Preimplantation genetic testing method for x-linked syndromic intellectual disability type 33

A dual detection system using restriction endonucleases and STRs addresses the challenges of small sample sizes in PGT for X-linked syndromic intellectual disability type 33, ensuring accurate and reliable detection of pathogenic variants in embryos.

RU2864797C1Active Publication Date: 2026-06-29PUBLICHNOE AKTSIONERNOE OBSHCHESTVO TSENTR GENETIKI I REPRODUKTIVNOJ MEDITSINY GENETIKO
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
RU2025123034
Authority / Receiving Office
RU · RU
Patent Type
Patents
Current Assignee / Owner
Filing Date
2025-08-20
Publication Date
2026-06-29
Estimated Expiration
2045-08-20

AI Technical Summary

Technical Problem

The challenge in preimplantation genetic testing (PGT) for X-linked syndromic intellectual disability type 33 is the small amount of biomaterial available for analysis, which complicates accurate detection of pathogenic variants due to potential contamination, uneven amplification, and degradation, while also lacking information about the embryo's biological characteristics.

Method used

A dual detection system using restriction endonucleases and short tandem repeats (STRs) for analyzing DNA from various sources, including single cells, to accurately identify pathogenic variants in the TAF1 gene, ensuring reliable diagnostic results.

Benefits of technology

The system enables precise detection of pathogenic variants in embryos, reducing the risk of contamination and amplification errors, and providing a comprehensive assessment of genetic status despite limited sample size.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000001
    Figure 00000001
  • Figure 00000002
    Figure 00000002
Patent Text Reader

Abstract

FIELD: molecular biology.SUBSTANCE: method for preimplantation genetic testing of X-linked syndromic mental retardation type 33 is described, which involves identifying the inheritance of the genetic variant NC_000023.10:70603983C>T (p.Arg727Trp) in the TAF1 gene, including a dual detection system – direct and indirect.EFFECT: creation of a test system for diagnosing the pathogenic variant: NC_000023.10:70603983C>T (p.Arg727Trp) in the TAF1 gene with a dual detection system – direct and indirect.1 cl, 2 tbl, 1 ex
Need to check novelty before this filing date? Find Prior Art

Description

[0001] The invention relates to preimplantation genetic testing for monogenic diseases. Currently, more than 350 million people worldwide suffer from a rare disease (according to the RARE Project). The total number of such diseases, according to estimates by the European Organization for Rare Diseases (EURORDIS), ranges from 5,000 to 7,000. Approximately 80% of rare diseases have a genetic cause. Knowing the genetic basis of a disease allows for a highly accurate prediction not only of the health of an already born child but also to assess the risk of having such a child by analyzing the parents' genotypes, as well as to conduct genetic diagnosis at the earliest stages. Preimplantation genetic testing (PGT) for monogenic diseases is becoming a powerful tool for the prevention of such diseases.

[0002] The present invention relates to a method for preimplantation genetic testing of X-linked syndromic intellectual disability type 33. X-linked syndromic intellectual disability type 33 is a genetically heterogeneous disease caused by mutations on the X chromosome. The frequency of X-linked syndromic intellectual disability varies from 1:1000 to 1.8:1000 in the population, but has not been specifically established for this type. This disease results in manifestations of global developmental delay, intellectual disability (ID), characteristic facial dysmorphology (prominent supraorbital ridges, down-slanting palpebral fissures, drooping cheeks, long philtrum, low-set and prominent ears, long face, high palate, pointed chin and forward-facing nostrils), generalized hypotonia and various neurological features.With an X-linked recessive inheritance pattern of the disease, the probability of having a child with this disease in a family is 50% if a boy is born, and a girl with a 50% probability will be an asymptomatic carrier of the mutation.

[0003] X-linked syndromic intellectual disability 33 can be caused by pathogenic genetic variants in the TAF1 gene, located on chromosome X. [O'Rawe et al. TAF1 variants are associated with dysmorphic features, intellectual disability, and neurological manifestations. Am. J. Hum. Genet. 97: 922–932, 2015] [OMIM. Intellectual developmental disorder, x-linked, syndromic 33; MRXS33. 2015. https: / / omim.org / entry / 300966 (accessed 21.10.2021)] This gene encodes the TBP-TATA binding protein (TATA-binding associated protein, factor 1), which is part of the TFIID protein complex required for RNA polymerase II-mediated transcription of many, if not all, protein-coding genes in eukaryotic cells.

[0004] PGT for X-linked syndromic intellectual disability type 33 is performed for families with a confirmed molecular genetic cause of the disease. It is important to note that the pathogenicity and causativity of genetic variants is determined before PGT for a monogenic disease and is not included in the goals and objectives of PGT for a monogenic disease, nor in the complex of measures for conducting PGT for a monogenic disease. Pathogenicity is assessed according to the international standard—the criteria described in 2015 by the American College of Medical Genetics and Genomics (Association for Molecular Pathology (ACMG-AMP)) during the search for the molecular genetic cause of the disease. PGT is recommended for families with a high risk of having a child with a severe (incurable) hereditary disease with an identified pathogenic variant that determines this risk.PGT allows you to select from all the embryos obtained during IVF (in vitro fertilization) embryos without a pathogenic variant, and therefore without the risk of developing a disease.

[0005] The main challenge in embryo genetic diagnosis is the small initial amount of biomaterial, as a biopsy specimen contains only one to three cells. In this case, to improve the efficiency and accuracy of the analysis, it is important to completely eliminate the possibility of contamination and mitigate the potential effects of uneven and / or incomplete amplification, as well as biomaterial degradation. This requires the development of a test system with specific characteristics. The test system is designed to accommodate various types of biomaterial—total deoxyribonucleic acid (DNA) isolated from various tissues, whole genome amplification (WGA) products, and single cells.The combination of versatility in biomaterial selection and step-by-step amplification of target fragments enables the analysis of multiple pathogenic variants in a single sample, including on single cells, and the detection of incomplete amplification, contamination, or sample degradation. Another feature of PGT is the lack of information about the embryo's biological characteristics: unlike an adult, an embryo may have any chromosomal abnormalities, complicating the assessment of the embryo's status for a specific genetic variant. Therefore, a test system for PGT of a monogenic disease must be able to identify such cases and assess their impact on the reliability of the diagnostic result.

[0006] No description of a similar technical solution was found in publicly available sources.

[0007] The presented method of PGT for X-linked syndromic mental retardation type 33 solves the problem of developing a more accurate method of preimplantation genetic testing of this monogenic disease without the use of expensive devices and reagents, which could be used on various types of biomaterial: DNA isolated from different tissues, the product of whole genome amplification (WGA), single cells.

[0008] The technical result was the creation of a test system for diagnosing a pathogenic variant (the nucleotide number in the reference sequence of genomic DNA is designated by the prefix NC): NC_000023.10:70603983C>T (p.Arg727Trp) in the TAF1 gene with a dual detection system - direct and indirect. Missense variants in the TAF1 gene lead to the development of X-linked syndromic mental retardation type 33 [Cheng, Hanyin et al. "Missense variants in TAF1 and developmental phenotypes: challenges of determining pathogenicity." Human mutation, 10.1002 / humu.23936. 23 Oct. 2019, doi:10.1002 / humu.23936] According to the conclusion of the geneticist who consulted the patients in whose family this mutation was discovered, based on the sum of the literary data and segregation in the family, the genetic variant NC_000023.10:70603983C>T (p.Arg727Trp) was interpreted as pathogenic and it was concluded that it is the cause of the development of syndromic mental retardation type 33 in members of this family.A dual detection system is necessary when working with small amounts of biomaterial, as unstable amplification can lead to loss of information or reduced analytical accuracy. Direct diagnostics involve directly analyzing the presence or absence of a pathogenic variant. In this case, restriction endonucleases were selected for the single nucleotide polymorphism (SNP) genetic variant NC_000023.10:70603983C>T (p.Arg727Trp). These restriction endonucleases enable detection of the pathogenic variant using PCR-RFLP (restriction fragment length polymorphism), based on sequence differences at the restriction site between different alleles. Indirect diagnostics involves analyzing the inheritance of molecular genetic markers linked to the mutation, i.e., inherited along with it.To achieve this, polymorphic loci called STRs (short tandem repeats) were selected within 3 Mb of the TAF1 gene in each direction (corresponding to an average crossover rate of 3%), with a heterozygosity of at least 0.70 to ensure maximum indirect diagnostic information. STRs are repeats of two or more nucleotides located one after the other (e.g., the adenine-cytosine (AC) pair, repeated several times in a row: ACACACACA) and are present in large numbers in the human genome. The number of repeats in each STR can vary from individual to individual and can also differ between homologous chromosomes in the same individual.Heterozygosity above 0.70 indicates a high probability that the same individual will have a different number of nucleotide repeats in a given STR on one chromosome than in the same STR on the homologous chromosome. In other words, the alleles of a given marker in that individual will differ in length. Amplification of a fragment containing such a marker will produce amplicons of two different lengths. By analyzing the number of repeats in several markers surrounding a pathogenic variant and studying their inheritance in the tested family, it is possible to establish linkage between the marker alleles and the pathogenic variant.The diagnostic value of studying the repeat counts of these markers in embryos is that the inherited allele of each marker allows us to determine whether the embryo has inherited a TAF1 gene carrying a pathogenic variant or a TAF1 gene from another, homologous chromosome that does not carry the pathogenic variant. Primers for amplification using nested or semi-nested PCR in two rounds were selected for each of these loci, increasing the accuracy and efficiency of amplification. The test system included 13 STR loci for the TAF1 gene: DXS453, DXS69.6, DXS70.1, DXS70.2, DXS70.3, DXS70.4, DXS8030, DXS70.7, DXS70.8, DXS71.1, DXS6743, DXS71.5, DXS1124. The amplification primers are located on the X chromosome in the region of coordinates 69448125-71544061 (according to hg19). The sequences of the primers for amplification of DNA fragments containing the listed STR loci are indicated in the claims in the list of SEQ ID NOs 1-40.It is important to note that a number of special requirements were observed when selecting primers: the length of the product with external primers for the first round of PCR should not exceed 500 bp (for production from fragments obtained during whole-genome amplification), the length of the product with internal primers for the second round of PCR should be from 120 to 350 bp, high specificity of external primers, and the annealing temperature should not differ by more than 1°C.

[0009] Preparatory stage of the urban-type settlement

[0010] The preparatory stage involves testing the test system: selecting amplification conditions optimal for primer performance, analyzing the efficiency and specificity of PCR amplification in both rounds, and assessing the test system's versatility for various biosample types (DNA, WGA product, single cells). During the test system testing, stock primer dilutions with a concentration of 100 mM and working dilutions of primer combinations (a combination of primer pairs for rounds 1 and 2) with a concentration of 10 mM of each primer in solution were prepared.Since various types of matrices can be used in the diagnostics of clinical material, two biopsies of single cells in a special lysis buffer (1×PCR Buffer, 0.1% Tween-20, 0.1% Triton X-100, 1 μg Proteinase K), two samples of whole-genome amplification products of embryo biopsies (WGA), as well as total DNA of family members isolated from blood were used in the development of the test system to compile a pedigree and identify the linkage of a pathogenic variant with the alleles of polymorphic markers.

[0011] In nested and semi-nested PCR, amplification is performed in two stages. In the first stage, multiplex PCR is performed with all external primers for all loci included in the test system to enrich the sample with all target fragments. In the second stage, each fragment is individually amplified with internal primers.

[0012] Semi-nested PCR

[0013] For the first stage, external highly specific primers were selected for amplifying fragments from 300 to 500 bp. For the second stage, primers were selected for amplifying fragments no longer than 350 base pairs, and labels for detection by fragment analysis were introduced. The primer sequences for amplifying DNA fragments containing the listed STR loci are listed in the claims in SEQ ID NOs 1-40. The PCR mixture for the first round of amplification contained 1×PCR Buffer with Mg2+ (Eurogen, Russia), 0.1 mM of each deoxynucleotide, 0.15 μM of each primer, 2.5 U / μl of HsTaq DNA polymerase (Eurogen, Russia), 6% DMSO, and 1 μl of total DNA, 2.5 μl of WGA, or 5 μl of lysis buffer with the sample as a template. The first round of amplification was carried out according to the following protocol: denaturation at 94°C for 2 minutes, 30 cycles with a decrease in the annealing temperature of the primers from 62 to 45°C in each cycle, and an extension step for all templates at 72°C for 10 minutes.Next, the products of the first stage were distributed into individual test tubes with one pair of primers for a specific locus.

[0014] The PCR mixture for the second stage included 1×PCR buffer with Mg2+ (Eurogen, Russia), 0.5×RediLoad™ loading buffer (Thermo Fisher Scientific, USA), 0.2 mM of each deoxynucleotide, 0.2 μM of each primer, 1 U / μl HsTaq DNA polymerase (Eurogen, Russia), 6% dimethyl sulfoxide (DMSO) and 1 μl of the PCR product from the first stage of amplification as a template. The second stage of amplification was carried out according to the following protocol: denaturation at 95°C for 2 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, primer annealing at 57°C for 30 seconds, template synthesis at 72°C for 1 minute, and extension of all templates at 72°C for 5 minutes. Evaluation of the efficiency and specificity of amplification was performed using electrophoresis in 2% agarose gel. The results of agarose gel electrophoresis allow one to determine the required dilution of the amplification products for application to fragment analysis (DNA amplification products of family members).

[0015] Fragment analysis of the amplification products was performed using capillary electrophoresis on a 3130x1 Genetic Analyzer (Applied Biosystems, USA). Based on the results of fragment analysis, a pedigree is compiled and informative polymorphic STR loci are noted for each family, which will subsequently be used in clinical diagnostics. Loci are divided into non-informative (the carrier of the pathogenic variant is homozygous for this locus), semi-informative (on some of the parental chromosomes, the alleles for this marker match), and informative (on all parental chromosomes, the alleles of this marker are different, which makes it possible to distinguish each of them during embryo genotype analysis). Detection of pathogenic variant NC_000023.10:70603983C>T (p.Arg727Trp) was carried out using the amplification primers presented in SEQ ID NO 41-44: for the first round of nested PCR SEQ ID NO 41 and SEQ ID NO 42, for the second round of nested PCR, to identify the normal allele SEQ ID NO 43 and SEQ ID NO 42, for the second round of nested PCR, to identify the mutant allele SEQ ID NO 44 and SEQ ID NO 42.

[0016] Polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP)

[0017] Restriction fragment length polymorphism (RFLP) is a method for studying genomic DNA by specifically cleaving DNA with restriction endonucleases and then analyzing the sizes of the resulting fragments (restrictions) by gel electrophoresis. This method produces fragments of varying lengths depending on differences in the nucleotide sequence at the restriction site, enabling the detection of single-nucleotide variants if they are located at the restriction site. Sanger sequencing can provide more accurate detection of pathogenic variants; however, in the context of PGT, PCR-RFLP is more effective due to the reduced probability of allele dropout (ADO) and, consequently, an erroneous result in assessing the embryo's status for a pathogenic variant.

[0018] A PCR-RFLP-based test system was developed to detect the pathogenic variant NC_000023.10:70603983C>T (p.Arg727Trp). The amplification stage is described in detail in the previous section. The following primers were used: respectively. The amplification products from the internal primers for detecting the pathogenic variant were then used in a restriction reaction. Endonuclease Hpy8I cleaves only the wild-type allele, while endonuclease SmiI cleaves only the mutant allele of the NC_000023.10:70603983C>T (p.Arg727Trp) variant. Detection was performed by electrophoresis in a 12% polyacrylamide gel.

[0019] Example 1

[0020] Patients A

[0021] Family A contacted CGRM Genetiko. The woman was an asymptomatic carrier of X-linked syndromic intellectual disability, 33, carrying the genetic variant NC_000023.10:70603983C>T (p.Arg727Trp) in the TAF1 gene. The couple was recommended to undergo PGT for X-linked syndromic intellectual disability, 33, as part of IVF to select embryos that did not inherit the disorder.

[0022] Family haplotyping

[0023] In the first stage, biomaterial (peripheral blood) was obtained from family members to detect the pathogenic variant and identify linkage groups of polymorphic marker alleles. Primer sequences for amplifying DNA fragments containing STR loci are listed in the patent claims as SEQ ID NOs 1-40. Thirteen STR loci were analyzed. Of these, nine were found to be informative for the patient. Therefore, embryo samples were tested only for informative markers.

[0024] Linkage groups were determined as follows. The alleles of polymorphic markers that matched in the patient, a carrier of the NC_000023.10:70603983C>T (p.Arg727Trp) variant, and in her brother with X-linked syndromic mental retardation were recognized as linked to each other and to this genetic variant. Mismatched alleles of polymorphic markers in the patient and her brother were recognized as linked to each other and to the normal allele of the gene. The obtained results for the informative markers are presented in Table 1. Alleles listed on the same line are located on the same chromosome, that is, they represent a linkage group. Thus, for the patient, two linkage groups are represented, corresponding to each of the human X chromosomes. The patient's partner and brother are represented by one linkage group each, since they are male and have only one X chromosome. Variant NC_000023.10:70603983C>T (p.Arg727Trp) is designated in the table as TAF1 p.Arg727Trp.In the table, N denotes the wild-type allele (normal allele), and mut denotes the mutant allele. The numbers represent the lengths of the amplicons in nucleotide pairs; their lengths depend on the number of repeats in the STR marker.

[0025]

[0026] As a result of haplotyping, it was concluded that the patient’s partner had the following linked alleles of STR markers with a pathogenic variant: DXS453 - 290, DXS69.6 - 145, DXS70.1 -200, DXS70.2 - 201, DXS70.3 -170, DXS71.1 -203, DXS6743 -102, DXS71.5 - 179, DXS1124 - 135.

[0027] Preimplantation genetic testing

[0028] Two embryos were obtained in an IVF cycle. A biopsy was performed on day 5 of development (at the IVF clinic). The biopsy specimen in WGA buffer (1×PBS (Invitrogen, USA), 1% polyvinylpyrrolidone (PVP) (Fertipro, Belgium)) was sent to the Genetico laboratory. To monitor for contamination at various stages of sample processing, the laboratory has developed a system of controls: a contamination control for the biopsy buffer, a contamination control during transportation (one tube with the buffer is not opened by the embryologist), and a contamination control for each sample (a sample of the medium from the last wash drop of the biopsy material). All of these controls, along with the samples, undergo whole-genome amplification, after which the slightest amount of DNA contaminating the controls will be visible. Whole genome amplification was performed using the commercial SurePlex kit (Illumina, USA).

[0029] The whole-genome amplification product, as well as DNA from all family members, was amplified in step 1 using multiplex PCR with primers for detecting the pathogenic variant and primers for polymorphic markers informative for family A, in accordance with the test system protocol developed during the preparatory phase. In step 2, amplification was performed for each marker separately, according to the developed test system protocol. This allowed us to determine the linkage groups inherited by each embryo. The results are presented in Table 2.

[0030]

[0031] Based on direct and indirect diagnostic tests, both embryos did not inherit the disease. At the parents' request, preimplantation genetic screening for chromosomal abnormalities was performed on embryo 1. Based on all test results, embryo 1 was recommended for transfer.

[0032] --->

[0033] <?xml version="1.0" encoding="ISO-8859-1"?>

[0034] <!DOCTYPE ST26SequenceListing SYSTEM "ST26SequenceListing_V1_3.dtd"

[0035] PUBLIC "- / / WIPO / / DTD Sequence Listing 1.3 / / EN">

[0036] <ST26SequenceListing productionDate="2026-04-07"

[0037] softwareVersion="2.3.0" softwareName="WIPO Sequence" fileName="Method

[0038] Preimplantation genetic testing of X-linked

[0039] syndromic mental retardation type 33.xml" dtdVersion="V1_3">

[0040] <applicationidentification>

[0041] <ipofficecode>RU< / ipofficecode>

[0042] <applicationnumbertext> 2025123034< / applicationnumbertext>

[0043] <filingdate> 2025-08-20< / filingdate>

[0044] < / applicationidentification>

[0045] <applicantfilereference> 2025123034< / applicantfilereference>

[0046] <applicantname languagecode="ru">Public joint-stock company

[0047] “Center of Genetics and Reproductive Medicine “GENETIKO”< / applicantname>

[0048] <applicantnamelatin>CENTER OF GENETICS AND REPRODUCTIVE MEDICINE

[0049] GENETICO PUBLIC JOINT-STOCK COMPANY< / applicantnamelatin>

[0050] <inventiontitle languagecode="ru">Preimplantation method

[0051] Genetic testing of X-linked syndromic mental

[0052] backwardness type 33< / inventiontitle>

[0053] <sequencetotalquantity> 44< / sequencetotalquantity>

[0054] <sequencedata sequenceidnumber="1">

[0055] <insdseq>

[0056] <INSDSeq_length> 19< / INSDSeq_length>

[0057] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0058] <INSDSeq_division> PAT< / INSDSeq_division>

[0059] <INSDSeq_feature-table>

[0060] <insdfeature>

[0061] <INSDFeature_key>source< / INSDFeature_key>

[0062] <INSDFeature_location>1..19< / INSDFeature_location>

[0063] <INSDFeature_quals>

[0064] <insdqualifier>

[0065] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0066] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0067] < / insdqualifier>

[0068] <insdqualifier id="q2">

[0069] <INSDQualifier_name>organism< / INSDQualifier_name>

[0070] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0071] < / insdqualifier>

[0072] < / INSDFeature_quals>

[0073] < / insdfeature>

[0074] < / INSDSeq_feature-table>

[0075] <INSDSeq_sequence> ggaagcagcttgccagata< / INSDSeq_sequence>

[0076] < / insdseq>

[0077] < / sequencedata>

[0078] <sequencedata sequenceidnumber="2">

[0079] <insdseq>

[0080] <INSDSeq_length> 20< / INSDSeq_length>

[0081] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0082] <INSDSeq_division> PAT< / INSDSeq_division>

[0083] <INSDSeq_feature-table>

[0084] <insdfeature>

[0085] <INSDFeature_key>source< / INSDFeature_key>

[0086] <INSDFeature_location>1..20< / INSDFeature_location>

[0087] <INSDFeature_quals>

[0088] <insdqualifier>

[0089] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0090] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0091] < / insdqualifier>

[0092] <insdqualifier id="q4">

[0093] <INSDQualifier_name>organism< / INSDQualifier_name>

[0094] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0095] < / insdqualifier>

[0096] < / INSDFeature_quals>

[0097] < / insdfeature>

[0098] < / INSDSeq_feature-table>

[0099] <INSDSeq_sequence> gggcaagtgatcttggtctc< / INSDSeq_sequence>

[0100] < / insdseq>

[0101] < / sequencedata>

[0102] <sequencedata sequenceidnumber="3">

[0103] <insdseq>

[0104] <INSDSeq_length> 18< / INSDSeq_length>

[0105] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0106] <INSDSeq_division> PAT< / INSDSeq_division>

[0107] <INSDSeq_feature-table>

[0108] <insdfeature>

[0109] <INSDFeature_key>source< / INSDFeature_key>

[0110] <INSDFeature_location>1..18< / INSDFeature_location>

[0111] <INSDFeature_quals>

[0112] <insdqualifier>

[0113] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0114] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0115] < / insdqualifier>

[0116] <insdqualifier id="q6">

[0117] <INSDQualifier_name>organism< / INSDQualifier_name>

[0118] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0119] < / insdqualifier>

[0120] < / INSDFeature_quals>

[0121] < / insdfeature>

[0122] < / INSDSeq_feature-table>

[0123] <INSDSeq_sequence> cgatctttgctgccccta< / INSDSeq_sequence>

[0124] < / insdseq>

[0125] < / sequencedata>

[0126] <sequencedata sequenceidnumber="4">

[0127] <insdseq>

[0128] <INSDSeq_length> 18< / INSDSeq_length>

[0129] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0130] <INSDSeq_division> PAT< / INSDSeq_division>

[0131] <INSDSeq_feature-table>

[0132] <insdfeature>

[0133] <INSDFeature_key>source< / INSDFeature_key>

[0134] <INSDFeature_location>1..18< / INSDFeature_location>

[0135] <INSDFeature_quals>

[0136] <insdqualifier>

[0137] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0138] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0139] < / insdqualifier>

[0140] <insdqualifier id="q12">

[0141] <INSDQualifier_name>organism< / INSDQualifier_name>

[0142] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0143] < / insdqualifier>

[0144] < / INSDFeature_quals>

[0145] < / insdfeature>

[0146] < / INSDSeq_feature-table>

[0147] <INSDSeq_sequence> aaccattcccctgttggt< / INSDSeq_sequence>

[0148] < / insdseq>

[0149] < / sequencedata>

[0150] <sequencedata sequenceidnumber="5">

[0151] <insdseq>

[0152] <INSDSeq_length> 19< / INSDSeq_length>

[0153] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0154] <INSDSeq_division> PAT< / INSDSeq_division>

[0155] <INSDSeq_feature-table>

[0156] <insdfeature>

[0157] <INSDFeature_key>source< / INSDFeature_key>

[0158] <INSDFeature_location>1..19< / INSDFeature_location>

[0159] <INSDFeature_quals>

[0160] <insdqualifier>

[0161] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0162] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0163] < / insdqualifier>

[0164] <insdqualifier id="q14">

[0165] <INSDQualifier_name>organism< / INSDQualifier_name>

[0166] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0167] < / insdqualifier>

[0168] < / INSDFeature_quals>

[0169] < / insdfeature>

[0170] < / INSDSeq_feature-table>

[0171] <INSDSeq_sequence> agaattgatgaacccaccc< / INSDSeq_sequence>

[0172] < / insdseq>

[0173] < / sequencedata>

[0174] <sequencedata sequenceidnumber="6">

[0175] <insdseq>

[0176] <INSDSeq_length> 22< / INSDSeq_length>

[0177] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0178] <INSDSeq_division> PAT< / INSDSeq_division>

[0179] <INSDSeq_feature-table>

[0180] <insdfeature>

[0181] <INSDFeature_key>source< / INSDFeature_key>

[0182] <INSDFeature_location>1..22< / INSDFeature_location>

[0183] <INSDFeature_quals>

[0184] <insdqualifier>

[0185] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0186] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0187] < / insdqualifier>

[0188] <insdqualifier id="q16">

[0189] <INSDQualifier_name>organism< / INSDQualifier_name>

[0190] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0191] < / insdqualifier>

[0192] < / INSDFeature_quals>

[0193] < / insdfeature>

[0194] < / INSDSeq_feature-table>

[0195] <INSDSeq_sequence> ataggttgaacatttgtgtgc< / INSDSeq_sequence>

[0196] < / insdseq>

[0197] < / sequencedata>

[0198] <sequencedata sequenceidnumber="7">

[0199] <insdseq>

[0200] <INSDSeq_length>19< / INSDSeq_length>

[0201] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0202] <INSDSeq_division>PAT< / INSDSeq_division>

[0203] <INSDSeq_feature-table>

[0204] <insdfeature>

[0205] <INSDFeature_key>source< / INSDFeature_key>

[0206] <INSDFeature_location>1..19< / INSDFeature_location>

[0207] <INSDFeature_quals>

[0208] <insdqualifier>

[0209] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0210] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0211] < / insdqualifier>

[0212] <insdqualifier id="q18">

[0213] <INSDQualifier_name>organism< / INSDQualifier_name>

[0214] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0215] < / insdqualifier>

[0216] < / INSDFeature_quals>

[0217] < / insdfeature>

[0218] < / INSDSeq_feature-table>

[0219] <INSDSeq_sequence>catttgtctcgctggtcgt< / INSDSeq_sequence>

[0220] < / insdseq>

[0221] < / sequencedata>

[0222] <sequencedata sequenceidnumber="8">

[0223] <insdseq>

[0224] <INSDSeq_length> 19< / INSDSeq_length>

[0225] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0226] <INSDSeq_division> PAT< / INSDSeq_division>

[0227] <INSDSeq_feature-table>

[0228] <insdfeature>

[0229] <INSDFeature_key>source< / INSDFeature_key>

[0230] <INSDFeature_location>1..19< / INSDFeature_location>

[0231] <INSDFeature_quals>

[0232] <insdqualifier>

[0233] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0234] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0235] < / insdqualifier>

[0236] <insdqualifier id="q20">

[0237] <INSDQualifier_name>organism< / INSDQualifier_name>

[0238] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0239] < / insdqualifier>

[0240] < / INSDFeature_quals>

[0241] < / insdfeature>

[0242] < / INSDSeq_feature-table>

[0243] <INSDSeq_sequence> tcctgctgcctgcattaga< / INSDSeq_sequence>

[0244] < / insdseq>

[0245] < / sequencedata>

[0246] <sequencedata sequenceidnumber="9">

[0247] <insdseq>

[0248] <INSDSeq_length> 18< / INSDSeq_length>

[0249] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0250] <INSDSeq_division> PAT< / INSDSeq_division>

[0251] <INSDSeq_feature-table>

[0252] <insdfeature>

[0253] <INSDFeature_key>source< / INSDFeature_key>

[0254] <INSDFeature_location>1..18< / INSDFeature_location>

[0255] <INSDFeature_quals>

[0256] <insdqualifier>

[0257] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0258] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0259] < / insdqualifier>

[0260] <insdqualifier id="q22">

[0261] <INSDQualifier_name>organism< / INSDQualifier_name>

[0262] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0263] < / insdqualifier>

[0264] < / INSDFeature_quals>

[0265] < / insdfeature>

[0266] < / INSDSeq_feature-table>

[0267] <INSDSeq_sequence> ctgctgtgttccgcttca< / INSDSeq_sequence>

[0268] < / insdseq>

[0269] < / sequencedata>

[0270] <sequencedata sequenceidnumber="10">

[0271] <insdseq>

[0272] <INSDSeq_length> 21< / INSDSeq_length>

[0273] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0274] <INSDSeq_division> PAT< / INSDSeq_division>

[0275] <INSDSeq_feature-table>

[0276] <insdfeature>

[0277] <INSDFeature_key>source< / INSDFeature_key>

[0278] <INSDFeature_location>1..21< / INSDFeature_location>

[0279] <INSDFeature_quals>

[0280] <insdqualifier>

[0281] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0282] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0283] < / insdqualifier>

[0284] <insdqualifier id="q24">

[0285] <INSDQualifier_name>organism< / INSDQualifier_name>

[0286] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0287] < / insdqualifier>

[0288] < / INSDFeature_quals>

[0289] < / insdfeature>

[0290] < / INSDSeq_feature-table>

[0291] <INSDSeq_sequence> gcaggcacagaagttcagagt< / INSDSeq_sequence>

[0292] < / insdseq>

[0293] < / sequencedata>

[0294] <sequencedata sequenceidnumber="11">

[0295] <insdseq>

[0296] <INSDSeq_length>20< / INSDSeq_length>

[0297] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0298] <INSDSeq_division>PAT< / INSDSeq_division>

[0299] <INSDSeq_feature-table>

[0300] <insdfeature>

[0301] <INSDFeature_key>source< / INSDFeature_key>

[0302] <INSDFeature_location>1..20< / INSDFeature_location>

[0303] <INSDFeature_quals>

[0304] <insdqualifier>

[0305] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0306] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0307] < / insdqualifier>

[0308] <insdqualifier id="q26">

[0309] <INSDQualifier_name>organism< / INSDQualifier_name>

[0310] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0311] < / insdqualifier>

[0312] < / INSDFeature_quals>

[0313] < / insdfeature>

[0314] < / INSDSeq_feature-table>

[0315] <INSDSeq_sequence>catcgagtcggagattgtga< / INSDSeq_sequence>

[0316] < / insdseq>

[0317] < / sequencedata>

[0318] <sequencedata sequenceidnumber="12">

[0319] <insdseq>

[0320] <INSDSeq_length> 18< / INSDSeq_length>

[0321] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0322] <INSDSeq_division> PAT< / INSDSeq_division>

[0323] <INSDSeq_feature-table>

[0324] <insdfeature>

[0325] <INSDFeature_key>source< / INSDFeature_key>

[0326] <INSDFeature_location>1..18< / INSDFeature_location>

[0327] <INSDFeature_quals>

[0328] <insdqualifier>

[0329] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0330] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0331] < / insdqualifier>

[0332] <insdqualifier id="q28">

[0333] <INSDQualifier_name>organism< / INSDQualifier_name>

[0334] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0335] < / insdqualifier>

[0336] < / INSDFeature_quals>

[0337] < / insdfeature>

[0338] < / INSDSeq_feature-table>

[0339] <INSDSeq_sequence> tgtggtcaaggaaacgca< / INSDSeq_sequence>

[0340] < / insdseq>

[0341] < / sequencedata>

[0342] <sequencedata sequenceidnumber="13">

[0343] <insdseq>

[0344] <INSDSeq_length> 20< / INSDSeq_length>

[0345] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0346] <INSDSeq_division> PAT< / INSDSeq_division>

[0347] <INSDSeq_feature-table>

[0348] <insdfeature>

[0349] <INSDFeature_key>source< / INSDFeature_key>

[0350] <INSDFeature_location>1..20< / INSDFeature_location>

[0351] <INSDFeature_quals>

[0352] <insdqualifier>

[0353] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0354] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0355] < / insdqualifier>

[0356] <insdqualifier id="q30">

[0357] <INSDQualifier_name>organism< / INSDQualifier_name>

[0358] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0359] < / insdqualifier>

[0360] < / INSDFeature_quals>

[0361] < / insdfeature>

[0362] < / INSDSeq_feature-table>

[0363] <INSDSeq_sequence> gaagttgactcccaacccac< / INSDSeq_sequence>

[0364] < / insdseq>

[0365] < / sequencedata>

[0366] <sequencedata sequenceidnumber="14">

[0367] <insdseq>

[0368] <INSDSeq_length> 20< / INSDSeq_length>

[0369] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0370] <INSDSeq_division> PAT< / INSDSeq_division>

[0371] <INSDSeq_feature-table>

[0372] <insdfeature>

[0373] <INSDFeature_key>source< / INSDFeature_key>

[0374] <INSDFeature_location>1..20< / INSDFeature_location>

[0375] <INSDFeature_quals>

[0376] <insdqualifier>

[0377] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0378] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0379] < / insdqualifier>

[0380] <insdqualifier id="q32">

[0381] <INSDQualifier_name>organism< / INSDQualifier_name>

[0382] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0383] < / insdqualifier>

[0384] < / INSDFeature_quals>

[0385] < / insdfeature>

[0386] < / INSDSeq_feature-table>

[0387] <INSDSeq_sequence> cagctcagggatcttcgtgt< / INSDSeq_sequence>

[0388] < / insdseq>

[0389] < / sequencedata>

[0390] <sequencedata sequenceidnumber="15">

[0391] <insdseq>

[0392] <INSDSeq_length> 20< / INSDSeq_length>

[0393] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0394] <INSDSeq_division> PAT< / INSDSeq_division>

[0395] <INSDSeq_feature-table>

[0396] <insdfeature>

[0397] <INSDFeature_key>source< / INSDFeature_key>

[0398] <INSDFeature_location>1..20< / INSDFeature_location>

[0399] <INSDFeature_quals>

[0400] <insdqualifier>

[0401] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0402] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0403] < / insdqualifier>

[0404] <insdqualifier id="q34">

[0405] <INSDQualifier_name>organism< / INSDQualifier_name>

[0406] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0407] < / insdqualifier>

[0408] < / INSDFeature_quals>

[0409] < / insdfeature>

[0410] < / INSDSeq_feature-table>

[0411] <INSDSeq_sequence> tgctggctcaatagggacat< / INSDSeq_sequence>

[0412] < / insdseq>

[0413] < / sequencedata>

[0414] <sequencedata sequenceidnumber="16">

[0415] <insdseq>

[0416] <INSDSeq_length> 17< / INSDSeq_length>

[0417] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0418] <INSDSeq_division> PAT< / INSDSeq_division>

[0419] <INSDSeq_feature-table>

[0420] <insdfeature>

[0421] <INSDFeature_key>source< / INSDFeature_key>

[0422] <INSDFeature_location>1..17< / INSDFeature_location>

[0423] <INSDFeature_quals>

[0424] <insdqualifier>

[0425] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0426] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0427] < / insdqualifier>

[0428] <insdqualifier id="q36">

[0429] <INSDQualifier_name>organism< / INSDQualifier_name>

[0430] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0431] < / insdqualifier>

[0432] < / INSDFeature_quals>

[0433] < / insdfeature>

[0434] < / INSDSeq_feature-table>

[0435] <INSDSeq_sequence> catggagtccgaggctg< / INSDSeq_sequence>

[0436] < / insdseq>

[0437] < / sequencedata>

[0438] <sequencedata sequenceidnumber="17">

[0439] <insdseq>

[0440] <INSDSeq_length>21< / INSDSeq_length>

[0441] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0442] <INSDSeq_division>PAT< / INSDSeq_division>

[0443] <INSDSeq_feature-table>

[0444] <insdfeature>

[0445] <INSDFeature_key>source< / INSDFeature_key>

[0446] <INSDFeature_location>1..21< / INSDFeature_location>

[0447] <INSDFeature_quals>

[0448] <insdqualifier>

[0449] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0450] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0451] < / insdqualifier>

[0452] <insdqualifier id="q38">

[0453] <INSDQualifier_name>organism< / INSDQualifier_name>

[0454] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0455] < / insdqualifier>

[0456] < / INSDFeature_quals>

[0457] < / insdfeature>

[0458] < / INSDSeq_feature-table>

[0459] <INSDSeq_sequence>ctagcactcaagcacagtgca< / INSDSeq_sequence>

[0460] < / insdseq>

[0461] < / sequencedata>

[0462] <sequencedata sequenceidnumber="18">

[0463] <insdseq>

[0464] <INSDSeq_length> 22< / INSDSeq_length>

[0465] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0466] <INSDSeq_division> PAT< / INSDSeq_division>

[0467] <INSDSeq_feature-table>

[0468] <insdfeature>

[0469] <INSDFeature_key>source< / INSDFeature_key>

[0470] <INSDFeature_location>1..22< / INSDFeature_location>

[0471] <INSDFeature_quals>

[0472] <insdqualifier>

[0473] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0474] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0475] < / insdqualifier>

[0476] <insdqualifier id="q40">

[0477] <INSDQualifier_name>organism< / INSDQualifier_name>

[0478] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0479] < / insdqualifier>

[0480] < / INSDFeature_quals>

[0481] < / insdfeature>

[0482] < / INSDSeq_feature-table>

[0483] <INSDSeq_sequence> ctgagaccaggcctactattca< / INSDSeq_sequence>

[0484] < / insdseq>

[0485] < / sequencedata>

[0486] <sequencedata sequenceidnumber="19">

[0487] <insdseq>

[0488] <INSDSeq_length> 20< / INSDSeq_length>

[0489] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0490] <INSDSeq_division> PAT< / INSDSeq_division>

[0491] <INSDSeq_feature-table>

[0492] <insdfeature>

[0493] <INSDFeature_key>source< / INSDFeature_key>

[0494] <INSDFeature_location>1..20< / INSDFeature_location>

[0495] <INSDFeature_quals>

[0496] <insdqualifier>

[0497] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0498] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0499] < / insdqualifier>

[0500] <insdqualifier id="q42">

[0501] <INSDQualifier_name>organism< / INSDQualifier_name>

[0502] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0503] < / insdqualifier>

[0504] < / INSDFeature_quals>

[0505] < / insdfeature>

[0506] < / INSDSeq_feature-table>

[0507] <INSDSeq_sequence> gttggaattgctaggaggca< / INSDSeq_sequence>

[0508] < / insdseq>

[0509] < / sequencedata>

[0510] <sequencedata sequenceidnumber="20">

[0511] <insdseq>

[0512] <INSDSeq_length> 19< / INSDSeq_length>

[0513] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0514] <INSDSeq_division> PAT< / INSDSeq_division>

[0515] <INSDSeq_feature-table>

[0516] <insdfeature>

[0517] <INSDFeature_key>source< / INSDFeature_key>

[0518] <INSDFeature_location>1..19< / INSDFeature_location>

[0519] <INSDFeature_quals>

[0520] <insdqualifier>

[0521] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0522] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0523] < / insdqualifier>

[0524] <insdqualifier id="q44">

[0525] <INSDQualifier_name>organism< / INSDQualifier_name>

[0526] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0527] < / insdqualifier>

[0528] < / INSDFeature_quals>

[0529] < / insdfeature>

[0530] < / INSDSeq_feature-table>

[0531] <INSDSeq_sequence> gcagcactaaaacgaccca< / INSDSeq_sequence>

[0532] < / insdseq>

[0533] < / sequencedata>

[0534] <sequencedata sequenceidnumber="21">

[0535] <insdseq>

[0536] <INSDSeq_length>20< / INSDSeq_length>

[0537] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0538] <INSDSeq_division>PAT< / INSDSeq_division>

[0539] <INSDSeq_feature-table>

[0540] <insdfeature>

[0541] <INSDFeature_key>source< / INSDFeature_key>

[0542] <INSDFeature_location>1..20< / INSDFeature_location>

[0543] <INSDFeature_quals>

[0544] <insdqualifier>

[0545] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0546] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0547] < / insdqualifier>

[0548] <insdqualifier id="q46">

[0549] <INSDQualifier_name>organism< / INSDQualifier_name>

[0550] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0551] < / insdqualifier>

[0552] < / INSDFeature_quals>

[0553] < / insdfeature>

[0554] < / INSDSeq_feature-table>

[0555] <INSDSeq_sequence>cgcaccacatcaatcacttc< / INSDSeq_sequence>

[0556] < / insdseq>

[0557] < / sequencedata>

[0558] <sequencedata sequenceidnumber="22">

[0559] <insdseq>

[0560] <INSDSeq_length> 24< / INSDSeq_length>

[0561] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0562] <INSDSeq_division> PAT< / INSDSeq_division>

[0563] <INSDSeq_feature-table>

[0564] <insdfeature>

[0565] <INSDFeature_key>source< / INSDFeature_key>

[0566] <INSDFeature_location>1..24< / INSDFeature_location>

[0567] <INSDFeature_quals>

[0568] <insdqualifier>

[0569] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0570] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0571] < / insdqualifier>

[0572] <insdqualifier id="q48">

[0573] <INSDQualifier_name>organism< / INSDQualifier_name>

[0574] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0575] < / insdqualifier>

[0576] < / INSDFeature_quals>

[0577] < / insdfeature>

[0578] < / INSDSeq_feature-table>

[0579] <INSDSeq_sequence> aacttcccagtgtaaagacacatt< / INSDSeq_sequence>

[0580] < / insdseq>

[0581] < / sequencedata>

[0582] <sequencedata sequenceidnumber="23">

[0583] <insdseq>

[0584] <INSDSeq_length> 21< / INSDSeq_length>

[0585] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0586] <INSDSeq_division> PAT< / INSDSeq_division>

[0587] <INSDSeq_feature-table>

[0588] <insdfeature>

[0589] <INSDFeature_key>source< / INSDFeature_key>

[0590] <INSDFeature_location>1..21< / INSDFeature_location>

[0591] <INSDFeature_quals>

[0592] <insdqualifier>

[0593] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0594] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0595] < / insdqualifier>

[0596] <insdqualifier id="q50">

[0597] <INSDQualifier_name>organism< / INSDQualifier_name>

[0598] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0599] < / insdqualifier>

[0600] < / INSDFeature_quals>

[0601] < / insdfeature>

[0602] < / INSDSeq_feature-table>

[0603] <INSDSeq_sequence> tggctaggttgcagtaagcat< / INSDSeq_sequence>

[0604] < / insdseq>

[0605] < / sequencedata>

[0606] <sequencedata sequenceidnumber="24">

[0607] <insdseq>

[0608] <INSDSeq_length> 20< / INSDSeq_length>

[0609] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0610] <INSDSeq_division> PAT< / INSDSeq_division>

[0611] <INSDSeq_feature-table>

[0612] <insdfeature>

[0613] <INSDFeature_key>source< / INSDFeature_key>

[0614] <INSDFeature_location>1..20< / INSDFeature_location>

[0615] <INSDFeature_quals>

[0616] <insdqualifier>

[0617] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0618] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0619] < / insdqualifier>

[0620] <insdqualifier id="q52">

[0621] <INSDQualifier_name>organism< / INSDQualifier_name>

[0622] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0623] < / insdqualifier>

[0624] < / INSDFeature_quals>

[0625] < / insdfeature>

[0626] < / INSDSeq_feature-table>

[0627] <INSDSeq_sequence> tagggcacgaagataagctg< / INSDSeq_sequence>

[0628] < / insdseq>

[0629] < / sequencedata>

[0630] <sequencedata sequenceidnumber="25">

[0631] <insdseq>

[0632] <INSDSeq_length> 21< / INSDSeq_length>

[0633] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0634] <INSDSeq_division> PAT< / INSDSeq_division>

[0635] <INSDSeq_feature-table>

[0636] <insdfeature>

[0637] <INSDFeature_key>source< / INSDFeature_key>

[0638] <INSDFeature_location>1..21< / INSDFeature_location>

[0639] <INSDFeature_quals>

[0640] <insdqualifier>

[0641] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0642] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0643] < / insdqualifier>

[0644] <insdqualifier id="q54">

[0645] <INSDQualifier_name>organism< / INSDQualifier_name>

[0646] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0647] < / insdqualifier>

[0648] < / INSDFeature_quals>

[0649] < / insdfeature>

[0650] < / INSDSeq_feature-table>

[0651] <INSDSeq_sequence> tgtgccctcctaggtgttaga< / INSDSeq_sequence>

[0652] < / insdseq>

[0653] < / sequencedata>

[0654] <sequencedata sequenceidnumber="26">

[0655] <insdseq>

[0656] <INSDSeq_length> 17< / INSDSeq_length>

[0657] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0658] <INSDSeq_division> PAT< / INSDSeq_division>

[0659] <INSDSeq_feature-table>

[0660] <insdfeature>

[0661] <INSDFeature_key>source< / INSDFeature_key>

[0662] <INSDFeature_location>1..17< / INSDFeature_location>

[0663] <INSDFeature_quals>

[0664] <insdqualifier>

[0665] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0666] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0667] < / insdqualifier>

[0668] <insdqualifier id="q56">

[0669] <INSDQualifier_name>organism< / INSDQualifier_name>

[0670] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0671] < / insdqualifier>

[0672] < / INSDFeature_quals>

[0673] < / insdfeature>

[0674] < / INSDSeq_feature-table>

[0675] <INSDSeq_sequence> ttcagccggaatcctcg< / INSDSeq_sequence>

[0676] < / insdseq>

[0677] < / sequencedata>

[0678] <sequencedata sequenceidnumber="27">

[0679] <insdseq>

[0680] <INSDSeq_length> 20< / INSDSeq_length>

[0681] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0682] <INSDSeq_division> PAT< / INSDSeq_division>

[0683] <INSDSeq_feature-table>

[0684] <insdfeature>

[0685] <INSDFeature_key>source< / INSDFeature_key>

[0686] <INSDFeature_location>1..20< / INSDFeature_location>

[0687] <INSDFeature_quals>

[0688] <insdqualifier>

[0689] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0690] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0691] < / insdqualifier>

[0692] <insdqualifier id="q58">

[0693] <INSDQualifier_name>organism< / INSDQualifier_name>

[0694] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0695] < / insdqualifier>

[0696] < / INSDFeature_quals>

[0697] < / insdfeature>

[0698] < / INSDSeq_feature-table>

[0699] <INSDSeq_sequence> aagggagagcaccctcaatt< / INSDSeq_sequence>

[0700] < / insdseq>

[0701] < / sequencedata>

[0702] <sequencedata sequenceidnumber="28">

[0703] <insdseq>

[0704] <INSDSeq_length> 20< / INSDSeq_length>

[0705] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0706] <INSDSeq_division> PAT< / INSDSeq_division>

[0707] <INSDSeq_feature-table>

[0708] <insdfeature>

[0709] <INSDFeature_key>source< / INSDFeature_key>

[0710] <INSDFeature_location>1..20< / INSDFeature_location>

[0711] <INSDFeature_quals>

[0712] <insdqualifier>

[0713] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0714] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0715] < / insdqualifier>

[0716] <insdqualifier id="q60">

[0717] <INSDQualifier_name>organism< / INSDQualifier_name>

[0718] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0719] < / insdqualifier>

[0720] < / INSDFeature_quals>

[0721] < / insdfeature>

[0722] < / INSDSeq_feature-table>

[0723] <INSDSeq_sequence> cccgtggctggacttagac< / INSDSeq_sequence>

[0724] < / insdseq>

[0725] < / sequencedata>

[0726] <sequencedata sequenceidnumber="29">

[0727] <insdseq>

[0728] <INSDSeq_length> 22< / INSDSeq_length>

[0729] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0730] <INSDSeq_division> PAT< / INSDSeq_division>

[0731] <INSDSeq_feature-table>

[0732] <insdfeature>

[0733] <INSDFeature_key>source< / INSDFeature_key>

[0734] <INSDFeature_location>1..22< / INSDFeature_location>

[0735] <INSDFeature_quals>

[0736] <insdqualifier>

[0737] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0738] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0739] < / insdqualifier>

[0740] <insdqualifier id="q62">

[0741] <INSDQualifier_name>organism< / INSDQualifier_name>

[0742] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0743] < / insdqualifier>

[0744] < / INSDFeature_quals>

[0745] < / insdfeature>

[0746] < / INSDSeq_feature-table>

[0747] <INSDSeq_sequence> acctgtaactgtgagatggcaa< / INSDSeq_sequence>

[0748] < / insdseq>

[0749] < / sequencedata>

[0750] <sequencedata sequenceidnumber="30">

[0751] <insdseq>

[0752] <INSDSeq_length> 22< / INSDSeq_length>

[0753] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0754] <INSDSeq_division> PAT< / INSDSeq_division>

[0755] <INSDSeq_feature-table>

[0756] <insdfeature>

[0757] <INSDFeature_key>source< / INSDFeature_key>

[0758] <INSDFeature_location>1..22< / INSDFeature_location>

[0759] <INSDFeature_quals>

[0760] <insdqualifier>

[0761] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0762] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0763] < / insdqualifier>

[0764] <insdqualifier id="q64">

[0765] <INSDQualifier_name>organism< / INSDQualifier_name>

[0766] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0767] < / insdqualifier>

[0768] < / INSDFeature_quals>

[0769] < / insdfeature>

[0770] < / INSDSeq_feature-table>

[0771] <INSDSeq_sequence> cttggcattcaaagacttcaac< / INSDSeq_sequence>

[0772] < / insdseq>

[0773] < / sequencedata>

[0774] <sequencedata sequenceidnumber="31">

[0775] <insdseq>

[0776] <INSDSeq_length> 18< / INSDSeq_length>

[0777] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0778] <INSDSeq_division> PAT< / INSDSeq_division>

[0779] <INSDSeq_feature-table>

[0780] <insdfeature>

[0781] <INSDFeature_key>source< / INSDFeature_key>

[0782] <INSDFeature_location>1..18< / INSDFeature_location>

[0783] <INSDFeature_quals>

[0784] <insdqualifier>

[0785] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0786] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0787] < / insdqualifier>

[0788] <insdqualifier id="q66">

[0789] <INSDQualifier_name>organism< / INSDQualifier_name>

[0790] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0791] < / insdqualifier>

[0792] < / INSDFeature_quals>

[0793] < / insdfeature>

[0794] < / INSDSeq_feature-table>

[0795] <INSDSeq_sequence> ccagctcatgctgcattc< / INSDSeq_sequence>

[0796] < / insdseq>

[0797] < / sequencedata>

[0798] <sequencedata sequenceidnumber="32">

[0799] <insdseq>

[0800] <INSDSeq_length> 21< / INSDSeq_length>

[0801] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0802] <INSDSeq_division> PAT< / INSDSeq_division>

[0803] <INSDSeq_feature-table>

[0804] <insdfeature>

[0805] <INSDFeature_key>source< / INSDFeature_key>

[0806] <INSDFeature_location>1..21< / INSDFeature_location>

[0807] <INSDFeature_quals>

[0808] <insdqualifier>

[0809] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0810] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0811] < / insdqualifier>

[0812] <insdqualifier id="q68">

[0813] <INSDQualifier_name>organism< / INSDQualifier_name>

[0814] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0815] < / insdqualifier>

[0816] < / INSDFeature_quals>

[0817] < / insdfeature>

[0818] < / INSDSeq_feature-table>

[0819] <INSDSeq_sequence> agctggtcaaacagaacct< / INSDSeq_sequence>

[0820] < / insdseq>

[0821] < / sequencedata>

[0822] <sequencedata sequenceidnumber="33">

[0823] <insdseq>

[0824] <INSDSeq_length> 20< / INSDSeq_length>

[0825] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0826] <INSDSeq_division> PAT< / INSDSeq_division>

[0827] <INSDSeq_feature-table>

[0828] <insdfeature>

[0829] <INSDFeature_key>source< / INSDFeature_key>

[0830] <INSDFeature_location>1..20< / INSDFeature_location>

[0831] <INSDFeature_quals>

[0832] <insdqualifier>

[0833] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0834] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0835] < / insdqualifier>

[0836] <insdqualifier id="q70">

[0837] <INSDQualifier_name>organism< / INSDQualifier_name>

[0838] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0839] < / insdqualifier>

[0840] < / INSDFeature_quals>

[0841] < / insdfeature>

[0842] < / INSDSeq_feature-table>

[0843] <INSDSeq_sequence> gcagtcttgccagttgctat< / INSDSeq_sequence>

[0844] < / insdseq>

[0845] < / sequencedata>

[0846] <sequencedata sequenceidnumber="34">

[0847] <insdseq>

[0848] <INSDSeq_length> 22< / INSDSeq_length>

[0849] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0850] <INSDSeq_division> PAT< / INSDSeq_division>

[0851] <INSDSeq_feature-table>

[0852] <insdfeature>

[0853] <INSDFeature_key>source< / INSDFeature_key>

[0854] <INSDFeature_location>1..22< / INSDFeature_location>

[0855] <INSDFeature_quals>

[0856] <insdqualifier>

[0857] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0858] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0859] < / insdqualifier>

[0860] <insdqualifier id="q72">

[0861] <INSDQualifier_name>organism< / INSDQualifier_name>

[0862] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0863] < / insdqualifier>

[0864] < / INSDFeature_quals>

[0865] < / insdfeature>

[0866] < / INSDSeq_feature-table>

[0867] <INSDSeq_sequence> accactttttacaggtcagcct< / INSDSeq_sequence>

[0868] < / insdseq>

[0869] < / sequencedata>

[0870] <sequencedata sequenceidnumber="35">

[0871] <insdseq>

[0872] <INSDSeq_length> 21< / INSDSeq_length>

[0873] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0874] <INSDSeq_division> PAT< / INSDSeq_division>

[0875] <INSDSeq_feature-table>

[0876] <insdfeature>

[0877] <INSDFeature_key>source< / INSDFeature_key>

[0878] <INSDFeature_location>1..21< / INSDFeature_location>

[0879] <INSDFeature_quals>

[0880] <insdqualifier>

[0881] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0882] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0883] < / insdqualifier>

[0884] <insdqualifier id="q74">

[0885] <INSDQualifier_name>organism< / INSDQualifier_name>

[0886] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0887] < / insdqualifier>

[0888] < / INSDFeature_quals>

[0889] < / insdfeature>

[0890] < / INSDSeq_feature-table>

[0891] <INSDSeq_sequence> tccagactgtcgctttctgta< / INSDSeq_sequence>

[0892] < / insdseq>

[0893] < / sequencedata>

[0894] <sequencedata sequenceidnumber="36">

[0895] <insdseq>

[0896] <INSDSeq_length> 21< / INSDSeq_length>

[0897] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0898] <INSDSeq_division> PAT< / INSDSeq_division>

[0899] <INSDSeq_feature-table>

[0900] <insdfeature>

[0901] <INSDFeature_key>source< / INSDFeature_key>

[0902] <INSDFeature_location>1..21< / INSDFeature_location>

[0903] <INSDFeature_quals>

[0904] <insdqualifier>

[0905] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0906] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0907] < / insdqualifier>

[0908] <insdqualifier id="q76">

[0909] <INSDQualifier_name>organism< / INSDQualifier_name>

[0910] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0911] < / insdqualifier>

[0912] < / INSDFeature_quals>

[0913] < / insdfeature>

[0914] < / INSDSeq_feature-table>

[0915] <INSDSeq_sequence> tctatggtaagggtgtgtccc< / INSDSeq_sequence>

[0916] < / insdseq>

[0917] < / sequencedata>

[0918] <sequencedata sequenceidnumber="37">

[0919] <insdseq>

[0920] <INSDSeq_length>17< / INSDSeq_length>

[0921] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0922] <INSDSeq_division>PAT< / INSDSeq_division>

[0923] <INSDSeq_feature-table>

[0924] <insdfeature>

[0925] <INSDFeature_key>source< / INSDFeature_key>

[0926] <INSDFeature_location>1..17< / INSDFeature_location>

[0927] <INSDFeature_quals>

[0928] <insdqualifier>

[0929] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0930] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0931] < / insdqualifier>

[0932] <insdqualifier id="q78">

[0933] <INSDQualifier_name>organism< / INSDQualifier_name>

[0934] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0935] < / insdqualifier>

[0936] < / INSDFeature_quals>

[0937] < / insdfeature>

[0938] < / INSDSeq_feature-table>

[0939] <INSDSeq_sequence>ttgtgccctttgcagct< / INSDSeq_sequence>

[0940] < / insdseq>

[0941] < / sequencedata>

[0942] <sequencedata sequenceidnumber="38">

[0943] <insdseq>

[0944] <INSDSeq_length> 22< / INSDSeq_length>

[0945] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0946] <INSDSeq_division> PAT< / INSDSeq_division>

[0947] <INSDSeq_feature-table>

[0948] <insdfeature>

[0949] <INSDFeature_key>source< / INSDFeature_key>

[0950] <INSDFeature_location>1..22< / INSDFeature_location>

[0951] <INSDFeature_quals>

[0952] <insdqualifier>

[0953] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0954] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0955] < / insdqualifier>

[0956] <insdqualifier id="q80">

[0957] <INSDQualifier_name>organism< / INSDQualifier_name>

[0958] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0959] < / insdqualifier>

[0960] < / INSDFeature_quals>

[0961] < / insdfeature>

[0962] < / INSDSeq_feature-table>

[0963] <INSDSeq_sequence> atcaggttgcagaacgtttca< / INSDSeq_sequence>

[0964] < / insdseq>

[0965] < / sequencedata>

[0966] <sequencedata sequenceidnumber="39">

[0967] <insdseq>

[0968] <INSDSeq_length>19< / INSDSeq_length>

[0969] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0970] <INSDSeq_division>PAT< / INSDSeq_division>

[0971] <INSDSeq_feature-table>

[0972] <insdfeature>

[0973] <INSDFeature_key>source< / INSDFeature_key>

[0974] <INSDFeature_location>1..19< / INSDFeature_location>

[0975] <INSDFeature_quals>

[0976] <insdqualifier>

[0977] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0978] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0979] < / insdqualifier>

[0980] <insdqualifier id="q82">

[0981] <INSDQualifier_name>organism< / INSDQualifier_name>

[0982] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0983] < / insdqualifier>

[0984] < / INSDFeature_quals>

[0985] < / insdfeature>

[0986] < / INSDSeq_feature-table>

[0987] <INSDSeq_sequence>ctcctttggcccactatgc< / INSDSeq_sequence>

[0988] < / insdseq>

[0989] < / sequencedata>

[0990] <sequencedata sequenceidnumber="40">

[0991] <insdseq>

[0992] <INSDSeq_length> 27< / INSDSeq_length>

[0993] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0994] <INSDSeq_division> PAT< / INSDSeq_division>

[0995] <INSDSeq_feature-table>

[0996] <insdfeature>

[0997] <INSDFeature_key>source< / INSDFeature_key>

[0998] <INSDFeature_location>1..27< / INSDFeature_location>

[0999] <INSDFeature_quals>

[1000] <insdqualifier>

[1001] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1002] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1003] < / insdqualifier>

[1004] <insdqualifier id="q84">

[1005] <INSDQualifier_name>organism< / INSDQualifier_name>

[1006] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1007] < / insdqualifier>

[1008] < / INSDFeature_quals>

[1009] < / insdfeature>

[1010] < / INSDSeq_feature-table>

[1011] <INSDSeq_sequence> agttttacctgaagcatatattgagg< / INSDSeq_sequence>

[1012] < / insdseq>

[1013] < / sequencedata>

[1014] <sequencedata sequenceidnumber="41">

[1015] <insdseq>

[1016] <INSDSeq_length> 19< / INSDSeq_length>

[1017] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1018] <INSDSeq_division> PAT< / INSDSeq_division>

[1019] <INSDSeq_feature-table>

[1020] <insdfeature>

[1021] <INSDFeature_key>source< / INSDFeature_key>

[1022] <INSDFeature_location>1..19< / INSDFeature_location>

[1023] <INSDFeature_quals>

[1024] <insdqualifier>

[1025] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1026] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1027] < / insdqualifier>

[1028] <insdqualifier id="q86">

[1029] <INSDQualifier_name>organism< / INSDQualifier_name>

[1030] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1031] < / insdqualifier>

[1032] < / INSDFeature_quals>

[1033] < / insdfeature>

[1034] < / INSDSeq_feature-table>

[1035] <INSDSeq_sequence> tatgcgcacacctcaggac< / INSDSeq_sequence>

[1036] < / insdseq>

[1037] < / sequencedata>

[1038] <sequencedata sequenceidnumber="42">

[1039] <insdseq>

[1040] <INSDSeq_length>26< / INSDSeq_length>

[1041] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1042] <INSDSeq_division>PAT< / INSDSeq_division>

[1043] <INSDSeq_feature-table>

[1044] <insdfeature>

[1045] <INSDFeature_key>source< / INSDFeature_key>

[1046] <INSDFeature_location>1..26< / INSDFeature_location>

[1047] <INSDFeature_quals>

[1048] <insdqualifier>

[1049] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1050] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1051] < / insdqualifier>

[1052] <insdqualifier id="q88">

[1053] <INSDQualifier_name>organism< / INSDQualifier_name>

[1054] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1055] < / insdqualifier>

[1056] < / INSDFeature_quals>

[1057] < / insdfeature>

[1058] < / INSDSeq_feature-table>

[1059] <INSDSeq_sequence>tatgtaagtttgcagtttgtctcact< / INSDSeq_sequence>

[1060] < / insdseq>

[1061] < / sequencedata>

[1062] <sequencedata sequenceidnumber="43">

[1063] <insdseq>

[1064] <INSDSeq_length> 27< / INSDSeq_length>

[1065] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1066] <INSDSeq_division> PAT< / INSDSeq_division>

[1067] <INSDSeq_feature-table>

[1068] <insdfeature>

[1069] <INSDFeature_key>source< / INSDFeature_key>

[1070] <INSDFeature_location>1..27< / INSDFeature_location>

[1071] <INSDFeature_quals>

[1072] <insdqualifier>

[1073] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1074] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1075] < / insdqualifier>

[1076] <insdqualifier id="q90">

[1077] <INSDQualifier_name>organism< / INSDQualifier_name>

[1078] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1079] < / insdqualifier>

[1080] < / INSDFeature_quals>

[1081] < / insdfeature>

[1082] < / INSDSeq_feature-table>

[1083] <INSDSeq_sequence> gcaaccaagataaagaactattgtaaa< / INSDSeq_sequence>

[1084] < / insdseq>

[1085] < / sequencedata>

[1086] <sequencedata sequenceidnumber="44">

[1087] <insdseq>

[1088] <INSDSeq_length> 27< / INSDSeq_length>

[1089] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1090] <INSDSeq_division> PAT< / INSDSeq_division>

[1091] <INSDSeq_feature-table>

[1092] <insdfeature>

[1093] <INSDFeature_key>source< / INSDFeature_key>

[1094] <INSDFeature_location>1..27< / INSDFeature_location>

[1095] <INSDFeature_quals>

[1096] <insdqualifier>

[1097] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1098] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1099] < / insdqualifier>

[1100] <insdqualifier id="q92">

[1101] <INSDQualifier_name>organism< / INSDQualifier_name>

[1102] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1103] < / insdqualifier>

[1104] < / INSDFeature_quals>

[1105] < / insdfeature>

[1106] < / INSDSeq_feature-table>

[1107] <INSDSeq_sequence> gcaaccaagataaagaactaatttaa< / INSDSeq_sequence>

[1108] < / insdseq>

[1109] < / sequencedata>

[1110]

[1111] <---

Citation Information

Patent Citations

  • Method for preimplantation genetic testing of duchenne / becker muscular dystrophy

    RU2775416C1

  • Method for pre-implantation genetic testing of louis-bar syndrome

    RU2777081C1