A set of oligodeoxyribonucleotide primers and a fluorescently labeled probe for the identification of RNA / cDNA of the feline leukemia virus (FeLV)
RU2024140456A3Pending Publication Date: 2026-06-30ИСАЕВ СЕРГЕЙ АЛЕКСАНДРОВИЧ
View PDF 0 Cites 0 Cited by
Patent Information
- Application Number
- RU2024140456
- Authority / Receiving Office
- RU · RU
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2026-06-30
Abstract
A set of specific oligodeoxyribonucleotide primers VT-Bc-F 5'- GAGGCAGCAACGGGTAAC -3', VT-Bc-R 5'- CCAATTGYTACTCTGGTGAGG -3' and a fluorescently labeled probe VT-Bc-P 5'-(R6G)- GTTCGATTCCGGAGAGGGAGC -(BHQ2)-3' to a fragment of the gene of the small ribosomal subunit of 16S RNA of pathogenic babesia of the genus Babesia for the detection of causative agents of babesiosis (piroplasmosis) in dogs.
Need to check novelty before this filing date? Find Prior Art