Preimplantation genetic testing method for autosomal dominant polycystic kidney disease

Abstract

FIELD: biotechnology.SUBSTANCE: method for preimplantation genetic testing of autosomal dominant polycystic kidney disease is proposed. The method involves identifying the inheritance of the pathogenic variant NC_000016.9:2140552G>A (NM_001009944.2:c.12178C>T, p.Gln4060Ter) in the PKD1 gene using a dual detection system, including direct and indirect detection. During the development of the test system, high specificity and efficiency were demonstrated, as well as versatility in relation to various types of biological samples. The method can be used not only for the detection of a specific pathogenic variant, but also for any other pathogenic variant or several in the PKD1 gene using indirect detection.EFFECT: invention may find application in preimplantation genetic testing for families at high risk of developing autosomal dominant polycystic kidney disease in future children.1 cl, 2 tbl, 1 ex

Description

[0001] The invention relates to preimplantation genetic testing for monogenic diseases. Currently, more than 350 million people worldwide suffer from a rare disease (according to the RARE Project). The total number of such diseases, according to estimates by the European Organization for Rare Diseases (EURORDIS), ranges from 5,000 to 7,000. Approximately 80% of rare diseases have a genetic cause. Knowing the genetic basis of a disease allows for a highly accurate prediction not only of the health of an already born child but also to assess the risk of having such a child by analyzing the parents' genotypes, as well as to conduct genetic diagnosis at the earliest stages. Preimplantation genetic testing (PGT) for monogenic diseases is becoming a powerful tool for the prevention of such diseases.

[0002] The present invention relates to a method for preimplantation genetic testing for autosomal dominant polycystic kidney disease. Autosomal dominant polycystic kidney disease is a hereditary disorder affecting the kidneys. Autosomal dominant polycystic kidney disease occurs with a frequency of approximately 1 in 1,000. This disease leads to the development of multiple cysts in the renal parenchyma, leading to renal failure, high blood pressure, lumbar pain, and infections. Hematuria may occasionally occur due to cyst rupture. Extrarenal manifestations of the disease are also present, including liver cysts, heart valve defects, and arterial aneurysms in various locations. Symptoms of the disease typically appear between the ages of 30 and 40. With an autosomal dominant type of inheritance of the disease, the probability of having a child with this disease in a family is 50%.

[0003] Autosomal dominant polycystic kidney disease can be caused by pathogenic genetic variants in the PKD1 gene, located on chromosome 16. [Cornec-Le Gall et al. 2019. The Lancet, 393(10174), 919-935.] This gene encodes the protein polycystin-1, which is expressed by renal tubular epithelial cells, as well as in other tissues such as the heart, glands, and liver. This protein is involved in the regulation of fluid flow and pressure in the kidneys.

[0004] PGT for autosomal dominant polycystic kidney disease is performed for families with a confirmed molecular genetic cause of the disease. It is important to note that the pathogenicity and causativity of genetic variants is determined before PGT for a monogenic disease and is not included in the goals and objectives of PGT for monogenic diseases, nor in the complex of measures for performing PGT for monogenic diseases. Pathogenicity is assessed according to the international standard—the criteria described in 2015 by the American College of Medical Genetics and Genomics (Association for Molecular Pathology (ACMG-AMP)) during the search for the molecular genetic cause of the disease. PGT is recommended for families with a high risk of having a child with a severe (incurable) hereditary disease with an identified pathogenic variant that determines this risk.PGT allows you to select from all the embryos obtained during IVF (in vitro fertilization) embryos without a pathogenic variant and, therefore, without the risk of developing a disease.

[0005] The main challenge in embryo genetic diagnosis is the small initial amount of biomaterial, as each biopsy contains only one to three cells. In this case, to improve the efficiency and accuracy of the analysis, it is important to completely eliminate the possibility of contamination and mitigate the potential effects of uneven and / or incomplete amplification, as well as biomaterial degradation. This requires the development of a test system with specific characteristics. The test system is designed to accommodate various types of biomaterial—total deoxyribonucleic acid (DNA) isolated from various tissues, whole genome amplification (WGA) products, and single cells.The combination of versatility in biomaterial selection and step-by-step amplification of target fragments enables the analysis of multiple pathogenic variants in a single sample, including on single cells, and the detection of incomplete amplification, contamination, or sample degradation. Another feature of PGT is the lack of information about the embryo's biological characteristics: unlike an adult, an embryo may have any chromosomal abnormalities, which complicates the assessment of the embryo's status for a specific genetic variant. Therefore, a test system for PGT of a monogenic disease must be able to identify such cases and assess their impact on the reliability of the diagnostic result.

[0006] The closest technical solution is the PGT of autosomal dominant polycystic kidney disease proposed by Murphy, E. L. and colleagues [Murphy, E. L. et al, 2008. Am J Kidney Dis. XX(XX): 1-7] for the detection of mutations in the PKD1 gene in embryonic biopsy material, using direct and indirect diagnostics by analyzing the inheritance of alleles of four polymorphic markers linked to a pathogenic variant. Such a number of markers does not allow achieving high information content and versatility of the test system. An important advantage of the approach we propose is the use of a larger number of polymorphic markers for indirect diagnostics - 19 in total - which reduces the likelihood of an unreliable result due to allele loss or recombination.

[0007] The presented method of PGT for autosomal dominant polycystic kidney disease solves the problem of developing a more accurate method of preimplantation genetic testing of this monogenic disease without the use of expensive devices and reagents, which could be used on various types of biomaterial: DNA isolated from different tissues, the product of whole genome amplification (WGA), single cells.

[0008] The technical result was the creation of a test system for the diagnosis of a pathogenic variant (the nucleotide number in the reference sequence of genomic DNA is designated by the prefix NC, the nucleotide number in the reference sequence of the coding transcript is designated by the prefix NM): NC_000016.9:2140552G>A (NM_001009944.2:c.l2178C>T, p.Gln4060Ter) in the PKD1 gene with a dual detection system - direct and indirect. This variant was previously described in the literature as the cause of autosomal dominant polycystic kidney disease. [Wu, G., & Somlo, S. (2000). Mol. Genet. Metab. 69(1), 1-15.] A dual detection system is necessary when working with small amounts of biomaterial, since unstable amplification can lead to loss of information or reduced accuracy of the analysis. Direct diagnostics involves analyzing the presence or absence of a pathogenic variant directly. In this case, for the genetic variant NC_000016.9:2140552G>A (NM_001009944.2:c.12178C>T, p.Gln4060Ter) of the single nucleotide polymorphism (SNP) type.Restriction endonucleases were selected for the single nucleotide polymorphism (SNP) gene, enabling detection of the pathogenic variant using PCR-RFLP (restriction fragment length polymorphism), based on sequence differences at the restriction site between different alleles. Indirect diagnostics involve analyzing the inheritance of molecular genetic markers linked to the mutation, i.e., inherited along with it. For this purpose, polymorphic loci, called STRs (short tandem repeats), were selected within 3 MB of the PKD1 gene in each direction (corresponding to an average of 3% crossing over) with a heterozygosity of at least 0.70 to ensure maximum informativeness of indirect diagnostics. STRs are repeats of two or more nucleotides located one after the other (for example, the adenine-cytosine (AC) pair, repeated several times in a row: ACACACACA) and are present in large quantities in the human genome.The number of repeats in each of these markers can vary from individual to individual and can also differ in the same person on two homologous chromosomes. Heterozygosity above 0.70 indicates a high probability that in the same person, the number of nucleotide repeats in a given STR on one chromosome will differ from the number of repeats in the same STR on the homologous chromosome. In other words, the alleles of a given marker in this individual will differ in length. Amplification of a fragment containing such a marker will produce amplicons of two different lengths. By analyzing the number of repeats in several markers surrounding a pathogenic variant and studying their inheritance in the tested family, it is possible to establish linkage between the marker alleles and the pathogenic variant.The diagnostic value of studying the number of repeats in these markers in embryos is that the allele of each marker inherited by the embryo can be used to determine whether the embryo has inherited a PKD1 gene carrying a pathogenic variant or whether it has inherited a PKD1 gene from another, homologous chromosome that does not contain the pathogenic variant. For each of these loci, primers were selected for amplification using nested or semi-nested PCR in two rounds, increasing the accuracy and efficiency of amplification. The test system included 20 STR loci for the PKD1 gene: D16S0.52, D16S0.56, D16S1.29, D16S1.43, D16S3024, D16S1.83, D16S1.95, D16S2.28, D16S2.34, D16S2.4, D16S2.51, D16S2.71, D16AAT30.3, D16S3070, D16S3082.1, D16S3082.2, D16A4T32.0, D16AAGG32.2, D16S2618, D16AC33.3. The primers for amplification are located on chromosome 16 in the region of coordinates 522246-3280278 (according to hg19).The primer sequences for amplifying DNA fragments containing the listed STR loci are specified in the claims in the list of SEQ ID NOs 1-64. It is important to note that a number of special requirements were observed during the selection of primers: the length of the product with external primers for the first round of PCR should not exceed 500 bp (for production from fragments obtained during whole-genome amplification), the length of the product with internal primers for the second round of PCR should be from 120 to 350 bp, high specificity of external primers, and the annealing temperature should not differ by more than 1°C.

[0009] Preparatory stage of the urban-type settlement

[0010] The preparatory stage involves testing the test system: selecting amplification conditions optimal for primer performance, analyzing the efficiency and specificity of PCR amplification in both rounds, and assessing the test system's versatility for various biosample types (DNA, WGA product, single cells). During the test system testing, stock primer dilutions with a concentration of 100 mM and working dilutions of primer combinations (a combination of primer pairs for rounds 1 and 2 of the PCR) were prepared with a concentration of 10 mM of each primer in solution.Since various types of matrices can be used in the diagnostics of clinical material, two biopsies of single cells in a special lysis buffer (1×PCR Buffer, 0.1% Tween-20, 0.1% Triton X-100, 1 μg Proteinase K), two samples of whole-genome amplification products of embryo biopsies (WGA), as well as total DNA of family members isolated from blood were used in the development of the test system to compile a pedigree and identify the linkage of a pathogenic variant with the alleles of polymorphic markers.

[0011] In nested and semi-nested PCR, amplification is performed in two stages. In the first stage, multiplex PCR is performed with all external primers for all loci included in the test system to enrich the sample with all target fragments. In the second stage, each fragment is individually amplified with internal primers.

[0012] Semi-nested PCR

[0013] For the first stage, external highly specific primers were selected for amplifying fragments from 300 to 500 bp. For the second stage, primers were selected for amplifying fragments no longer than 350 base pairs, and labels for detection by fragment analysis were introduced. The primer sequences for amplifying DNA fragments containing STR loci are listed in the claims in SEQ ID NOs 1-64. The PCR mixture for the first round of amplification contained 1xPCR buffer with Mg2+ (Eurogen, Russia), 0.1 mM of each deoxynucleotide, 0.15 μM of each primer, 2.5 U / μl HsTaq DNA polymerase (Eurogen, Russia), 6% dimethyl sulfoxide (DMSO), and 1 μl of total DNA or 2.5 μl of WGA or 5 μl of lysis buffer with the sample as a template. The first round of amplification was carried out according to the following protocol: denaturation step at 94°C for 2 minutes, 30 cycles with a decrease in the annealing temperature of the primers from 62 to 45°C in each cycle, a step for extension of all templates at 72°C for 10 minutes.Next, the products of the first stage were distributed into individual test tubes with one pair of primers for a specific locus.

[0014] The PCR mixture for the second stage included 1xPCR buffer with Mg2+ (Eurogen, Russia), 0.5xRediLoad™ loading buffer (Thermo Fisher Scientific, USA), 0.2 mM of each deoxynucleotide, 0.2 μM of each primer, 1 U / μl HsTaq DNA polymerase (Eurogen, Russia), 6% dimethyl sulfoxide (DMSO), and 1 μl of the PCR product from the first stage of amplification as a template. The second stage of amplification was carried out according to the following protocol: denaturation stage at 95°C for 2 minutes, 35 cycles: denaturation at 95°C for 30 seconds, primer annealing at 57°C for 30 seconds, template synthesis at 72°C for 1 minute, stage of extension of all templates at 72°C for 5 minutes. Evaluation of amplification efficiency and specificity was performed using 2% agarose gel electrophoresis. The agarose gel electrophoresis results allow one to determine the required dilution of the amplification products for fragment analysis (DNA amplification products from family members).

[0015] Fragment analysis of the amplification products was performed using capillary electrophoresis on a 3130x1 Genetic Analyzer (Applied Biosystems, USA). Based on the fragment analysis results, a pedigree is compiled and informative polymorphic STR loci are identified for each family, which will subsequently be used in clinical diagnostics. Loci are categorized as non-informative (the carrier of the pathogenic variant is homozygous for this locus), semi-informative (the alleles for this marker are the same on some parental chromosomes), and informative (the alleles for this marker are different on all parental chromosomes, allowing each of them to be distinguished during embryo genotype analysis).

[0016] Polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP)

[0017] Restriction fragment length polymorphism (RFLP) is a method for studying genomic DNA by specifically cleaving DNA with restriction endonucleases and then analyzing the sizes of the resulting fragments (restrictions) by gel electrophoresis. This method produces fragments of varying lengths depending on differences in the nucleotide sequence at the restriction site, enabling the detection of single-nucleotide variants if they are located at the restriction site. Sanger sequencing can provide more accurate detection of pathogenic variants; however, in the context of PGT, PCR-RFLP is more effective due to the reduced probability of allele dropout (ADO) and, consequently, an erroneous result in assessing the embryo's status for a pathogenic variant.

[0018] A PCR-RFLP-based assay was developed to detect the pathogenic variant NC_000016.9:2140552G>A (NM_001009944.2:c.12178C>T, p.Gln4060Ter). The amplification step is described in detail in the previous section. The following primers were used:

[0019] External primers:

[0020] Straight: 5'-CTCCACCATCTCGTAGTCCT-3'

[0021] Reverse: 5 '-AGCAGACAGATTTCTCGTCC-3'

[0022] Internal primers:

[0023] Straight: 5'-TCCACCATCTCGTAGTCCT-3'

[0024] Reverse: 5'-GGGAGGGCGTCTTAGC-3'

[0025] The amplification products from the internal primers for detection of the pathogenic variant were then used in a restriction reaction. Endonuclease cleaves only the wild-type allele, while the endonuclease cleaves only the mutant allele of the NC_000016.9:2140552G>A (NM_001009944.2:c.12178C>T, p.Gln4060Ter) variant. Detection was performed by electrophoresis in a 12% polyacrylamide gel.

[0026] Example 1

[0027] Patients A

[0028] Family A contacted CGRM Genetiko. The wife and her child from a previous marriage suffer from autosomal dominant polycystic kidney disease with heterozygous carriage of the pathogenic variant NC_000016.9:2140552G>A (NM_001009944.2:c.12178C>T, p.Gln4060Ter) in the PKD1 gene. The couple was recommended to undergo PGT for autosomal dominant polycystic kidney disease as part of IVF to select embryos that have not inherited the disease.

[0029] Family haplotyping

[0030] In the first stage, biomaterial (peripheral blood) was obtained from family members to detect the pathogenic variant and identify linkage groups of polymorphic marker alleles. Twenty STR loci were analyzed. The primer sequences for amplifying DNA fragments containing the listed STR loci are listed in the patent claims in SEQ ID NOs 1-64. Twelve loci were found to be informative for the patient. Therefore, embryo samples were tested only for informative markers.

[0031] Linkage groups were established as follows. Alleles of polymorphic markers matching in the child with the disease and the parent - carrier of the pathogenic variant NC_000016.9:2140552G>A (NM_001009944.2:c.12178C>T, p.Gln4060Ter) in the PKD1 gene were recognized as linked to each other and to the pathogenic variant. Alleles of polymorphic markers that did not match in the parent and the child with the disease were recognized as linked to each other and to the normal allele of the gene. Alleles of polymorphic markers matching in the partner and his mother were recognized as linked to each other and to the normal allele of the PKD1 gene. The alleles of polymorphic markers that did not match in the partner and his mother were also found to be linked to each other and to the normal allele of the PKD1 gene. The results obtained for the informative markers are presented in Table 1. Alleles listed on the same line are located on the same chromosome, that is, they represent a linkage group.Thus, for each family member, 2 linkage groups are presented, corresponding to each of the 2 sixteenth human chromosomes. The results obtained for the informative markers are presented in Table 1. The table uses the multiple designation of the pathogenic variant NC_000016.9:2140552G>A (NM_001009944.2:c.12178C>T, p.Gln4060Ter) - PKD1 c. 12178C>T. N in the table denotes the absence of a pathogenic variant, mut - the presence of a pathogenic variant. The numbers indicate the lengths of amplicons in nucleotide pairs; their lengths depend on the number of repeats in the STR marker.

[0032]

[0033] As a result of haplotyping, it was concluded that the patient with the pathogenic variant had the following linked alleles of STR markers: D16S1.43 - 273, D16S3024 -296, D16S1.83 - 209, D16S2.28 - 297, D16S2.4 - 203, D16S2.51 - 268, D16AAGG32.2 - 108.

[0034] Preimplantation genetic testing

[0035] Three embryos were obtained in an IVF cycle. A biopsy was performed on day 5 of development (at the IVF clinic). The biopsy specimen in WGA buffer (1x PBS (Invitrogen, USA), 1% polyvinylpyrrolidone (PVP) (Fertipro, Belgium)) was sent to the Genetico laboratory. To monitor for contamination at various stages of sample processing, the laboratory has developed a system of controls: a contamination control for the biopsy buffer, a contamination control during transportation (one tube with the buffer is not opened by the embryologist), and a contamination control for each sample (a sample of the medium from the last wash drop of the biopsy material). All of these controls, along with the samples, undergo whole-genome amplification, after which the slightest amount of DNA contaminating the controls will be visible. Whole genome amplification was performed using the commercial SurePlex kit (Illumina, USA).

[0036] The whole-genome amplification product, as well as DNA from all family members, was amplified in step 1 using multiplex PCR with primers for detecting the pathogenic variant and primers for polymorphic markers informative for family A, in accordance with the test system protocol developed during the preparatory stage. In step 2, amplification was performed for each marker separately, according to the developed test system protocol. This allowed us to determine the linkage groups inherited by each embryo. The results are presented in Table 2.

[0037]

[0038] Based on the results of direct and indirect diagnostics, 3 embryos (embryos 1, 3, and 5) did not inherit the disease. Embryos 2 and 4 were identified with a haplotype corresponding to the inherited disease. In embryo 2, direct diagnostics revealed loss of the mutant allele, and the presence of a pathogenic variant was established by indirect diagnostics, i.e., by the linkage group of polymorphic markers. For embryo 1, the absence of a pathogenic variant was also established only by the linkage groups inherited from the parents. With parental consent, preimplantation genetic screening for chromosomal abnormalities was performed for the embryos that did not inherit the disease. Based on the results of all tests, 2 embryos (embryos 3 and 5) were recommended for transfer. Embryo 1 was not recommended due to the identified chromosomal abnormalities.

[0039] --->

[0040] <?xml version="1.0" encoding="ISO-8859-1"?>

[0041] <!DOCTYPE ST26SequenceListing SYSTEM "ST26SequenceListing_V1_3.dtd"

[0042] PUBLIC "- / / WIPO / / DTD Sequence Listing 1.3 / / EN">

[0043] <ST26SequenceListing productionDate="2026-03-26"

[0044] softwareVersion="2.3.0" softwareName="WIPO Sequence" fileName="Method

[0045] Preimplantation genetic testing of autosomal dominant

[0046] polycystic kidney disease.xml" dtdVersion="V1_3">

[0047] <applicationidentification>

[0048] <ipofficecode>RU< / ipofficecode>

[0049] <applicationnumbertext> 2025120632< / applicationnumbertext>

[0050] <filingdate> 2025-07-25< / filingdate>

[0051] < / applicationidentification>

[0052] <applicantfilereference> 2025120632< / applicantfilereference>

[0053] <applicantname languagecode="ru">Public joint-stock company

[0054] “Center of Genetics and Reproductive Medicine “GENETIKO”< / applicantname>

[0055] <applicantnamelatin>CENTER OF GENETICS AND REPRODUCTIVE MEDICINE

[0056] GENETICO PUBLIC JOINT-STOCK COMPANY< / applicantnamelatin>

[0057] <inventiontitle languagecode="ru">Preimplantation method

[0058] Genetic testing for autosomal dominant polycystic disease

[0059] kidneys< / inventiontitle>

[0060] <sequencetotalquantity> 68< / sequencetotalquantity>

[0061] <sequencedata sequenceidnumber="1">

[0062] <insdseq>

[0063] <INSDSeq_length>21< / INSDSeq_length>

[0064] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0065] <INSDSeq_division>PAT< / INSDSeq_division>

[0066] <INSDSeq_feature-table>

[0067] <insdfeature>

[0068] <INSDFeature_key>source< / INSDFeature_key>

[0069] <INSDFeature_location>1..21< / INSDFeature_location>

[0070] <INSDFeature_quals>

[0071] <insdqualifier>

[0072] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0073] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0074] < / insdqualifier>

[0075] <insdqualifier id="q2">

[0076] <INSDQualifier_name>organism< / INSDQualifier_name>

[0077] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0078] < / insdqualifier>

[0079] < / INSDFeature_quals>

[0080] < / insdfeature>

[0081] < / INSDSeq_feature-table>

[0082] <INSDSeq_sequence>tccacgctaggatgtaagagg< / INSDSeq_sequence>

[0083] < / insdseq>

[0084] < / sequencedata>

[0085] <sequencedata sequenceidnumber="2">

[0086] <insdseq>

[0087] <INSDSeq_length> 20< / INSDSeq_length>

[0088] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0089] <INSDSeq_division> PAT< / INSDSeq_division>

[0090] <INSDSeq_feature-table>

[0091] <insdfeature>

[0092] <INSDFeature_key>source< / INSDFeature_key>

[0093] <INSDFeature_location>1..20< / INSDFeature_location>

[0094] <INSDFeature_quals>

[0095] <insdqualifier>

[0096] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0097] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0098] < / insdqualifier>

[0099] <insdqualifier id="q4">

[0100] <INSDQualifier_name>organism< / INSDQualifier_name>

[0101] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0102] < / insdqualifier>

[0103] < / INSDFeature_quals>

[0104] < / insdfeature>

[0105] < / INSDSeq_feature-table>

[0106] <INSDSeq_sequence> ttctcgggggaattaaagcag< / INSDSeq_sequence>

[0107] < / insdseq>

[0108] < / sequencedata>

[0109] <sequencedata sequenceidnumber="3">

[0110] <insdseq>

[0111] <INSDSeq_length> 24< / INSDSeq_length>

[0112] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0113] <INSDSeq_division> PAT< / INSDSeq_division>

[0114] <INSDSeq_feature-table>

[0115] <insdfeature>

[0116] <INSDFeature_key>source< / INSDFeature_key>

[0117] <INSDFeature_location>1..24< / INSDFeature_location>

[0118] <INSDFeature_quals>

[0119] <insdqualifier>

[0120] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0121] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0122] < / insdqualifier>

[0123] <insdqualifier id="q6">

[0124] <INSDQualifier_name>organism< / INSDQualifier_name>

[0125] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0126] < / insdqualifier>

[0127] < / INSDFeature_quals>

[0128] < / insdfeature>

[0129] < / INSDSeq_feature-table>

[0130] <INSDSeq_sequence> aatcagtgtaaacttggaggagag< / INSDSeq_sequence>

[0131] < / insdseq>

[0132] < / sequencedata>

[0133] <sequencedata sequenceidnumber="4">

[0134] <insdseq>

[0135] <INSDSeq_length> 19< / INSDSeq_length>

[0136] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0137] <INSDSeq_division> PAT< / INSDSeq_division>

[0138] <INSDSeq_feature-table>

[0139] <insdfeature>

[0140] <INSDFeature_key>source< / INSDFeature_key>

[0141] <INSDFeature_location>1..19< / INSDFeature_location>

[0142] <INSDFeature_quals>

[0143] <insdqualifier>

[0144] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0145] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0146] < / insdqualifier>

[0147] <insdqualifier id="q8">

[0148] <INSDQualifier_name>organism< / INSDQualifier_name>

[0149] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0150] < / insdqualifier>

[0151] < / INSDFeature_quals>

[0152] < / insdfeature>

[0153] < / INSDSeq_feature-table>

[0154] <INSDSeq_sequence> disabledgagactgaccccct< / INSDSeq_sequence>

[0155] < / insdseq>

[0156] < / sequencedata>

[0157] <sequencedata sequenceidnumber="5">

[0158] <insdseq>

[0159] <INSDSeq_length> 19< / INSDSeq_length>

[0160] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0161] <INSDSeq_division> PAT< / INSDSeq_division>

[0162] <INSDSeq_feature-table>

[0163] <insdfeature>

[0164] <INSDFeature_key>source< / INSDFeature_key>

[0165] <INSDFeature_location>1..19< / INSDFeature_location>

[0166] <INSDFeature_quals>

[0167] <insdqualifier>

[0168] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0169] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0170] < / insdqualifier>

[0171] <insdqualifier id="q10">

[0172] <INSDQualifier_name>organism< / INSDQualifier_name>

[0173] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0174] < / insdqualifier>

[0175] < / INSDFeature_quals>

[0176] < / insdfeature>

[0177] < / INSDSeq_feature-table>

[0178] <INSDSeq_sequence> gaatcagcgtgaccagagc< / INSDSeq_sequence>

[0179] < / insdseq>

[0180] < / sequencedata>

[0181] <sequencedata sequenceidnumber="6">

[0182] <insdseq>

[0183] <INSDSeq_length> 19< / INSDSeq_length>

[0184] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0185] <INSDSeq_division> PAT< / INSDSeq_division>

[0186] <INSDSeq_feature-table>

[0187] <insdfeature>

[0188] <INSDFeature_key>source< / INSDFeature_key>

[0189] <INSDFeature_location>1..19< / INSDFeature_location>

[0190] <INSDFeature_quals>

[0191] <insdqualifier>

[0192] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0193] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0194] < / insdqualifier>

[0195] <insdqualifier id="q12">

[0196] <INSDQualifier_name>organism< / INSDQualifier_name>

[0197] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0198] < / insdqualifier>

[0199] < / INSDFeature_quals>

[0200] < / insdfeature>

[0201] < / INSDSeq_feature-table>

[0202] <INSDSeq_sequence> tgagatgagacaccaacgg< / INSDSeq_sequence>

[0203] < / insdseq>

[0204] < / sequencedata>

[0205] <sequencedata sequenceidnumber="7">

[0206] <insdseq>

[0207] <INSDSeq_length>19< / INSDSeq_length>

[0208] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0209] <INSDSeq_division>PAT< / INSDSeq_division>

[0210] <INSDSeq_feature-table>

[0211] <insdfeature>

[0212] <INSDFeature_key>source< / INSDFeature_key>

[0213] <INSDFeature_location>1..19< / INSDFeature_location>

[0214] <INSDFeature_quals>

[0215] <insdqualifier>

[0216] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0217] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0218] < / insdqualifier>

[0219] <insdqualifier id="q14">

[0220] <INSDQualifier_name>organism< / INSDQualifier_name>

[0221] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0222] < / insdqualifier>

[0223] < / INSDFeature_quals>

[0224] < / insdfeature>

[0225] < / INSDSeq_feature-table>

[0226] <INSDSeq_sequence>acattttcagtcaacggcc< / INSDSeq_sequence>

[0227] < / insdseq>

[0228] < / sequencedata>

[0229] <sequencedata sequenceidnumber="8">

[0230] <insdseq>

[0231] <INSDSeq_length>19< / INSDSeq_length>

[0232] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0233] <INSDSeq_division>PAT< / INSDSeq_division>

[0234] <INSDSeq_feature-table>

[0235] <insdfeature>

[0236] <INSDFeature_key>source< / INSDFeature_key>

[0237] <INSDFeature_location>1..19< / INSDFeature_location>

[0238] <INSDFeature_quals>

[0239] <insdqualifier>

[0240] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0241] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0242] < / insdqualifier>

[0243] <insdqualifier id="q16">

[0244] <INSDQualifier_name>organism< / INSDQualifier_name>

[0245] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0246] < / insdqualifier>

[0247] < / INSDFeature_quals>

[0248] < / insdfeature>

[0249] < / INSDSeq_feature-table>

[0250] <INSDSeq_sequence>ctcacgttttacacccgct< / INSDSeq_sequence>

[0251] < / insdseq>

[0252] < / sequencedata>

[0253] <sequencedata sequenceidnumber="9">

[0254] <insdseq>

[0255] <INSDSeq_length> 21< / INSDSeq_length>

[0256] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0257] <INSDSeq_division> PAT< / INSDSeq_division>

[0258] <INSDSeq_feature-table>

[0259] <insdfeature>

[0260] <INSDFeature_key>source< / INSDFeature_key>

[0261] <INSDFeature_location>1..21< / INSDFeature_location>

[0262] <INSDFeature_quals>

[0263] <insdqualifier>

[0264] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0265] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0266] < / insdqualifier>

[0267] <insdqualifier id="q18">

[0268] <INSDQualifier_name>organism< / INSDQualifier_name>

[0269] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0270] < / insdqualifier>

[0271] < / INSDFeature_quals>

[0272] < / insdfeature>

[0273] < / INSDSeq_feature-table>

[0274] <INSDSeq_sequence> attcttggtgtctggagcagt< / INSDSeq_sequence>

[0275] < / insdseq>

[0276] < / sequencedata>

[0277] <sequencedata sequenceidnumber="10">

[0278] <insdseq>

[0279] <INSDSeq_length> 17< / INSDSeq_length>

[0280] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0281] <INSDSeq_division> PAT< / INSDSeq_division>

[0282] <INSDSeq_feature-table>

[0283] <insdfeature>

[0284] <INSDFeature_key>source< / INSDFeature_key>

[0285] <INSDFeature_location>1..17< / INSDFeature_location>

[0286] <INSDFeature_quals>

[0287] <insdqualifier>

[0288] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0289] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0290] < / insdqualifier>

[0291] <insdqualifier id="q20">

[0292] <INSDQualifier_name>organism< / INSDQualifier_name>

[0293] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0294] < / insdqualifier>

[0295] < / INSDFeature_quals>

[0296] < / insdfeature>

[0297] < / INSDSeq_feature-table>

[0298] <INSDSeq_sequence> gccctcgacacacaa< / INSDSeq_sequence>

[0299] < / insdseq>

[0300] < / sequencedata>

[0301] <sequencedata sequenceidnumber="11">

[0302] <insdseq>

[0303] <INSDSeq_length>16< / INSDSeq_length>

[0304] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0305] <INSDSeq_division>PAT< / INSDSeq_division>

[0306] <INSDSeq_feature-table>

[0307] <insdfeature>

[0308] <INSDFeature_key>source< / INSDFeature_key>

[0309] <INSDFeature_location>1..16< / INSDFeature_location>

[0310] <INSDFeature_quals>

[0311] <insdqualifier>

[0312] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0313] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0314] < / insdqualifier>

[0315] <insdqualifier id="q22">

[0316] <INSDQualifier_name>organism< / INSDQualifier_name>

[0317] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0318] < / insdqualifier>

[0319] < / INSDFeature_quals>

[0320] < / insdfeature>

[0321] < / INSDSeq_feature-table>

[0322] <INSDSeq_sequence>gtaccgccggatgtcg< / INSDSeq_sequence>

[0323] < / insdseq>

[0324] < / sequencedata>

[0325] <sequencedata sequenceidnumber="12">

[0326] <insdseq>

[0327] <INSDSeq_length> 17< / INSDSeq_length>

[0328] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0329] <INSDSeq_division> PAT< / INSDSeq_division>

[0330] <INSDSeq_feature-table>

[0331] <insdfeature>

[0332] <INSDFeature_key>source< / INSDFeature_key>

[0333] <INSDFeature_location>1..17< / INSDFeature_location>

[0334] <INSDFeature_quals>

[0335] <insdqualifier>

[0336] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0337] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0338] < / insdqualifier>

[0339] <insdqualifier id="q24">

[0340] <INSDQualifier_name>organism< / INSDQualifier_name>

[0341] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0342] < / insdqualifier>

[0343] < / INSDFeature_quals>

[0344] < / insdfeature>

[0345] < / INSDSeq_feature-table>

[0346] <INSDSeq_sequence> tgtgcgacttccagctg< / INSDSeq_sequence>

[0347] < / insdseq>

[0348] < / sequencedata>

[0349] <sequencedata sequenceidnumber="13">

[0350] <insdseq>

[0351] <INSDSeq_length> 17< / INSDSeq_length>

[0352] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0353] <INSDSeq_division> PAT< / INSDSeq_division>

[0354] <INSDSeq_feature-table>

[0355] <insdfeature>

[0356] <INSDFeature_key>source< / INSDFeature_key>

[0357] <INSDFeature_location>1..17< / INSDFeature_location>

[0358] <INSDFeature_quals>

[0359] <insdqualifier>

[0360] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0361] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0362] < / insdqualifier>

[0363] <insdqualifier id="q26">

[0364] <INSDQualifier_name>organism< / INSDQualifier_name>

[0365] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0366] < / insdqualifier>

[0367] < / INSDFeature_quals>

[0368] < / insdfeature>

[0369] < / INSDSeq_feature-table>

[0370] <INSDSeq_sequence> cttcgcaaagctgccag< / INSDSeq_sequence>

[0371] < / insdseq>

[0372] < / sequencedata>

[0373] <sequencedata sequenceidnumber="14">

[0374] <insdseq>

[0375] <INSDSeq_length> 18< / INSDSeq_length>

[0376] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0377] <INSDSeq_division> PAT< / INSDSeq_division>

[0378] <INSDSeq_feature-table>

[0379] <insdfeature>

[0380] <INSDFeature_key>source< / INSDFeature_key>

[0381] <INSDFeature_location>1..18< / INSDFeature_location>

[0382] <INSDFeature_quals>

[0383] <insdqualifier>

[0384] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0385] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0386] < / insdqualifier>

[0387] <insdqualifier id="q28">

[0388] <INSDQualifier_name>organism< / INSDQualifier_name>

[0389] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0390] < / insdqualifier>

[0391] < / INSDFeature_quals>

[0392] < / insdfeature>

[0393] < / INSDSeq_feature-table>

[0394] <INSDSeq_sequence> tgtgctgctctttgggtg< / INSDSeq_sequence>

[0395] < / insdseq>

[0396] < / sequencedata>

[0397] <sequencedata sequenceidnumber="15">

[0398] <insdseq>

[0399] <INSDSeq_length> 20< / INSDSeq_length>

[0400] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0401] <INSDSeq_division> PAT< / INSDSeq_division>

[0402] <INSDSeq_feature-table>

[0403] <insdfeature>

[0404] <INSDFeature_key>source< / INSDFeature_key>

[0405] <INSDFeature_location>1..20< / INSDFeature_location>

[0406] <INSDFeature_quals>

[0407] <insdqualifier>

[0408] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0409] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0410] < / insdqualifier>

[0411] <insdqualifier id="q30">

[0412] <INSDQualifier_name>organism< / INSDQualifier_name>

[0413] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0414] < / insdqualifier>

[0415] < / INSDFeature_quals>

[0416] < / insdfeature>

[0417] < / INSDSeq_feature-table>

[0418] <INSDSeq_sequence> ccttccttgatgctgacaca< / INSDSeq_sequence>

[0419] < / insdseq>

[0420] < / sequencedata>

[0421] <sequencedata sequenceidnumber="16">

[0422] <insdseq>

[0423] <INSDSeq_length> 19< / INSDSeq_length>

[0424] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0425] <INSDSeq_division> PAT< / INSDSeq_division>

[0426] <INSDSeq_feature-table>

[0427] <insdfeature>

[0428] <INSDFeature_key>source< / INSDFeature_key>

[0429] <INSDFeature_location>1..19< / INSDFeature_location>

[0430] <INSDFeature_quals>

[0431] <insdqualifier>

[0432] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0433] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0434] < / insdqualifier>

[0435] <insdqualifier id="q32">

[0436] <INSDQualifier_name>organism< / INSDQualifier_name>

[0437] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0438] < / insdqualifier>

[0439] < / INSDFeature_quals>

[0440] < / insdfeature>

[0441] < / INSDSeq_feature-table>

[0442] <INSDSeq_sequence> ccaagtccgacaattcctg< / INSDSeq_sequence>

[0443] < / insdseq>

[0444] < / sequencedata>

[0445] <sequencedata sequenceidnumber="17">

[0446] <insdseq>

[0447] <INSDSeq_length> 22< / INSDSeq_length>

[0448] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0449] <INSDSeq_division> PAT< / INSDSeq_division>

[0450] <INSDSeq_feature-table>

[0451] <insdfeature>

[0452] <INSDFeature_key>source< / INSDFeature_key>

[0453] <INSDFeature_location>1..22< / INSDFeature_location>

[0454] <INSDFeature_quals>

[0455] <insdqualifier>

[0456] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0457] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0458] < / insdqualifier>

[0459] <insdqualifier id="q34">

[0460] <INSDQualifier_name>organism< / INSDQualifier_name>

[0461] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0462] < / insdqualifier>

[0463] < / INSDFeature_quals>

[0464] < / insdfeature>

[0465] < / INSDSeq_feature-table>

[0466] <INSDSeq_sequence> ctgattcttgggagatgtatgc< / INSDSeq_sequence>

[0467] < / insdseq>

[0468] < / sequencedata>

[0469] <sequencedata sequenceidnumber="18">

[0470] <insdseq>

[0471] <INSDSeq_length>21< / INSDSeq_length>

[0472] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0473] <INSDSeq_division>PAT< / INSDSeq_division>

[0474] <INSDSeq_feature-table>

[0475] <insdfeature>

[0476] <INSDFeature_key>source< / INSDFeature_key>

[0477] <INSDFeature_location>1..21< / INSDFeature_location>

[0478] <INSDFeature_quals>

[0479] <insdqualifier>

[0480] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0481] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0482] < / insdqualifier>

[0483] <insdqualifier id="q36">

[0484] <INSDQualifier_name>organism< / INSDQualifier_name>

[0485] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0486] < / insdqualifier>

[0487] < / INSDFeature_quals>

[0488] < / insdfeature>

[0489] < / INSDSeq_feature-table>

[0490] <INSDSeq_sequence>ttgtcctctggtcctacgtct< / INSDSeq_sequence>

[0491] < / insdseq>

[0492] < / sequencedata>

[0493] <sequencedata sequenceidnumber="19">

[0494] <insdseq>

[0495] <INSDSeq_length> 23< / INSDSeq_length>

[0496] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0497] <INSDSeq_division> PAT< / INSDSeq_division>

[0498] <INSDSeq_feature-table>

[0499] <insdfeature>

[0500] <INSDFeature_key>source< / INSDFeature_key>

[0501] <INSDFeature_location>1..23< / INSDFeature_location>

[0502] <INSDFeature_quals>

[0503] <insdqualifier>

[0504] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0505] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0506] < / insdqualifier>

[0507] <insdqualifier id="q38">

[0508] <INSDQualifier_name>organism< / INSDQualifier_name>

[0509] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0510] < / insdqualifier>

[0511] < / INSDFeature_quals>

[0512] < / insdfeature>

[0513] < / INSDSeq_feature-table>

[0514] <INSDSeq_sequence> cagaagccatagttctctaaccct< / INSDSeq_sequence>

[0515] < / insdseq>

[0516] < / sequencedata>

[0517] <sequencedata sequenceidnumber="20">

[0518] <insdseq>

[0519] <INSDSeq_length> 21< / INSDSeq_length>

[0520] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0521] <INSDSeq_division> PAT< / INSDSeq_division>

[0522] <INSDSeq_feature-table>

[0523] <insdfeature>

[0524] <INSDFeature_key>source< / INSDFeature_key>

[0525] <INSDFeature_location>1..21< / INSDFeature_location>

[0526] <INSDFeature_quals>

[0527] <insdqualifier>

[0528] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0529] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0530] < / insdqualifier>

[0531] <insdqualifier id="q40">

[0532] <INSDQualifier_name>organism< / INSDQualifier_name>

[0533] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0534] < / insdqualifier>

[0535] < / INSDFeature_quals>

[0536] < / insdfeature>

[0537] < / INSDSeq_feature-table>

[0538] <INSDSeq_sequence> agccagctgagaagctcttac< / INSDSeq_sequence>

[0539] < / insdseq>

[0540] < / sequencedata>

[0541] <sequencedata sequenceidnumber="21">

[0542] <insdseq>

[0543] <INSDSeq_length> 18< / INSDSeq_length>

[0544] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0545] <INSDSeq_division> PAT< / INSDSeq_division>

[0546] <INSDSeq_feature-table>

[0547] <insdfeature>

[0548] <INSDFeature_key>source< / INSDFeature_key>

[0549] <INSDFeature_location>1..18< / INSDFeature_location>

[0550] <INSDFeature_quals>

[0551] <insdqualifier>

[0552] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0553] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0554] < / insdqualifier>

[0555] <insdqualifier id="q44">

[0556] <INSDQualifier_name>organism< / INSDQualifier_name>

[0557] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0558] < / insdqualifier>

[0559] < / INSDFeature_quals>

[0560] < / insdfeature>

[0561] < / INSDSeq_feature-table>

[0562] <INSDSeq_sequence> cctcaaatcttccctggc< / INSDSeq_sequence>

[0563] < / insdseq>

[0564] < / sequencedata>

[0565] <sequencedata sequenceidnumber="22">

[0566] <insdseq>

[0567] <INSDSeq_length> 22< / INSDSeq_length>

[0568] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0569] <INSDSeq_division> PAT< / INSDSeq_division>

[0570] <INSDSeq_feature-table>

[0571] <insdfeature>

[0572] <INSDFeature_key>source< / INSDFeature_key>

[0573] <INSDFeature_location>1..22< / INSDFeature_location>

[0574] <INSDFeature_quals>

[0575] <insdqualifier>

[0576] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0577] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0578] < / insdqualifier>

[0579] <insdqualifier id="q46">

[0580] <INSDQualifier_name>organism< / INSDQualifier_name>

[0581] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0582] < / insdqualifier>

[0583] < / INSDFeature_quals>

[0584] < / insdfeature>

[0585] < / INSDSeq_feature-table>

[0586] <INSDSeq_sequence> gagggactatggttagaggcac< / INSDSeq_sequence>

[0587] < / insdseq>

[0588] < / sequencedata>

[0589] <sequencedata sequenceidnumber="23">

[0590] <insdseq>

[0591] <INSDSeq_length> 18< / INSDSeq_length>

[0592] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0593] <INSDSeq_division> PAT< / INSDSeq_division>

[0594] <INSDSeq_feature-table>

[0595] <insdfeature>

[0596] <INSDFeature_key>source< / INSDFeature_key>

[0597] <INSDFeature_location>1..18< / INSDFeature_location>

[0598] <INSDFeature_quals>

[0599] <insdqualifier>

[0600] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0601] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0602] < / insdqualifier>

[0603] <insdqualifier id="q48">

[0604] <INSDQualifier_name>organism< / INSDQualifier_name>

[0605] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0606] < / insdqualifier>

[0607] < / INSDFeature_quals>

[0608] < / insdfeature>

[0609] < / INSDSeq_feature-table>

[0610] <INSDSeq_sequence> gtgtttcctaatcggcgg< / INSDSeq_sequence>

[0611] < / insdseq>

[0612] < / sequencedata>

[0613] <sequencedata sequenceidnumber="24">

[0614] <insdseq>

[0615] <INSDSeq_length>24< / INSDSeq_length>

[0616] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0617] <INSDSeq_division>PAT< / INSDSeq_division>

[0618] <INSDSeq_feature-table>

[0619] <insdfeature>

[0620] <INSDFeature_key>source< / INSDFeature_key>

[0621] <INSDFeature_location>1..24< / INSDFeature_location>

[0622] <INSDFeature_quals>

[0623] <insdqualifier>

[0624] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0625] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0626] < / insdqualifier>

[0627] <insdqualifier id="q50">

[0628] <INSDQualifier_name>organism< / INSDQualifier_name>

[0629] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0630] < / insdqualifier>

[0631] < / INSDFeature_quals>

[0632] < / insdfeature>

[0633] < / INSDSeq_feature-table>

[0634] <INSDSeq_sequence>atctgcttatgtgtttcctcactc< / INSDSeq_sequence>

[0635] < / insdseq>

[0636] < / sequencedata>

[0637] <sequencedata sequenceidnumber="25">

[0638] <insdseq>

[0639] <INSDSeq_length> 20< / INSDSeq_length>

[0640] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0641] <INSDSeq_division> PAT< / INSDSeq_division>

[0642] <INSDSeq_feature-table>

[0643] <insdfeature>

[0644] <INSDFeature_key>source< / INSDFeature_key>

[0645] <INSDFeature_location>1..20< / INSDFeature_location>

[0646] <INSDFeature_quals>

[0647] <insdqualifier>

[0648] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0649] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0650] < / insdqualifier>

[0651] <insdqualifier id="q52">

[0652] <INSDQualifier_name>organism< / INSDQualifier_name>

[0653] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0654] < / insdqualifier>

[0655] < / INSDFeature_quals>

[0656] < / insdfeature>

[0657] < / INSDSeq_feature-table>

[0658] <INSDSeq_sequence> tgagatgacaacctccgtgt< / INSDSeq_sequence>

[0659] < / insdseq>

[0660] < / sequencedata>

[0661] <sequencedata sequenceidnumber="26">

[0662] <insdseq>

[0663] <INSDSeq_length> 19< / INSDSeq_length>

[0664] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0665] <INSDSeq_division> PAT< / INSDSeq_division>

[0666] <INSDSeq_feature-table>

[0667] <insdfeature>

[0668] <INSDFeature_key>source< / INSDFeature_key>

[0669] <INSDFeature_location>1..19< / INSDFeature_location>

[0670] <INSDFeature_quals>

[0671] <insdqualifier>

[0672] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0673] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0674] < / insdqualifier>

[0675] <insdqualifier id="q54">

[0676] <INSDQualifier_name>organism< / INSDQualifier_name>

[0677] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0678] < / insdqualifier>

[0679] < / INSDFeature_quals>

[0680] < / insdfeature>

[0681] < / INSDSeq_feature-table>

[0682] <INSDSeq_sequence> cccttggtctacaatgcgt< / INSDSeq_sequence>

[0683] < / insdseq>

[0684] < / sequencedata>

[0685] <sequencedata sequenceidnumber="27">

[0686] <insdseq>

[0687] <INSDSeq_length> 23< / INSDSeq_length>

[0688] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0689] <INSDSeq_division> PAT< / INSDSeq_division>

[0690] <INSDSeq_feature-table>

[0691] <insdfeature>

[0692] <INSDFeature_key>source< / INSDFeature_key>

[0693] <INSDFeature_location>1..23< / INSDFeature_location>

[0694] <INSDFeature_quals>

[0695] <insdqualifier>

[0696] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0697] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0698] < / insdqualifier>

[0699] <insdqualifier id="q56">

[0700] <INSDQualifier_name>organism< / INSDQualifier_name>

[0701] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0702] < / insdqualifier>

[0703] < / INSDFeature_quals>

[0704] < / insdfeature>

[0705] < / INSDSeq_feature-table>

[0706] <INSDSeq_sequence> cttcacaaaaggcagtaaacta< / INSDSeq_sequence>

[0707] < / insdseq>

[0708] < / sequencedata>

[0709] <sequencedata sequenceidnumber="28">

[0710] <insdseq>

[0711] <INSDSeq_length> 20< / INSDSeq_length>

[0712] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0713] <INSDSeq_division> PAT< / INSDSeq_division>

[0714] <INSDSeq_feature-table>

[0715] <insdfeature>

[0716] <INSDFeature_key>source< / INSDFeature_key>

[0717] <INSDFeature_location>1..20< / INSDFeature_location>

[0718] <INSDFeature_quals>

[0719] <insdqualifier>

[0720] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0721] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0722] < / insdqualifier>

[0723] <insdqualifier id="q58">

[0724] <INSDQualifier_name>organism< / INSDQualifier_name>

[0725] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0726] < / insdqualifier>

[0727] < / INSDFeature_quals>

[0728] < / insdfeature>

[0729] < / INSDSeq_feature-table>

[0730] <INSDSeq_sequence> tatgtaccaggcccaggaaa< / INSDSeq_sequence>

[0731] < / insdseq>

[0732] < / sequencedata>

[0733] <sequencedata sequenceidnumber="29">

[0734] <insdseq>

[0735] <INSDSeq_length>19< / INSDSeq_length>

[0736] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0737] <INSDSeq_division>PAT< / INSDSeq_division>

[0738] <INSDSeq_feature-table>

[0739] <insdfeature>

[0740] <INSDFeature_key>source< / INSDFeature_key>

[0741] <INSDFeature_location>1..19< / INSDFeature_location>

[0742] <INSDFeature_quals>

[0743] <insdqualifier>

[0744] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0745] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0746] < / insdqualifier>

[0747] <insdqualifier id="q60">

[0748] <INSDQualifier_name>organism< / INSDQualifier_name>

[0749] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0750] < / insdqualifier>

[0751] < / INSDFeature_quals>

[0752] < / insdfeature>

[0753] < / INSDSeq_feature-table>

[0754] <INSDSeq_sequence>catacccttgcactccagc< / INSDSeq_sequence>

[0755] < / insdseq>

[0756] < / sequencedata>

[0757] <sequencedata sequenceidnumber="30">

[0758] <insdseq>

[0759] <INSDSeq_length> 21< / INSDSeq_length>

[0760] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0761] <INSDSeq_division> PAT< / INSDSeq_division>

[0762] <INSDSeq_feature-table>

[0763] <insdfeature>

[0764] <INSDFeature_key>source< / INSDFeature_key>

[0765] <INSDFeature_location>1..21< / INSDFeature_location>

[0766] <INSDFeature_quals>

[0767] <insdqualifier>

[0768] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0769] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0770] < / insdqualifier>

[0771] <insdqualifier id="q62">

[0772] <INSDQualifier_name>organism< / INSDQualifier_name>

[0773] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0774] < / insdqualifier>

[0775] < / INSDFeature_quals>

[0776] < / insdfeature>

[0777] < / INSDSeq_feature-table>

[0778] <INSDSeq_sequence> accccaaatgacaagaaaggt< / INSDSeq_sequence>

[0779] < / insdseq>

[0780] < / sequencedata>

[0781] <sequencedata sequenceidnumber="31">

[0782] <insdseq>

[0783] <INSDSeq_length>19< / INSDSeq_length>

[0784] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0785] <INSDSeq_division>PAT< / INSDSeq_division>

[0786] <INSDSeq_feature-table>

[0787] <insdfeature>

[0788] <INSDFeature_key>source< / INSDFeature_key>

[0789] <INSDFeature_location>1..19< / INSDFeature_location>

[0790] <INSDFeature_quals>

[0791] <insdqualifier>

[0792] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0793] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0794] < / insdqualifier>

[0795] <insdqualifier id="q64">

[0796] <INSDQualifier_name>organism< / INSDQualifier_name>

[0797] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0798] < / insdqualifier>

[0799] < / INSDFeature_quals>

[0800] < / insdfeature>

[0801] < / INSDSeq_feature-table>

[0802] <INSDSeq_sequence>gtctctgtgcctggaggtc< / INSDSeq_sequence>

[0803] < / insdseq>

[0804] < / sequencedata>

[0805] <sequencedata sequenceidnumber="32">

[0806] <insdseq>

[0807] <INSDSeq_length> 18< / INSDSeq_length>

[0808] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0809] <INSDSeq_division> PAT< / INSDSeq_division>

[0810] <INSDSeq_feature-table>

[0811] <insdfeature>

[0812] <INSDFeature_key>source< / INSDFeature_key>

[0813] <INSDFeature_location>1..18< / INSDFeature_location>

[0814] <INSDFeature_quals>

[0815] <insdqualifier>

[0816] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0817] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0818] < / insdqualifier>

[0819] <insdqualifier id="q66">

[0820] <INSDQualifier_name>organism< / INSDQualifier_name>

[0821] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0822] < / insdqualifier>

[0823] < / INSDFeature_quals>

[0824] < / insdfeature>

[0825] < / INSDSeq_feature-table>

[0826] <INSDSeq_sequence> tgaacccaggagtggagg< / INSDSeq_sequence>

[0827] < / insdseq>

[0828] < / sequencedata>

[0829] <sequencedata sequenceidnumber="33">

[0830] <insdseq>

[0831] <INSDSeq_length> 20< / INSDSeq_length>

[0832] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0833] <INSDSeq_division> PAT< / INSDSeq_division>

[0834] <INSDSeq_feature-table>

[0835] <insdfeature>

[0836] <INSDFeature_key>source< / INSDFeature_key>

[0837] <INSDFeature_location>1..20< / INSDFeature_location>

[0838] <INSDFeature_quals>

[0839] <insdqualifier>

[0840] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0841] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0842] < / insdqualifier>

[0843] <insdqualifier id="q68">

[0844] <INSDQualifier_name>organism< / INSDQualifier_name>

[0845] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0846] < / insdqualifier>

[0847] < / INSDFeature_quals>

[0848] < / insdfeature>

[0849] < / INSDSeq_feature-table>

[0850] <INSDSeq_sequence> caggtagcaagttttgtg< / INSDSeq_sequence>

[0851] < / insdseq>

[0852] < / sequencedata>

[0853] <sequencedata sequenceidnumber="34">

[0854] <insdseq>

[0855] <INSDSeq_length> 20< / INSDSeq_length>

[0856] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0857] <INSDSeq_division> PAT< / INSDSeq_division>

[0858] <INSDSeq_feature-table>

[0859] <insdfeature>

[0860] <INSDFeature_key>source< / INSDFeature_key>

[0861] <INSDFeature_location>1..20< / INSDFeature_location>

[0862] <INSDFeature_quals>

[0863] <insdqualifier>

[0864] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0865] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0866] < / insdqualifier>

[0867] <insdqualifier id="q70">

[0868] <INSDQualifier_name>organism< / INSDQualifier_name>

[0869] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0870] < / insdqualifier>

[0871] < / INSDFeature_quals>

[0872] < / insdfeature>

[0873] < / INSDSeq_feature-table>

[0874] <INSDSeq_sequence> ccacagacttctttcctggg< / INSDSeq_sequence>

[0875] < / insdseq>

[0876] < / sequencedata>

[0877] <sequencedata sequenceidnumber="35">

[0878] <insdseq>

[0879] <INSDSeq_length>17< / INSDSeq_length>

[0880] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0881] <INSDSeq_division>PAT< / INSDSeq_division>

[0882] <INSDSeq_feature-table>

[0883] <insdfeature>

[0884] <INSDFeature_key>source< / INSDFeature_key>

[0885] <INSDFeature_location>1..17< / INSDFeature_location>

[0886] <INSDFeature_quals>

[0887] <insdqualifier>

[0888] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0889] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0890] < / insdqualifier>

[0891] <insdqualifier id="q72">

[0892] <INSDQualifier_name>organism< / INSDQualifier_name>

[0893] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0894] < / insdqualifier>

[0895] < / INSDFeature_quals>

[0896] < / insdfeature>

[0897] < / INSDSeq_feature-table>

[0898] <INSDSeq_sequence>gctctgagccatctgcc< / INSDSeq_sequence>

[0899] < / insdseq>

[0900] < / sequencedata>

[0901] <sequencedata sequenceidnumber="36">

[0902] <insdseq>

[0903] <INSDSeq_length> 17< / INSDSeq_length>

[0904] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0905] <INSDSeq_division> PAT< / INSDSeq_division>

[0906] <INSDSeq_feature-table>

[0907] <insdfeature>

[0908] <INSDFeature_key>source< / INSDFeature_key>

[0909] <INSDFeature_location>1..17< / INSDFeature_location>

[0910] <INSDFeature_quals>

[0911] <insdqualifier>

[0912] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0913] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0914] < / insdqualifier>

[0915] <insdqualifier id="q74">

[0916] <INSDQualifier_name>organism< / INSDQualifier_name>

[0917] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0918] < / insdqualifier>

[0919] < / INSDFeature_quals>

[0920] < / insdfeature>

[0921] < / INSDSeq_feature-table>

[0922] <INSDSeq_sequence> cttcatccccaggctca< / INSDSeq_sequence>

[0923] < / insdseq>

[0924] < / sequencedata>

[0925] <sequencedata sequenceidnumber="37">

[0926] <insdseq>

[0927] <INSDSeq_length> 20< / INSDSeq_length>

[0928] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0929] <INSDSeq_division> PAT< / INSDSeq_division>

[0930] <INSDSeq_feature-table>

[0931] <insdfeature>

[0932] <INSDFeature_key>source< / INSDFeature_key>

[0933] <INSDFeature_location>1..20< / INSDFeature_location>

[0934] <INSDFeature_quals>

[0935] <insdqualifier>

[0936] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0937] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0938] < / insdqualifier>

[0939] <insdqualifier id="q76">

[0940] <INSDQualifier_name>organism< / INSDQualifier_name>

[0941] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0942] < / insdqualifier>

[0943] < / INSDFeature_quals>

[0944] < / insdfeature>

[0945] < / INSDSeq_feature-table>

[0946] <INSDSeq_sequence> agaataacaggctgggcgag< / INSDSeq_sequence>

[0947] < / insdseq>

[0948] < / sequencedata>

[0949] <sequencedata sequenceidnumber="38">

[0950] <insdseq>

[0951] <INSDSeq_length> 20< / INSDSeq_length>

[0952] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0953] <INSDSeq_division> PAT< / INSDSeq_division>

[0954] <INSDSeq_feature-table>

[0955] <insdfeature>

[0956] <INSDFeature_key>source< / INSDFeature_key>

[0957] <INSDFeature_location>1..20< / INSDFeature_location>

[0958] <INSDFeature_quals>

[0959] <insdqualifier>

[0960] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0961] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0962] < / insdqualifier>

[0963] <insdqualifier id="q78">

[0964] <INSDQualifier_name>organism< / INSDQualifier_name>

[0965] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0966] < / insdqualifier>

[0967] < / INSDFeature_quals>

[0968] < / insdfeature>

[0969] < / INSDSeq_feature-table>

[0970] <INSDSeq_sequence> gaccccaaggtggttagagg< / INSDSeq_sequence>

[0971] < / insdseq>

[0972] < / sequencedata>

[0973] <sequencedata sequenceidnumber="39">

[0974] <insdseq>

[0975] <INSDSeq_length> 20< / INSDSeq_length>

[0976] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0977] <INSDSeq_division> PAT< / INSDSeq_division>

[0978] <INSDSeq_feature-table>

[0979] <insdfeature>

[0980] <INSDFeature_key>source< / INSDFeature_key>

[0981] <INSDFeature_location>1..20< / INSDFeature_location>

[0982] <INSDFeature_quals>

[0983] <insdqualifier>

[0984] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0985] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0986] < / insdqualifier>

[0987] <insdqualifier id="q80">

[0988] <INSDQualifier_name>organism< / INSDQualifier_name>

[0989] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0990] < / insdqualifier>

[0991] < / INSDFeature_quals>

[0992] < / insdfeature>

[0993] < / INSDSeq_feature-table>

[0994] <INSDSeq_sequence> atggtggtgtgtacctgtgc< / INSDSeq_sequence>

[0995] < / insdseq>

[0996] < / sequencedata>

[0997] <sequencedata sequenceidnumber="40">

[0998] <insdseq>

[0999] <INSDSeq_length> 20< / INSDSeq_length>

[1000] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1001] <INSDSeq_division> PAT< / INSDSeq_division>

[1002] <INSDSeq_feature-table>

[1003] <insdfeature>

[1004] <INSDFeature_key>source< / INSDFeature_key>

[1005] <INSDFeature_location>1..20< / INSDFeature_location>

[1006] <INSDFeature_quals>

[1007] <insdqualifier>

[1008] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1009] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1010] < / insdqualifier>

[1011] <insdqualifier id="q82">

[1012] <INSDQualifier_name>organism< / INSDQualifier_name>

[1013] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1014] < / insdqualifier>

[1015] < / INSDFeature_quals>

[1016] < / insdfeature>

[1017] < / INSDSeq_feature-table>

[1018] <INSDSeq_sequence> gccctttttggcccagact< / INSDSeq_sequence>

[1019] < / insdseq>

[1020] < / sequencedata>

[1021] <sequencedata sequenceidnumber="41">

[1022] <insdseq>

[1023] <INSDSeq_length>22< / INSDSeq_length>

[1024] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1025] <INSDSeq_division>PAT< / INSDSeq_division>

[1026] <INSDSeq_feature-table>

[1027] <insdfeature>

[1028] <INSDFeature_key>source< / INSDFeature_key>

[1029] <INSDFeature_location>1..22< / INSDFeature_location>

[1030] <INSDFeature_quals>

[1031] <insdqualifier>

[1032] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1033] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1034] < / insdqualifier>

[1035] <insdqualifier id="q84">

[1036] <INSDQualifier_name>organism< / INSDQualifier_name>

[1037] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1038] < / insdqualifier>

[1039] < / INSDFeature_quals>

[1040] < / insdfeature>

[1041] < / INSDSeq_feature-table>

[1042] <INSDSeq_sequence>cccactttatcccctaaccata< / INSDSeq_sequence>

[1043] < / insdseq>

[1044] < / sequencedata>

[1045] <sequencedata sequenceidnumber="42">

[1046] <insdseq>

[1047] <INSDSeq_length> 22< / INSDSeq_length>

[1048] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1049] <INSDSeq_division> PAT< / INSDSeq_division>

[1050] <INSDSeq_feature-table>

[1051] <insdfeature>

[1052] <INSDFeature_key>source< / INSDFeature_key>

[1053] <INSDFeature_location>1..22< / INSDFeature_location>

[1054] <INSDFeature_quals>

[1055] <insdqualifier>

[1056] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1057] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1058] < / insdqualifier>

[1059] <insdqualifier id="q86">

[1060] <INSDQualifier_name>organism< / INSDQualifier_name>

[1061] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1062] < / insdqualifier>

[1063] < / INSDFeature_quals>

[1064] < / insdfeature>

[1065] < / INSDSeq_feature-table>

[1066] <INSDSeq_sequence> gtggtttaagagagcaaggagg< / INSDSeq_sequence>

[1067] < / insdseq>

[1068] < / sequencedata>

[1069] <sequencedata sequenceidnumber="43">

[1070] <insdseq>

[1071] <INSDSeq_length> 22< / INSDSeq_length>

[1072] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1073] <INSDSeq_division> PAT< / INSDSeq_division>

[1074] <INSDSeq_feature-table>

[1075] <insdfeature>

[1076] <INSDFeature_key>source< / INSDFeature_key>

[1077] <INSDFeature_location>1..22< / INSDFeature_location>

[1078] <INSDFeature_quals>

[1079] <insdqualifier>

[1080] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1081] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1082] < / insdqualifier>

[1083] <insdqualifier id="q88">

[1084] <INSDQualifier_name>organism< / INSDQualifier_name>

[1085] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1086] < / insdqualifier>

[1087] < / INSDFeature_quals>

[1088] < / insdfeature>

[1089] < / INSDSeq_feature-table>

[1090] <INSDSeq_sequence> gaattacttgaacacggggaggt< / INSDSeq_sequence>

[1091] < / insdseq>

[1092] < / sequencedata>

[1093] <sequencedata sequenceidnumber="44">

[1094] <insdseq>

[1095] <INSDSeq_length>22< / INSDSeq_length>

[1096] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1097] <INSDSeq_division>PAT< / INSDSeq_division>

[1098] <INSDSeq_feature-table>

[1099] <insdfeature>

[1100] <INSDFeature_key>source< / INSDFeature_key>

[1101] <INSDFeature_location>1..22< / INSDFeature_location>

[1102] <INSDFeature_quals>

[1103] <insdqualifier>

[1104] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1105] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1106] < / insdqualifier>

[1107] <insdqualifier id="q90">

[1108] <INSDQualifier_name>organism< / INSDQualifier_name>

[1109] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1110] < / insdqualifier>

[1111] < / INSDFeature_quals>

[1112] < / insdfeature>

[1113] < / INSDSeq_feature-table>

[1114] <INSDSeq_sequence>tcctcttatcctgtacctctgc< / INSDSeq_sequence>

[1115] < / insdseq>

[1116] < / sequencedata>

[1117] <sequencedata sequenceidnumber="45">

[1118] <insdseq>

[1119] <INSDSeq_length>20< / INSDSeq_length>

[1120] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1121] <INSDSeq_division>PAT< / INSDSeq_division>

[1122] <INSDSeq_feature-table>

[1123] <insdfeature>

[1124] <INSDFeature_key>source< / INSDFeature_key>

[1125] <INSDFeature_location>1..20< / INSDFeature_location>

[1126] <INSDFeature_quals>

[1127] <insdqualifier>

[1128] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1129] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1130] < / insdqualifier>

[1131] <insdqualifier id="q92">

[1132] <INSDQualifier_name>organism< / INSDQualifier_name>

[1133] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1134] < / insdqualifier>

[1135] < / INSDFeature_quals>

[1136] < / insdfeature>

[1137] < / INSDSeq_feature-table>

[1138] <INSDSeq_sequence>gtcctgattctgcattttgc< / INSDSeq_sequence>

[1139] < / insdseq>

[1140] < / sequencedata>

[1141] <sequencedata sequenceidnumber="46">

[1142] <insdseq>

[1143] <INSDSeq_length> 18< / INSDSeq_length>

[1144] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1145] <INSDSeq_division> PAT< / INSDSeq_division>

[1146] <INSDSeq_feature-table>

[1147] <insdfeature>

[1148] <INSDFeature_key>source< / INSDFeature_key>

[1149] <INSDFeature_location>1..18< / INSDFeature_location>

[1150] <INSDFeature_quals>

[1151] <insdqualifier>

[1152] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1153] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1154] < / insdqualifier>

[1155] <insdqualifier id="q94">

[1156] <INSDQualifier_name>organism< / INSDQualifier_name>

[1157] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1158] < / insdqualifier>

[1159] < / INSDFeature_quals>

[1160] < / insdfeature>

[1161] < / INSDSeq_feature-table>

[1162] <INSDSeq_sequence> ggacctgcggaaataacg< / INSDSeq_sequence>

[1163] < / insdseq>

[1164] < / sequencedata>

[1165] <sequencedata sequenceidnumber="47">

[1166] <insdseq>

[1167] <INSDSeq_length> 22< / INSDSeq_length>

[1168] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1169] <INSDSeq_division> PAT< / INSDSeq_division>

[1170] <INSDSeq_feature-table>

[1171] <insdfeature>

[1172] <INSDFeature_key>source< / INSDFeature_key>

[1173] <INSDFeature_location>1..22< / INSDFeature_location>

[1174] <INSDFeature_quals>

[1175] <insdqualifier>

[1176] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1177] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1178] < / insdqualifier>

[1179] <insdqualifier id="q96">

[1180] <INSDQualifier_name>organism< / INSDQualifier_name>

[1181] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1182] < / insdqualifier>

[1183] < / INSDFeature_quals>

[1184] < / insdfeature>

[1185] < / INSDSeq_feature-table>

[1186] <INSDSeq_sequence> atcagagaggacctgcggaaat< / INSDSeq_sequence>

[1187] < / insdseq>

[1188] < / sequencedata>

[1189] <sequencedata sequenceidnumber="48">

[1190] <insdseq>

[1191] <INSDSeq_length>22< / INSDSeq_length>

[1192] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1193] <INSDSeq_division>PAT< / INSDSeq_division>

[1194] <INSDSeq_feature-table>

[1195] <insdfeature>

[1196] <INSDFeature_key>source< / INSDFeature_key>

[1197] <INSDFeature_location>1..22< / INSDFeature_location>

[1198] <INSDFeature_quals>

[1199] <insdqualifier>

[1200] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1201] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1202] < / insdqualifier>

[1203] <insdqualifier id="q98">

[1204] <INSDQualifier_name>organism< / INSDQualifier_name>

[1205] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1206] < / insdqualifier>

[1207] < / INSDFeature_quals>

[1208] < / insdfeature>

[1209] < / INSDSeq_feature-table>

[1210] <INSDSeq_sequence>cctgtacctctgccatgtgtct< / INSDSeq_sequence>

[1211] < / insdseq>

[1212] < / sequencedata>

[1213] <sequencedata sequenceidnumber="49">

[1214] <insdseq>

[1215] <INSDSeq_length> 22< / INSDSeq_length>

[1216] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1217] <INSDSeq_division> PAT< / INSDSeq_division>

[1218] <INSDSeq_feature-table>

[1219] <insdfeature>

[1220] <INSDFeature_key>source< / INSDFeature_key>

[1221] <INSDFeature_location>1..22< / INSDFeature_location>

[1222] <INSDFeature_quals>

[1223] <insdqualifier>

[1224] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1225] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1226] < / insdqualifier>

[1227] <insdqualifier id="q100">

[1228] <INSDQualifier_name>organism< / INSDQualifier_name>

[1229] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1230] < / insdqualifier>

[1231] < / INSDFeature_quals>

[1232] < / insdfeature>

[1233] < / INSDSeq_feature-table>

[1234] <INSDSeq_sequence> ctgcggaaataacggtgacact< / INSDSeq_sequence>

[1235] < / insdseq>

[1236] < / sequencedata>

[1237] <sequencedata sequenceidnumber="50">

[1238] <insdseq>

[1239] <INSDSeq_length> 20< / INSDSeq_length>

[1240] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1241] <INSDSeq_division> PAT< / INSDSeq_division>

[1242] <INSDSeq_feature-table>

[1243] <insdfeature>

[1244] <INSDFeature_key>source< / INSDFeature_key>

[1245] <INSDFeature_location>1..20< / INSDFeature_location>

[1246] <INSDFeature_quals>

[1247] <insdqualifier>

[1248] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1249] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1250] < / insdqualifier>

[1251] <insdqualifier id="q102">

[1252] <INSDQualifier_name>organism< / INSDQualifier_name>

[1253] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1254] < / insdqualifier>

[1255] < / INSDFeature_quals>

[1256] < / insdfeature>

[1257] < / INSDSeq_feature-table>

[1258] <INSDSeq_sequence> tatagtggtgatgagccggg< / INSDSeq_sequence>

[1259] < / insdseq>

[1260] < / sequencedata>

[1261] <sequencedata sequenceidnumber="51">

[1262] <insdseq>

[1263] <INSDSeq_length> 20< / INSDSeq_length>

[1264] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1265] <INSDSeq_division> PAT< / INSDSeq_division>

[1266] <INSDSeq_feature-table>

[1267] <insdfeature>

[1268] <INSDFeature_key>source< / INSDFeature_key>

[1269] <INSDFeature_location>1..20< / INSDFeature_location>

[1270] <INSDFeature_quals>

[1271] <insdqualifier>

[1272] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1273] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1274] < / insdqualifier>

[1275] <insdqualifier id="q104">

[1276] <INSDQualifier_name>organism< / INSDQualifier_name>

[1277] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1278] < / insdqualifier>

[1279] < / INSDFeature_quals>

[1280] < / insdfeature>

[1281] < / INSDSeq_feature-table>

[1282] <INSDSeq_sequence> ggactaaactcgggttccgc< / INSDSeq_sequence>

[1283] < / insdseq>

[1284] < / sequencedata>

[1285] <sequencedata sequenceidnumber="52">

[1286] <insdseq>

[1287] <INSDSeq_length> 20< / INSDSeq_length>

[1288] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1289] <INSDSeq_division> PAT< / INSDSeq_division>

[1290] <INSDSeq_feature-table>

[1291] <insdfeature>

[1292] <INSDFeature_key>source< / INSDFeature_key>

[1293] <INSDFeature_location>1..20< / INSDFeature_location>

[1294] <INSDFeature_quals>

[1295] <insdqualifier>

[1296] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1297] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1298] < / insdqualifier>

[1299] <insdqualifier id="q106">

[1300] <INSDQualifier_name>organism< / INSDQualifier_name>

[1301] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1302] < / insdqualifier>

[1303] < / INSDFeature_quals>

[1304] < / insdfeature>

[1305] < / INSDSeq_feature-table>

[1306] <INSDSeq_sequence> aggagaatcgcttgaacccg< / INSDSeq_sequence>

[1307] < / insdseq>

[1308] < / sequencedata>

[1309] <sequencedata sequenceidnumber="53">

[1310] <insdseq>

[1311] <INSDSeq_length> 23< / INSDSeq_length>

[1312] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1313] <INSDSeq_division> PAT< / INSDSeq_division>

[1314] <INSDSeq_feature-table>

[1315] <insdfeature>

[1316] <INSDFeature_key>source< / INSDFeature_key>

[1317] <INSDFeature_location>1..23< / INSDFeature_location>

[1318] <INSDFeature_quals>

[1319] <insdqualifier>

[1320] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1321] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1322] < / insdqualifier>

[1323] <insdqualifier id="q108">

[1324] <INSDQualifier_name>organism< / INSDQualifier_name>

[1325] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1326] < / insdqualifier>

[1327] < / INSDFeature_quals>

[1328] < / insdfeature>

[1329] < / INSDSeq_feature-table>

[1330] <INSDSeq_sequence> tccctcggcgaaatattaactc< / INSDSeq_sequence>

[1331] < / insdseq>

[1332] < / sequencedata>

[1333] <sequencedata sequenceidnumber="54">

[1334] <insdseq>

[1335] <INSDSeq_length> 20< / INSDSeq_length>

[1336] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1337] <INSDSeq_division> PAT< / INSDSeq_division>

[1338] <INSDSeq_feature-table>

[1339] <insdfeature>

[1340] <INSDFeature_key>source< / INSDFeature_key>

[1341] <INSDFeature_location>1..20< / INSDFeature_location>

[1342] <INSDFeature_quals>

[1343] <insdqualifier>

[1344] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1345] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1346] < / insdqualifier>

[1347] <insdqualifier id="q110">

[1348] <INSDQualifier_name>organism< / INSDQualifier_name>

[1349] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1350] < / insdqualifier>

[1351] < / INSDFeature_quals>

[1352] < / insdfeature>

[1353] < / INSDSeq_feature-table>

[1354] <INSDSeq_sequence> actactcgagcccagaaggt< / INSDSeq_sequence>

[1355] < / insdseq>

[1356] < / sequencedata>

[1357] <sequencedata sequenceidnumber="55">

[1358] <insdseq>

[1359] <INSDSeq_length>20< / INSDSeq_length>

[1360] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1361] <INSDSeq_division>PAT< / INSDSeq_division>

[1362] <INSDSeq_feature-table>

[1363] <insdfeature>

[1364] <INSDFeature_key>source< / INSDFeature_key>

[1365] <INSDFeature_location>1..20< / INSDFeature_location>

[1366] <INSDFeature_quals>

[1367] <insdqualifier>

[1368] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1369] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1370] < / insdqualifier>

[1371] <insdqualifier id="q112">

[1372] <INSDQualifier_name>organism< / INSDQualifier_name>

[1373] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1374] < / insdqualifier>

[1375] < / INSDFeature_quals>

[1376] < / insdfeature>

[1377] < / INSDSeq_feature-table>

[1378] <INSDSeq_sequence>gtgacaagaacgagactgcg< / INSDSeq_sequence>

[1379] < / insdseq>

[1380] < / sequencedata>

[1381] <sequencedata sequenceidnumber="56">

[1382] <insdseq>

[1383] <INSDSeq_length> 21< / INSDSeq_length>

[1384] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1385] <INSDSeq_division> PAT< / INSDSeq_division>

[1386] <INSDSeq_feature-table>

[1387] <insdfeature>

[1388] <INSDFeature_key>source< / INSDFeature_key>

[1389] <INSDFeature_location>1..21< / INSDFeature_location>

[1390] <INSDFeature_quals>

[1391] <insdqualifier>

[1392] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1393] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1394] < / insdqualifier>

[1395] <insdqualifier id="q114">

[1396] <INSDQualifier_name>organism< / INSDQualifier_name>

[1397] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1398] < / insdqualifier>

[1399] < / INSDFeature_quals>

[1400] < / insdfeature>

[1401] < / INSDSeq_feature-table>

[1402] <INSDSeq_sequence> ggcctactgatcagtgcctct< / INSDSeq_sequence>

[1403] < / insdseq>

[1404] < / sequencedata>

[1405] <sequencedata sequenceidnumber="57">

[1406] <insdseq>

[1407] <INSDSeq_length>20< / INSDSeq_length>

[1408] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1409] <INSDSeq_division>PAT< / INSDSeq_division>

[1410] <INSDSeq_feature-table>

[1411] <insdfeature>

[1412] <INSDFeature_key>source< / INSDFeature_key>

[1413] <INSDFeature_location>1..20< / INSDFeature_location>

[1414] <INSDFeature_quals>

[1415] <insdqualifier>

[1416] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1417] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1418] < / insdqualifier>

[1419] <insdqualifier id="q116">

[1420] <INSDQualifier_name>organism< / INSDQualifier_name>

[1421] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1422] < / insdqualifier>

[1423] < / INSDFeature_quals>

[1424] < / insdfeature>

[1425] < / INSDSeq_feature-table>

[1426] <INSDSeq_sequence>tccattctcctcctcctccc< / INSDSeq_sequence>

[1427] < / insdseq>

[1428] < / sequencedata>

[1429] <sequencedata sequenceidnumber="58">

[1430] <insdseq>

[1431] <INSDSeq_length>20< / INSDSeq_length>

[1432] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1433] <INSDSeq_division>PAT< / INSDSeq_division>

[1434] <INSDSeq_feature-table>

[1435] <insdfeature>

[1436] <INSDFeature_key>source< / INSDFeature_key>

[1437] <INSDFeature_location>1..20< / INSDFeature_location>

[1438] <INSDFeature_quals>

[1439] <insdqualifier>

[1440] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1441] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1442] < / insdqualifier>

[1443] <insdqualifier id="q118">

[1444] <INSDQualifier_name>organism< / INSDQualifier_name>

[1445] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1446] < / insdqualifier>

[1447] < / INSDFeature_quals>

[1448] < / insdfeature>

[1449] < / INSDSeq_feature-table>

[1450] <INSDSeq_sequence>acctccactgaatcaccagc< / INSDSeq_sequence>

[1451] < / insdseq>

[1452] < / sequencedata>

[1453] <sequencedata sequenceidnumber="59">

[1454] <insdseq>

[1455] <INSDSeq_length> 20< / INSDSeq_length>

[1456] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1457] <INSDSeq_division> PAT< / INSDSeq_division>

[1458] <INSDSeq_feature-table>

[1459] <insdfeature>

[1460] <INSDFeature_key>source< / INSDFeature_key>

[1461] <INSDFeature_location>1..20< / INSDFeature_location>

[1462] <INSDFeature_quals>

[1463] <insdqualifier>

[1464] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1465] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1466] < / insdqualifier>

[1467] <insdqualifier id="q120">

[1468] <INSDQualifier_name>organism< / INSDQualifier_name>

[1469] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1470] < / insdqualifier>

[1471] < / INSDFeature_quals>

[1472] < / insdfeature>

[1473] < / INSDSeq_feature-table>

[1474] <INSDSeq_sequence> gtccactaggtgaaggctga< / INSDSeq_sequence>

[1475] < / insdseq>

[1476] < / sequencedata>

[1477] <sequencedata sequenceidnumber="60">

[1478] <insdseq>

[1479] <INSDSeq_length>20< / INSDSeq_length>

[1480] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1481] <INSDSeq_division>PAT< / INSDSeq_division>

[1482] <INSDSeq_feature-table>

[1483] <insdfeature>

[1484] <INSDFeature_key>source< / INSDFeature_key>

[1485] <INSDFeature_location>1..20< / INSDFeature_location>

[1486] <INSDFeature_quals>

[1487] <insdqualifier>

[1488] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1489] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1490] < / insdqualifier>

[1491] <insdqualifier id="q122">

[1492] <INSDQualifier_name>organism< / INSDQualifier_name>

[1493] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1494] < / insdqualifier>

[1495] < / INSDFeature_quals>

[1496] < / insdfeature>

[1497] < / INSDSeq_feature-table>

[1498] <INSDSeq_sequence>gtgcacgcctgtagtacctt< / INSDSeq_sequence>

[1499] < / insdseq>

[1500] < / sequencedata>

[1501] <sequencedata sequenceidnumber="61">

[1502] <insdseq>

[1503] <INSDSeq_length> 21< / INSDSeq_length>

[1504] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1505] <INSDSeq_division> PAT< / INSDSeq_division>

[1506] <INSDSeq_feature-table>

[1507] <insdfeature>

[1508] <INSDFeature_key>source< / INSDFeature_key>

[1509] <INSDFeature_location>1..21< / INSDFeature_location>

[1510] <INSDFeature_quals>

[1511] <insdqualifier>

[1512] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1513] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1514] < / insdqualifier>

[1515] <insdqualifier id="q124">

[1516] <INSDQualifier_name>organism< / INSDQualifier_name>

[1517] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1518] < / insdqualifier>

[1519] < / INSDFeature_quals>

[1520] < / insdfeature>

[1521] < / INSDSeq_feature-table>

[1522] <INSDSeq_sequence> tgtactggtttcaaaggcgct< / INSDSeq_sequence>

[1523] < / insdseq>

[1524] < / sequencedata>

[1525] <sequencedata sequenceidnumber="62">

[1526] <insdseq>

[1527] <INSDSeq_length> 20< / INSDSeq_length>

[1528] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1529] <INSDSeq_division> PAT< / INSDSeq_division>

[1530] <INSDSeq_feature-table>

[1531] <insdfeature>

[1532] <INSDFeature_key>source< / INSDFeature_key>

[1533] <INSDFeature_location>1..20< / INSDFeature_location>

[1534] <INSDFeature_quals>

[1535] <insdqualifier>

[1536] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1537] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1538] < / insdqualifier>

[1539] <insdqualifier id="q126">

[1540] <INSDQualifier_name>organism< / INSDQualifier_name>

[1541] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1542] < / insdqualifier>

[1543] < / INSDFeature_quals>

[1544] < / insdfeature>

[1545] < / INSDSeq_feature-table>

[1546] <INSDSeq_sequence> gggttcttaagctgcctcca< / INSDSeq_sequence>

[1547] < / insdseq>

[1548] < / sequencedata>

[1549] <sequencedata sequenceidnumber="63">

[1550] <insdseq>

[1551] <INSDSeq_length>21< / INSDSeq_length>

[1552] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1553] <INSDSeq_division>PAT< / INSDSeq_division>

[1554] <INSDSeq_feature-table>

[1555] <insdfeature>

[1556] <INSDFeature_key>source< / INSDFeature_key>

[1557] <INSDFeature_location>1..21< / INSDFeature_location>

[1558] <INSDFeature_quals>

[1559] <insdqualifier>

[1560] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1561] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1562] < / insdqualifier>

[1563] <insdqualifier id="q128">

[1564] <INSDQualifier_name>organism< / INSDQualifier_name>

[1565] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1566] < / insdqualifier>

[1567] < / INSDFeature_quals>

[1568] < / insdfeature>

[1569] < / INSDSeq_feature-table>

[1570] <INSDSeq_sequence>caccaaagccctaaagtagca< / INSDSeq_sequence>

[1571] < / insdseq>

[1572] < / sequencedata>

[1573] <sequencedata sequenceidnumber="64">

[1574] <insdseq>

[1575] <INSDSeq_length> 20< / INSDSeq_length>

[1576] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1577] <INSDSeq_division> PAT< / INSDSeq_division>

[1578] <INSDSeq_feature-table>

[1579] <insdfeature>

[1580] <INSDFeature_key>source< / INSDFeature_key>

[1581] <INSDFeature_location>1..20< / INSDFeature_location>

[1582] <INSDFeature_quals>

[1583] <insdqualifier>

[1584] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1585] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1586] < / insdqualifier>

[1587] <insdqualifier id="q130">

[1588] <INSDQualifier_name>organism< / INSDQualifier_name>

[1589] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1590] < / insdqualifier>

[1591] < / INSDFeature_quals>

[1592] < / insdfeature>

[1593] < / INSDSeq_feature-table>

[1594] <INSDSeq_sequence> ctggccaatgcagttccaga< / INSDSeq_sequence>

[1595] < / insdseq>

[1596] < / sequencedata>

[1597] <sequencedata sequenceidnumber="65">

[1598] <insdseq>

[1599] <INSDSeq_length>20< / INSDSeq_length>

[1600] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1601] <INSDSeq_division>PAT< / INSDSeq_division>

[1602] <INSDSeq_feature-table>

[1603] <insdfeature>

[1604] <INSDFeature_key>source< / INSDFeature_key>

[1605] <INSDFeature_location>1..20< / INSDFeature_location>

[1606] <INSDFeature_quals>

[1607] <insdqualifier>

[1608] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1609] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1610] < / insdqualifier>

[1611] <insdqualifier id="q132">

[1612] <INSDQualifier_name>organism< / INSDQualifier_name>

[1613] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1614] < / insdqualifier>

[1615] < / INSDFeature_quals>

[1616] < / insdfeature>

[1617] < / INSDSeq_feature-table>

[1618] <INSDSeq_sequence>ctccaccatctcgtagtcct< / INSDSeq_sequence>

[1619] < / insdseq>

[1620] < / sequencedata>

[1621] <sequencedata sequenceidnumber="66">

[1622] <insdseq>

[1623] <INSDSeq_length> 20< / INSDSeq_length>

[1624] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1625] <INSDSeq_division> PAT< / INSDSeq_division>

[1626] <INSDSeq_feature-table>

[1627] <insdfeature>

[1628] <INSDFeature_key>source< / INSDFeature_key>

[1629] <INSDFeature_location>1..20< / INSDFeature_location>

[1630] <INSDFeature_quals>

[1631] <insdqualifier>

[1632] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1633] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1634] < / insdqualifier>

[1635] <insdqualifier id="q134">

[1636] <INSDQualifier_name>organism< / INSDQualifier_name>

[1637] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1638] < / insdqualifier>

[1639] < / INSDFeature_quals>

[1640] < / insdfeature>

[1641] < / INSDSeq_feature-table>

[1642] <INSDSeq_sequence> agcagacagatttctcgtcc< / INSDSeq_sequence>

[1643] < / insdseq>

[1644] < / sequencedata>

[1645] <sequencedata sequenceidnumber="67">

[1646] <insdseq>

[1647] <INSDSeq_length>19< / INSDSeq_length>

[1648] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1649] <INSDSeq_division>PAT< / INSDSeq_division>

[1650] <INSDSeq_feature-table>

[1651] <insdfeature>

[1652] <INSDFeature_key>source< / INSDFeature_key>

[1653] <INSDFeature_location>1..19< / INSDFeature_location>

[1654] <INSDFeature_quals>

[1655] <insdqualifier>

[1656] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1657] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1658] < / insdqualifier>

[1659] <insdqualifier id="q136">

[1660] <INSDQualifier_name>organism< / INSDQualifier_name>

[1661] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1662] < / insdqualifier>

[1663] < / INSDFeature_quals>

[1664] < / insdfeature>

[1665] < / INSDSeq_feature-table>

[1666] <INSDSeq_sequence>tccaccatctcgtagtcct< / INSDSeq_sequence>

[1667] < / insdseq>

[1668] < / sequencedata>

[1669] <sequencedata sequenceidnumber="68">

[1670] <insdseq>

[1671] <INSDSeq_length> 16< / INSDSeq_length>

[1672] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1673] <INSDSeq_division> PAT< / INSDSeq_division>

[1674] <INSDSeq_feature-table>

[1675] <insdfeature>

[1676] <INSDFeature_key>source< / INSDFeature_key>

[1677] <INSDFeature_location>1..16< / INSDFeature_location>

[1678] <INSDFeature_quals>

[1679] <insdqualifier>

[1680] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1681] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1682] < / insdqualifier>

[1683] <insdqualifier id="q138">

[1684] <INSDQualifier_name>organism< / INSDQualifier_name>

[1685] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1686] < / insdqualifier>

[1687] < / INSDFeature_quals>

[1688] < / insdfeature>

[1689] < / INSDSeq_feature-table>

[1690] <INSDSeq_sequence> ggggggcgtcttagc< / INSDSeq_sequence>

[1691] < / insdseq>

[1692] < / sequencedata>

[1693]

[1694] <---

Images