Receiving Office
- PE · PE
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-08-31
- Filing Date
- 2024-06-28
- Publication Date
- 2026-07-09
Abstract
Description
Plant cultivation methods, applications and products Technical Field
[0001] The present invention relates to the field of plant cultivation, and in particular to a plant cultivation method, application, obtained target plants and products. Background Art
[0002] Artificial intervention methods for plant cultivation generally include a variety of approaches, such as genetic engineering, cell engineering, microbial engineering, etc. In order to obtain new plant varieties, the aforementioned methods are usually adopted; the new plant varieties here include the whole plant, plant organs (flowers, fruits, seeds, roots, stems, leaves, etc.), plant tissues, plant cells and other parts that can be obtained from plants.
[0003] The newly obtained plant varieties are usually expected to exhibit more optimized traits, such as optimized growth, increased yield, optimized biomass, optimized architecture, or optimized cell division. Among these optimized traits, increased yield can be achieved through various means, such as increasing the volume or weight of individual seeds / thousand seeds, increasing the number of root tillers, and other factors that can affect plant yield, especially increasing the yield of the desired part of the plant.
[0004] The above expectation is usually achieved through some transformation methods, such as modifying the plant's DNA or histones to achieve the purpose of changing plant traits. Prior to this application, there have been studies on the purpose of optimizing plant traits by demethylating plant RNA.
[0005] Summary of the Invention
[0006] While the aforementioned approaches can indeed yield plants with optimized traits, particularly those with increased yield, these plants still contain the inducing medium initially introduced into the plants. Furthermore, the screening criteria for obtaining plants still rely on plants containing the inducing medium and exhibiting optimized traits. Therefore, the applicants have discovered through research that plants with optimized traits can be obtained even without the inducing medium. Furthermore, the degree of trait optimization achieved is no less than that achieved with plants containing the inducing medium.
[0007] In view of this, the plant cultivation method provided by the present invention can obtain plants with optimized traits and without the introduction of inducing media. The specific scheme adopted is as follows:
[0008] A plant breeding method comprises introducing an induction medium into an initial plant, and obtaining a target plant that does not contain the induction medium and has optimized traits compared to the initial plant through breeding; the induction medium can induce demethylation of 6-methylated bases in RNA of the plant.
[0009] Optionally, the target plant has at least one optimized trait compared to the initial plant, and the degree of optimization is Y.
[0010] Alternatively, the initial plant is transiently introduced with the induction medium to directly obtain a target plant that does not contain the induction medium and has optimized traits compared to the initial plant.
[0011] Alternatively, the induction medium is transiently introduced into protoplast cells of the original plant.
[0012] Optionally, an induction medium is introduced into the initial plant to obtain an intermediate plant; the intermediate plant is cultured through subsequent generations to obtain a target plant that does not contain the induction medium and has optimized traits compared to the initial plant.
[0013] Optionally, the intermediate plant contains an induction medium.
[0014] Optionally, the target plant has at least one optimized trait compared to the initial plant, and the degree of optimization is Y.
[0015] Optionally, the intermediate plant has at least one optimized trait compared to the initial plant, and the degree of optimization is X.
[0016] Optionally, Y is a multiple increase compared to the initial plant during the same period, Y≥0.20; Y≥0.50; Y≥1.00; preferably Y≥2.00; preferably Y≥3.00; preferably Y≥4.00.
[0017] Optionally, the trait optimization includes increased yield.
[0018] Optionally, the trait optimization includes increasing the yield of plant organs.
[0019] Optionally, the trait optimization includes at least one of an increase in volume, an increase in number, an increase in weight, and an increase in the number of tillers of plant organs.
[0020] Alternatively, the inducing agent can induce demethylation of 6-methylated adenine in plant RNA.
[0021] Optionally, the induction medium is introduced in excess compared to the initial plants.
[0022] Optionally, the inducing medium is a nucleic acid molecule and / or polypeptide, a homologue thereof, a functional variant thereof or a combination thereof.
[0023] Alternatively, when the induction medium is a nucleic acid molecule, a homologue thereof, a functional variant thereof, or a combination thereof, the target plant does not contain the induction medium and does not contain the polypeptide expressed by the induction medium;
[0024] When the induction agent is a polypeptide, a homologue thereof, a functional variant thereof or a combination thereof, the target plant does not contain the induction agent.
[0025] Optionally, the induction medium is selected from RNA m6A demethylase and its encoding nucleic acid.
[0026] Optionally, the inducing medium is selected from at least one of FTO nucleic acid molecules and / or polypeptides, homologs thereof, functional variants thereof or combinations thereof.
[0027] Optionally, the FTO in the induction medium is derived from vertebrates, invertebrates, algae, or their orthologs or paralogs.
[0028] Optionally, the induction medium is shown in the sequence listing Seq.ID.No.1 to Seq.ID.No.15.
[0029] Optionally, the initial plant is selected from at least one of food crops, feed crops, fiber crops, oil crops, sugar crops, beverage crops, spice crops, seasoning crops, medicinal crops, dye crops, ornamental crops, fruit crops, and vegetable crops; preferably selected from at least one of rapeseed, tomato, lettuce, and sugar beet; or preferably selected from at least one of rice, corn, soybean, potato, wheat, millet, sugarcane, sorghum, and cassava; or preferably selected from at least one of tobacco, alfalfa, rubber grass, cotton, flax, sunflower, mustard, sedge, hemp, and poplar.
[0030] Optionally, the introduced initial plant region includes at least one of a plant organ, a plant tissue, and a plant cell.
[0031] Optionally, the initial plant region introduced is selected from plant meristems.
[0032] Optionally, the induction medium is introduced into at least one of the cell nucleus and cell sap of the initial plant.
[0033] Alternatively, the introduction method includes introducing a vector encapsulating the induction medium into the initial plant.
[0034] Optionally, the offspring cultivation method includes at least one of natural genetic screening removal, hybrid genetic screening removal, and active removal.
[0035] The present application also provides an application of the above-mentioned plant cultivation method in preparing plants that do not contain an inducing medium and have optimized traits.
[0036] The present application also provides a target plant obtained by the above-mentioned plant cultivation method, including at least one of a living plant, a plant organ, a plant tissue, and a plant cell.
[0037] The present application also provides products obtained by inactivating the target plant. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] FIG1 is a schematic diagram of the demethylation process of N6-methylated adenine;
[0039] FIG2 is an electrophoresis diagram of a plant sample obtained by PCR detection;
[0040] FIG3 is an example of the pCAMBIA 1307 vector carrying the FTO gene and the hygromycin resistance gene Hygromycin being transformed into Agrobacterium LBA4404 in Example 2;
[0041] FIG4 is a comparison of the whole plant and rice grains of the initial plant (Nipp) and the intermediate plant (FTO) obtained using rice as an example in Example 2;
[0042] FIG5 is a comparison diagram of the whole plant and rice grains of the initial plant (Nipp) and the target plant (Progeny FTO) obtained using rice as an example in Example 2;
[0043] FIG6 is a comparative diagram of the root systems of the initial plant (Nipp), the intermediate plant (FTO), and the target plant (Progeny FTO) obtained using rice as an example in Example 2. DETAILED DESCRIPTION
[0044] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the present invention is further described in detail below with reference to specific embodiments.
[0045] The present application has been found through research that plants have specific enzymes that can promote the base methylation of their RNA during growth and development. For example, methyltransferase MTA can promote the 6-methylation of the adenine base of RNA. Here, 6- refers to the adenine base, which is connected to the N on the RNA sequence as the starting point, and is ranked 6th in order or in reverse order. The methylated RNA undergoes a series of processes such as subsequent expression, and itself or its resulting products can promote the growth and development of plants. Experiments have confirmed that removing this methylated specific enzyme can affect the growth and development of plants (for example, it cannot produce surviving seeds or seeds cannot germinate normally). However, it has been found through research that after removing some of the methyl groups at the base position, the RNA itself or its products are more conducive to the growth and development of plants, and promote the optimization of plant traits. The method of removing the methyl group can be achieved by using a certain inducing medium.
[0046] Normally, in order to obtain plants with optimized traits, plants that retain this type of inducing medium are usually selected to obtain plants whose optimized traits can be maintained. However, the applicant unexpectedly discovered that plants that have been induced to demethylate RNA by a certain inducing medium can still maintain their optimized traits even in the absence of the inducing medium. More advantageously, the optimized traits can even be genetically retained.
[0047] The present study found that by introducing a certain induction medium that can promote RNA demethylation into plants, the plant's own traits can be optimized, and plants without induction medium and with optimized traits can be obtained, especially in terms of increased plant yield.
[0048] These inducing agents that promote plant RNA demethylation are typically based on RNA that is already methylated at its bases. Most of these inducing agents are associated with demethylases, such as FTO. The chemical mechanism of their induction is shown in Figure 1, using the demethylation process of 6-methylated adenine as an example. Research has found that, while the specific RNA sequences demethylated by these inducing agents are currently unclear, it is clear that these inducing agents can indeed demethylate RNA that is already methylated at its bases, thereby obtaining plants with optimized traits. Even more advantageously, plants that do not contain these inducing agents and have optimized traits can also be obtained.
[0049] One embodiment of the present application provides a plant breeding method, which includes introducing an induction medium into an initial plant, and obtaining a target plant that does not contain the induction medium and has optimized traits compared to the initial plant; the induction medium can induce demethylation of 6-methylated bases in the plant's RNA.
[0050] The "plant" to be cultivated herein specifically refers to a whole plant or plant part with activity, including the whole plant, the ancestors and descendants of the plant, and parts of the plant, including seeds, branches, stems, leaves, roots, flowers, fruits, etc. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, etc., and can also extend to the harvestable parts of the plant of the present invention, such as but not limited to the plant body and its descendants, or other obtainable active plant parts, etc. The "plant" described in this application is not limited to specific species, and includes, for example, herbaceous plants, woody plants, algae, ferns, and all plants belonging to the superfamily of the plant kingdom, etc., preferably, for example, monocotyledons or dicotyledons.
[0051] The "plants" to be cultivated herein, as mentioned above, can be selected from a variety of plants, for example, plants selected from the following categories of use: food crops (such as rice, corn, soybean, etc.), feed crops (such as alfalfa, etc.), fiber crops (such as cotton, hemp, etc.), oil crops (such as sesame, peanuts, etc.), sugar crops (such as sugarcane, sugar beet, etc.), beverage crops, spice crops, seasoning crops, medicinal crops (such as ginseng, ganoderma lucidum, Fritillaria, etc.), dye crops, ornamental crops, fruit crops, vegetable crops, etc.; or selected from any one of the following specific plants: for example, preferably selected from at least one of rapeseed (Brassica napus L.), tomato (Lycopersicon esculentum Mill.), lettuce (Lactuca sativa L.var.ramosa Hort.), and sugar beet (Beta vulgaris L.); or preferably selected from rice (Oryza sativa L.), corn (Zea mays L.), soybean (Glycine max (Linn.) Merr.), potato (Solanum tuberosum), wheat (Triticum aestivum L.), millet (Setaria italica var. germanica (Mill.) Schred.), sugarcane (Saccharum officinarum), sorghum (Sorghum bicolor (L.) Moench), cassava (Manihot esculenta Crantz); or preferably at least one selected from tobacco (Nicotiana tabacum L.), alfalfa (Medicago Sativa Linn), rubber grass (Taraxacum kok-saghyz Rodin), cotton (Gossypium spp), flax (Linum usitatissimum L.), sunflower (Helianthus annuus L.), flax mustard (Camelina sativa (L.) Crantz), sedge (Cyperus esculentus L.), hemp (Cannabis sativa L.), and poplar (Populus L.).
[0052] The term "initial plant" herein refers to a plant that has not been treated by the method of the present application, and its species and structure may specifically include any of the aforementioned plants. The source of the "initial plant" may be a wild plant or a plant obtained by artificial cultivation.
[0053] The term "target plant" herein refers to the plant that is processed by the method of the present application and is expected to be obtained, and its species and structure can also include any of the aforementioned plants.
[0054] The term "products obtained by processing plants" used in this article specifically refers to the products obtained after the aforementioned "plants" are inactivated and processed, and are inactive; it is not limited to various industries, such as industrial, medicinal, edible, etc., nor is it limited to specific ingredient products, such as dry granules, powder, oil, fat, fatty acid, starch or protein, etc., nor is it limited to specific product forms, such as solid, liquid, gaseous or mixed states, etc.
[0055] The term "increased yield" as defined herein means an increased weight of a specific harvested part relative to the initial plant, e.g. for rice, an increase in the weight of rice grains is an increased yield, for potatoes, an increase in the weight of tubers is an increased yield, etc.
[0056] The term "increased biomass" as defined herein refers to the increased weight of the entire plant excluding the portion evaluated for yield increase; for example, for rice, the increased weight of the remaining portion excluding the rice grains is the increased biomass.
[0057] The yield and biomass described in this article are all compared with the dry weight of plants at the same period.
[0058] Implementation of the method of the present invention provides plants with increased growth rate. Therefore, the present invention provides a method for increasing plant growth rate, the method comprising introducing an inducing agent that promotes RNA demethylation into the plant to obtain a target plant that does not carry the inducing agent.
[0059] Therefore, the present invention provides a method for increasing plant yield, which comprises introducing an induction agent into an initial plant, and obtaining a target plant that does not contain the induction agent and has increased yield compared to the initial plant; the induction agent can induce RNA demethylation in the plant.
[0060] Plant traits can be adjusted and optimized by introducing an induction agent for RNA demethylation. Alternatively, plant traits can also be adjusted and optimized by using homologs, functional variants / combinations of the induction agent.
[0061] The term "inducing medium" as defined herein refers to a medium that can induce demethylation of RNA in plants. "Inducing" can refer to either catalysis or participation in a reaction, preferably catalysis. Such mediators can currently be, for example, demethylases, such as FTO. Furthermore, "RNA" includes one or more RNAs of plants, such as ribosomal RNA (rRNA), messenger RNA (mRNA), transfer RNA (tRNA), etc.; "demethylation" refers to the demethylation of already methylated RNA, which can be demethylation at one or more sites in the RNA, such as the demethylation of already methylated bases in the RNA, such as the demethylation of bases at 1-methylation, or the demethylation of bases at 6-methylation. Here, 1- and 6- both define the position of methylation, such as the 1-position, where the N starting position of a base-linked RNA is the 1-position, and the 6-position, counting clockwise or counterclockwise, is the 6-position. Here, "base" can be, for example, common bases in nucleic acid molecules, such as adenine (A), cytosine (C), guanine (G), etc.
[0062] The source of the "inducing medium" can be any one or more sources, such as from animals or microorganisms; more preferably, the inducing medium can be derived from vertebrates, algae, preferably from humans or green algae; the "source" defined herein can be directly derived from vertebrates or algae, or indirectly derived from vertebrates or algae, such as from a direct homolog of a vertebrate or algae or a paralog thereof, preferably from a direct homolog of a human or green algae or a paralog thereof.
[0063] The term "paralog" refers to the duplication of genes within the genome of a species, resulting in paralogous genes.
[0064] The term "orthologs" relates to homologous genes in different organisms resulting from speciation.
[0065] The term "homology" herein refers to homologous sequences having equivalent functions to the inducing mediator sequences; the term "functional variant / combination" herein refers to variants / combinations of inducing mediators having equivalent functions obtained by mutation, combination, etc. using the inducing mediators.
[0066] The term "introduction" herein includes one or more aspects, such as introduction route, introduction area, introduction amount, and the like.
[0067] Introduction can occur via a variety of routes, including infection of the plant with a vector carrying the inducing agent, insertion of the inducing agent into the plant's DNA, or insertion of the vector carrying the inducing agent into cells. The specific region of introduction is not limited, and may include, for example, the nucleus or the cytosol. Furthermore, introduction can be transient or prolonged, and in small amounts or in excess, depending on the characteristics of the plant and the inducing agent introduced.
[0068] The term "free from induction medium" herein means that the obtained target plant at least does not contain the introduced induction medium.
[0069] For example, when the induction agent is a nucleic acid molecule, a homologue thereof or a functional variant thereof, the target plant does not contain the induction agent and the polypeptide expressed by it.
[0070] When the induction agent is a polypeptide, a homologue thereof or a functional variant thereof, the target plant does not contain the induction agent.
[0071] More specifically, the present application provides a method for cultivating a plant, the method comprising the following steps:
[0072] The initial plant is introduced with an inducing medium to obtain an intermediate plant; the intermediate plant is cultured through subsequent generations to obtain a target plant that does not contain an inducing medium and has optimized traits compared to the initial plant.
[0073] The target plant obtained in the present application, which does not contain an inducing medium and has optimized traits compared to the initial plant, can be obtained directly or indirectly. Direct acquisition, for example, can be the instantaneous introduction of an inducing medium into the initial plant, especially the instantaneous introduction of an inducing medium into the protoplast cells of the initial plant; indirect acquisition can be obtained through an intermediate plant, that is, the first plant obtained after the introduction of the inducing medium, and the second plant (target plant) is obtained through its offspring cultivation. Both the former and the latter have an effect on the RNA demethylation of the plant. The difference lies in whether it passes through an intermediate plant. Similarly, the terms "intermediate plant" and "target plant" in this article are the same as the aforementioned plants in structure or species.
[0074] The "inducing medium" described herein is selected from RNA m6A demethylase and its encoding nucleic acid, wherein the encoding nucleic acid is the amino acid sequence of the RNA m6A demethylase of the present application, and various nucleic acids encoding its amino acid sequence can be obtained by conventional reverse engineering in the art, or a nucleic acid directly obtained from the source of RNA m6A demethylase.
[0075] The term "intermediate plant" herein may be any subsequent generation of plant of the initial plant."Intermediate plant" may contain an induction medium.
[0076] The "target plant" herein may be any subsequent generation of the initial plant. When no intermediate plant is produced, the target plant is a plant directly cultivated from the initial plant. When an intermediate plant is produced, the target plant is cultivated from the intermediate plant and then obtained from its progeny.
[0077] The present application method can not specifically limit the numerical value of proterties optimization degree, that is, it can not be quantitatively described, only qualitative description is carried out. In the present application method, the proterties of plant can be improved or beneficially increased, all belong to proterties optimization. In addition, the proterties optimization degree X, Y defined herein can also be limited by specific numerical values, which are all based on the same proterties of the initial plant as compared, such as seed quantity increases X, Y, and total seed weight increases X, Y.
[0078] The trait optimization degree Y of the target plant can be the same as, not exceeding, or even exceeding the trait optimization degree X of the intermediate plant. If calculated as a multiple of increase, Y is the multiple of increase compared to the initial plant over the same period, with Y ≥ 0.20; Y ≥ 0.50; Y ≥ 1.00; preferably Y ≥ 2.00; preferably Y ≥ 3.00; and preferably Y ≥ 4.00. Here, the multiple of increase can be, for example, a multiple of weight gain or other multiples.
[0079] In the method of the present application, the induction medium can be selected as a nucleic acid molecule and / or polypeptide, a homologue thereof or a functional variant / combination thereof.
[0080] The term also refers to an inducing agent that can be a nucleic acid molecule or polypeptide, or a mixture of nucleic acid molecules and polypeptides; it can even refer to a paralog or ortholog sharing the aforementioned homology with the nucleic acid molecule or polypeptide, or a substance obtained by corresponding vectors, hybridization, or fusion. Specifically, existing inducing agents for demethylation can be, for example, one or more of the sequences listed in the following sequence listing. It should be understood that inducing agents are not limited to the sequences listed in the sequence listing.
[0081] The "nucleic acid molecule and / or polypeptide, homologue or functional variant thereof" may be any natural or synthetic substance.
[0082] The term "hybridization" as defined herein is the process in which complementary nucleotide sequences of basic homology return to each other. The hybridization process can occur completely in solution, i.e., complementary nucleic acids are all in solution. The hybridization process can also be carried out in such a way that one of the complementary nucleic acids is fixed on a matrix such as magnetic beads, agarose beads or any other resin. In addition, the hybridization process can also be carried out in such a way that one of the complementary nucleic acids is fixed on a solid support such as nitrocellulose membrane or nylon membrane, or is fixed on a silica glass support such as by photolithography. In order to make hybridization occur, usually nucleic acid molecules are thermally denatured or chemically denatured so that the double-stranded nucleic acid is melted into two strands and / or hairpin or other secondary structures are removed from single-stranded nucleic acid. The stringency of hybridization is subject to the influence of conditions such as temperature, salt concentration and hybridization buffer composition.
[0083] The nucleic acid molecule or its variant can be from any natural or artificial source. The nucleic acid / gene or its variant can be isolated from a microbial source such as bacteria, yeast or fungi, or from a plant, algae or animal (including human) source. The nucleic acid can be modified from its native form in terms of composition and / or genomic environment by rigorous manual manipulation. The nucleic acid is preferably of algal origin, particularly, for example, of green algae origin.
[0084] The term "homolog" encompasses two special forms of homology, orthologous sequences and paralogous sequences, which relate to evolutionary concepts used to describe the genetic relationships of genes.
[0085] Homologues can also be in the form of "insertion variants" of proteins, i.e., wherein one or more amino acid residues are introduced into a predetermined site in the protein. Insertion can include amino-terminal and / or carboxyl-terminal fusions, as well as insertions within the sequence of single or multiple amino acids. Typically, the insertion within the amino acid sequence will be smaller than the amino-terminal or carboxyl-terminal fusions, being approximately 1 to 10 residues. Examples of amino-terminal or carboxyl-terminal fusion proteins or peptides include binding domains or activation domains of transcriptional activators such as those used in yeast two-hybrid systems, phage coat proteins, (histidine) 6-tags, glutathione S-transferase-tags, protein A, maltose binding protein, dihydrofolate reductase, Tag.100 epitopes, c-myc epitopes, FLAG epitopes, lacZ, CMP (calmodulin binding peptide), HA epitopes, protein C epitopes, and VSV epitopes.
[0086] Functional variants that can be used in the present application's method also include optional splice variants of nucleic acid molecules or genes. The term "selectable splice variant" as used herein encompasses such nucleic acid sequence variants in which selected introns and / or exons have been excised, replaced, or added. Such variants are those in which the biological activity of the protein remains unaffected, and can be obtained by selectively retaining the functional fragments of the polypeptide. Such splice variants can be naturally discovered or can be artificial. Methods for producing such splice variants are well known in the art.
[0087] The advantages of increased yield or increased root system of the new plants obtained by the plant cultivation method of the present application will be described below through specific examples.
[0088] Example 1: Method for inducing target plants by co-culturing induction medium and protoplasts
[0089] 1. Expression and purification of induction media
[0090] Experimental group: The induction medium was cloned into the pET28a vector expressed in Escherichia coli to obtain an induction medium with an N-terminal fusion His6 tag. The cloned plasmid was transformed into gold competent cells of E. coli and cultured. When the OD600 was 0.6-0.8, 0.5mM IPTG was added for induction. The cells were expressed at 16°C for 20 hours and then harvested. Ultrasonic disruption was performed for 10 minutes and high-speed centrifugation was performed at 13000 rpm for 30 minutes. The supernatant was collected for subsequent purification experiments. First, Ni column affinity purification was performed, followed by cation exchange column, and finally size exclusion chromatography column. The collected protein was concentrated to a higher concentration of 10-20 mg / mL, and the purity of the protein was detected by polyacrylamide gel electrophoresis.
[0091] Control group: except that the induction medium was not used, the other steps and parameters were the same as those of the experimental group.
[0092] 2. Preparation of protoplasts
[0093] Method 1: Seeds were sterilized in a 70% ethanol, 0.4% hypochlorite solution for 15 minutes, washed three times with distilled water, and sown on 1 / 2 MS solid medium. Seedlings were grown in a 25°C greenhouse under a photoperiod of 16 hours of light and 8 hours of darkness. To isolate protoplasts, leaves, stems, and sheaths of 14-day-old seedlings were incubated with an enzyme solution (1.0% cellulase R10, 0.5% macerozyme R10, 0.45 M mannitol, 20 mM MES [pH 5.7], in CPW) at 25°C in the dark with shaking (40 rpm), then diluted with an equal volume of W5 solution. After filtration, protoplasts were collected by centrifugation at 100 g for 5 minutes. The protoplasts were resuspended in CPW21S solution (CPW containing 21% [w / v] sucrose, pH 5.8) and centrifuged at 80 g for 7 minutes to collect the protoplasts at the bottom of the tube. Resuspend the protoplasts in W5 solution and centrifuge at 70g for 5 minutes to collect the protoplasts at the bottom of the tube. Finally, resuspend the protoplasts in W5 solution and count them using a hemocytometer under a microscope. Dilute the protoplasts to 1×10 6 Protoplast density: 100 protoplasts / mL MMG solution (0.4 M mannitol, 15 mM MgCl2, 4 mM MES [pH 5.7]). Suitable for plants such as Arabidopsis and rice.
[0094] The second method: Take plant leaves grown in B5 medium for 3 weeks and digest them with an enzyme solution (1% cellulose R10, 0.25% macerozyme R10, 0.5M mannitol, 8mM CaCl2, 5mM MES [pH 5.7], 0.1% BSA) in the dark at 25°C for 5 hours. Resuspend the protoplasts twice with an equal volume of W5 solution. To obtain intact protoplasts, place the protoplasts in the W5 solution on an equal volume of 21% sucrose gradient at 50g and centrifuge for 5 minutes. Collect the intact protoplasts and resuspend them in W5 solution. Before PEG-mediated transfection, place the prepared protoplast solution at 4°C for at least 1 hour. Suitable for plants such as tobacco.
[0095] 3. Protoplast transfection
[0096] Before transfection, 1-5×10 5 Protoplasts were suspended in 200 μL of MMG solution and gently mixed with 5–20 μL of protein solution (10–60 μg of induction mediator protein) (separately for control and experimental groups) and 210 μL of freshly prepared PEG solution (40% [w / v] PEG 4000, 0.2 M mannitol, and 0.1 M CaCl₂). The mixture was incubated at 25°C in the dark for 10 minutes. Following incubation, 950 μL of W5 solution (2 mM MES [pH 5.7], 154 mM NaCl, 125 mM CaCl₂, and 5 mM KCl) was slowly added, and the resulting solution was thoroughly mixed by inverting the tube. Protoplasts were collected by centrifugation at 100 g for 3 minutes and gently resuspended in 1 ml of WI solution (0.5 M mannitol, 20 mM KCl, and 4 mM MES [pH 5.7]). Finally, the protoplasts were transferred to multiwell plates and cultured in the dark at 25°C for 24 to 48 hours.
[0097] 4. Protoplast regeneration
[0098] The transfected protoplasts were resuspended in 0.5× B5 supplemented medium (0.5× B5 medium, 375 mg / L CaCl2·2H2O, 18.35 mg / L NaFe-EDTA, 270 mg / L sodium succinate, 103 g / L sucrose, 0.2 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.3 mg / L 6-benzylaminopurine (BAP), and 0.1 g / L MES), and an equal volume of 2.4% agarose solution was added to dilute the protoplasts to 2.5×10 5 Protoplasts / ml were embedded in agarose and plated in 6-well plates. The plates were covered with 2 ml of 0.5×B5 liquid medium and incubated at 25°C in the dark. After 7 days, fresh 2 ml of 0.5×B5 liquid medium was replaced. The 6-well plates were transferred to the light (16 h light [30 μmol / m-2 s -1 ] and 8 hours of darkness) and cultured at 25°C. After 3 weeks of culture, microcalli that had grown to several millimeters in diameter were transferred to MS regeneration medium containing 30 g / L sucrose, 0.6% plant agar, 0.1 mg / L α-naphthaleneacetic acid (NAA), and 0.5 mg / L BAP. After approximately 4 weeks on the regeneration medium, the induction of new shoot tissue was observed.
[0099] 5. Plant bud tissue regeneration, transplanting, and management
[0100] The newly formed bud tissue was cut and transferred to a rooting medium to root and form complete seedlings. The surviving plants were then transplanted to a greenhouse and fertilized and watered as usual. The transformed seedlings were harvested.
[0101] 6. Obtaining genetically improved plants without induction media
[0102] Harvested transformed seedlings are free of the inducing agent and can be identified by genomic DNA PCR. These plants are then planted in the field and their yield is evaluated through at least two field trials. Plants with increased yield are selected, ultimately obtaining the target plants free of the inducing agent.
[0103] The following data is calculated based on samples collected from mature experimental and control target plants. The measured data refer to the aforementioned information. Yields of different plants are calculated as a percentage increase (Y) relative to the yield of the control plants. Yields are calculated based on the harvested product or root system of each plant, not limited to roots, stems, leaves, flowers, fruits, and seeds.
[0104] The yield of the control group plants in this application is the yield of the initial plants without the introduction of the inducing medium. Y is the percentage increase or enhancement of each trait based on the initial plants, expressed in %. The above data refer to dry weight, specifically the weight obtained after oven-drying at 105°C for 20 minutes and oven-drying at 80°C for 20 hours. Example 1: The inducing medium is a polypeptide or a nucleic acid molecule encoding the same. The specific sequence can be the same as SEQ ID NOs: 1-4 in the sequence listing of the specification, or a homologous sequence with equivalent functions, or a variant / combination with equivalent functions. The inducing medium can be derived from vertebrates, invertebrates, or algae.
[0105] The data obtained below are all based on a single variable (i.e., the experimental group with the introduction of an inducing medium sequence or the control group with no introduction of an inducing medium sequence). The remaining factors affecting plant yield and root system increase are artificially unified, such as the soil environment, air environment, water quality, other introduced components, cultivation conditions and methods, cultivation time period, etc.; all substances or components used can be purchased commercially.
[0106] Table 1—Induction medium derived from human (Homo sapiens) FTO (experimental group)
[0107] The above Table 1 may use the human FTO polypeptide sequence of SEQ ID NOs: 1 in the sequence listing or a DNA encoding and expressing the polypeptide sequence, or a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.
[0108] Table 2—Induction medium from porcine (Sus scrofa) FTO (experimental group)
[0109] The above Table 2 may use the porcine FTO polypeptide sequence of SEQ ID NOs: 2 in the sequence listing or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.
[0110] Table 3 - Induction medium from bovine (Bos taurus) FTO (experimental group)
[0111] The above Table 3 may use the bovine FTO polypeptide sequence of SEQ ID NOs: 3 in the sequence listing or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.
[0112] Table 4—Induction medium from green flagellate algae (Ostreococcus lucimarinus) FTO (experimental group)
[0113] The above Table 4 may use the green flagellate FTO polypeptide sequence of SEQ ID NOs: 4 in the sequence listing or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.
[0114] Example 2: Method for obtaining intermediate plants by infecting callus tissue with Agrobacterium and screening target plants in subsequent generations
[0115] 1. Inducing callus tissue using plant seeds as test materials
[0116] 1) Disinfection:
[0117] Take mature seeds of the plant, shell them manually, select plump, smooth and sterile seeds, place the seeds in a 100ml sterile beaker, pour in 70% alcohol for disinfection for 2 minutes; pour out the alcohol, add 20% sodium hypochlorite (NaClO) solution, and soak for 30 minutes; pour out the sodium hypochlorite solution, wash the seeds with sterile distilled water 4 to 5 times, and finally soak the seeds in sterile distilled water for 30 minutes.
[0118] 2) Induction culture (sterile operation required):
[0119] After sterilizing, place the seeds on sterile filter paper to dry them. Place 12-14 seeds per dish in NB medium (pH 5.8) containing 2.0 mg / L 2,4-D. To ensure optimal induction efficiency, keep the seeds germinating parallel to the medium or slightly downward, rather than upward or vertically downward. Seal the dish with parafilm and incubate in a dark incubator at 30°C and approximately 50% humidity for 20-30 days until noticeably loose callus forms. Subculture or pre-culture transformation can then be performed.
[0120] 3) Subculture (sterile operation required):
[0121] Open a culture dish on a clean bench and use tweezers to select naturally split, vigorously growing, firm, tender yellow callus with a diameter of approximately 3 mm. Place 10 calli per dish in NB medium (pH 5.8) containing 2.0 mg / L 2,4-D and 0.5 mg / L 6-BA. Incubate at 30°C in the dark. If the callus becomes severely softened, subculture in the light is recommended. Subculture should last approximately 10-15 days (depending on the growth of the callus) for a total of two subcultures. Note: If excessive water is observed on the lid of the dish during culture, this is not recommended and may cause the culture to fail. This is because the bottom of the dish is heated, and the lid temperature is lower than the medium temperature, causing condensation on the lid.
[0122] 2. Agrobacterium culture
[0123] Experimental group: The vector carrying the induction medium and the hygromycin resistance gene Hygromycin was transferred into the parasite, for example, the pCAMBIA 1307 vector carrying the induction medium and the hygromycin resistance gene Hygromycin was transferred into Agrobacterium LBA4404 and inoculated onto YEP solid medium containing 20 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Kan).
[0124] Control group: The vector of the hygromycin resistance gene Hygromycin is transferred into the parasite, for example, the pCAMBIA 1307 vector of the hygromycin resistance gene Hygromycin is transferred into Agrobacterium LBA4404, and inoculated onto YEP solid culture medium containing 20 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Kan).
[0125] After culturing the control and experimental groups at 28°C for 2 days, single Agrobacterium clones were picked for colony PCR to verify whether the induction medium had been transferred into Agrobacterium, and positive single clones were selected and cultured in 4 ml YEP (containing 50 mg / L Kan and 20 mg / L R-Lif) culture medium at 28°C and 220 rpm for 20 to 36 h until the OD600 of the bacterial solution reached 0.8 to 1.0.
[0126] 3. Infection and Co-cultivation
[0127] 1) Centrifuge the cultured Agrobacterium (control and experimental groups separately) at 4°C, 4000 rpm for 10 minutes, and remove the supernatant. Resuspend the culture in AAM medium containing 100 μmol / L acetosyringone to a final OD600 concentration of approximately 0.2.
[0128] 2) Pick out rice callus that has grown to a certain size and infect it with Agrobacterium suspension for 20 to 30 minutes.
[0129] 3) Remove the callus tissue and place it on sterile filter paper to drain for 20-30 minutes to prevent excessive growth of Agrobacterium during co-culture and excessive damage to the callus tissue.
[0130] 4) The callus tissue was placed in NB medium (pH 5.2) containing 2.0 mg / L 2,4-D and 100 μmol / L acetosyringone and cultured in the dark at 25°C for 48 to 72 hours.
[0131] Note: The co-culture should be followed up and observed. If Agrobacterium is obviously seen, it means that the infection is excessive and the subsequent screening will easily lead to bacterial growth.
[0132] 4. Screening of resistant callus
[0133] Remove the callus and wash it 5-6 times with sterile water, shaking it constantly. Then, place the callus on sterile filter paper to air dry, and evenly plate it on NB medium (pH 5.8) containing 50 mg / L hygromycin for the first round of selection. Incubate in the dark at 28°C. If mold or Agrobacterium growth is observed, transfer the callus to a new screening plate.
[0134] After new callus tissue grows after about 30 days of screening, transfer it to new NB medium (pH 5.8) containing 50 mg / L hygromycin and screen for another 7-10 days. If it grows obviously, it is a positive callus tissue. If it does not grow, even if it does not turn brown and die, it may be a false positive.
[0135] 5. Induction, differentiation and rooting of positive callus
[0136] Place the yellow, vigorously growing callus particles from the second screening (to ensure that the callus used for differentiation is free of defects) onto NB medium (pH 5.8) containing 2.0 mg / L 6-BA, 0.5 mg / L kinetin, and 50 mg / L hygromycin. Place two to three positive clones per bottle, using a small amount of callus per clone. The quality of the callus should be high, not the quantity. Incubate in the dark at 27°C for 10 days. After 10-20 days of differentiation under light, rooting can begin after green leaves appear. Light intensity is 4000 lux, 14 hours per day.
[0137] Induce rooting by placing robust seedlings from each clone in 1 / 2 N6 medium (pH 5.8) containing 0.5 mg / L naphthaleneacetic acid and 50 mg / L hygromycin, with 2-3 seedlings per bottle. Incubate at 27-30°C under 4000 lux for 14 hours per day. After 7-10 days, remove the sealing film and add an appropriate amount of sterile water. Transplant after 2-3 days.
[0138] Note: The callus cannot be subcultured during the differentiation process. The time from differentiation to transplantation of intermediate plants is about three months.
[0139] 6. Training and transplanting of middle plants
[0140] Pick out the seedlings of the intermediate plants with relatively complete differentiation of roots, stems and leaves (open the lid in time when the seedlings grow to the top of the test tube), open the sealing film, add appropriate amount of distilled water or sterile water (to prevent bacteria from growing in the culture medium), harden the seedlings for about 3 days to a week, then wash off the agar, transplant them into soil pots in the greenhouse for growth, test, and obtain the intermediate plants.
[0141] 7. Testing and verification of intermediate plants
[0142] 1) PCR Assay: Design induction mediator primers, for example, FTO-F: ATGAAGCGCACCCCGACTG; FTO-R: GGGTTTTGCTTCCAGAAGCTGA. PCR reaction program: 95°C for 5 min, 95°C for 15 s, 58°C for 15 s, 72°C for 30 s, 35 cycles, extension at 72°C for 10 min, and storage at 4°C. After completion of the reaction, analyze the PCR products by 1% agarose gel electrophoresis.
[0143] 2) Method for rapid detection of intermediate plants with hygromycin: Cut and collect fresh green leaves about 1 cm long from the seedlings to be tested (with incisions left at both ends), place them flat on the test medium (0.7% agar, 1 ml / L 6-BA, 50 mg / L hygromycin), and incubate them at 28°C, 16 h light / 8 h dark for 48 h. Plants with leaves that remain bright green are positive, while leaves of negative seedlings show blocky necrosis.
[0144] 8. Evaluation of the effect of induction medium in intermediate plants
[0145] The following data is calculated based on samples collected from the middle of the experimental and control groups at maturity. The data used for this analysis refers to the aforementioned information. Yields of different plants are calculated as a percentage increase (X) relative to the yield of the control group. Yields are calculated based on the harvested product or root system of each plant, not limited to roots, stems, leaves, flowers, fruit, or seeds.
[0146] The yield of the control group plants in the present application is the yield of the initial plants without the introduction of the inducing medium, and Y is the percentage data of the increase or increase of each trait based on the initial plants, in %. The above data involve weight as dry weight, specifically the data obtained by weighing after fixing in an oven at 105°C for 20 minutes and baking in an oven at 80°C for 20 hours.
[0147] The data obtained below are all based on a single variable (i.e., the experimental group with the introduction of an inducing medium sequence or the control group with no introduction of an inducing medium sequence). The remaining factors affecting plant yield and root system increase are artificially unified, such as the soil environment, air environment, water quality, other introduced components, cultivation conditions and methods, cultivation time period, etc.; all substances or components used can be purchased commercially.
[0148] 9. Obtaining genetically improved target plants without induction media
[0149] 1) Isolated from an intermediate plant.
[0150] In plants that heterozygously overexpress an inducing mediator, when cells undergo meiosis to form germ cells, the inducing mediator is separated along with the separation of homologous chromosomes and enters one of the gametes. After self-pollination, it is independently inherited by the gametes to offspring, resulting in genetic segregation and the production of offspring that do not carry the inducing mediator and offspring that overexpress the inducing mediator. Plants whose genomes lack the inducing mediator and hygromycin genes can be screened for by PCR testing of genomic DNA. These plants lacking the inducing mediator and hygromycin genes are then planted and evaluated for optimized traits through at least two experiments. Target plants with optimized traits are then selected, ultimately yielding target plants whose genomes lack the inducing mediator and hygromycin genes.
[0151] 2) Obtained by hybridization between an intermediate plant and the wild type.
[0152] Crop hybridization involves fertilizing the pistils of one variety with pollen from another variety, resulting in hybrid seeds. For example, rice is a self-pollinating crop with monoecious plants and identical flowers. To obtain hybrid seeds, the male organs of the T3 generation of pure lines that overexpress an inducing agent must be removed and artificially pollinated with wild-type rice pollen. Hybrid seeds are intermediate plants that overexpress the inducing agent. Self-pollination will cause genetic segregation, resulting in progeny that do not carry the inducing agent and progeny that overexpress the inducing agent. Genomic DNA PCR testing can be used to screen for rice whose genomes lack the inducing agent and hygromycin genes. These plants are then grown and evaluated for optimized traits through at least two experiments. Target plants with optimized traits are then selected, ultimately yielding target plants whose genomes lack the inducing agent and hygromycin genes.
[0153] 3) Obtained through natural loss during the genetic process of intermediate plants from generation to generation.
[0154] During the seed reproduction process, crops undergo meiosis to form reproductive cells. The sperm (pollen) and egg combine to complete the fertilization process to form a zygote, which then develops into a seed. This process increases species diversity and promotes the evolution of species genotypes. During the generation-by-generation reproduction of seed plants, exogenously introduced genes will be naturally lost. After the loss of exogenous genes, target plants with optimized traits that do not carry induction media are obtained. During the generation-by-generation inheritance of strains overexpressing induction media, continuous genomic DNA PCR detection from generation to generation revealed that the exogenous genes in the genome were lost, meaning that the induction media and hygromycin genes could not be detected. Based on existing experience, exogenous gene loss can be observed in the T2 generation. These plants that do not carry induction media and hygromycin genes are planted, and their optimized traits are evaluated through at least two experiments. The target plants with optimized traits are screened out, and ultimately the target plants with optimized traits whose genomes do not carry induction media and hygromycin genes are obtained.
[0155] Note: Genomic DNA PCR detection method:
[0156] Design gene primers, for example, FTO-F: AGGAAGTTCATTTCATTTGGAGAGGAC; FTO-R: GGGTTTTGCTTCCAGAAGCTGA. PCR reaction program: 95°C for 5 minutes, 95°C for 15 seconds, 60°C for 120 seconds, 72°C for 30 seconds, 35 cycles, extension at 72°C for 10 minutes, and storage at 4°C. PCR products were analyzed by 1% agarose gel electrophoresis.
[0157] Hygromycin gene primers were designed: Hyg-F: CTTCTACACAGCCATCGGTC; Hyg-R: ACAATCCCACTATCCTTCGC. The PCR reaction program was as follows: 95°C for 5 minutes, 95°C for 15 seconds, 55°C for 120 seconds, 72°C for 30 seconds, extension at 72°C for 10 minutes, and storage at 4°C. After completion of the reaction, PCR products were analyzed by 1% agarose gel electrophoresis.
[0158] Here’s how:
[0159] 1. Plant DNA Extraction Method
[0160] Kit Name: DNAquick Plant System Quick Plant Genomic DNA Extraction System
[0161] Brand: TIANGEN
[0162] 1. Processing materials:
[0163] Take 100mg of fresh plant tissue and place it in a 2ml test tube containing a steel ball, or place 10mg into the wells of a 96-well plate (the volume of the solution below the 96-well plate extraction should be halved). Place in a -80°C refrigerator for at least 30 minutes, shake in a grinder for 1 minute, add 400µl of buffer FP1 and 6µl of RNase A (10mg / ml), vortex for 1 minute, and let it stand at room temperature for 10 minutes. Note: Due to the rich diversity of plant materials, the optimal amount of experimental material should be determined based on the different materials or different tissues of the same material.
[0164] 2. Add 130ul of buffer FP2, mix thoroughly, and vortex for 1min.
[0165] 3. Centrifuge at 12,000 rpm (~13,400 x g) for 5 min and transfer the supernatant to a new centrifuge tube.
[0166] 4. Optional step: Centrifuge the supernatant again at 12,000 rpm (~13,400 x g) for 5 min and transfer the supernatant to a new centrifuge tube.
[0167] Note: The purpose of this step is to remove the precipitated impurities in the supernatant to make the extracted genomic DNA purer.
[0168] 5. Add 0.7 volumes of isopropanol to the supernatant and mix thoroughly. Flocculent genomic DNA will appear (e.g., add 350 μl of isopropanol to 500 μl of supernatant). Centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes. Discard the supernatant and retain the pellet.
[0169] 6. Add 600 μl of 70% ethanol, vortex for 5 seconds, centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes, and discard the supernatant.
[0170] 7. Repeat step 6.
[0171] 8. Open the lid and invert it at room temperature for 5-10 minutes to completely dry any remaining ethanol.
[0172] Note: Ethanol residue will affect subsequent enzyme reactions (enzyme digestion, PCR, etc.)
[0173] 9. Add 200ul of elution buffer TE and dissolve the DNA in a 65-degree water bath for 10-60 seconds, inverting and mixing several times to help dissolve the DNA. Finally, a DNA solution is obtained.
[0174] 2. PCR reaction
[0175] 1. Reagents
[0176] Specific primer: FTO primer
[0177] PCR enzyme mix: New blue fuel high-fidelity Taq enzyme mix, brand: Polymer
[0178] Primers: FTO primers, forward primer FTO-F, reverse primer FTO-R
[0179] 2. Configure the reaction system
[0180] Add each component in turn to the wells of a 0.2 ml centrifuge tube or PCR plate
[0181] 3. Set the time and temperature as follows, and perform electrophoresis identification after amplification.
[0182] Pre-denaturation at 95°C for 3 min, enter the cyclic amplification stage: 95°C for 30 s → 58°C for 30 s → 72°C for 20 s, cycle 30-35 times, and keep warm at 72°C for 5 min.
[0183] 3. Agarose nucleic acid electrophoresis
[0184] 1. Wash the electrophoresis equipment with distilled water and set up the comb.
[0185] 2. Prepare an agarose gel of appropriate concentration of 1.5%. Accurately weigh 1.5 g of agarose and add it to a conical flask. Add about 100 ml of electrophoresis buffer (TAE).
[0186] 3. After melting in a microwave oven, take it out and wait for a while to cool down before adding 10ul of dye (10000X), mix thoroughly and pour into the electrophoresis tank.
[0187] 4. Allow the gel to solidify at room temperature for about 40 minutes, carefully remove the comb, and place the gel in the electrophoresis tank for sample application.
[0188] 5. Add electrophoresis buffer to the electrophoresis tank until it covers the surface of the gel. There should be no bubbles in the sample wells.
[0189] 6. Prepare the sample before spotting. Add 5ul of sample and marker (in the eight-tube strip). Use a gun to slowly inject the mixed sample into the spotting wells, taking care not to cross the holes.
[0190] 7. According to the positive and negative poles (red positive and black negative), turn on the power supply, the voltage is 40-60V, and the time is 30-40min. You can judge whether to terminate the electrophoresis based on the position of bromophenol blue.
[0191] 8. After electrophoresis is complete, turn off the power, observe the gel image, and compare the markers to determine the fragment size.
[0192] 4. Test results:
[0193] As shown in the electrophoresis diagram in Figure 2: the presence of bands indicates that the sample contains the FTO gene, and the absence of bands indicates that the sample does not contain the FTO gene.
[0194] 10. Evaluation of target plant traits
[0195] The following data is calculated based on samples collected from mature experimental and control target plants. The measured data refer to the aforementioned information. Yields of different plants are calculated as a percentage increase (Y) relative to the yield of the control plants. Yields are calculated based on the harvested product or root system of each plant, not limited to roots, stems, leaves, flowers, fruits, and seeds.
[0196] The yield of the control group plants in the present application is the yield of the initial plants without the introduction of the inducing medium, and Y is the percentage data of the increase or increase of each trait based on the initial plants, in %. The above data involve weight as dry weight, specifically the data obtained by weighing after fixing in an oven at 105°C for 20 minutes and baking in an oven at 80°C for 20 hours.
[0197] The data obtained below are all based on a single variable (i.e., the experimental group with the introduction of an inducing medium sequence or the control group with no introduction of an inducing medium sequence). The remaining factors affecting plant yield and root system increase are artificially unified, such as the soil environment, air environment, water quality, other introduced components, cultivation conditions and methods, cultivation time period, etc.; all substances or components used can be purchased commercially.
[0198] In Example 2, the inducing medium is a nucleic acid molecule or a polypeptide. The specific sequence can be the same as SEQ ID NOs: 1 to 8 or SEQ ID NOs: 12 to 15 in the sequence listing of the specification, or a homologous sequence with equivalent functions, or a variant / combination with equivalent functions; the inducing medium can be derived from vertebrates or algae.
[0199] The solution used in Example 2 can be specifically exemplified as follows:
[0200] 1. YEP liquid medium formula for Agrobacterium growth (content per liter): yeast extract 10g / L + peptone 10g / L + NaCl 5g / L, pH 7.2. For solid medium, add 15g / L agar.
[0201] 2. Agrobacterium resuspension AAM culture medium: 50 ml 20×AA macroelements, 10 ml 100×FeEDTA, 10 ml 100×B5 macroelements, 10 ml 100×B5 vitamins, 100 ml 10×AA amino acids, 1 ml 100 mM acetosyringone, 68.5 g sucrose, 36 g glucose, 0.5 g hydrolyzed casein, make up to 1000 ml, adjust pH to 5.2, and sterilize through 0.22 mm cellulose acetate membrane.
[0202] 3. 20×AA macroelements: 59g KCl, 3g CaCl2·2H2O, 10g MgSO4·7H2O and 3g NaH2PO4·H2O. Make up to 1L with distilled water and store at 4℃.
[0203] 4. 10×AA amino acids: 8.76 g Gin, 2.66 g Asp, 1.74 g Arg, and 75 mg Gly are diluted to 1 L with distilled water, sterilized by passing through a 0.22 mm cellulose acetate membrane, and stored at 4°C.
[0204] 5. 100× Vitamin B5: 10g inositol, 1g thiamine hydrochloride, 100mg pyridoxine hydrochloride and 100mg niacin. Add distilled water to 1L and store at 4℃.
[0205] 6. 100×B5 macroelements: 1.320mg MnSO4·4H2O, 200mg ZnSO4·7H2O, 2.5mg CuSO4·5H2O, 25mg Na2MoO4·2H2O, 2.5mg CoCl2·6H2O, 300mg H3BO3 and 75mg KI. Add distilled water to 1L and store at 4℃.
[0206] 7. NB medium: N6 medium macroelements and trace elements, B5 medium organic elements, 300 mg / L hydrolyzed casein, 500 mg / L glutamine, 30 g / L sucrose and 8 g / L agar.
[0207] Example 3: Method for obtaining intermediate plants by infecting the stem tip tissue with Agrobacterium and screening target plants in the offspring
[0208] 1. Inducing callus tissue using mature plant embryos as test materials
[0209] Take mature seeds and soak them in clean water, change the water every 1 to 2 hours, and germinate and root them at 37℃ until the seeds burst and turn white. When the embryo grows to 1.5 to 2.0 cm, use a scalpel to cut off the embryo and coleoptile from the stem ring at the stem tip to expose the stem tip meristem.
[0210] 2. Agrobacterium culture (same as step 2 in Example 2)
[0211] 3. Infection and Co-cultivation
[0212] The treated plants were placed in AAM resuspension (see Example 2, step 3), 200 l / L of surfactant Silwet L-77 was added, and vacuum treated at 1.5 kPa for 8 minutes. The resuspension was discarded, and the plants were placed on clean, moist perlite and cultured in the dark at 28°C for 3 days.
[0213] 4. Screening, transplanting and management of intermediate plants
[0214] After dark incubation, plants were transferred to a seedbed. Leaves from transformed plants at the three- to four-leaf stage were collected for PCR analysis of transformed seedlings. Designed primers for the gene, for example, FTO-F: ATGAAGCGCACCCCGACTG; FTO-R: GGGTTTTGCTTCCAGAAGCTGA. The PCR reaction procedure was: 95°C for 5 minutes, 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 30 seconds, 35 cycles, extension at 72°C for 10 minutes, and storage at 4°C. PCR products were analyzed by 1% agarose gel electrophoresis. Seven days later, surviving plants were transplanted to the greenhouse of a transgenic plant demonstration base and maintained with standard fertilization and watering. Transformed seedlings were harvested for seed.
[0215] 5. Evaluation of the properties of the intermediate plants (same as step 8 in Example 2)
[0216] 6. Obtaining genetically improved target plants without induction media
[0217] The transformed seedlings of the results can undergo gene separation to produce a progeny that does not carry an inducing medium type and a progeny that overexpresses an inducing medium type. The plant whose genome does not carry an inducing medium and a hygromycin gene can be screened by the mode of genomic DNA PCR detection (same as Example 2, Step 9). These plants that do not carry an inducing medium and a hygromycin gene are planted, and their optimized proterties are evaluated by at least two experiments, and the target plant whose proterties are optimized is screened out, and the target plant whose genome does not carry an inducing medium and a hygromycin gene is finally obtained.
[0218] The induction medium may be naturally lost in the harvested transformed seedlings. These plants that do not carry the induction medium and hygromycin gene (the genomic DNA PCR detection method is the same as that in Example 2, step 9) are planted and their optimized traits are evaluated through at least two experiments to screen out target plants with optimized traits. Ultimately, target plants with optimized traits whose genomes do not carry the induction medium and hygromycin gene are obtained.
[0219] 7. Evaluation of target plant traits (same as step 10 in Example 2)
[0220] Example 4: Method for obtaining intermediate plants by inducing meristem production through Agrobacterium infection and screening target plants in subsequent generations (this method can be applied to any living plant to directly obtain target plants by inducing meristem production)
[0221] 1. Plant cultivation
[0222] The mature seeds were planted in nutrient soil and grown in a 24°C greenhouse environment with 16 h light / 8 h dark conditions until maturity (approximately 63 to 66 days).
[0223] 2. Agrobacterium culture
[0224] DRs (growth regulatory elements) are a type of growth regulatory elements that induce plants to form meristems. Commonly used ones include BBM, ipt, ΔMP, STM, Wus2, etc.
[0225] Experimental Group: A vector carrying the induction medium, the hygromycin resistance gene, and DRs was transformed into Agrobacterium GV3101. The cells were cultured overnight at 28°C for 12 hours in growth medium (10 mM MES, pH 5.6, 20 μM acetosyringone, 50 mg / L kanamycin, and 50 mg / L gentamicin). The cells were centrifuged at 5000 rpm for 10 minutes, harvested, and resuspended in infiltration medium (10 mM MES, 150 μM acetosyringone, and 10 mM MgCl2) to an OD600 of 0.2-0.3. The Agrobacterium infection medium was incubated at room temperature (approximately 25°C) for 2-4 hours prior to inoculation.
[0226] Control: Vectors carrying the hygromycin and DRs genes were transformed into Agrobacterium GV3101. Cultures were grown overnight at 28°C for 12 hours in growth medium (10 mM MES, pH 5.6, 20 μM acetosyringone, 50 mg / L kanamycin, and 50 mg / L gentamicin). The cells were centrifuged at 5000 rpm for 10 minutes, harvested, and resuspended in infiltration medium (10 mM MES, 150 μM acetosyringone, and 10 mM MgCl₂) to an OD₀⁻¹ value of 0.2–0.3. The Agrobacterium inoculation solution was incubated at room temperature (approximately 25°C) for 2–4 hours prior to inoculation.
[0227] 3. Infection and screening of intermediate plants
[0228] Visible shoot meristems were removed from all plants, leaving 2-3 nodes and supporting leaves. The wound site was immediately inoculated with the Agrobacterium infection solution using a syringe and a 31G needle. Plants were observed 38-48 days after inoculation for bud formation at the cut site. Each injection site with newly formed tissue or meristems was counted as a single event. The presence of bud tissue was identified by genomic PCR (see Example 2, Step 7) as an indicator of transgene presence and expression.
[0229] 4. Transplantation and management of intermediate plants
[0230] The newly formed bud tissue was cut and transferred to a rooting medium to root and form complete seedlings. The surviving plants were then transplanted to a greenhouse and fertilized and watered as usual. The transformed seedlings were harvested.
[0231] 5. Evaluation of the properties of the intermediate plants (same as step 8 in Example 2)
[0232] 6. Obtaining target plants with optimized traits without induction media
[0233] Harvested transformed seedlings undergo genetic segregation, producing progeny that lack the inducing mediator and progeny that overexpress the inducing mediator. Genomic DNA PCR can be used to screen for plants whose genomes lack the inducing mediator and hygromycin genes. These plants lacking the inducing mediator and hygromycin genes are then planted and evaluated for optimized traits through at least two experiments. Target plants with optimized traits are then selected, ultimately yielding target plants lacking the inducing mediator and hygromycin genes.
[0234] The induction medium may be naturally lost in the harvested transformed seedling seeds. These plants that do not carry the induction medium and hygromycin genes are planted, and their optimized traits are evaluated through at least two experiments to screen out target plants with optimized traits, and finally obtain target plants with optimized traits whose genomes do not carry the induction medium and hygromycin genes.
[0235] 7. Evaluation of target plant traits (same as step 10 in Example 2)
[0236] Example 5: Method for obtaining target plants by mechanical inoculation of PVX vectors
[0237] 1. Plant cultivation
[0238] The mature seeds were planted in nutrient soil and grown in a 24°C greenhouse environment with 16 h light / 8 h dark conditions until maturity (approximately 63 to 66 days).
[0239] 2. Agrobacterium culture
[0240] Experimental Group: The pPZPVX vector carrying the induction medium was transformed into Agrobacterium C58C1. After culture in Luria broth, the cells were harvested and suspended in infection buffer (10 mM MES [pH 5.8], 10 mM MgCl2, 100 μg / mL acetosyringone) to an OD600 of 0.2-0.3. The Agrobacterium infection solution was incubated at room temperature (approximately 25°C) for 2-4 hours before inoculation.
[0241] Control: Transform Agrobacterium C58C1 with the pPZPVX vector without the induction medium. After culturing in Luria broth, harvest the cells and resuspend them in infection buffer (10 mM MES [pH 5.8], 10 mM MgCl2, 100 μg / mL acetosyringone) to an OD600 of 0.2-0.3. Incubate the Agrobacterium infection solution at room temperature (approximately 25°C) for 2-4 hours before inoculation.
[0242] 3. Infection and screening of intermediate plants
[0243] Tobacco leaves were infiltrated with Agrobacterium carrying an inducible mediator expression plasmid using a syringe. Seven days later, the inoculated leaves were homogenized in 10 mM NaPi buffer (pH 7.0) (Western blot analysis confirmed the expression of the inducible mediator). The homogenized leaves were centrifuged at 16,000 g for 3 minutes, and the supernatant was filtered through a 0.45 μm filter. The filtered supernatant was mixed with 600-mesh corundum and applied to the fourth or fifth true leaf. The leaves were then gently rubbed by hand to mechanically inoculate with PVX. After inoculation, the plants were grown at 16°C under a 16-hour light / 8-hour dark photoperiod. After 7-8 days, the inoculated sites were observed for new shoot formation.
[0244] Note: Western blot detection of induction mediator expression: Take the inoculated leaf tissue powder and mix it with 1×10- ...
[0245] 4. Transplantation and management of intermediate plants
[0246] The newly formed bud tissue was cut and transferred to a rooting medium to root and form complete seedlings. The surviving plants were then transplanted to a greenhouse and fertilized and watered as usual. The transformed seedlings were harvested.
[0247] 5. Evaluation of the properties of the intermediate plants (same as step 8 in Example 2)
[0248] 6. Obtaining target plants with optimized traits without induction media
[0249] Harvested transformed seedlings are free of the inducing agent and can be identified by genomic DNA PCR. These plants, free of the inducing agent, are then planted and evaluated for optimized traits through at least two experiments. Target plants with optimized traits are then selected, ultimately yielding target plants whose genomes lack both the inducing agent and the hygromycin gene.
[0250] 7. Evaluation of target plant traits (same as step 10 in Example 2)
[0251] Example 6: Method for obtaining target plants through haploid induction-editing (HI-Edit) technology
[0252] Haploid induction (HI) technology can induce haploids by appropriately modifying CENTROMERIC HISTONE3 (CENH3) or knocking out MATRILINEAL (MATL) genes, followed by chromosome doubling. This allows homozygous candidate materials to be obtained quickly, fixing crop genotypes and holding significant significance in crop breeding practices. Haploid induction-editing (HI-Edit) technology combines haploid induction breeding with gene editing techniques, enabling direct improvement of a wide range of plants, including commercial varieties, in a short period of time, breaking free from the species and genotype limitations of existing gene editing systems. Since the chromosomes of the donor carrying the gene editing element are eliminated during hybridization after introduction into the haploid induction line, the resulting hybrids do not contain the genetic information of the paternal parent. Multiple backcrosses are eliminated; chromosome doubling of the target haploid plant alone can yield improved diploid lines, shortening the breeding cycle. HI-Edit can also be used to improve target crops through distant hybridization, making it widely applicable and enabling the generation of transgene-free lines.
[0253] 1. Construct an induction medium vector and introduce it into the non-haploid inbred line NP2222 to obtain stable transformed plants
[0254] Nine-day-old immature embryos isolated from the inbred line NP2222 were mixed with either Agrobacterium strain LBA4404 carrying a vector containing an induction medium (experimental group) or Agrobacterium strain LBA4404 not carrying a vector containing an induction medium (control group). The infected embryos were cultured on recovery medium and callus induction medium. Callus was selected on a medium containing mannose, and resistant callus was regenerated into intermediate plants to obtain stably transformed plants.
[0255] 2. Evaluation of the properties of the intermediate plants (same as step 8 in Example 2)
[0256] 3. Select the intermediate plants carrying the induction medium and hybridize them with the natural haploid induction line RWKS, and select the individuals carrying the induction medium and the homozygous matl mutation.
[0257] The natural haploid inducer line, RWKS, contains the haploid inducer mat1 allele and the R1 color marker. When RWSK is crossed with a line carrying an inducer, the progeny will segregate for the trait. Hybrid offspring containing the inducer, the haploid inducer mat1 allele from RWKS, and the R1 color marker are selected and self-pollinated. Individuals carrying the inducer and the homozygous mat1 mutation are selected from the F2 population.
[0258] 4. Screening and acquisition of target plants
[0259] F2 plants homozygous for mat1 and the inducing agent were recrossed with various inbred lines. Haploid plants with the MATL genotype and lacking the inducing agent were selected using the RWKS-specific kernel color marker. The target plants were then obtained through embryo rescue. Harvested, transgenic plants lacking the inducing agent were identified by genomic DNA PCR. These plants were then planted and evaluated for optimized traits in at least two experiments. Target plants with optimized traits were selected, ultimately achieving target plants lacking both the inducing agent and the hygromycin gene.
[0260] 5. Evaluation of target plant traits (same as step 10 in Example 2)
[0261] The above-mentioned Examples 2 to 6 all require obtaining target plants through intermediate plants, and all measure the degree of trait optimization. The following table data is presented based on the data of Example 2. The data of the remaining examples basically differ from the data of Example 2 by no more than ±5%, and will not be repeated here.
[0262] Table 5—Induction medium derived from human (Homo sapiens) FTO (experimental group)
[0263] The above Table 5 may use the human FTO polypeptide sequence of SEQ ID NOs: 1 in the sequence listing or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.
[0264] Table 6 - Induction medium from porcine (Sus scrofa) FTO (experimental group)
[0265] The above Table 6 may use the porcine FTO polypeptide sequence of SEQ ID NOs: 2 in the sequence listing or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.
[0266] Table 7 - Induction medium from cattle (Bos taurus) FTO (experimental group)
[0267] The above Table 7 may use the bovine FTO polypeptide sequence of SEQ ID NOs: 3 in the sequence listing or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.
[0268] Table 8—Induction medium from green flagellate algae (Ostreococcus lucimarinus) FTO (experimental group)
[0269] The above Table 8 may use the green flagellate FTO polypeptide sequence of SEQ ID NOs: 4 in the sequence listing or a DNA capable of expressing the polypeptide sequence, a homologous sequence with equivalent functions or a variant / combination with equivalent functions thereof.
[0270] Table 9 - Examples of FTO introduction into plants where the induction medium is derived from various algae and invertebrates
[0271] Table 9 above may use various algae sequences and invertebrate sequences listed in SEQ ID NOs: 5 to 15 or DNA expressing the sequences, homologous sequences with equivalent functions or variants / combinations with equivalent functions thereof.
[0272] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A plant cultivation method, characterized in that: The method comprises introducing an induction medium into an initial plant, and obtaining a target plant without the induction medium and having optimized traits compared with the initial plant through cultivation; the induction medium can induce demethylation of 6-methylated bases in RNA of the plant.
2. The plant cultivation method according to claim 1, characterized in that The target plant has at least one optimized trait compared to the initial plant, and the degree of optimization is Y.
3. The plant cultivation method according to claim 1, characterized in that The initial plant is instantaneously introduced with the induction medium, and the target plant which does not contain the induction medium and has optimized traits compared with the initial plant is directly obtained.
4. The plant cultivation method according to claim 1, characterized in that The induction medium is transiently introduced into the protoplast cells of the initial plant.
5. The plant cultivation method according to claim 1, characterized in that The initial plant is introduced with an inducing medium to obtain an intermediate plant; the intermediate plant is cultured through subsequent generations to obtain a target plant that does not contain an inducing medium and has optimized traits compared to the initial plant.
6. The plant cultivation method according to claim 5, characterized in that The intermediate plant contains the inducing medium.
7. The plant cultivation method according to claim 5, characterized in that The target plant has at least one optimized trait compared to the initial plant, and the degree of optimization is Y.
8. The plant cultivation method according to claim 7, characterized in that The intermediate plant has at least one optimized trait compared to the initial plant, and the degree of optimization is X.
9. The plant cultivation method according to any one of claims 2 or 7, characterized in that: Y is the multiple increase compared to the initial plant in the same period, Y≥0.20; Y≥0.50; Y≥1.00; preferably Y≥2.00; preferably Y≥3.00; preferably Y≥4.
00.
10. The plant cultivation method according to claim 1, characterized in that The trait optimization includes increased yield.
11. The plant cultivation method according to claim 1, characterized in that: The trait optimization includes increased yield of plant organs.
12. The plant cultivation method according to claim 1, characterized in that: The trait optimization includes at least one of an increase in volume, an increase in number, an increase in weight, and an increase in the number of tillers of plant organs.
13. The plant cultivation method according to claim 1, characterized in that: The inducing medium can induce the demethylation of 6-methylated adenine in plant RNA.
14. The plant cultivation method according to claim 1, characterized in that: Compared to the initial plants, an excess of induction medium was introduced.
15. The plant cultivation method according to claim 1, characterized in that: The induction medium is a nucleic acid molecule and / or a polypeptide, a homologue thereof, a functional variant thereof or a combination thereof.
16. The plant cultivation method according to claim 1, characterized in that: When the induction medium is a nucleic acid molecule, a homologue thereof, a functional variant thereof or a combination thereof, the target plant does not contain the induction medium, and does not contain the polypeptide expressed by the induction medium; When the induction medium is a polypeptide, a homologue thereof, a functional variant thereof or a combination thereof, the target plant does not contain the induction medium.
17. The plant cultivation method according to claim 1, characterized in that: The induction mediator is selected from RNA m6A demethylase and its encoding nucleic acid.
18. The plant cultivation method according to claim 1, characterized in that: The inducing medium is selected from at least one of FTO nucleic acid molecules and / or polypeptides, homologues thereof, functional variants thereof or combinations thereof.
19. The plant cultivation method according to claim 1, characterized in that: The FTO in the induction medium is derived from vertebrates, invertebrates, algae, or their direct homologs or paralogs.
20. The plant cultivation method according to claim 1, characterized in that The induction medium is shown in the sequence table Seq.ID.No1 to Seq.ID.No15.
21. The plant cultivation method according to claim 1, characterized in that: The initial plant is selected from at least one of food crops, fodder crops, fiber crops, oil crops, sugar crops, beverage crops, spice crops, seasoning crops, medicinal crops, dye crops, ornamental crops, fruit crops, and vegetable crops; preferably selected from at least one of rapeseed, tomato, lettuce, and sugar beet; or preferably selected from at least one of rice, corn, soybean, potato, wheat, millet, sugarcane, sorghum, and cassava; or preferably selected from at least one of tobacco, alfalfa, rubber grass, cotton, flax, sunflower, flax mustard, sedge, hemp, and poplar.
22. The plant cultivation method according to claim 1, characterized in that: The introduced initial plant region includes at least one of a plant organ, a plant tissue, and a plant cell.
23. The plant cultivation method according to claim 1, characterized in that: The initial plant region introduced is selected from the plant meristem.
24. The plant cultivation method according to claim 1, characterized in that The induction medium is introduced into at least one of the cell nucleus and cell sap of the initial plant.
25. The plant cultivation method according to claim 1, characterized in that: The introduction method includes introducing a vector encapsulating the induction medium into the initial plant.
26. The plant cultivation method according to claim 1, characterized in that: The offspring cultivation method includes at least one of natural genetic screening removal, hybrid genetic screening removal, and active removal.
27. Use of the plant breeding method according to claim 1 in preparing plants without induction medium and with optimized traits.
28. A product obtained by inactivating the target plant obtained by the plant breeding method according to claim 1.