Method for detecting haarlem genotype of mycobacteriumtuberculosis

Abstract

FIELD: biotechnology.SUBSTANCE: method for detecting the Haarlem genotype of Mycobacterium tuberculosis. The method is distinguished in that a nucleotide substitution in the Rv0282 gene at position 211C>T, specific for a given genotype, is detected using a polymerase chain reaction using oligonucleotide primers SEQ ID NO: 1 and SEQ ID NO: 2 with subsequent treatment of the PCR product with the restriction endonuclease HhaI and electrophoresis of the restriction products in agarose gel, in the case of a mutation in the Rv0282 gene at position 211C>T, specific for the Haarlem genotype of M. tuberculosis , the presence of a marker fragment 256 nucleotide pairs long is observed, and in the presence of two restriction fragments 90 nucleotide pairs and 166 nucleotide pairs long, the strain is judged to belong to any other genotype of M. tuberculosisEFFECT: development of a method for rapid, simple and reliable detection of the Haarlem genotype of M. tuberculosis.1 cl, 4 dwg, 3 ex

Description

[0001] The invention relates to medicine, namely to phthisiology, and can be used for laboratory determination of Mycobacterium tuberculosis, belonging to the Haarlem genotype of Mycobacterium tuberculosis.

[0002] The population structure of the Mycobacterium tuberculosis species is clonal, and most of the currently circulating strains belong to four phylogenetic lineages, L1-L4, which are also named geographically: Indian Ocean, East Asian, Central Asian, and Euro-American, respectively (Gagneux, 2018). The lineages are further divided into usually smaller families of genotypes, some of which are distributed worldwide due to either specific population migration flows or pathogenic properties of the strains. The Euro-American L4 lineage is one of the most genetically and geographically heterogeneous (Stucki et al., 2016; Zenteno-Cuevas et al., 2021; Ashton et al., 2023). L4 is thought to have originated several millennia ago in Eurasia and spread in all directions, but mainly from Europe to the Americas and Africa (Mokrousov et al., 2017).Lineage 4 genotypes were initially identified using classical genotyping methods, primarily spoligotyping (Brudey et al., 2006). The Haarlem genotype is an important subset and the second most common genotype of L4 after the LAM genotype. The genotype was named after the city of Haarlem in the Netherlands, where it was first isolated from a tuberculosis patient. A distinctive combination of virulence properties was demonstrated for Haarlem strains in a study on mouse and macrophage models: Haarlem strains were characterized by high uptake, high cytokine induction, and rapid growth rates (Reiling et al., 2013). Long-term presence of the epidemic Haarlem strain was described in Tunisia (Mardassi et al., 2005).

[0003] The Haarlem genotype was initially defined based on spoligotyping (Brudey et al., 2006; Demay et al., 2012; Couvin et al., 2019). In the SITVIT2 spoligotyping database (http: / / www.pasteur-guadeloupe.fr:8081 / SITVIT2 / ), it is divided into three subclades. Subclade H3 is ancestral and is characterized by the missing signal 31 (along with four missing signals 33-36, characteristic of all strains of the L4 lineage). Its main and foundational SIT (also ancestral for all Haarlem) is S1T50 (Fig. 1). Spoligotyping-based decision rules for detection of the Haarlem genotype were described in SITVIT2 and include mandatory absence of signals 31 and 33-36, along with the presence of signal 32 (Demay et al., 2012; Couvin et al., 2019).

[0004] In general, Haarlem isolates are mostly susceptible to antibiotics; however, in a number of Russian studies, half of the Haarlem strains were resistant (Vyazovaya et al., 2021, 2022; Umpeleva et al., 2013; Pasechnik et al., 2018; Vyazovaya et al., 2020; Zhdanova et al., 2022). In Latvia, the proportion of resistant isolates varied from 10% to 100% among different Haarlem spoligotypes, while the largest spoligotype SIT283 / H1 included 43 isolates (4.7%), all of which were resistant (Pole et al., 2020). It is possible that certain ethnic groups are more susceptible to infection and disease with TB due to Haarlem strains (Vyazovaya et al., 2020; Smit et al., 2013; Pichat et al., 2016; van Nimwegen, 2002).

[0005] Overall, it appears that identifying strains of the Haarlem genotype of M. tuberculosis is an urgent public health task.

[0006] It is known that strains of this genotype can be identified using spoligotyping, which yields a characteristic profile for Haarlem strains with a marker deletion of signal 31, along with a deletion of signals 33-36, characteristic of the entire Lineage 4 (Demay et al., 2012) (Fig. 1A). However, there are also questionable derivative profiles with large blocks of deleted signals, which make it impossible to judge the genotype of the strain. Such profiles are defined at the genetic family level as "unknown" in the international SITVIT2 database http: / / www.pasteur-guadeloupe.fr:8081 / SITVIT2 / (for examples, see Fig. 1B). It is also possible to identify Haarlem strains by identifying a mutation in the Rv0282 gene at position 211C>T (Shitikov, Bespyatykh, 2023) using fragment sequencing of this gene or whole-genome sequencing. However, spoligotyping is not reliable, and both methods (spoligotyping and sequencing) are technically complex and time-consuming.

[0007] The objective of the proposed invention is to develop a method for rapid, simple and reliable detection of the Haarlem genotype of M. tuberculosis.

[0008] A mutation marker for the Haarlem genotype was previously described at genomic position 342340 C>T, i.e., in the Rv0282 gene at position 211C>T. It was shown that among existing strains, there are only two alleles at this position: C (all genotypes except Haarlem) or T (Haarlem) (Shitikov, Bespyatykh, 2023). It should be noted that this mutation disrupts the recognition site of the HhaI restriction endonuclease GCGC (Fig. 2). To detect this mutation, we designed primers and developed a detection method using polymerase chain reaction followed by treatment with HhaI restriction enzyme and separation of restriction products in agarose gel (PCR-RFLP [polymerase chain reaction - restriction fragment length polymorphism] method) (Fig. 2, 3).

[0009] The objective is achieved by identifying a mutation in the Rv0282 gene at position 211 C>T using PCR using oligonucleotide primers 5'-TGACATTGGCATGGTGGCCG, indicated in the sequence listing as SEQ ID NO: 1, and 5'-CGAGGCGGCTTCCAGCAC, SEQ ID NO: 2, followed by treatment of the PCR product (256 nucleotide pairs [bp]) with restriction endonuclease HhaI and electrophoresis of the restriction products in agarose gel, wherein in the case of the Rv0282 211-T mutation, specific for the Haarlem genotype, a 256 bp fragment is observed, and in the case of the wild allele Rv0282 211-C, two 166 bp fragments are observed. and 90 bp and judge whether the strain belongs to any other genotype of M. tuberculosis.

[0010] Two restriction variants are easily distinguishable by agarose gel electrophoresis even with a short electrophoresis time and a short gel length, which is convenient in practice (Fig. 3).

[0011] The technical result of using the claimed invention is: 1. speed (less than one day from the moment of DNA isolation); 2. simple and unambiguous interpretation of the results; 3. the possibility of analyzing large collections of M. tuberculosis strains to assess their belonging to the Haarlem genotype for diagnostic purposes and in population studies.

[0012] The invention is explained by drawings, where Fig. 1. - Schematic spoligotyping profiles based on hybridization analysis of 43 spacers in the DR / CRISPR locus of M. tuberculosis. A. The main ancestral spoligotypes of the Haarlem genotype. B. Undetectable profiles with long blocks of deleted signals ("unknown genotype", according to the SITVIT2 resource). Black and white squares in the profile schematically show the presence and absence of a signal, respectively. SIT - spoligotype international type, international spoligotyping type, according to the SITVIT2 database http: / / www.pasteur-guadeloupe.fr:8081 / SITVIT2 / .

[0013] Fig. 2 - Schematic representation of the Rv0282 gene fragment. Mutation at position 211 C>T, specific for the Haarlem genotype of Mycobacterium tuberculosis. Position 211-C, where the C>T mutation inactivates the HhaI restriction site GCGC (shown in bold), is highlighted in capital letters. Oligonucleotide primers are indicated by short arrows. Thin double-headed arrows indicate the PCR product (256 bp) and restriction fragments of 90 bp and 166 bp (in the presence of the HhaI restriction site).

[0014] Fig. 3 - PCR-RFLP detection of substitution in the Rv0282 gene at position 211C>T. Agarose gel electrophoresis. Lanes 1,2,4,5,8 - M. tuberculosis strains with a mutation at this position (Haarlem genotype), which are characterized by one fragment of 256 bp; lanes 3,6,7 - M. tuberculosis strains of other genotypes (Beijing, LAM, Ural, respectively) with the wild-type allele, the length of two fragments is 90 bp and 166 bp. Molecular weight marker - "DNA marker Step100" (BioLabMix). Long arrows on the right are marker fragments of restriction of Haarlem strains (256 bp) and strains of other genotypes of M. tuberculosis (90 bp and 166 bp). Short arrows on the left are the main fragments of the molecular weight marker, bp - nucleotide pairs.

[0015] Fig. 4 - Detection of the Haarlem genotype by the developed PCR-RFLP method of the Rv0282 gene in strains with truncated spoligotyping profiles and not detectable at the genetic family level (defined as "unknown genotypes" in the SITVIT2 spoligotyping database http: / / www.pasteur-guadeloupe.fr:8081 / SITVIT2 / ). Black and white squares in the profile schematically show the presence and absence of a signal, respectively. SIT - spoligotype international type, international spoligotyping type according to the SITVIT2 database. A. Strains from Russia. B. Strains from Belarus.

[0016] The method is as follows.

[0017] DNA extraction from M. tuberculosis culture grown on Lowenstein-Jensen medium is carried out according to van Embden et al. (1993): 1 standard bacteriological loop of the culture is suspended in 400 µl of TE x1 buffer and incubated for 20 min at 85°C. Further processing is carried out using lysozyme, proteinase K, sodium dodecyl sulfate and cetyltrimethylammonium bromide. The resulting cell lysate is treated with a mixture of phenol-chloroform-isoamyl alcohol (25:24:1), centrifuged, precipitated with isopropanol, washed with 70% ethanol, the precipitate is dried and dissolved in 30-50 µl of TE x1.

[0018] The following self-designed primers were used to carry out the PCR reaction: 5'-TGACATTGGCATGGTGGCCG and 5'-CGAGGCGGCTTCCAGCAC (Fig. 2). Purified DNA (0.1-0.5 μl) was added to the PCR mixture (final volume 30 μl) containing 1 mM MgCl2, 0.5 U Taq DNA polymerase, 100 μM of each dNTP, primers (10 pmol each). PCR was carried out in a thermal cycler under the following temperature regime: 95°C, 4 min, 40 cycles of 95°C, 40 s; 67°C, 20 s, 72°C, 20 s and a final extension at 72°C, 5 min. The presence of a 256-bp PCR product is assessed by electrophoresis in a 1.5% agarose gel, stained with ethidium bromide, and visualized with a UV transilluminator. The molecular weight marker is "Step100 DNA Marker" (BioLabMix) or similar.

[0019] Then the PCR product is treated with the HhaI restriction enzyme as follows. Restriction is performed in a microtube placed in a thermal cycler or a water bath for 3 hours at 37°C in a volume of 10 microliters (5 µl of the PCR product, 2 units of restriction enzyme, and 1 µl of 10x buffer for this restriction enzyme). The restriction products are separated by electrophoresis in a 1.5% agarose gel (standard agarose, for example, agarose SYS-Q0009-0.1 (Helicon, Moscow)), stained with ethidium bromide, and visualized on a UV transilluminator. Molecular weight marker - "DNA marker Step100" (BioLabMix) or similar.

[0020] Result evaluation. In the case of the wild-type allele, two fragments of 90 bp and 166 bp are observed, and in the case of the Rv0282 mutation at position 211C>T (specific for the Haarlem genotype), the presence of one fragment of 256 bp in length is observed (Fig. 3).

[0021] The method was optimized using DNA from strains with a known Rv0282 gene sequence for which whole-genome sequencing data had previously been obtained: strain 338-b, belonging to the Haarlem genotype, strain Beijing 5582 genotype, and reference strain H37Rv, genotype L4.9 (accession numbers SAMN48801825, SRR32263914, and SRR18572457, respectively, in the Sequence Read Archive of the National Center for Biotechnology Information). The method was then tested on DNA collections of clinical M. tuberculosis isolates representing areas with different pathogen populations and different proportions of Haarlem genotype strains, as shown in the examples below. All isolates were previously genotyped using spoligotyping.

[0022] Examples of application of the method for detecting the Haarlem genotype of M. tuberculosis.

[0023] Example 1. Detection of the Haarlem genotype using the developed PCR-RFLP method in M. tuberculosis isolates in the M. tuberculosis DNA collection from the regions of Northwest Russia.

[0024] The study included M. tuberculosis DNA samples from the Novgorod and Pskov regions (n=63). DNA was genotyped using spoligotyping, followed by comparison with the SITVIT2 resource, and VNTR typing.

[0025] Next, the DNA of all strains was tested using the proposed PCR-RFLP method to identify Haarlem strains. In this example, as in those described below, DNA from the H37Rv strain (wild-type allele) and DNA from the sequenced strain 338-b, isolated in Pskov in 2015 (spoligotype SIT49 of the Haarlem genotype according to the international SITVIT2 database), were used as controls. Unambiguous results were obtained for all tested strains. Twenty-nine strains were assigned to the Haarlem genotype by both methods (spoligotyping and PCR-RFLP). According to spoligotyping, 5 strains had truncated spoligotyping profiles and were defined at the genetic family level as "unknown genotype." The application of the developed method allowed us to resolve the question of the phylogenetic status of these five strains, assigning them to the Haarlem genotype (Fig. 4A). This demonstrates the merit of our method, which successfully resolved the question of the phylogenetic status of strains with truncated spoligotyping profiles.

[0026] Example 2. Detection of the Haarlem genotype by the developed PCR-RFLP method in M. tuberculosis isolates in the M. tuberculosis DNA collection from Belarus.

[0027] The study included mycobacterial DNA samples from Belarus (n=35). The DNA was spoligotyped and compared with the SITVIT2 resource.

[0028] Unambiguous results (either Haarlem or another genotype) were obtained for all samples studied. Based on spoligoprofiles, only one strain in the Belarusian sample was identified as Haarlem (the prototype spoligotype SIT50) and six strains as Unknown (Fig. 4B). However, the PCR-RFLP method assigned all seven of these strains to the Haarlem genotype.

[0029] Examples 1 and 2 show that the actual proportion of the Haarlem genotype in M. tuberculosis populations in Northwest Russia and Belarus is higher than previously thought.

[0030] Example 3. Detection of the Haarlem genotype in M. tuberculosis isolates in a M. tuberculosis DNA collection from Vietnam, a region with low circulation of Euro-American lineage strains in general and Haarlem strains in particular.

[0031] The study included mycobacterial DNA samples from Vietnam (n=36). The DNA was spoligotyped and compared with the SITVIT2 resource.

[0032] The application of the developed PCR-RFLP method revealed 1 strain of the Haarlem genotype (classical spoligotype SIT50) in the studied strains, which was consistent with the results of spoligotyping.

[0033] Literature

[0034] Vyazovaya A.A., Lebedeva I.A., Ushakova N.B., Pavlov V.V., Gerasimova A.A., Solovieva N.S., Zhuravlev V.Yu., Narvskaya O.V. Molecular genetic analysis of the Mycobacterium tuberculosis population in the Vologda Oblast - a region with a low incidence of tuberculosis / / Infection and immunity. - 2021. - Vol. 11. - No. 3. - P. 497-505.

[0035] Vyazovaya A.A., Gavrilova N.Yu., Gerasimova A.A., Bychkova A.O., Avadeniy I., Anikieva E.V., Solovieva N.S., Zhuravlev V.Yu., Mokrousov I.V., Narvskaya O.V. Molecular genetic monitoring of the Mycobacterium tuberculosis population in the Murmansk region. Molecular Genetics, Microbiology and Virology. 2022; 40(2):21-27.

[0036] Umpeleva T.V., Kravchenko M.A., Eremeeva N.I., Vyazovaya A.A., Narvskaya O.V. Molecular genetic characteristics of Mycobacterium tuberculosis strains circulating in the Ural region of Russia / / Infection and immunity. - 2013. - V. 3. - No. 1. - P. 21-28.

[0037] Ashton RM, Cha J, Anscombe C, Thuong NTT, Thwaites GE, Walker TM. Distribution and origins of Mycobacterium tuberculosis L4 in Southeast Asia. Microb Genom. Feb 2023; 9(2):mgen000955.

[0038] Brudey K, Driscoll JR, Rigouts L, Prodinger WM, Gori A, Al-Hajoj SA, Allix C, Aristimuno L, Arora J, Baumanis V, et al. Mycobacterium tuberculosis complex genetic diversity: mining the fourth international spoligotyping database (SpolDB4) for classification, population genetics and epidemiology. BMC Microbiol. 2006;6:23. doi: 10.1186 / 1471-2180-6-23.

[0039] Couvin D, David A, Zozio T, Rastogi N. Macro-geographical specificities of the prevailing tuberculosis epidemic as seen through SITV1T2, an updated version of the Mycobacterium tuberculosis genotyping database. Infect Genet Evol. 2019;72:31-43. doi: 10.1016 / j.meegid.2018.12.030.

[0040] Demay C, Liens B, Burguiere T, Hill V, Couvin D, Millet J, Mokrousov I, Sola C, Zozio T, Rastogi N. SITVITWEB--a publicly available international multimarker database for studying Mycobacterium tuberculosis genetic diversity and molecular epidemiology. Infect Genet Evol. 2012;12:755-66. doi: 10.1016 / j.meegid.2012.02.004.

[0041] Gagneux S. Ecology and evolution of Mycobacterium tuberculosis. Nat Rev Microbiol. Rev. 2018;16:202–2 doi:10.1038 / nrmicro.2018.8.

[0042] Mardassi H, Namouchi A, Haltiti R, Zarrouk M, Mhenni B, Karboul A, Khabouchi N, Gey van Pittius NC, Streicher EM, Rauzier J, Gicquel B, Dellagi K. Tuberculosis due to resistant Haarlem strain, Tunisia. Emerg Infect Dis. 2005;11:957–61. doi: 10.3201 / eid1106.041365.

[0043] Mokrousov I, Shitikov E, Skiba Y, Kolchenko S, Chemyaeva E, Vyazovaya A. Emerging peak on the phylogeographic landscape of Mycobacterium tuberculosis in West Asia: Definite smoke, likely fire. Mol Phylogenet Evol. 2017;116:202–212.

[0044] Pasechnik O, Vyazovaya A, Vitriv S, Tatarintseva M, Blokh A, Stasenko V, Mokrousov I. Major genotype families and epidemic clones of Mycobacterium tuberculosis in Omsk region, Western Siberia, Russia, marked by a high burden of tuberculosis-HIV coinfection. Tuberculosis (Edinb). 2018;108:163-168. doi: 10.1016 / j.tube.2017.12.003.

[0045] Pichat C, Couvin D, Carret G, Frédénucci I, Jacomo V, Carricajo A, Boisset S, Dumitrescu O, Flandrois JP, Lina G, Rastogi N. Combined Genotypic, Phylogenetic, and Epidemiologic Analyses of Mycobacterium tuberculosis Genetic Diversity in the Rhone Alpes Region, France. PLoS One. 2016;ll:e0153580.

[0046] Pole I, Trofimova J, Norvaisa I, Supply P, Skenders G, Nodieva A, Ozere I, Riekstina V, Igumnova V, Storozenko J, Jansone I, Viksna L, Ranka R. Analysis of Mycobacterium tuberculosis genetic lineages circulating in Riga and Riga region, Latvia, isolated between 2008 and 2012. Infect Genet Evol. 2020;78:104126.

[0047] Reiling N, Homolka S, Walter K, Brandenburg J, Niwinski L, Ernst M, Herzmann C, Lange C, Diel R, Ehlers S, Niemann S. Clade-specific virulence patterns of Mycobacterium tuberculosis complex strains in human primary macrophages and aerogenically infected mice. mBio. 2013;4:e00250-13. doi: 10.1128 / mBio.00250-13.

[0048] Shitikov E, Bespiatykh D. A revised SNP-based barcoding scheme for typing Mycobacterium tuberculosis complex isolates. mSphere. 2023 Jun 14:e0016923.

[0049] Smit PW, Haanperä M, Rantala P, Couvin D, Lyytikäinen O, Rastogi N, Ruutu P, Soini H. Molecular epidemiology of tuberculosis in Finland, 2008-2011. PLoS One. 2013;8:e85027.

[0050] Stucki D, Brites D, Jeljeli L, Coscolla M, Liu Q, Trauner A, Fenner L, Rutaihwa L, Borrell S, Luo T, Gao Q, Kato-Maeda M, Ballif M, Egger M, Macedo R, Mardassi H, Moreno M, Tudo Vila G, G, J, Glo, M, Thomas Jamieson F, Guthrie JL, Asante-Poku A, Yeboah-Manu D, Wampande E, Ssengooba W, Joloba M, Henry Boom W, Basu 1, Bower J, Saraiva M, Vaconcellos SEG, Suffys P, Koch A, Wilkinson R, Gail-Bekker L, Malla B, Ley SD, Beck HP, Toit VS, VS, VS Sanchez-Padilla E, Bonnet M, Gil-Brusola A, Frank M, Penlap Beng VN, Eisenach K, Alani I, Wangui Ndung'u P, Revathi G, Gehre F, Akter S, Ntoumi F, Stewart-Isherwood L, Ntinginya NE, Rachow A, Hoelscher M, Ciri Skenders, Skenders, GDM, Bakonders, D.D. Stakenas P, Diel R, Crudu V, Moldovan O, Al-Hajoj S, Otero L, Barletta F, Jane Carter E, Diero L, Supply P, Comas I, Niemann S, Gagneux S. Mycobacterium tuberculosis lineage 4 comprises globally distributed and geographically restricted sublineages. Nat Genet. 2016;48:1535-1543.

[0051] van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B, Hermans P, Martin C, McAdam R, Shinnick TM, Small P. Strain identification of Mycobacterium tuberculosis by DNA Hngerprinting: recommendations for a standardized methodology. J Clin Microbiol. 1993 Feb; 31(2):406-9. doi: 10.1128 / jcm.31.2.406-409.1993.

[0052] van Nimwegen N. 2002. "The Demographic History of the Dutch in the East Indies". Nederlands Interdisciplinair Demografisch Instituut Vyazovaya A, Proshina E, Gerasimova A, Avadenii I, Solovieva N, Zhuravlev V, Narvskaya O, Mokrousov I. Increased transmissibility of Russian successful strain Beijing B0 / W148 of Mycobacterium tuberculosis: Indirect clues from history and demographics. Tuberculosis (Edinb). 2020;122:101937. doi: 10.1016 / j.tube.2020.101937.

[0053] Zenteno-Cuevas R, Munro-Rojas D, Perez-Martinez D, Fernandez-Morales E, Jimenez-Ruano AC, Montero H, Escobar L, de Igartua E, Trigos A, Fuentes-Dominguez J. Genetic diversity and drug susceptibility of Mycobacterium tuberculosis in a city with a high prevalence of drug resistant tuberculosis from Southeast of Mexico. BMC Infect Dis. 2021 Nov 30;21(1):1202.

[0054] Zhdanova S, Mokrousov I, Orlova E, Sinkov V, Ogarkov O. Transborder molecular analysis of drug-resistant tuberculosis in Mongolia and Eastern Siberia, Russia. Transbound Emerg Dis. 2022 Sep;69(5):e1800-e1814.

[0055] --->

[0056] <?xml version="1.0" encoding="UTF-8"?>

[0057] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0058] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0059] <ST26SequenceListing dtdVersion="V1_3" fileName="Способ детекции

[0060] генотипа Haarlem Mycobacterium tuberculosis.xml" softwareName="WIPO

[0061] Sequence" softwareVersion="2.3.0" productionDate="2025-06-03">

[0062] <applicantfilereference> 1< / applicantfilereference>

[0063] <applicantname languagecode="ru">Federal State

[0064] Budgetary institution "St. Petersburg Research

[0065] Institute of Phthisiopulmonology of the Ministry of Health of the Russian Federation

[0066] Federation (FSBI "St. Petersburg Research Institute of Physiology" of the Ministry of Health of the Russian Federation)< / applicantname>

[0067] <applicantnamelatin>Federal State Budgetary Institution "St.

[0068] Petersburg Research Institute of Phthisiopulmonology" of the

[0069] Ministry of Health of the Russian Federation (FSBI "SPb

[0070] NIIF" of the Ministry of Health of Russia)< / applicantnamelatin>

[0071] <inventiontitle languagecode="ru">Method for detecting the Haarlem genotype

[0072] Mycobacterium tuberculosis< / inventiontitle>

[0073] <sequencetotalquantity> 2< / sequencetotalquantity>

[0074] <sequencedata sequenceidnumber="1">

[0075] <insdseq>

[0076] <INSDSeq_length> 20< / INSDSeq_length>

[0077] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0078] <INSDSeq_division> PAT< / INSDSeq_division>

[0079] <INSDSeq_feature-table>

[0080] <insdfeature>

[0081] <INSDFeature_key>source< / INSDFeature_key>

[0082] <INSDFeature_location>1..20< / INSDFeature_location>

[0083] <INSDFeature_quals>

[0084] <insdqualifier>

[0085] <INSDQualifier_name>PCR_primers< / INSDQualifier_name>

[0086] <INSDQualifier_value>fwd_name: 342340F1, fwd_seq:

[0087] tgacattggcatggtggccg, rev_name: 342340R1, rev_seq:

[0088] cgaggcggcttccagcac< / INSDQualifier_value>

[0089] < / insdqualifier>

[0090] <insdqualifier>

[0091] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0092] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0093] < / insdqualifier>

[0094] <insdqualifier id="q2">

[0095] <INSDQualifier_name>organism< / INSDQualifier_name>

[0096] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0097] < / insdqualifier>

[0098] < / INSDFeature_quals>

[0099] < / insdfeature>

[0100] < / INSDSeq_feature-table>

[0101] <INSDSeq_sequence> tgacattggcatggtggccg< / INSDSeq_sequence>

[0102] < / insdseq>

[0103] < / sequencedata>

[0104] <sequencedata sequenceidnumber="2">

[0105] <insdseq>

[0106] <INSDSeq_length> 18< / INSDSeq_length>

[0107] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0108] <INSDSeq_division> PAT< / INSDSeq_division>

[0109] <INSDSeq_feature-table>

[0110] <insdfeature>

[0111] <INSDFeature_key>source< / INSDFeature_key>

[0112] <INSDFeature_location>1..18< / INSDFeature_location>

[0113] <INSDFeature_quals>

[0114] <insdqualifier>

[0115] <INSDQualifier_name>PCR_primers< / INSDQualifier_name>

[0116] <INSDQualifier_value>fwd_name: 342340F1, fwd_seq:

[0117] tgacattggcatggtggccg, rev_name: 342340R1, rev_seq:

[0118] cgaggcggcttccagcac< / INSDQualifier_value>

[0119] < / insdqualifier>

[0120] <insdqualifier>

[0121] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0122] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0123] < / insdqualifier>

[0124] <insdqualifier id="q4">

[0125] <INSDQualifier_name>organism< / INSDQualifier_name>

[0126] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0127] < / insdqualifier>

[0128] < / INSDFeature_quals>

[0129] < / insdfeature>

[0130] < / INSDSeq_feature-table>

[0131] <INSDSeq_sequence> cgaggcggcttccagcac< / INSDSeq_sequence>

[0132] < / insdseq>

[0133] < / sequencedata>

[0134]

[0135] <---

Claims

A method for detecting the Haarlem genotype of Mycobacterium tuberculosis, characterized in that a nucleotide substitution in the Rv0282 gene at position 211C>T, specific for the given genotype, is detected using a polymerase chain reaction using oligonucleotide primers SEQ ID NO: 1 and SEQ ID NO: 2, followed by treatment of the PCR product with the restriction endonuclease HhaI and electrophoresis of the restriction products in an agarose gel, wherein in the case of a mutation in the Rv0282 gene at position 211C>T, specific for the Haarlem genotype of M. tuberculosis, the presence of a marker fragment of 256 nucleotide pairs in length is observed, and in the presence of two restriction fragments of 90 nucleotide pairs and 166 nucleotide pairs in length, the strain is judged to belong to any other genotype of M. tuberculosis.

Images