Method for diagnosing ovarian cancer by detecting methylation in TRH gene

The analysis of DNA methylation in the TRH gene through methods like pyrosequencing addresses the limitations of existing ovarian cancer markers, improving early detection and diagnostic accuracy.

RU2864812C1Active Publication Date: 2026-06-29FEDERALNOE GOSUDARSTVENNOE BYUDZHETNOE UCHREZHDENIE NATSIONALNYJ MEDITSINSKIJ ISSLEDOVATELSKIJ TSENTR ONKOLOGII IMENI N N BLOKHINA MINISTSTVA ZDRAVOOKHRANENIYA ROSSIJSKOJ FEDERATSII FGBU NMITS ONKOLOGII IM N N BLOKHINA MINZDRAVA ROSSII
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
RU2025137914
Authority / Receiving Office
RU · RU
Patent Type
Patents
Current Assignee / Owner
Filing Date
2025-12-24
Publication Date
2026-06-29
Estimated Expiration
2045-12-24

AI Technical Summary

Technical Problem

Current diagnostic markers for ovarian cancer, such as CA-125 and HE4, have low specificity and sensitivity, leading to late detection and high mortality rates due to the asymptomatic nature of the disease, necessitating the development of more accurate early diagnostic markers.

Method used

Analysis of DNA methylation patterns, specifically in the Thyrotropin-Releasing Hormone (TRH) gene, using methods like pyrosequencing to detect methylation levels in biological samples, including tissue biopsies and fluids, to identify ovarian cancer.

Benefits of technology

Enhances the accuracy of ovarian cancer detection, particularly in early stages, by utilizing DNA methylation analysis of the TRH gene, providing a reliable diagnostic method for clinical samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000005
    Figure 00000005
  • Figure 00000006
    Figure 00000006
  • Figure 00000007
    Figure 00000007
Patent Text Reader

Abstract

FIELD: molecular biology.SUBSTANCE: method for diagnosing ovarian cancer by detecting methylation in the TRH gene is described, including the steps of obtaining a biological sample from an individual, isolating and purifying genomic DNA, and determining the methylation status of the sequence SEQ ID NO: 1 in the TRH gene by any method that allows detection of DNA methylation. If abnormal methylation of the specified DNA sequence in the TRH gene is detected, a conclusion is made about the presence of ovarian cancer.EFFECT: highly reliable detection of ovarian cancer in clinical samples by analyzing the methylation of the sequence SEQ ID NO: 1.1 cl, 4 dwg, 2 ex
Need to check novelty before this filing date? Find Prior Art

Description

[0001] The invention relates to the field of medicine, in particular to molecular oncology and gynecology, and can be used for DNA diagnostics of ovarian cancer.

[0002] Ovarian cancer (OC) is the eighth most common cancer among women worldwide and remains one of the leading causes of death among gynecological malignancies. In 2022, approximately 325,000 new cases and 235,000 deaths from OC were registered worldwide (Bray F., Laversanne M., Sung H., Ferlay J., Siegel R.L., Soerjomataram I., Jemal A. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries / / CA: A Cancer Journal for Clinitians. - 2024. - Vol. 74, No. 3. - P. 229-263). In Russia in 2023, 14,023 new cases of ovarian cancer were diagnosed, with 6,996 deaths (Status of oncological care for the population of Russia in 2024 / Edited by Kaprin A.D., Starinsky, V.V., Petrova, G.V. - Moscow: P.A. Herzen Moscow Oncology Research Institute - branch of the National Medical Research Center of Radiology of the Ministry of Health of Russia, 2025. - 275 p.).High mortality with global five-year survival rates ranging from 30-40% is due to various factors, including the histological subtype of the tumor and the stage at which the malignant neoplasm was detected. The main problem in the fight against this disease is its late detection, which is associated with the asymptomatic course of the disease and insufficient diagnostic value of existing markers. As a result, the majority of cases of ovarian cancer are detected only in the late stages of the disease (Torre LA, Trabert B., DeSantis C.E., Miller K.D., Samimi G., Runowicz C.D., Gaudet M.M., Jemal A., Siegel R.L. Ovarian cancer statistics, 2018 / / CA: A Cancer Journal for Clinitians. - 2018. - Vol. 68, No. 4. - P. 284-296).

[0003] In clinical practice, serological tumor markers CA-125 and HE4 are widely used for the diagnosis and monitoring of ovarian cancer. CA-125 is a common tumor marker for the diagnosis and monitoring of ovarian cancer, increasing in 80% of patients at late stages and in 50% at early stages. Its disadvantage is low specificity, since the level can increase with inflammation, benign tumors and other neoplasms (Funston G., Mounce L. T., Price S., Rous B., Crosbie E. J., Hamilton W., Walter F. M. CA125 test result, test-to-diagnosis interval, and stage in ovarian cancer at diagnosis: a retrospective cohort study using electronic health records / / British Journal of General Practice. - 2021. - Vol. 71, No. 707. - P. e465-e472). HE4 detects ovarian cancer with a sensitivity of 58-83% and a specificity of 83-99%. It is less likely to increase in benign gynecological diseases and endometriosis compared to CA-125, but is increased in endometrial cancer, lung cancer, breast cancer, and other oncological diseases (Zhang R., Siu M. K. Y., Ngan H. Y. S., Chan K. K. L. Molecular Biomarkers for the Early Detection of Ovarian Cancer / / International Journal of Molecular Sciences. - 2022. - Vol. 23, No. 19. - P. 12041). To improve the accuracy of early diagnosis, disease screening, as well as monitoring of ovarian cancer relapses, especially with low or absent levels of existing serological markers, new or additional markers are needed.

[0004] DNA methylation is an important epigenetic marker in cancer diagnostics, since its abnormal patterns may indicate the presence of a tumor. These changes often manifest themselves in the early stages of the disease as hypermethylation of tumor suppressor genes, which leads to their inactivation, as well as as general hypomethylation. Analysis of DNA methylation sequences in biological samples (blood, urine, tissues) using a variety of techniques allows us to successfully identify, diagnose and prognosticate the course of various malignant neoplasms. In modern clinical practice, the analysis of epigenetic markers carried out using minimally invasive methods is becoming increasingly important (Pharo H., Vedeld H. M., Sjurgard IV, Pinto R., Lind GE From concept to clinic: a roadmap for DNA methylation biomarkers in liquid biopsies / / Oncogene. -2025. - Vol. 44, No. 49. - P. 4814-4831).

[0005] DNA hypermethylation of sequences in the Thyrotropin Releasing Hormone (TRH) gene in malignant neoplasms was demonstrated for the first time in pancreatic cancer. The genes CSMD2, SLC32A1, TMEM204, and TRH were shown to be hypermethylated in cell lines, and the genes CSMD2, SLC32A1, and TRH were also increased in methylation in primary pancreatic tumors (Shimizu H., Horii A., Sunamura M., Motoi F., Egawa S., Unno M., Fukushige S. Identification of epigenetically silenced genes in human pancreatic cancer by a novel method "microarray coupled with methyl-CpG targeted transcriptional activation" (MeTA-array) / / Biochemical and Biophysical Research Communications. - 2011. - Vol. 411, No. 1. - P. 162-167).Methylation of the TRH gene, in combination with the analysis of 18 other gene markers (ANKRD28, BHLHE40, CGGBP1, RBSP3, EPHB1, FGD5, FOXP1, G0RASP1 / TTC21, IQSEC1, ITGA9, LOC285375, LRRC3B, LRRN1, MITF, NKIRAS1 / RPL15, UBE2E2, VHL, WNT7A), can be used for the early diagnosis of non-small cell lung cancer. In addition, the use of this panel of markers allows us to predict the development and metastasis of the tumor, as well as distinguish between the two main types of lung cancer: squamous cell carcinoma and adenocarcinoma, with high accuracy (Dmitriev AA, Kashuba VI, Haraldson K., Senchenko VN, Pavlova TV, Kudryavtseva AV, Anedchenko EA, Krasnov GS, Pronina IV, Loginov VI, Kondratieva TT, Kazubskaya TP, Braga EA, Yenamandra SP, Ignatjev I., Ernberg I., Klein G., Lerman MI, Zabarovsky ER Genetic and epigenetic analysis of non-small cell lung cancer with Notl microarrays / / Epigenetics. - 2012. - Vol. 7, No. 5. - P. 502-513).Analysis of methylation of CpG sites in seven genes (FAM150A, ZNF540, ZNF671, ZNF154, PRAC, SLC13A5, and TRH) in patients with clear cell renal cell carcinoma demonstrated the prognostic significance of this panel. An association was found between the methylation profile and the frequency of relapse-free and overall survival, as well as the probability of disease-related death (Tian Y., Arai E., Gotoh M., Komiyama M., Fujimoto H., Kanai Y. Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes / / BMC Cancer. - 2014. - Vol. 14. - P. 772). Studies have shown that DNA methylation at cgO 1009664 in the TRH gene can serve as a biomarker for screening oral squamous cell carcinoma and oropharyngeal cancer. This method involves the use of oral swabs and washings to obtain biological material for analysis (Puttipanyalears S, Arayataweegool A, Chalertpet K, Rattanachayoto P)., Mahattanasakul R., Tangjaturonsasme N., Kerekhanjanarong V., Mutirangura A., Kitkumthorn N. TRH site-specific methylation in oral and oropharyngeal squamous cell carcinoma / / BMC Cancer. - 2018. - Vol.18, No. 1. - P. 786). In addition, methylation of the TRH, RASSF1A, CDKN2A and MGMT genes can be used as a predictive biomarker for the early diagnosis of oral squamous cell carcinoma and non-invasive oral cancer screening in clinical practice (Alafaria H. AA, Jalal AS Novel DNA methylation biomarkers for early diagnosis of oral tongue squamous cell carcinoma (OTSCC) / / Journal of Applied Genetics. - 2024. - Vol. 65, No. 3. - P. 541-548) (Lim I., Tan J., Alam A., Idrees M., Brenan PA, Coletta RD, Kujan O. Epigenetics in the diagnosis and prognosis of head and neck cancer: A systematic review / / Journal of Oral Pathology & Medicine. - 2024. - Vol. 53, No. 2. - P. 90-106).Methylation at the cgO site 1009664 of the TRH gene is a promising biomarker for the diagnosis of high-grade cervical precancerous lesions (CIN2+), including CIN2, CIN3, and cervical cancer. Studying the TRH methylation level allows for the highly accurate identification of women who require colposcopic examination, which significantly simplifies and accelerates the diagnosis of CIN2+ (Chaiwongkot A., Buranapraditkun S., Oranratanaphan S., Chuen-Im T., Kitkumthorn N. Efficiency of CIN2+Detection by Thyrotropin-Releasing Hormone (TRH) Site-Specific Methylation / / Viruses. - 2023. - Vol. 15, No. 9. - P. 1802). Patent application RU2804962C1, filed October 9, 2023 (IPC C12Q1 / 68), describes a method for detecting and analyzing genomic DNA methylation in peripheral blood samples from patients with non-Hodgkin's lymphoma. The method involves analyzing the genomic DNA methylation of at least one of 45 genes, including the TRH gene.

[0007] Document RU2630669C1, dated September 11, 2017 (IPC C12Q1 / 68), describes a method for determining the methylation of PuCGPy sites in the regulatory regions of colorectal cancer tumor marker genes using GLAD-PCR analysis. A set of oligonucleotide primers and fluorescently labeled probes for implementing this method is also presented. The study generated a list of 57 tumor marker genes whose methylation is frequently found in the genomic DNA of colorectal cancer cells. Among them are the TRH gene, as well as the following genes: SEPT9, SYNE1, FGF12, GAD2, HAND1, CACNA1G, CNRIP1, TLX2, LOX, LAMA1, GAS7, SLC6A15, BOLL, TFPI2, SOCS3, TRH, MDFI, ClorfO, RUNX3, TMEFF2, SFRP2, WNT5A, IGFBP7, TFPI2, FOXE1, NPY, WIF1, CIDEB, RIC3, ​​KCNQ5, COL4A1, SPG20, SND1, PENK, CD01, THBD, EDIL3, DUSP26, UCHL1, STOX2, ELMO1, SLC30A10, IGF2, ESR1, EYA4, NALCN, FLU, RXRg, RYR2, PRKAR1B, BEND5, ITGA4, ADHFE1, NGFR, GATA4, NEYROG1, FBN1.

[0008] The closest analogue (prototype) of this invention is the international patent application US20220243278A1 "Detecting the presence or absence of multiple types of cancer." This application describes a technology for screening various types of cancer, allowing for the simultaneous detection of many types of oncological diseases. Among them: cancer of the liver, esophagus, lungs, ovaries, pancreas, stomach, bladder, breast, cervix, colon, prostate, kidney and uterus. The method is based on measuring the methylation level in certain regions of genes. Various biological samples can be used as objects of analysis. The analysis of biological samples is carried out by measuring the methylation level of one or more marker sites in the following genes: FAIM2,

[0009] For the TRH gene, the application indicates a 92 bp sequence in the promoter region (genomic coordinates chr3:129693484-129693575, GRCh37 / hg19), which differs from the sequence claimed in our invention (SEQ ID NO: 1, genomic coordinates chr3:129693566-129693710, GRCh37 / hg19).

[0010] The objective of the invention is to develop a new method for diagnosing ovarian cancer by detecting methylation in the TRH gene.

[0011] The technical result of the invention is that the claimed method enables highly reliable detection of ovarian cancer in clinical samples by analyzing the methylation of the sequence (SEQ ID NO: 1). The method improves the accuracy of DNA diagnostics, including the early diagnosis of ovarian cancer, by using DNA from any biological material for analysis.

[0012] The invention is available for use in clinical practice.

[0013] The technical result is achieved by analyzing biopsy specimens, postoperative material, and cells from various biological fluids for methylation of the promoter region in the thyrotropin-releasing hormone (TRH) gene using any method capable of detecting DNA methylation. If abnormal methylation of the specified DNA sequences in the TRH gene is detected, the disease is diagnosed.

[0014] Diagnosis of ovarian cancer is carried out as follows.

[0015] Biological material is collected from individuals undergoing screening for cancer or with a confirmed diagnosis. The following may be used as biological material: postoperative tissue, ovarian tissue biopsies, cells from uterine aspirates, or cells from ascitic fluid.

[0016] Isolation and purification of genomic DNA from biological samples are carried out.

[0017] Analysis of the methylation level of the sequence SEQ ID NO: 1 in genomic DNA is carried out by any method that allows detection of DNA methylation. Such methods include approaches using bisulfite conversion of DNA based on specific restriction enzymes or affinity enrichment, followed by analysis using polymerase chain reaction, sequencing or chip analysis, etc. (Pajares M. J., Palanca-Ballester C, Urtasun R., Alemany-Cosme E., Lahoz A., Sandoval J. Methods for analysis of specific DNA methylation status / / Methods. - 2021. - Vol. 187.-P. 3-12). The methylation status of the sequence SEQ ID NO: 1 in a biological sample is assessed using a threshold level, which is set for each method separately.

[0018] The invention is illustrated by example 1, representing a study of samples of tumor and non-tumor ovarian tissue, and example 2, representing a study of cell samples of aspirates from the uterine cavity of a patient with an established diagnosis of ovarian cancer and a conditionally healthy patient without ovarian pathologies.

[0019] Example 1. Analysis of the methylation level of SEQ ID NO: 1 in the TRH gene by pyrosequencing for the diagnosis of ovarian cancer in tumor and non-tumor ovarian tissue samples.

[0020] Tumor and non-tumor ovarian tissue samples (macroscopically unaffected by the tumor process) were obtained by freezing the tissue fragments no more than 30 minutes after completion of resection. Samples of conditionally healthy ovarian tissue, unaffected by the tumor process, were obtained as a result of laparoscopic prophylactic oophorectomy or during removal of the uterine appendages for other neoplasms of the female reproductive system. Genomic DNA preparations were isolated from ovarian tissue samples using the PureLink™ Genomic DNA Mini Kit (Invitrogen) according to the manufacturer's protocol. DNA was eluted from the columns in 100 μl of nuclease-free distilled water. DNA concentration was determined using the Qubit dsDNA Assay Kit on a Qubit fluorometer (Thermofisher Scientific, Invitrogen USA).Bisulfite treatment of genomic DNA from ovarian cancer tumor material was performed using the EZ DNA Methylation-Gold Kit TM reagent kit (Zymo Research, article number D5006, USA) and the program recommended by the kit manufacturer.

[0021] DNA amplification for methylation analysis of SEQ ID NO: 1 by pyrosequencing was performed using primers specific to SEQ ID NO: 1, taking into account bisulfite conversion. Two primers were used, one of which (SEQ ID NO: 3) was modified with biotin at the 5' end for subsequent immobilization on streptavidin Sepharose during pyrosequencing, and the second unmodified primer (SEQ ID NO: 2).

[0022] The following oligonucleotide sequences are used:

[0023]

[0024] For amplification, we used the thermostable "hot-start" polymerase SmarTaq as part of a ready-made mixture of reagents for PCR analysis - 5X MasDDTaqMIX (Dialat, Russia).

[0025] Amplification was performed in a volume of 25 µl. The reaction mixture contained: 5 µl of 5X MasDDTaqMIX mixture, specific primers (0.2 pmol in 1 µl of reaction mixture), and 2 µl (acceptable concentration range: 0.5-25 ng) of bisulfite-treated genomic DNA.

[0026] PCR was performed on a T100 amplifier (Bio-Rad, USA) according to the following program:

[0027] Step 1: denaturation at t=95°C for 3 min

[0028] Stage 2: 45 PCR cycles:

[0029] - denaturation at t=95°C for 15 sec

[0030] - annealing of oligonucleotides at t=52°C for 15 sec

[0031] - elongation at t=72°C for 20 sec

[0032] Stage 3: elongation at t=72° for 5 min.

[0033] Pyrosequencing was performed on a PyroMark Q24 instrument (Qiagen, USA) using a specific primer (SEQ ID NO: 2).

[0034] Analyzed sequence by bisulfite pyrosequencing:

[0035] GYGTAATTTTTTGTTTGYGTAAAGTTTYGTGGTATTTYGAGYGTTTTTTAAGT (SEQ ID NO 4), where Y are variable C / T positions.

[0036] The resulting sequences were analyzed using PyroMark Q24 Advanced Software, which allows analysis of the methylation level of CpG or CpN sites.

[0037] Example 2. Analysis of the methylation level of SEQ ID NO: 1 in the TRH gene by pyrosequencing for the diagnosis of ovarian cancer in cell samples of aspirates from the uterine cavity of a patient with a confirmed diagnosis of ovarian cancer and a patient without ovarian pathologies.

[0038] Clinical cell samples were obtained by uterine cavity aspiration using a Pipelle type C probe from patients with ovarian cancer and from healthy women (without ovarian pathologies). All samples were obtained before surgical or therapeutic treatment. Sample volume ranged from 200 μl to 1.5 ml. Samples were diluted in 1-7.5 ml of ice-cold PBS buffer and processed no later than 2 hours later. All procedures were performed on ice or at 4°C. Cells from aspirates were pelleted by 20-minute centrifugation at 1300g, after which the supernatant was collected. Cell pellets were stored at -80°C. Genomic DNA preparations from uterine aspirate cells were isolated using the PureLink™ Genomic DNA Mini Kit (Invitrogen) according to the manufacturer's protocol. DNA was eluted from the columns in 100 µl of nuclease-free distilled water.DNA concentration was determined using the Qubit dsDNA Assay Kit on a Qubit fluorometer (Thermofisher Scientific, Invitrogen, USA). Bisulfite treatment of genomic DNA from ovarian cancer tumor material was performed using the EZ DNA Methylation-Gold Kit™ (Zymo Research, part number D5006, USA) and the software recommended by the kit manufacturer.

[0039] Amplification of bisulfite-converted DNA, as well as analysis of the methylation level of the sequence SEQ ID NO 1 by the pyrosequencing method, was carried out according to the method described for Example 1.

[0040] The invention is illustrated by figures 1-4.

[0041] Figure 1. Example of a pyrogram of methylation analysis of SEQ ID NO: 1 in non-tumor ovarian tissue. The average methylation level in genomic DNA of cells in uterine aspirates from a patient with normal ovarian pathologies is <10%, corresponding to unmethylated SEQ ID NO: 1.

[0042] Figure 2. - Example of a pyrogram of methylation analysis for SEQ ID NO: 1 in ovarian tumor tissue. The average methylation level in genomic DNA from ovarian tumor tissue is >10%, corresponding to methylated SEQ ID NO: 1.

[0043] Figure 3 - Example of a pyrogram of methylation analysis of SEQ ID NO: 1 in cells from uterine aspirates of a patient without ovarian pathologies. The average genomic DNA methylation level in uterine aspirates of a patient without ovarian pathologies is <10%, corresponding to unmethylated SEQ ID NO: 1.

[0044] Figure 4 - Example of a pyrogram of methylation analysis of SEQ ID NO: 1 in cells from uterine aspirates of a patient diagnosed with ovarian cancer. The average methylation level in the genomic DNA of the patient's uterine aspirates is >10%, corresponding to methylated SEQ ID NO: 1.

[0045] The sequences of genomic DNA and oligonucleotides are given in the Sequence Listing.

[0046] A copy of the Listing of Genomic DNA and Oligonucleotide Sequences provided on a machine-readable medium is identical to the Listing of Genomic DNA and Oligonucleotide Sequences in printed form.

[0047]

[0048] --->

[0049] <?xml version="1.0" encoding="UTF-8"?>

[0050] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0051] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0052] <ST26SequenceListing dtdVersion="V1_3" fileName="Способ диагностики

[0053] рака яичников путем выявления метилирования в гене TRH.xml"

[0054] softwareName="WIPO Sequence" softwareVersion="2.3.0"

[0055] productionDate="2025-12-14">

[0056] <applicationidentification>

[0057] <ipofficecode>< / ipofficecode>

[0058] <applicationnumbertext>OC-DIAG < / applicationnumbertext>

[0059] <filingdate> 2025-12-14< / filingdate>

[0060] < / applicationidentification>

[0061] <applicantfilereference> OC-DIAG< / applicantfilereference>

[0062] <applicantname languagecode="ru">Federal State

[0063] budgetary institution of the Ministry of Health of the Russian Federation

[0064] Federation National Medical Research Center of Oncology

[0065] named after N.N. Blokhin< / applicantname>

[0066] <applicantnamelatin>Federal State Budgetary Institution "NN

[0067] Blokhin National Medical Research Center of Oncology" of the

[0068] Ministry of Health of the Russian Federation< / applicantnamelatin>

[0069] <inventorname languagecode="ru">Svetlana Vinokurova

[0070] Vladimirovna< / inventorname>

[0071] <inventornamelatin>Vinokurova Svetlana

[0072] Vladimirovna< / inventornamelatin>

[0073] <inventiontitle languagecode="ru">A method for diagnosing ovarian cancer

[0074] by detecting methylation in the TRH gene< / inventiontitle>

[0075] <sequencetotalquantity> 4< / sequencetotalquantity>

[0076] <sequencedata sequenceidnumber="1">

[0077] <insdseq>

[0078] <INSDSeq_length>145< / INSDSeq_length>

[0079] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0080] <INSDSeq_division>PAT< / INSDSeq_division>

[0081] <INSDSeq_feature-table>

[0082] <insdfeature>

[0083] <INSDFeature_key>source< / INSDFeature_key>

[0084] <INSDFeature_location>1..145< / INSDFeature_location>

[0085] <INSDFeature_quals>

[0086] <insdqualifier>

[0087] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0088] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0089] < / insdqualifier>

[0090] <insdqualifier id="q2">

[0091] <INSDQualifier_name>organism< / INSDQualifier_name>

[0092] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0093] < / insdqualifier>

[0094] < / INSDFeature_quals>

[0095] < / insdfeature>

[0096] < / INSDSeq_feature-table>

[0097] <INSDSeq_sequence>caggcgcccggggtcctcagcgctgcagactcctgacctgccgactgcg

[0098] gatcccgagtccccggatcccggacccatcctgtggagcccactcctggcaggtaaccgccccaacccct

[0099] ctccttccgcagacggtgtccgggag< / INSDSeq_sequence>

[0100] < / insdseq>

[0101] < / sequencedata>

[0102] <sequencedata sequenceidnumber="2">

[0103] <insdseq>

[0104] <INSDSeq_length> 20< / INSDSeq_length>

[0105] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0106] <INSDSeq_division> PAT< / INSDSeq_division>

[0107] <INSDSeq_feature-table>

[0108] <insdfeature>

[0109] <INSDFeature_key>source< / INSDFeature_key>

[0110] <INSDFeature_location>1..20< / INSDFeature_location>

[0111] <INSDFeature_quals>

[0112] <insdqualifier>

[0113] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0114] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0115] < / insdqualifier>

[0116] <insdqualifier id="q4">

[0117] <INSDQualifier_name>organism< / INSDQualifier_name>

[0118] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0119] < / insdqualifier>

[0120] < / INSDFeature_quals>

[0121] < / insdfeature>

[0122] < / INSDSeq_feature-table>

[0123] <INSDSeq_sequence> yggtttatttgaagaggggtt< / INSDSeq_sequence>

[0124] < / insdseq>

[0125] < / sequencedata>

[0126] <sequencedata sequenceidnumber="3">

[0127] <insdseq>

[0128] <INSDSeq_length> 23< / INSDSeq_length>

[0129] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0130] <INSDSeq_division> PAT< / INSDSeq_division>

[0131] <INSDSeq_feature-table>

[0132] <insdfeature>

[0133] <INSDFeature_key>source< / INSDFeature_key>

[0134] <INSDFeature_location>1..23< / INSDFeature_location>

[0135] <INSDFeature_quals>

[0136] <insdqualifier>

[0137] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0138] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0139] < / insdqualifier>

[0140] <insdqualifier id="q6">

[0141] <INSDQualifier_name>organism< / INSDQualifier_name>

[0142] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0143] < / insdqualifier>

[0144] < / INSDFeature_quals>

[0145] < / insdfeature>

[0146] < / INSDSeq_feature-table>

[0147] <INSDSeq_sequence> acctaccaaaaataaactccaca< / INSDSeq_sequence>

[0148] < / insdseq>

[0149] < / sequencedata>

[0150] <sequencedata sequenceidnumber="4">

[0151] <insdseq>

[0152] <INSDSeq_length> 53< / INSDSeq_length>

[0153] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0154] <INSDSeq_division> PAT< / INSDSeq_division>

[0155] <INSDSeq_feature-table>

[0156] <insdfeature>

[0157] <INSDFeature_key>source< / INSDFeature_key>

[0158] <INSDFeature_location>1..53< / INSDFeature_location>

[0159] <INSDFeature_quals>

[0160] <insdqualifier>

[0161] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0162] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0163] < / insdqualifier>

[0164] <insdqualifier id="q8">

[0165] <INSDQualifier_name>organism< / INSDQualifier_name>

[0166] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0167] < / insdqualifier>

[0168] < / INSDFeature_quals>

[0169] < / insdfeature>

[0170] < / INSDSeq_feature-table>

[0171] <INSDSeq_sequence> gygtaatttttgtttgygtaaagtttygtggtattttygagygtttttt

[0172] aagt< / INSDSeq_sequence>

[0173] < / insdseq>

[0174] < / sequencedata>

[0175]

[0176] <---

Citation Information

Patent Citations

  • Method for analysing disorders related to ovarian carcinoma

    RU2511408C2

  • METHOD FOR DIAGNOSING OVARIAN CANCER BASED ON A GROUP OF microRNA GENES

    RU2703399C1

  • Methods for detecting and predicting cancer and / or CIN3

    WO2021255459A1