METHOD FOR PRODUCING CRISPR-Cas RIBONUCLEOPROTEIN COMPLEX PREPARATION AND PREPARATION FOR DETECTING THE bla-CTX-M-15 ANTIBIOTIC RESISTANCE GENE IN ULTRA-LOW CONCENTRATIONS
Guide RNAs and CRISPR-Cas ribonucleoprotein complexes enable ultra-sensitive detection of bla-CTX-M-15, addressing the limitations of existing methods by allowing rapid, cost-effective detection of single copies without specialized equipment.
Patent Information
- Application Number
- RU2025131539
- Authority / Receiving Office
- RU · RU
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2025-11-13
- Publication Date
- 2026-07-07
- Estimated Expiration
- 2045-11-13
AI Technical Summary
Existing methods for detecting the antibiotic resistance gene bla-CTX-M-15 are time-consuming, require specialized equipment, and are not sensitive enough to identify single copies, posing challenges for rapid and accurate diagnostics.
Development of guide RNAs and CRISPR-Cas ribonucleoprotein complexes, specifically using LbCpf1 from Lachnospiraceae, to detect bla-CTX-M-15 with high sensitivity, enabling detection of single copies without the need for nucleic acid isolation or specialized equipment.
The proposed method achieves ultra-sensitive detection of bla-CTX-M-15 down to single copies, accelerating diagnostics and simplifying the process while reducing costs and equipment requirements.
Smart Images

Figure 00000014 
Figure 00000015 
Figure 00000016
Abstract
Description
[0001] The invention relates to the field of genetic engineering and biotechnology, namely to guide RNAs that can be used in CRISPR-Cas12 systems as part of ribonucleoprotein complexes for identifying (detecting, detecting) the antibiotic resistance gene bla-CTX-M-15, as well as to methods for producing preparations of the CRISPR-Cas ribonucleoprotein complex and to the preparations themselves.
[0002] The invention allows for the in vitro detection of single copies of the antibiotic resistance gene bla-CTX-M-15.
[0003] The guide RNAs described in this application can be used to detect the bla-CTX-M-15 antibiotic resistance gene after specific amplification of a fragment of the bla-CTX-M-15 antibiotic resistance gene. The amplification can be carried out by various methods, including polymerase chain reaction (PCR); loop-mediated isothermal amplification (LAMP); helicase-dependent amplification (HDA); recombinase-mediated amplification (RPA); strand displacement amplification (SDA); nucleic acid sequence-based amplification (NASBA); transcription-mediated amplification (TMA); nicking enzyme-mediated amplification (NEAR); circular amplification (RCA) and many other types of amplification.
[0004] The guide RNAs described in this application can be used to develop highly sensitive and high-tech next-generation diagnostic systems based on CRISPR technologies to improve diagnostic methods for infectious diseases.
[0005] To address epidemiological challenges related to infectious disease outbreaks, pathogen detection, and identification, as well as the detection of specific bacterial genes, it is necessary to develop and implement modern molecular epidemiology technologies into surveillance and monitoring services. One such technology is the use of genetic editing elements of the CRISPR-Cas system. This technology is developing quite effectively for the development of treatments for certain diseases, despite a number of difficulties associated with the emergence of unforeseen mutations. In-depth research into the application of the CRISPR-Cas system has revealed its potential for sophisticated diagnostic procedures for identifying infectious agents in humans, as well as their genotyping.
[0006] In 2018, it was shown that Cas12, one of the enzymes in the CRISPR system, begins to non-specifically hydrolyze single-stranded DNA after recognizing its target DNA. This property of Cas12 can be used as an indicator of the presence of a specific target, such as the genome of a virus or bacteria. Researchers used this discovery to create a nucleic acid detection platform known as DETECTR (DNA Endonuclease Targeted CRISPR Trans Reporter). DETECTR was first used to detect and genotype the human papillomavirus (HPV). The proposed platform combines the Cas12a nuclease, its guide RNA specific to HPV nucleic acid, and a fluorescent reporter molecule. DETECTR technology is used to detect the target DNA after pre-amplification [JS Chen, E. Ma, LB Harrington, M. Da Costa, X. Tian, JM Palefsky, JADoudna, CRISPR-Cas 12a target binding releases indiscriminate single-stranded DNase activity, Science 360(6387) (2018) 436-439].
[0007] An equally important application of the CRISPR-Cas system is the identification of bacterial pathogens and the detection of specific bacterial genes. For example, the SHERLOCK platform enabled the accurate genotyping of several Escherichia coli and Pseudomonas aeruginosa strains with low cross-reactivity. Furthermore, the SHERLOCK platform was used to differentiate clinical isolates of Klebsiella pneumoniae with two different antibiotic resistance genes, opening significant potential for the development of multiplex systems for the simultaneous identification of bacterial pathogens and detection of their antibiotic resistance genes.
[0008] In this regard, the task of developing new effective methods for identifying antibiotic resistance genes in bacterial pathogens based on genetic technologies such as CRISPR-Cas is extremely urgent.
[0009] The prior art includes scientific articles describing the detection of the antibiotic resistance gene bla-CTX-M-15 in biological material [Higgins O, Chueiri A, O'Connor L, et al. Portable Differential Detection of CTX-M ESBL Gene Variants, bla CTX-М-1 and bla CTX-М-15, from Escherichia coli Isolates and Animal Fecal Samples Using Loop-Primer Endonuclease Cleavage Loop-Mediated Isothermal Amplification. Micromiol Spectr. 2023;11(1):e0331622. doi: 10.1128 / spectrum.03316-22; Maldonado J, González-Guerrero AB, Fernández-Gavela A, González-López JJ, Lechuga LM. Ultrasensitive Label-Free Detection of Unamplified Multidrug-Resistance Bacteria Genes with a Bimodal Waveguide Interferometric Biosensor. Diagnostics (Basel). 2020;10(10):845. Published 2020 Oct 19. doi:10.3390 / diagnostics10100845]. The sensitivity of the described methods is 16 DNA copies / reaction and 30 aM, which corresponds to 10 5 CFU / ml, respectively [Higgins O, Chueiri A, O'Connor L, et al. Portable Differential Detection of CTX-M ESBL Gene Variants, bla CTX-М-1 and bla CTX-М-15, from Escherichia coli Isolates and Animal Fecal Samples Using Loop-Primer Endonuclease Cleavage Loop-Mediated Isothermal Amplification. Microbiol Spectr. 2023;11(1):e0331622. doi:10.1128 / spectrum.03316-22; Maldonado J, González-Guerrero AB, Fernández-Gavela A, González-López JJ, Lechuga LM. Ultrasensitive Label-Free Detection of Unamplified Multidrug-Resistance Bacteria Genes with a Bimodal Waveguide Interferometric Biosensor. Diagnostics (Basel). 2020; 10(10):845. Published 2020 Oct 19. doi:10.3390 / diagnostics10100845]. Commercial reagent kits "AmpliTest® ESBL CTX-M LAMP" (RU No. RZN 2023 / 20771) with a sensitivity of 2×10 3 copies / ml up to 1×10 5 copies / ml depending on the clinical material being studied [https: / / amplitest.ru / catalog / nabory_dlya_diagnostiki_infektsionnykh_zabolevaniy / amplitest_blr_s_ctx_m_lamp / ] and “Reagent kit for detection of bla CTX-M genes of resistance of GOB to cephalosporins by the polymerase chain reaction method REZISTOM.STX-M”, intended for scientific research purposes, RUO, the sensitivity of which is not indicated in open sources of information [https: / / lytech.ru / product / infektsionnye-vozbuditeli-cheloveka / rezistentnost / blactx-m / ].
[0010] Until now, most extended-spectrum beta-lactamase detection kits, including the beta-lactamase encoded by the bla-CTX-M-15 gene, rely on agar diffusion testing and isoelectric point determination, which is generally considered sufficient for identifying strains producing ESBLs. However, due to the emergence of a large number of different bla-SHV, bla-TEM, and bla-CTX-M beta-lactamases, isoelectric focusing (IEF) appears to be unsuitable for phenotype determination of ESBLs. Furthermore, the described methods require extensive time, specialized equipment, and qualified personnel (microbiology).
[0011] The closest analogues of the claimed solution are inventions under patents RU 2745637 (priority date 15.04.2020) aimed at obtaining guide RNAs intended for the development of highly sensitive and high-tech next-generation diagnostic systems for detecting the antibiotic resistance gene blaVIM-2 (metallo-beta-lactamase class B VIM-2) of Pseudomos aeruginosa; RU 2782315 (priority date 27.12.2021), disclosing the technical feasibility of obtaining guide RNAs intended for the development of highly sensitive and high-tech next-generation diagnostic systems for detecting the antibiotic resistance gene mecA of Staphylococcus aureus based on CRISPR technologies; RU 2782739 (priority date 27.12.2021), disclosing the possibility of obtaining guide RNAs intended for the development of highly sensitive and high-tech diagnostic systems of a new generation for the detection of exoU encoding the exotoxin of the type 3 secretion system of Pseudomonas aeruginosa based on CRISPR technologies; RU 2820307 (priority date 05.12.2023) aimed at obtaining guide RNAs intended for the development of highly sensitive and high-tech diagnostic systems of a new generation for the detection of the antibiotic resistance gene bla-TEM-1 B; RU 2839763 (priority date 30.09.2024), disclosing the possibility of obtaining guide RNAs intended for the development of highly sensitive and high-tech diagnostic systems of a new generation for the detection of the antibiotic resistance gene bla-OXA-1 in ultra-low concentrations; RU 2839484 (priority date 30.09.2024), which discloses a method for detecting the antibiotic resistance gene bla-NDM-1.However, to expand the range of such diagnostic systems and improve methods for diagnosing infectious diseases, epidemiological surveillance and monitoring the spread of antibiotic-resistant microorganisms, it is necessary to develop new methods for identifying antibiotic resistance genes in pathogenic microorganisms.
[0012] Based on the above, a technical problem arises, which is the need to develop and obtain guide RNAs to detect single copies of the antibiotic resistance gene bla-CTX-M-15 in vitro.
[0013] The proposed technology is promising for a variety of applications, including DNA / RNA quantification, rapid multiplex expression detection, and other sensitive detection methods, such as identifying nucleic acid contamination in samples. CRISPR-Cas-based technology is a multifunctional, error-tolerant DNA detection technology suitable for rapid diagnosis, including infectious disease genotyping, and identification of antibiotic resistance genes and exotoxin-encoding genes in bacterial pathogens.
[0014] The application of the proposed technology makes it possible to create new generation diagnostic systems that will have the following properties:
[0015] • high sensitivity;
[0016] • the possibility of carrying out diagnostics at the patient’s bedside;
[0017] • the ability to carry out diagnostics in field conditions without the use of specialized high-tech equipment;
[0018] • speed and ease of analysis;
[0019] • reduced cost of analysis;
[0020] • no need to equip the diagnostic laboratory with expensive equipment;
[0021] • no need to isolate nucleic acids of the pathogen.
[0022] The invention relates to new agents - guide RNA, which can be used in CRISPR-Cas 12 systems for ultra-sensitive detection, identification, detection or detection of the antibiotic resistance gene bla-CTX-M-15 in biological samples.
[0023] The technical objective of the proposed invention is to develop new agents - guide RNAs that can be used in CRISPR-Cas 12 systems with Cas12 proteins, for example, LbCpf1 from Lachnospiraceae, for ultra-sensitive detection of the antibiotic resistance gene bla-CTX-M-15.
[0024] By implementing the present invention, according to the set of essential features set forth in the claims, an unexpected technical result is achieved—the ability to ultra-sensitively detect the bla-CTX-M-15 antibiotic resistance gene down to single copies in a single reaction. The invention increases the efficiency of detecting the bla-CTX-M-15 antibiotic resistance gene by up to twofold. The proposed invention also accelerates and simplifies the production of the final CRISPR-Cas ribonucleoprotein complex.
[0025] The technical result is achieved due to:
[0026] • development of guide RNA molecules that can be used in CRISPR-Cas 12 systems for ultra-sensitive detection of the bla-CTX-M-15 antibiotic resistance gene, wherein said guide RNAs are selected from the sequences of SEQ ID NO: 1-7, are capable of binding to target highly conserved regions of the bla-CTX-M-15 antibiotic resistance gene, contain an RNA hairpin that is recognized by the RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae, ensuring the detection of single copies of the bla-CTX-M-15 antibiotic resistance gene;
[0027] • the use of RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae, obtained according to the method previously developed by the authors (RU patent No. 2707542, priority date 03 / 28 / 2019), to create ribonucleoprotein complexes (RNCs) of the CRISPR-Cas system suitable for detecting the antibiotic resistance gene bla-CTX-M-15 in ultra-low concentrations (single copies);
[0028] • development of a set of specific oligonucleotides selected from SEQ ID NO: 8-38 for preliminary amplification of a fragment of the antibiotic resistance gene bla-CTX-M-15;
[0029] • optimization of conditions for preliminary amplification of the bla-CTX-M-15 antibiotic resistance gene fragment;
[0030] • determination of conditions for ultrasensitive detection of the antibiotic resistance gene bla-СТХ-М-15 and establishment of the sequence of stages of the method.
[0031] The guide RNAs according to the present invention correspond to highly conserved fragments of the antibiotic resistance gene bla-CTX-M-15. Most preferred are guide RNAs recognized by the RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae, characterized by, having or containing a nucleotide sequence selected from:
[0032] • SEQ ID NO: 1;
[0033] • SEQ ID NO: 2;
[0034] • SEQ ID NO: 3;
[0035] • SEQ ID NO: 4;
[0036] • SEQ ID NO: 5;
[0037] • SEQ ID NO: 6;
[0038] • SEQ ID NO: 7;
[0039] • or at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to any of them,
[0040] • or the complementary of any of them,
[0041] • or hybridizing with any of them under strict conditions.
[0042] Specific oligonucleotides for preliminary amplification of a fragment of the antibiotic resistance gene bla-CTX-M-15, according to the present invention, correspond to a highly conserved region of the antibiotic resistance gene bla-CTX-M-15. Most preferred are oligonucleotides characterized by, having or containing a nucleotide sequence selected from:
[0043] • SEQ ID NO: 8;
[0044] • SEQ ID NO: 9;
[0045] • SEQ ID NO: 10;
[0046] • SEQ ID NO: 11;
[0047] • SEQ ID NO: 12;
[0048] • SEQ ID NO: 13;
[0049] • SEQ ID NO: 14;
[0050] • SEQ ID NO: 15;
[0051] • SEQ ID NO: 16;
[0052] • SEQ ID NO: 17;
[0053] • SEQ ID NO: 18;
[0054] • SEQ ID NO: 19;
[0055] • SEQ ID NO: 20;
[0056] • SEQ ID NO: 21;
[0057] • SEQ ID NO: 22;
[0058] • SEQ ID NO: 23;
[0059] • SEQ ID NO: 24;
[0060] • SEQ ID NO: 25;
[0061] • SEQ ID NO: 26;
[0062] • SEQ ID NO: 27;
[0063] • SEQ ID NO: 28;
[0064] • SEQ ID NO: 29;
[0065] • SEQ ID NO: 30;
[0066] • SEQ ID NO: 31;
[0067] • SEQ ID NO: 32;
[0068] • SEQ ID NO: 33;
[0069] • SEQ ID NO: 34;
[0070] • SEQ ID NO: 35;
[0071] • SEQ ID NO: 36;
[0072] • SEQ ID NO: 37;
[0073] • SEQ ID NO: 38;
[0074] • or at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of them,
[0075] • or the complementary of any of them,
[0076] • or hybridizing with any of them under strict conditions.
[0077] According to the proposed invention, ribonucleoprotein complexes (RNCs) are obtained, consisting of at least one guide RNA and an RNA-directed DNA nuclease of the CRISPR-Cas system LbCpf1 from Lachnospiraceae, suitable for use in detecting the antibiotic resistance gene bla-CTX-M-15 in ultra-low concentrations (single copies).
[0078] The RPC preparations are solutions containing a guide RNA selected from SEQ ID NO: 1-7, combined with a protein of the CRISPR-Cas system (LbCpf1 from Lachnospiraceae) or freeze-dried RPC.
[0079] The obtained guide RNAs can be used as part of a kit for detecting the antibiotic resistance gene bla-CTX-M-15 with instructions for use.
[0080] The kit may further comprise components for preliminary amplification of a highly conserved fragment of the bla-CTX-M-15 antibiotic resistance gene, including one or more specific oligonucleotides selected from SEQ ID NO: 8-38. Moreover, at least one guide RNA in the kit may be in a complex with a CRISPR-Cas system protein (LbCpf1 from Lachnospiraceae) in a single container or separately in different containers.
[0081] The method for producing a preparation of the CRISPR-Cas ribonucleoprotein complex comprises:
[0082] (i) combining the CRISPR-Cas family Cas protein LbCpf1 from Lachnospiraceae into a complex with at least one guide RNA of SEQ ID NO: 1-7 and, if necessary,
[0083] (ii) lyophilizing the CRISPR-Cas ribonucleoprotein complex obtained in step (i),
[0084] thus obtaining a preparation of the CRISPR-Cas ribonucleoprotein complex
[0085] A preparation of the CRISPR-Cas ribonucleoprotein complex for detecting the bla-CTX-M-15 antibiotic resistance gene is proposed, which can be obtained by the method disclosed in this application. The preparation comprises the Cas protein of the CRISPR-Cas family LbCpf1 from Lachnospiraceae in a complex with at least one guide RNA with SEQ ID NOs: 1-7
[0086] The drug can be presented either in liquid form - a solution of the specified CRISPR-Cas ribonucleoprotein complex, or in the form of a lyophilisate - a lyophilized powder of the specified CRISPR-Cas ribonucleoprotein complex.
[0087] The proposed technology enables the detection of single copies of the bla-CTX-M-15 antibiotic resistance gene in patient biological samples selected from fluid and / or tissue suspected of containing the bla-CTX-M-15 antibiotic resistance gene. A biological sample may include blood, serum, or plasma, blood cells, saliva, sputum, lymphoid tissue, hematopoietic organ tissue, and other patient biological materials that can be used to analyze for the presence of the bla-CTX-M-15 antibiotic resistance gene.
[0088] Brief description of drawings
[0089] Fig. 1. Visualization of the amplified fragment of the antibiotic resistance gene bla-CTX-M-15 (708 bp in size) after preliminary amplification using oligonucleotides cm 15-1 for and cm 15-1 rev by electrophoresis in agarose gel, where the numbers 1-8 indicate:
[0090] 1 - Product obtained during amplification 7.79×10 6copies of the model matrix pGEM-T-bla-CTX-M-15;
[0091] 2 - Product obtained during amplification 7.79×10 5 copies of the model matrix pGEM-T-bla-CTX-M-15;
[0092] 3 - Product obtained during amplification 7.79×10 4 copies of the model matrix pGEM-T-bla-CTX-M-15;
[0093] 4 - Product obtained during the amplification of 7790 copies of the model template pGEM-T-bla-CTX-M-15;
[0094] 5 - Product obtained during the amplification of 779 copies of the model template pGEM-T-bla-CTX-M-15;
[0095] 6 - Product obtained during the amplification of 78 copies of the model matrix pGEM-T-bla-CTX-M-15;
[0096] 7 - Product obtained during the amplification of 8 copies of the model matrix pGEM-T-bla-CTX-M-15;
[0097] 8 - negative control, not containing the model matrix pGEM-T-bla-CTX-M-15;
[0098] M - molecular weight standards: from bottom to top 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000 nucleotide pairs (GeneRuler 100 bp Plus, Thermo Fisher Scientific, USA).
[0099] Fig. 2. Real-time fluorescence profile of a pre-amplified fragment of the antibiotic resistance gene bla-CTX-M-15 treated with a ribonucleoprotein complex containing the guide RNA crRNA-417 of CTX-M15 and the protein LbCpf1, in which the detection of a fragment of the model template pGEM-T-bla-CTX-M-15 by the ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing the guide RNA crRNA-417 of CTX-M15 is visualized by means of a graph, where:
[0100] - the vertical axis indicates the values of the normalized fluorescent signal generated by the dye;
[0101] - the horizontal axis indicates the fluorescence time in minutes;
[0102] - curves 9-16 show the number of copies of nucleic acid per reaction, namely:
[0103] 9 - 7790000 copies / reaction;
[0104] 10 - 779000 copies / reaction;
[0105] 11 - 77900 copies / reaction;
[0106] 12 - 7790 copies / reaction;
[0107] 13 - 779 copies / reaction;
[0108] 14 - 78 copies / reaction;
[0109] 15 - 8 copies / reaction;
[0110] 16 - K- (negative control).
[0111] Fig. 3. Real-time fluorescence profile of a pre-amplified fragment of the antibiotic resistance gene bla-CTX-M-15 treated with a ribonucleoprotein complex containing the guide RNA crRNA-663 of CTX-M15 and the protein LbCpf1, in which the detection of a fragment of the model template pGEM-T-bla-CTX-M-15 by the ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing the guide RNA crRNA-663 of CTX-M15 is visualized by means of a graph, where:
[0112] - the vertical axis shows the values of the normalized fluorescent signal generated by the dye;
[0113] - the horizontal axis indicates the fluorescence time in minutes;
[0114] - curves 17-24 show the number of copies of nucleic acid per reaction, namely:
[0115] 17 - 7790000 copies / reaction;
[0116] 18 - 779000 copies / reaction;
[0117] 19 - 77900 copies / reaction;
[0118] 20 - 7790 copies / reaction;
[0119] 21 - 779 copies / reaction;
[0120] 22 - 78 copies / reaction;
[0121] 23 - 8 copies / reaction;
[0122] 24 - K- (negative control).
[0123] Fig. 4. Real-time fluorescence profile of a pre-amplified fragment of the antibiotic resistance gene bla-CTX-M-15 treated with a ribonucleoprotein complex containing the guide RNA crRNA-5 of CTX-M15 and the protein LbCpf1, in which the detection of a fragment of the model template pGEM-T-bla-CTX-M-15 by the ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing the guide RNA crRNA-5 of CTX-M15 is visualized by means of a graph, where:
[0124] - the vertical axis shows the values of the normalized fluorescent signal generated by the dye;
[0125] - the horizontal axis indicates the fluorescence time in minutes;
[0126] - curves 25-32 show the number of copies of nucleic acid per reaction, namely:
[0127] 25 - 7790000 copies / reaction;
[0128] 26 - 779000 copies / reaction;
[0129] 27 - 77900 copies / reaction;
[0130] 28 - 7790 copies / reaction;
[0131] 29 - 779 copies / reaction;
[0132] 30 - 78 copies / reaction;
[0133] 31 - 8 copies / reaction;
[0134] 32 - K- (negative control).
[0135] Fig. 5. Real-time fluorescence profile of the pre-amplified fragment of the antibiotic resistance gene bla-CTX-M-15 treated with a ribonucleoprotein complex containing the guide RNA crRNA-473 of CTX-M15 and the protein LbCpf1, in which the detection of the fragment of the model template pGEM-T-bla-CTX-M-15 by the ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing the guide RNA crRNA-473 of CTX-M15 is visualized by means of a graph, where:
[0136] - the vertical axis shows the values of the normalized fluorescent signal generated by the dye;
[0137] - the horizontal axis indicates the fluorescence time in minutes;
[0138] - curves 33-40 show the number of copies of nucleic acid per reaction, namely.
[0139] 33 - 7790000 copies / reaction;
[0140] 34 - 779000 copies / reaction;
[0141] 35 - 77900 copies / reaction;
[0142] 36 - 7790 copies / reaction;
[0143] 37 - 779 copies / reaction;
[0144] 38 - 78 copies / reaction;
[0145] 39 - 8 copies / reaction;
[0146] 40 - K- (negative control).
[0147] Fig. 6. Real-time fluorescence profile of a pre-amplified fragment of the antibiotic resistance gene bla-CTX-M-15 treated with a ribonucleoprotein complex containing the guide RNA crRNA-158 of CTX-M15 and the protein LbCpf1, in which the detection of a fragment of the model template pGEM-T-bla-CTX-M-15 by the ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing the guide RNA crRNA-158 of CTX-M15 is visualized by means of a graph, where:
[0148] - the vertical axis shows the values of the normalized fluorescent signal generated by the dye;
[0149] - the horizontal axis indicates the fluorescence time in minutes;
[0150] - curves 41-48 show the number of copies of nucleic acid per reaction, namely:
[0151] 41 - 7790000 copies / reaction;
[0152] 42 - 779000 copies / reaction;
[0153] 43 - 77900 copies / reaction;
[0154] 44 - 7790 copies / reaction;
[0155] 45 - 779 copies / reaction;
[0156] 46 - 78 copies / reaction;
[0157] 47 - 8 copies / reaction;
[0158] 48 - K- (negative control).
[0159] Fig. 7. Real-time fluorescence profile of a pre-amplified fragment of the antibiotic resistance gene bla-CTX-M-15 treated with a ribonucleoprotein complex containing the guide RNA crRNA-383 of CTX-M15 and the protein LbCpf1, in which the detection of a fragment of the model template pGEM-T-bla-CTX-M-15 by the ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing the guide RNA crRNA-383 of CTX-M15 is visualized by means of a graph, where:
[0160] - the vertical axis shows the values of the normalized fluorescent signal generated by the dye;
[0161] - the horizontal axis indicates the fluorescence time in minutes;
[0162] - curves 49-56 show the number of copies of nucleic acid per reaction, namely:
[0163] 49 - 7790000 copies / reaction;
[0164] 50 - 779000 copies / reaction;
[0165] 51 - 77900 copies / reaction;
[0166] 52 - 7790 copies / reaction;
[0167] 53 - 779 copies / reaction;
[0168] 54 - 78 copies / reaction;
[0169] 55 - 8 copies / reaction;
[0170] 56 - K- (negative control).
[0171] Fig. 8. Real-time fluorescence profile of a pre-amplified fragment of the antibiotic resistance gene bla-CTX-M-15 treated with a ribonucleoprotein complex containing the guide RNA crRNA-240 of CTX-M15 and the protein LbCpf1, in which the detection of a fragment of the model template pGEM-T-bla-CTX-M-15 by the ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing the guide RNA crRNA-240 of CTX-M15 is visualized by means of a graph, where:
[0172] - the vertical axis shows the values of the normalized fluorescent signal generated by the dye;
[0173] - the horizontal axis indicates the fluorescence time in minutes;
[0174] - curves 57-64 show the number of copies of nucleic acid per reaction, namely:
[0175] 57 - 7790000 copies / reaction;
[0176] 58 - 779000 copies / reaction;
[0177] 59 - 77,900 copies / reaction;
[0178] 60 - 7790 copies / reaction;
[0179] 61 - 779 copies / reaction;
[0180] 62 - 78 copies / reaction;
[0181] 63-8 copies / reaction;
[0182] 64 - K- (negative control).
[0183] Fig. 9. End-point fluorescence values (60 assay cycles, 60 minutes) for the pre-amplified fragment of the antibiotic resistance gene bla-CTX-M-15 treated with ribonucleoprotein complexes containing the guide RNAs crRNA-417 CTX-M15, crRNA-663 CTX-M15, crRNA-5 CTX-M15, crRNA-473 CTX-M15, crRNA-158 CTX-M15, crRNA-383 CTX-M15 and crRNA-240 CTX-M15, where the detection of the pGEM-T-bla-CTX-M-15 model template fragment by the ribonucleoprotein complexes LbCpf1 from Lachnospiraceae is visualized by means of a graph, wherein:
[0184] - the vertical axis shows the values of the normalized fluorescent signal generated by the dye;
[0185] - the horizontal axis indicates the number of copies of the model matrix in the reaction;
[0186] - column The efficiency of detection of single copies of the pGEM-T-bla-CTX-M-15 model matrix fragment using crRNA-417 CTX-M15 was visualized;
[0187] - the column visualizes the efficiency of detecting single copies of the pGEM-T-bla-CTX-M-15 model matrix fragment using crRNA-663 CTX-M15;
[0188] - column The efficiency of detection of single copies of the pGEM-T-bla-CTX-M-15 model matrix fragment using crRNA-5 CTX-M15 was visualized;
[0189] - column The efficiency of detection of single copies of the pGEM-T-bla-CTX-M-15 model matrix fragment using crRNA-473 CTX-M15 was visualized;
[0190] - the column visualizes the efficiency of detecting single copies of the pGEM-T-bla-CTX-M-15 model matrix fragment using crRNA-158 CTX-M15;
[0191] - the column visualizes the efficiency of detecting single copies of the pGEM-T-bla-CTX-M-15 model matrix fragment using crRNA-383 CTX-M15;
[0192] - column The efficiency of detection of single copies of the pGEM-T-bla-CTX-M-15 model matrix fragment using crRNA-240 CTX-M15 was visualized.
[0193] Fig. 10. Visualization of the bla-CTX-M-15 antibiotic resistance gene fragment (708 bp in size) amplified from clinical samples after preliminary amplification using the cm 15-1 for and cm 15-1 rev oligonucleotides using agarose gel electrophoresis.
[0194] Fig. 11. End-point fluorescence values (60 analysis cycles, 60 minutes) for the bla-CTX-M-15 antibiotic resistance gene fragment pre-amplified from clinical samples and treated with ribonucleoprotein complexes containing the guide RNAs crRNA-417 CTX-M15, crRNA-663 CTX-M15, crRNA-5 CTX-M15, crRNA-473 CTX-M15, crRNA-158 CTX-M15, crRNA-383 CTX-M15, and crRNA-240 CTX-M15, where the graph visualizes the detection of the bla-CTX-M-15 antibiotic resistance gene fragment using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae on a limited panel of clinical samples, with:
[0195] - the vertical axis shows the values of the normalized fluorescent signal generated by the dye;
[0196] - sample identifiers are indicated horizontally;
[0197] - column The efficiency of detecting the fragment of the antibiotic resistance gene bla-СТХ-М-15 contained in the composition of drugs isolated from clinical samples using crRNA-417СТХ-М15 was demonstrated;
[0198] - the column shows the efficiency of detecting the fragment of the antibiotic resistance gene bla-CTX-M-15 contained in the composition of drugs isolated from clinical samples using crRNA-663 CTX-M15;
[0199] - column The efficiency of detecting the fragment of the antibiotic resistance gene bla-СТХ-М-15 contained in the composition of drugs isolated from clinical samples using crRNA-5СТХ-М15 was demonstrated;
[0200] - column The efficiency of detecting the fragment of the antibiotic resistance gene bla-СТХ-М-15 contained in the composition of drugs isolated from clinical samples using crRNA-473СТХ-М15 was demonstrated;
[0201] - the column shows the efficiency of detecting the fragment of the antibiotic resistance gene bla-CTX-M-15 contained in the composition of drugs isolated from clinical samples using crRNA-158 CTX-M15;
[0202] - the column shows the efficiency of detecting the fragment of the antibiotic resistance gene bla-CTX-M-15 contained in the composition of drugs isolated from clinical samples, using crRNA-383 CTX-M15;
[0203] - column The efficiency of detection of the fragment of the antibiotic resistance gene bla-СТХ-М-15 contained in the composition of drugs isolated from clinical samples using crRNA-240СТХ-М15 was demonstrated.
[0204] Examples of the invention
[0205] Example 1. Selection of target sequences in the antibiotic resistance gene bla-CTX-M-15 to create guide RNAs.
[0206] To select target sequences in the bla-CTX-M-15 antibiotic resistance gene for the design of guide RNAs, modern in silico algorithms for nucleotide sequence analysis and open-source software, including Benchling (https: / / www.benchling.com / molecular-biology / ), were used. A list of regions of the bla-CTX-M-15 antibiotic resistance gene was compiled with the theoretically calculated probability of their cleavage in highly conserved regions (Table 1). Guide RNAs that specifically recognize highly conserved regions of the bla-CTX-M-15 antibiotic resistance gene are represented by unique sequences (SEQ ID NOs: 1-7).
[0207]
[0208] Example 2. Preparation of material for detection of the antibiotic resistance gene bla-СТХ-М-15 by the preliminary amplification method.
[0209] Preparation of the material for detection of the bla-CTX-M-15 antibiotic resistance gene was performed using the preliminary amplification method. Plasmid DNA pGEM-T-bla-CTX-M-15, containing a 746 bp fragment of the bla-CTX-M-15 antibiotic resistance gene, was used as a model matrix.
[0210] Preliminary amplification of the region corresponding to the fragment of the antibiotic resistance gene bla-CTX-M-15 was carried out using specific oligonucleotides with SEQ ID NO: 8 and SEQ ID NO: 9.
[0211] The product encoding a fragment of the bla-CTX-M-15 antibiotic resistance gene was obtained by performing a randomized control test using specific oligonucleotides cm 15-1 for and cm 15-1 rev (GenTerra, Russia) and TaqF polymerase (Central Research Institute of Epidemiology, Rospotrebnadzor, Russia). The size of the amplified fragment was 708 nucleotide pairs.
[0212] Temperature amplification profile for obtaining PCR products of fragments of the antibiotic resistance gene bla-СТХ-М-15:
[0213] 1. Denaturation: 95°C for 3 minutes;
[0214] 2. 40 amplification cycles: 95°C - 15 sec, 55°C - 45 sec, 72°C - 30 sec;
[0215] 3. Final elongation: 72°C for 5 minutes.
[0216] During the preparation of the material for the detection of the antibiotic resistance gene bla-CTX-M-15 by the preliminary amplification method, titration of the model matrix pGEM-T-bla-CTX-M-15 was carried out by preparing serial dilutions (Table 2).
[0217]
[0218] To evaluate the efficiency of preliminary amplification, the obtained fragment of the antibiotic resistance gene bla-CTX-M-15 was visualized using electrophoresis in agarose gel (Fig. 1).
[0219] The material prepared in the described manner was used for experiments to identify the antibiotic resistance gene bla-CTX-M-15 using ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing guide RNAs crRNA-417 CTX-M15, crRNA-663 CTX-M15, crRNA-5 CTX-M15, crRNA-473 CTX-M15, crRNA-158 CTX-M15, crRNA-383 CTX-M15 and crRNA-240 CTX-M15, without preliminary purification.
[0220] Example 3. Creation of ribonucleoprotein complexes for detection of the antibiotic resistance gene bla-CTX-M-15.
[0221] The specific RNA oligonucleotides shown in Table 3 were used as guide RNAs to detect the antibiotic resistance gene bla-CTX-M-15.
[0222]
[0223] The authors created a ready-made ribonucleoprotein complex containing the CRISPR-Cas 12 protein LbCpf1 from Lachnospiraceae and guide RNA according to the standard protocol with some modifications [C. Anders, M. Jinek, In vitro enzymology of Cas9, Methods Enzymol. 546 (2014) 1-20, https: / / doi.org / 10.1016 / B978-0-12-801185-0.00001-5]. To form the ready-made ribonucleoprotein complex, 250 ng of the Cas protein LbCpf1 from Lachnospiraceae and guide RNA were mixed and incubated for 10 minutes at room temperature. The ribonucleoprotein complex obtained in this way is ready for detection of the antibiotic resistance gene bla-CTX-M-15.
[0224] Example 4. Detection of single copies of the antibiotic resistance gene bla-CTX-M-15 using CRISPR / Cas ribonucleoprotein complexes using a model matrix.
[0225] The pre-amplified material obtained by the method described in Example 2 was used as a template for detecting the antibiotic resistance gene bla-CTX-M-15 using CRISPR-Cas ribonucleoprotein complexes obtained by the method described in Example 3.
[0226] To detect the antibiotic resistance gene bla-CTX-M-15 using CRISPR-Cas ribonucleoprotein complexes, a reaction mixture containing the following components was prepared:
[0227] • 10× buffer (100 mM TrisHCl pH 8.0, 1 M NaCl);
[0228] • 50 mM MgCl2 (final concentration in the reaction mixture 10 mM);
[0229] • 250 ng ribonucleoprotein complex (LbCpf1 from Lachnospiraceae and guide RNAs crRNA-417 CTX-M15, crRNA-663 CTX-M15, crRNA-5 CTX-M15, crRNA-473 CTX-M15, crRNA-158 CTX-M15, crRNA-383 CTX-M15 and crRNA-240 CTX-M15);
[0230] • 10 pmol fluorescent probe (6FAM-TTATT-BHQ1);
[0231] • Target (pre-amplified fragment of the antibiotic resistance gene bla-CTX-M-15);
[0232] • water mQ.
[0233] Reaction mixtures containing all the necessary components were placed in a QuantStudio 5 thermocycler (Thermo Fisher Scientific, USA) and the following reaction parameters were set:
[0234] 30-60 cycles:
[0235] 1. 37°C - 35 sec,
[0236] 2. 37°C - 25 sec, fluorescence imaging.
[0237] First of all, experiments were carried out to detect single copies of the antibiotic resistance gene bla-CTX-M-15 using CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpf1 from Lachnospiraceae, using as a target a model matrix - plasmid DNA pGEM-T-bla-CTX-M-15, containing in its composition a fragment of the antibiotic resistance gene bla-CTX-M-15 of 746 bp.
[0238] To detect single copies of the bla-CTX-M-15 antibiotic resistance gene using CRISPR-Cas ribonucleoprotein complexes, we optimized the preliminary amplification process. Additional oligonucleotides with SEQ ID NOs: 10-38 were developed to amplify a fragment of the bla-CTX-M-15 antibiotic resistance gene contained in the pGEM-T-bla-CTX-M-15 model template. The amplification products obtained under optimized conditions were used as a template for detecting single copies of the bla-CTX-M-15 antibiotic resistance gene using CRISPR-Cas ribonucleoprotein complexes obtained by the method described in Example 3.
[0239] CRISPR-Cas ribonucleoprotein complexes were shown to be able to detect single copies of the bla-CTX-M-15 antibiotic resistance gene. Representative results of the assay are shown in real-time fluorescence profiles for a pre-amplified bla-CTX-M-15 antibiotic resistance gene fragment treated with ribonucleoprotein complexes containing the guide RNAs crRNA-417 CTX-M15, crRNA-663 CTX-M15, crRNA-5 CTX-M15, crRNA-473 CTX-M15, crRNA-158 CTX-M 15, crRNA-383 CTX-M15 and crRNA-240 CTX-M15 and the LbCpf1 protein, in Fig. 2, Fig. 3, Fig. 4, Fig. 5, Fig. 6, Fig. 7 and Fig. 8 respectively.
[0240] It should be noted that CRISPR-Cas12 complexes detect the bla-CTX-M-15 gene with varying efficiency. Thus, for crRNA-417 CTX-M15, crRNA-663 CTX-M15, crRNA-5 CTX-M15, crRNA-473 CTX-M15 and crRNA-383 CTX-M15, on average, already in the 2nd analysis cycle (2 minutes), the signal value obtained during the detection of single copies (8 copies / reaction) of the antibiotic resistance gene bla-CTX-M-15 exceeded the “noise” value (non-specific fluorescence of the control sample containing no target) by at least five times, and by the 3rd cycle (3 minutes of analysis) - by 10 times or more. Whereas for crRNA-240 CTX-M15 and crRNA-158 CTX-M15, the signal value obtained during the detection of single copies (8 copies / reaction) of the antibiotic resistance gene bla-CTX-M-15 exceeded the “noise” value (non-specific fluorescence of the control sample not containing the target) by 5 times by the 3rd cycle (3 minutes of analysis) and by the 5th cycle (5 minutes of analysis), respectively, and by 10 or more times by the 4th cycle (4 minutes) and by the 5th cycle (5 minutes of analysis), respectively.
[0241] During the study, the efficiency of detecting the antibiotic resistance gene bla-CTX-M-15 contained in the model matrix was assessed using various guide RNAs. It was shown that CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpf1 from Lachnospiraceae and guide RNAs detect the antibiotic resistance gene bla-CTX-M-15 with different efficiencies, and they can be arranged in the following order of decreasing activity (including the signal-to-noise ratio): crRNA-663 CTX-M15 ≈ crRNA-5 CTX-M15 ≈ crRNA-383 CTX-M15 ≥ crRNA-417 CTX-M15 ≈ crRNA-473 CTX-M15>crRNA-240 CTX-M15>crRNA-158 CTX-M15 (Fig. 9).
[0242] Example 5. Detection of the antibiotic resistance gene bla-CTX-M-15 using CRISPR / Cas ribonucleoprotein complexes in a limited panel of clinical samples.
[0243] The developed guide RNAs were tested on a limited panel of clinical samples (10 pcs.) containing the antibiotic resistance gene bla-CTX-M-15 (previously confirmed by next-generation sequencing).
[0244] To detect the bla-CTX-M-15 antibiotic resistance gene using CRISPR-Cas ribonucleoprotein complexes, preliminary amplification of a fragment of the bla-CTX-M-15 antibiotic resistance gene was performed. DNA samples from clinical samples of 10 patients were isolated for preliminary amplification using the commercially available RIBO-prep kit (Central Research Institute of Epidemiology, Rospotrebnadzor, Russia) according to the manufacturer's instructions.
[0245] The product encoding a fragment of the antibiotic resistance gene bla-CTX-M-15 was obtained by PCR using specific oligonucleotides cm 15-1 for and cm 15-1 rev (GenTerra, Russia) and visualized by electrophoresis in agarose gel (Fig. 10).
[0246] The material obtained in this way was used as a template for detecting the antibiotic resistance gene bla-CTX-M-15 using CRISPR-Cas ribonucleoprotein complexes obtained by the method described in Example 3.
[0247] Detection of the antibiotic resistance gene bla-CTX-M-15 using CRISPR-Cas ribonucleoprotein complexes was carried out according to the method described in Example 4.
[0248] The analysis demonstrated that CRISPR-Cas ribonucleoprotein complexes are capable of detecting the bla-CTX-M-15 antibiotic resistance gene in DNA preparations isolated from clinical samples. Moreover, on average, by the second cycle (2 minutes) of analysis, the signal value exceeded the "noise" (non-specific fluorescence of the control sample, which does not contain the target) by more than 10 times (Table 4).
[0249]
[0250]
[0251] Typical assay results are shown as examples of end-point fluorescence values (60 assay cycle, 60 minutes) for a pre-amplified fragment of the bla-CTX-M-15 antibiotic resistance gene (10 independent clinical samples) treated with ribonucleoportein complexes containing the guide RNAs crRNA-417 CTX-M15, crRNA-663 CTX-M15, crRNA-5 CTX-M15, crRNA-473 CTX-M15, crRNA-158 CTX-M15, crRNA-383 CTX-M15 and crRNA-240 CTX-M15 and the LbCpf1 protein, in Fig. 11.
[0252] The detection efficiency of the bla-CTX-M-15 antibiotic resistance gene contained in DNA preparations isolated from clinical samples using various guide RNAs in the CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpf1 from Lachnospiraceae, estimated by the ratio of signal to noise values during detection, can be presented in the following descending order: crRNA-473 CTX-M15 ≈ crRNA-417 CTX-M15>crRNA-663 CTX-M15 ≈ crRNA-5 CTX-M15 ≈ crRNA-383 CTX-M15 ≈ crRNA-240 CTX-M15>crRNA-158 CTX-M 15 (Table 4).
[0253] Thus, the developed guide RNAs allow for ultra-sensitive detection of single copies of the bla-CTX-M-15 antibiotic resistance gene and are capable of detecting it in DNA preparations isolated from clinical samples after preliminary amplification as part of CRISPR-Cas ribonucleoprotein complexes.
[0254] --->
[0255] <?xml version="1.0" encoding="UTF-8"?>
[0256] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing
[0257] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">
[0258] <st26sequencelisting dtdversion="V1_3" filename="2. Sposob
[0259] polucheniya bla-CTX-M-15.xml" softwarename="WIPO Sequence"
[0260] softwareversion="2.3.0" productiondate="2026-05-15">
[0261] <applicationidentification>
[0262] <ipofficecode>EN< / ipofficecode>
[0263] <applicationnumbertext> n / a< / applicationnumbertext>
[0264] <filingdate> 2025-11-12< / filingdate>
[0265] < / applicationidentification>
[0266] <applicantfilereference> n / a< / applicantfilereference>
[0267] <earliestpriorityapplicationidentification>
[0268] <ipofficecode> EN< / ipofficecode>
[0269] <applicationnumbertext> n0< / applicationnumbertext>
[0270] <filingdate> 2025-11-12< / filingdate>
[0271] < / earliestpriorityapplicationidentification>
[0272] <applicantname languagecode="ru">Federal Budgetary Scientific Institution Central Research Institute of Epidemiology
[0273] Rospotrebnadzor< / applicantname>
[0274] <applicantnamelatin> FBUN CRI< / applicantnamelatin>
[0275] <inventorname languagecode="ru">Alexander Tyumentsev
[0276] Igorevich< / inventorname>
[0277] <inventornamelatin> Tyumenev Aleksandr Igorevich< / inventornamelatin>
[0278] <inventiontitle languagecode="ru">Method of obtaining the drug
[0279] CRISPR-Cas ribonucleoprotein complex and a drug for detection
[0280] antibiotic resistance gene bla-CTX-M-15 in ultra-low
[0281] concentrations< / inventiontitle>
[0282] <sequencetotalquantity> 38< / sequencetotalquantity>
[0283] <sequencedata sequenceidnumber="1">
[0284] <insdseq>
[0285] <INSDSeq_length>40< / INSDSeq_length>
[0286] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0287] <INSDSeq_division>PAT< / INSDSeq_division>
[0288] <INSDSeq_feature-table>
[0289] <insdfeature>
[0290] <INSDFeature_key>source< / INSDFeature_key>
[0291] <INSDFeature_location>1..40< / INSDFeature_location>
[0292] <INSDFeature_quals>
[0293] <insdqualifier>
[0294] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0295] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0296] < / insdqualifier>
[0297] <insdqualifier>
[0298] <INSDQualifier_name>organism< / INSDQualifier_name>
[0299] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0300] < / insdqualifier>
[0301] < / INSDFeature_quals>
[0302] < / insdfeature>
[0303] < / INSDSeq_feature-table>
[0304] <INSDSeq_sequence>aatttctactaagtgtagatacgtcggctcggtacggtcg< / INSDSeq
[0305] _sequence>
[0306] < / insdseq>
[0307] < / sequencedata>
[0308] <sequencedata sequenceidnumber="2">
[0309] <insdseq>
[0310] <INSDSeq_length>40< / INSDSeq_length>
[0311] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0312] <INSDSeq_division>PAT< / INSDSeq_division>
[0313] <INSDSeq_feature-table>
[0314] <insdfeature>
[0315] <INSDFeature_key>source< / INSDFeature_key>
[0316] <INSDFeature_location>1..40< / INSDFeature_location>
[0317] <INSDFeature_quals>
[0318] <insdqualifier>
[0319] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0320] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0321] < / insdqualifier>
[0322] <insdqualifier>
[0323] <INSDQualifier_name>organism< / INSDQualifier_name>
[0324] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0325] < / insdqualifier>
[0326] < / INSDFeature_quals>
[0327] < / insdfeature>
[0328] < / INSDSeq_feature-table>
[0329] <INSDSeq_sequence>aatttctactaagtgtagatgccagatcaccgcgatatcg< / INSDSeq
[0330] _sequence>
[0331] < / insdseq>
[0332] < / sequencedata>
[0333] <sequencedata sequenceidnumber="3">
[0334] <insdseq>
[0335] <INSDSeq_length>40< / INSDSeq_length>
[0336] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0337] <INSDSeq_division>PAT< / INSDSeq_division>
[0338] <INSDSeq_feature-table>
[0339] <insdfeature>
[0340] <INSDFeature_key>source< / INSDFeature_key>
[0341] <INSDFeature_location>1..40< / INSDFeature_location>
[0342] <INSDFeature_quals>
[0343] <insdqualifier>
[0344] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0345] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0346] < / insdqualifier>
[0347] <insdqualifier>
[0348] <INSDQualifier_name>organism< / INSDQualifier_name>
[0349] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0350] < / insdqualifier>
[0351] < / INSDFeature_quals>
[0352] < / insdfeature>
[0353] < / INSDSeq_feature-table>
[0354] <INSDSeq_sequence>aatttctactaagtgtagatctgtacgtccgccgtttgcg< / INSDSeq
[0355] _sequence>
[0356] < / insdseq>
[0357] < / sequencedata>
[0358] <sequencedata sequenceidnumber="4">
[0359] <insdseq>
[0360] <INSDSeq_length>40< / INSDSeq_length>
[0361] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0362] <INSDSeq_division>PAT< / INSDSeq_division>
[0363] <INSDSeq_feature-table>
[0364] <insdfeature>
[0365] <INSDFeature_key>source< / INSDFeature_key>
[0366] <INSDFeature_location>1..40< / INSDFeature_location>
[0367] <INSDFeature_quals>
[0368] <insdqualifier>
[0369] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0370] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0371] < / insdqualifier>
[0372] <insdqualifier>
[0373] <INSDQualifier_name>organism< / INSDQualifier_name>
[0374] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0375] < / insdqualifier>
[0376] < / INSDFeature_quals>
[0377] < / insdfeature>
[0378] < / INSDSeq_feature-table>
[0379] <INSDSeq_sequence>aatttctactaagtgtagatcgccattgcccgaggtgaag< / INSDSeq
[0380] _sequence>
[0381] < / insdseq>
[0382] < / sequencedata>
[0383] <sequencedata sequenceidnumber="5">
[0384] <insdseq>
[0385] <INSDSeq_length>40< / INSDSeq_length>
[0386] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0387] <INSDSeq_division>PAT< / INSDSeq_division>
[0388] <INSDSeq_feature-table>
[0389] <insdfeature>
[0390] <INSDFeature_key>source< / INSDFeature_key>
[0391] <INSDFeature_location>1..40< / INSDFeature_location>
[0392] <INSDFeature_quals>
[0393] <insdqualifier>
[0394] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0395] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0396] < / insdqualifier>
[0397] <insdqualifier>
[0398] <INSDQualifier_name>organism< / INSDQualifier_name>
[0399] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0400] < / insdqualifier>
[0401] < / INSDFeature_quals>
[0402] < / insdfeature>
[0403] < / INSDSeq_feature-table>
[0404] <INSDSeq_sequence>aatttctactaagtgtagatcttcagcaccgcggccgcgg< / INSDSeq
[0405] _sequence>
[0406] < / insdseq>
[0407] < / sequencedata>
[0408] <sequencedata sequenceidnumber="6">
[0409] <insdseq>
[0410] <INSDSeq_length>40< / INSDSeq_length>
[0411] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0412] <INSDSeq_division>PAT< / INSDSeq_division>
[0413] <INSDSeq_feature-table>
[0414] <insdfeature>
[0415] <INSDFeature_key>source< / INSDFeature_key>
[0416] <INSDFeature_location>1..40< / INSDFeature_location>
[0417] <INSDFeature_quals>
[0418] <insdqualifier>
[0419] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0420] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0421] < / insdqualifier>
[0422] <insdqualifier>
[0423] <INSDQualifier_name>organism< / INSDQualifier_name>
[0424] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0425] < / insdqualifier>
[0426] < / INSDFeature_quals>
[0427] < / insdfeature>
[0428] < / INSDSeq_feature-table>
[0429] <INSDSeq_sequence>aatttctactaagtgtagatgtctcccagctgtcgggcga< / INSDSeq
[0430] _sequence>
[0431] < / insdseq>
[0432] < / sequencedata>
[0433] <sequencedata sequenceidnumber="7">
[0434] <insdseq>
[0435] <INSDSeq_length>40< / INSDSeq_length>
[0436] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0437] <INSDSeq_division>PAT< / INSDSeq_division>
[0438] <INSDSeq_feature-table>
[0439] <insdfeature>
[0440] <INSDFeature_key>source< / INSDFeature_key>
[0441] <INSDFeature_location>1..40< / INSDFeature_location>
[0442] <INSDFeature_quals>
[0443] <insdqualifier>
[0444] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0445] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0446] < / insdqualifier>
[0447] <insdqualifier>
[0448] <INSDQualifier_name>organism< / INSDQualifier_name>
[0449] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0450] < / insdqualifier>
[0451] < / INSDFeature_quals>
[0452] < / insdfeature>
[0453] < / INSDSeq_feature-table>
[0454] <INSDSeq_sequence>aatttctactaagtgtagatccgcaatcggattatagtta< / INSDSeq
[0455] _sequence>
[0456] < / insdseq>
[0457] < / sequencedata>
[0458] <sequencedata sequenceidnumber="8">
[0459] <insdseq>
[0460] <INSDSeq_length>20< / INSDSeq_length>
[0461] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0462] <INSDSeq_division>PAT< / INSDSeq_division>
[0463] <INSDSeq_feature-table>
[0464] <insdfeature>
[0465] <INSDFeature_key>source< / INSDFeature_key>
[0466] <INSDFeature_location>1..20< / INSDFeature_location>
[0467] <INSDFeature_quals>
[0468] <insdqualifier>
[0469] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0470] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0471] < / insdqualifier>
[0472] <insdqualifier>
[0473] <INSDQualifier_name>organism< / INSDQualifier_name>
[0474] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0475] < / insdqualifier>
[0476] < / INSDFeature_quals>
[0477] < / insdfeature>
[0478] < / INSDSeq_feature-table>
[0479] <INSDSeq_sequence>atgcgcaaacggcggacgta< / INSDSeq_sequence>
[0480] < / insdseq>
[0481] < / sequencedata>
[0482] <sequencedata sequenceidnumber="9">
[0483] <insdseq>
[0484] <INSDSeq_length> 20< / INSDSeq_length>
[0485] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0486] <INSDSeq_division> PAT< / INSDSeq_division>
[0487] <INSDSeq_feature-table>
[0488] <insdfeature>
[0489] <INSDFeature_key>source< / INSDFeature_key>
[0490] <INSDFeature_location>1..20< / INSDFeature_location>
[0491] <INSDFeature_quals>
[0492] <insdqualifier>
[0493] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0494] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0495] < / insdqualifier>
[0496] <insdqualifier>
[0497] <INSDQualifier_name>organism< / INSDQualifier_name>
[0498] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0499] < / insdqualifier>
[0500] < / INSDFeature_quals>
[0501] < / insdfeature>
[0502] < / INSDSeq_feature-table>
[0503] <INSDSeq_sequence> ccagaatcagcggcgcacga< / INSDSeq_sequence>
[0504] < / insdseq>
[0505] < / sequencedata>
[0506] <sequencedata sequenceidnumber="10">
[0507] <insdseq>
[0508] <INSDSeq_length>20< / INSDSeq_length>
[0509] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0510] <INSDSeq_division>PAT< / INSDSeq_division>
[0511] <INSDSeq_feature-table>
[0512] <insdfeature>
[0513] <INSDFeature_key>source< / INSDFeature_key>
[0514] <INSDFeature_location>1..20< / INSDFeature_location>
[0515] <INSDFeature_quals>
[0516] <insdqualifier>
[0517] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0518] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0519] < / insdqualifier>
[0520] <insdqualifier>
[0521] <INSDQualifier_name>organism< / INSDQualifier_name>
[0522] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0523] < / insdqualifier>
[0524] < / INSDFeature_quals>
[0525] < / insdfeature>
[0526] < / INSDSeq_feature-table>
[0527] <INSDSeq_sequence>gttcgcccgacagctgggag< / INSDSeq_sequence>
[0528] < / insdseq>
[0529] < / sequencedata>
[0530] <sequencedata sequenceidnumber="11">
[0531] <insdseq>
[0532] <INSDSeq_length>20< / INSDSeq_length>
[0533] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0534] <INSDSeq_division>PAT< / INSDSeq_division>
[0535] <INSDSeq_feature-table>
[0536] <insdfeature>
[0537] <INSDFeature_key>source< / INSDFeature_key>
[0538] <INSDFeature_location>1..20< / INSDFeature_location>
[0539] <INSDFeature_quals>
[0540] <insdqualifier>
[0541] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0542] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0543] < / insdqualifier>
[0544] <insdqualifier>
[0545] <INSDQualifier_name>organism< / INSDQualifier_name>
[0546] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0547] < / insdqualifier>
[0548] < / INSDFeature_quals>
[0549] < / insdfeature>
[0550] < / INSDSeq_feature-table>
[0551] <INSDSeq_sequence>gcggcgcacgatcttttggc< / INSDSeq_sequence>
[0552] < / insdseq>
[0553] < / sequencedata>
[0554] <sequencedata sequenceidnumber="12">
[0555] <insdseq>
[0556] <INSDSeq_length> 20< / INSDSeq_length>
[0557] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0558] <INSDSeq_division> PAT< / INSDSeq_division>
[0559] <INSDSeq_feature-table>
[0560] <insdfeature>
[0561] <INSDFeature_key>source< / INSDFeature_key>
[0562] <INSDFeature_location>1..20< / INSDFeature_location>
[0563] <INSDFeature_quals>
[0564] <insdqualifier>
[0565] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0566] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0567] < / insdqualifier>
[0568] <insdqualifier>
[0569] <INSDQualifier_name>organism< / INSDQualifier_name>
[0570] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0571] < / insdqualifier>
[0572] < / INSDFeature_quals>
[0573] < / insdfeature>
[0574] < / INSDSeq_feature-table>
[0575] <INSDSeq_sequence> acctcgggcaatggcgcaaa< / INSDSeq_sequence>
[0576] < / insdseq>
[0577] < / sequencedata>
[0578] <sequencedata sequenceidnumber="13">
[0579] <insdseq>
[0580] <INSDSeq_length> 20< / INSDSeq_length>
[0581] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0582] <INSDSeq_division> PAT< / INSDSeq_division>
[0583] <INSDSeq_feature-table>
[0584] <insdfeature>
[0585] <INSDFeature_key>source< / INSDFeature_key>
[0586] <INSDFeature_location>1..20< / INSDFeature_location>
[0587] <INSDFeature_quals>
[0588] <insdqualifier>
[0589] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0590] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0591] < / insdqualifier>
[0592] <insdqualifier>
[0593] <INSDQualifier_name>organism< / INSDQualifier_name>
[0594] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0595] < / insdqualifier>
[0596] < / INSDFeature_quals>
[0597] < / insdfeature>
[0598] < / INSDSeq_feature-table>
[0599] <INSDSeq_sequence> tagccaccgctgccggtt< / INSDSeq_sequence>
[0600] < / insdseq>
[0601] < / sequencedata>
[0602] <sequencedata sequenceidnumber="14">
[0603] <insdseq>
[0604] <INSDSeq_length> 20< / INSDSeq_length>
[0605] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0606] <INSDSeq_division> PAT< / INSDSeq_division>
[0607] <INSDSeq_feature-table>
[0608] <insdfeature>
[0609] <INSDFeature_key>source< / INSDFeature_key>
[0610] <INSDFeature_location>1..20< / INSDFeature_location>
[0611] <INSDFeature_quals>
[0612] <insdqualifier>
[0613] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0614] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0615] < / insdqualifier>
[0616] <insdqualifier>
[0617] <INSDQualifier_name>organism< / INSDQualifier_name>
[0618] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0619] < / insdqualifier>
[0620] < / INSDFeature_quals>
[0621] < / insdfeature>
[0622] < / INSDSeq_feature-table>
[0623] <INSDSeq_sequence> attgggcgacagccaacggg< / INSDSeq_sequence>
[0624] < / insdseq>
[0625] < / sequencedata>
[0626] <sequencedata sequenceidnumber="15">
[0627] <insdseq>
[0628] <INSDSeq_length>20< / INSDSeq_length>
[0629] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0630] <INSDSeq_division>PAT< / INSDSeq_division>
[0631] <INSDSeq_feature-table>
[0632] <insdfeature>
[0633] <INSDFeature_key>source< / INSDFeature_key>
[0634] <INSDFeature_location>1..20< / INSDFeature_location>
[0635] <INSDFeature_quals>
[0636] <insdqualifier>
[0637] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0638] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0639] < / insdqualifier>
[0640] <insdqualifier>
[0641] <INSDQualifier_name>organism< / INSDQualifier_name>
[0642] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0643] < / insdqualifier>
[0644] < / INSDFeature_quals>
[0645] < / insdfeature>
[0646] < / INSDSeq_feature-table>
[0647] <INSDSeq_sequence>cccgttggctgtcgcccaat< / INSDSeq_sequence>
[0648] < / insdseq>
[0649] < / sequencedata>
[0650] <sequencedata sequenceidnumber="16">
[0651] <insdseq>
[0652] <INSDSeq_length>18< / INSDSeq_length>
[0653] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0654] <INSDSeq_division>PAT< / INSDSeq_division>
[0655] <INSDSeq_feature-table>
[0656] <insdfeature>
[0657] <INSDFeature_key>source< / INSDFeature_key>
[0658] <INSDFeature_location>1..18< / INSDFeature_location>
[0659] <INSDFeature_quals>
[0660] <insdqualifier>
[0661] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0662] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0663] < / insdqualifier>
[0664] <insdqualifier>
[0665] <INSDQualifier_name>organism< / INSDQualifier_name>
[0666] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0667] < / insdqualifier>
[0668] < / INSDFeature_quals>
[0669] < / insdfeature>
[0670] < / INSDSeq_feature-table>
[0671] <INSDSeq_sequence>ggcaaccgtcacgctgtt< / INSDSeq_sequence>
[0672] < / insdseq>
[0673] < / sequencedata>
[0674] <sequencedata sequenceidnumber="17">
[0675] <insdseq>
[0676] <INSDSeq_length>20< / INSDSeq_length>
[0677] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0678] <INSDSeq_division>PAT< / INSDSeq_division>
[0679] <INSDSeq_feature-table>
[0680] <insdfeature>
[0681] <INSDFeature_key>source< / INSDFeature_key>
[0682] <INSDFeature_location>1..20< / INSDFeature_location>
[0683] <INSDFeature_quals>
[0684] <insdqualifier>
[0685] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0686] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0687] < / insdqualifier>
[0688] <insdqualifier>
[0689] <INSDQualifier_name>organism< / INSDQualifier_name>
[0690] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0691] < / insdqualifier>
[0692] < / INSDFeature_quals>
[0693] < / insdfeature>
[0694] < / INSDSeq_feature-table>
[0695] <INSDSeq_sequence>tttgcgccattgcccgaggt< / INSDSeq_sequence>
[0696] < / insdseq>
[0697] < / sequencedata>
[0698] <sequencedata sequenceidnumber="18">
[0699] <insdseq>
[0700] <INSDSeq_length>20< / INSDSeq_length>
[0701] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0702] <INSDSeq_division>PAT< / INSDSeq_division>
[0703] <INSDSeq_feature-table>
[0704] <insdfeature>
[0705] <INSDFeature_key>source< / INSDFeature_key>
[0706] <INSDFeature_location>1..20< / INSDFeature_location>
[0707] <INSDFeature_quals>
[0708] <insdqualifier>
[0709] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0710] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0711] < / insdqualifier>
[0712] <insdqualifier>
[0713] <INSDQualifier_name>organism< / INSDQualifier_name>
[0714] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0715] < / insdqualifier>
[0716] < / INSDFeature_quals>
[0717] < / insdfeature>
[0718] < / INSDSeq_feature-table>
[0719] <INSDSeq_sequence>aggaagtgtgccgctgtatg< / INSDSeq_sequence>
[0720] < / insdseq>
[0721] < / sequencedata>
[0722] <sequencedata sequenceidnumber="19">
[0723] <insdseq>
[0724] <INSDSeq_length> 20< / INSDSeq_length>
[0725] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0726] <INSDSeq_division> PAT< / INSDSeq_division>
[0727] <INSDSeq_feature-table>
[0728] <insdfeature>
[0729] <INSDFeature_key>source< / INSDFeature_key>
[0730] <INSDFeature_location>1..20< / INSDFeature_location>
[0731] <INSDFeature_quals>
[0732] <insdqualifier>
[0733] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0734] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0735] < / insdqualifier>
[0736] <insdqualifier>
[0737] <INSDQualifier_name>organism< / INSDQualifier_name>
[0738] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0739] < / insdqualifier>
[0740] < / INSDFeature_quals>
[0741] < / insdfeature>
[0742] < / INSDSeq_feature-table>
[0743] <INSDSeq_sequence> tctcccagctgtcgggcgaa< / INSDSeq_sequence>
[0744] < / insdseq>
[0745] < / sequencedata>
[0746] <sequencedata sequenceidnumber="20">
[0747] <insdseq>
[0748] <INSDSeq_length> 18< / INSDSeq_length>
[0749] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0750] <INSDSeq_division> PAT< / INSDSeq_division>
[0751] <INSDSeq_feature-table>
[0752] <insdfeature>
[0753] <INSDFeature_key>source< / INSDFeature_key>
[0754] <INSDFeature_location>1..18< / INSDFeature_location>
[0755] <INSDFeature_quals>
[0756] <insdqualifier>
[0757] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0758] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0759] < / insdqualifier>
[0760] <insdqualifier>
[0761] <INSDQualifier_name>organism< / INSDQualifier_name>
[0762] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0763] < / insdqualifier>
[0764] < / INSDFeature_quals>
[0765] < / insdfeature>
[0766] < / INSDSeq_feature-table>
[0767] <INSDSeq_sequence> gcagactgggtgtggcat< / INSDSeq_sequence>
[0768] < / insdseq>
[0769] < / sequencedata>
[0770] <sequencedata sequenceidnumber="21">
[0771] <insdseq>
[0772] <INSDSeq_length>20< / INSDSeq_length>
[0773] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0774] <INSDSeq_division>PAT< / INSDSeq_division>
[0775] <INSDSeq_feature-table>
[0776] <insdfeature>
[0777] <INSDFeature_key>source< / INSDFeature_key>
[0778] <INSDFeature_location>1..20< / INSDFeature_location>
[0779] <INSDFeature_quals>
[0780] <insdqualifier>
[0781] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0782] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0783] < / insdqualifier>
[0784] <insdqualifier>
[0785] <INSDQualifier_name>organism< / INSDQualifier_name>
[0786] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0787] < / insdqualifier>
[0788] < / INSDFeature_quals>
[0789] < / insdfeature>
[0790] < / INSDSeq_feature-table>
[0791] <INSDSeq_sequence>ctcccagctgtcgggcgaac< / INSDSeq_sequence>
[0792] < / insdseq>
[0793] < / sequencedata>
[0794] <sequencedata sequenceidnumber="22">
[0795] <insdseq>
[0796] <INSDSeq_length> 26< / INSDSeq_length>
[0797] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0798] <INSDSeq_division> PAT< / INSDSeq_division>
[0799] <INSDSeq_feature-table>
[0800] <insdfeature>
[0801] <INSDFeature_key>source< / INSDFeature_key>
[0802] <INSDFeature_location>1..26< / INSDFeature_location>
[0803] <INSDFeature_quals>
[0804] <insdqualifier>
[0805] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0806] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0807] < / insdqualifier>
[0808] <insdqualifier>
[0809] <INSDQualifier_name>organism< / INSDQualifier_name>
[0810] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0811] < / insdqualifier>
[0812] < / INSDFeature_quals>
[0813] < / insdfeature>
[0814] < / INSDSeq_feature-table>
[0815] <INSDSeq_sequence> tgattaacacagcagataattcgcaa< / INSDSeq_sequence>
[0816] < / insdseq>
[0817] < / sequencedata>
[0818] <sequencedata sequenceidnumber="23">
[0819] <insdseq>
[0820] <INSDSeq_length> 18< / INSDSeq_length>
[0821] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0822] <INSDSeq_division> PAT< / INSDSeq_division>
[0823] <INSDSeq_feature-table>
[0824] <insdfeature>
[0825] <INSDFeature_key>source< / INSDFeature_key>
[0826] <INSDFeature_location>1..18< / INSDFeature_location>
[0827] <INSDFeature_quals>
[0828] <insdqualifier>
[0829] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0830] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0831] < / insdqualifier>
[0832] <insdqualifier>
[0833] <INSDQualifier_name>organism< / INSDQualifier_name>
[0834] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0835] < / insdqualifier>
[0836] < / INSDFeature_quals>
[0837] < / insdfeature>
[0838] < / INSDSeq_feature-table>
[0839] <INSDSeq_sequence> squeaccaggaggaggga< / INSDSeq_sequence>
[0840] < / insdseq>
[0841] < / sequencedata>
[0842] <sequencedata sequenceidnumber="24">
[0843] <insdseq>
[0844] <INSDSeq_length> 27< / INSDSeq_length>
[0845] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0846] <INSDSeq_division> PAT< / INSDSeq_division>
[0847] <INSDSeq_feature-table>
[0848] <insdfeature>
[0849] <INSDFeature_key>source< / INSDFeature_key>
[0850] <INSDFeature_location>1..27< / INSDFeature_location>
[0851] <INSDFeature_quals>
[0852] <insdqualifier>
[0853] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0854] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0855] < / insdqualifier>
[0856] <insdqualifier>
[0857] <INSDQualifier_name>organism< / INSDQualifier_name>
[0858] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0859] < / insdqualifier>
[0860] < / INSDFeature_quals>
[0861] < / insdfeature>
[0862] < / INSDSeq_feature-table>
[0863] <INSDSeq_sequence> agataattcgcaaatactttatcgtgc< / INSDSeq_sequence>
[0864] < / insdseq>
[0865] < / sequencedata>
[0866] <sequencedata sequenceidnumber="25">
[0867] <insdseq>
[0868] <INSDSeq_length> 18< / INSDSeq_length>
[0869] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0870] <INSDSeq_division> PAT< / INSDSeq_division>
[0871] <INSDSeq_feature-table>
[0872] <insdfeature>
[0873] <INSDFeature_key>source< / INSDFeature_key>
[0874] <INSDFeature_location>1..18< / INSDFeature_location>
[0875] <INSDFeature_quals>
[0876] <insdqualifier>
[0877] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0878] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0879] < / insdqualifier>
[0880] <insdqualifier>
[0881] <INSDQualifier_name>organism< / INSDQualifier_name>
[0882] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0883] < / insdqualifier>
[0884] < / INSDFeature_quals>
[0885] < / insdfeature>
[0886] < / INSDSeq_feature-table>
[0887] <INSDSeq_sequence> caacccaggaagcaggca< / INSDSeq_sequence>
[0888] < / insdseq>
[0889] < / sequencedata>
[0890] <sequencedata sequenceidnumber="26">
[0891] <insdseq>
[0892] <INSDSeq_length> 18< / INSDSeq_length>
[0893] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[0894] <INSDSeq_division> PAT< / INSDSeq_division>
[0895] <INSDSeq_feature-table>
[0896] <insdfeature>
[0897] <INSDFeature_key>source< / INSDFeature_key>
[0898] <INSDFeature_location>1..18< / INSDFeature_location>
[0899] <INSDFeature_quals>
[0900] <insdqualifier>
[0901] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0902] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0903] < / insdqualifier>
[0904] <insdqualifier>
[0905] <INSDQualifier_name>organism< / INSDQualifier_name>
[0906] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0907] < / insdqualifier>
[0908] < / INSDFeature_quals>
[0909] < / insdfeature>
[0910] < / INSDSeq_feature-table>
[0911] <INSDSeq_sequence> gtaaagtgatggccgcgg< / INSDSeq_sequence>
[0912] < / insdseq>
[0913] < / sequencedata>
[0914] <sequencedata sequenceidnumber="27">
[0915] <insdseq>
[0916] <INSDSeq_length>21< / INSDSeq_length>
[0917] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0918] <INSDSeq_division>PAT< / INSDSeq_division>
[0919] <INSDSeq_feature-table>
[0920] <insdfeature>
[0921] <INSDFeature_key>source< / INSDFeature_key>
[0922] <INSDFeature_location>1..21< / INSDFeature_location>
[0923] <INSDFeature_quals>
[0924] <insdqualifier>
[0925] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0926] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0927] < / insdqualifier>
[0928] <insdqualifier>
[0929] <INSDQualifier_name>organism< / INSDQualifier_name>
[0930] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0931] < / insdqualifier>
[0932] < / INSDFeature_quals>
[0933] < / insdfeature>
[0934] < / INSDSeq_feature-table>
[0935] <INSDSeq_sequence>gctttacccagcgtcagattc< / INSDSeq_sequence>
[0936] < / insdseq>
[0937] < / sequencedata>
[0938] <sequencedata sequenceidnumber="28">
[0939] <insdseq>
[0940] <INSDSeq_length>18< / INSDSeq_length>
[0941] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0942] <INSDSeq_division>PAT< / INSDSeq_division>
[0943] <INSDSeq_feature-table>
[0944] <insdfeature>
[0945] <INSDFeature_key>source< / INSDFeature_key>
[0946] <INSDFeature_location>1..18< / INSDFeature_location>
[0947] <INSDFeature_quals>
[0948] <insdqualifier>
[0949] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0950] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0951] < / insdqualifier>
[0952] <insdqualifier>
[0953] <INSDQualifier_name>organism< / INSDQualifier_name>
[0954] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0955] < / insdqualifier>
[0956] < / INSDFeature_quals>
[0957] < / insdfeature>
[0958] < / INSDSeq_feature-table>
[0959] <INSDSeq_sequence>cggccgcgctacagtaca< / INSDSeq_sequence>
[0960] < / insdseq>
[0961] < / sequencedata>
[0962] <sequencedata sequenceidnumber="29">
[0963] <insdseq>
[0964] <INSDSeq_length>20< / INSDSeq_length>
[0965] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0966] <INSDSeq_division>PAT< / INSDSeq_division>
[0967] <INSDSeq_feature-table>
[0968] <insdfeature>
[0969] <INSDFeature_key>source< / INSDFeature_key>
[0970] <INSDFeature_location>1..20< / INSDFeature_location>
[0971] <INSDFeature_quals>
[0972] <insdqualifier>
[0973] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0974] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0975] < / insdqualifier>
[0976] <insdqualifier>
[0977] <INSDQualifier_name>organism< / INSDQualifier_name>
[0978] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[0979] < / insdqualifier>
[0980] < / INSDFeature_quals>
[0981] < / insdfeature>
[0982] < / INSDSeq_feature-table>
[0983] <INSDSeq_sequence>cagagtttgcgccattgccc< / INSDSeq_sequence>
[0984] < / insdseq>
[0985] < / sequencedata>
[0986] <sequencedata sequenceidnumber="30">
[0987] <insdseq>
[0988] <INSDSeq_length>21< / INSDSeq_length>
[0989] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0990] <INSDSeq_division>PAT< / INSDSeq_division>
[0991] <INSDSeq_feature-table>
[0992] <insdfeature>
[0993] <INSDFeature_key>source< / INSDFeature_key>
[0994] <INSDFeature_location>1..21< / INSDFeature_location>
[0995] <INSDFeature_quals>
[0996] <insdqualifier>
[0997] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0998] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0999] < / insdqualifier>
[1000] <insdqualifier>
[1001] <INSDQualifier_name>organism< / INSDQualifier_name>
[1002] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[1003] < / insdqualifier>
[1004] < / INSDFeature_quals>
[1005] < / insdfeature>
[1006] < / INSDSeq_feature-table>
[1007] <INSDSeq_sequence>aacgtggcgatgaataagctg< / INSDSeq_sequence>
[1008] < / insdseq>
[1009] < / sequencedata>
[1010] <sequencedata sequenceidnumber="31">
[1011] <insdseq>
[1012] <INSDSeq_length>20< / INSDSeq_length>
[1013] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[1014] <INSDSeq_division>PAT< / INSDSeq_division>
[1015] <INSDSeq_feature-table>
[1016] <insdfeature>
[1017] <INSDFeature_key>source< / INSDFeature_key>
[1018] <INSDFeature_location>1..20< / INSDFeature_location>
[1019] <INSDFeature_quals>
[1020] <insdqualifier>
[1021] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[1022] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[1023] < / insdqualifier>
[1024] <insdqualifier>
[1025] <INSDQualifier_name>organism< / INSDQualifier_name>
[1026] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[1027] < / insdqualifier>
[1028] < / INSDFeature_quals>
[1029] < / insdfeature>
[1030] < / INSDSeq_feature-table>
[1031] <INSDSeq_sequence>cagcttattcatcgccacgt< / INSDSeq_sequence>
[1032] < / insdseq>
[1033] < / sequencedata>
[1034] <sequencedata sequenceidnumber="32">
[1035] <insdseq>
[1036] <INSDSeq_length>20< / INSDSeq_length>
[1037] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[1038] <INSDSeq_division>PAT< / INSDSeq_division>
[1039] <INSDSeq_feature-table>
[1040] <insdfeature>
[1041] <INSDFeature_key>source< / INSDFeature_key>
[1042] <INSDFeature_location>1..20< / INSDFeature_location>
[1043] <INSDFeature_quals>
[1044] <insdqualifier>
[1045] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[1046] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[1047] < / insdqualifier>
[1048] <insdqualifier>
[1049] <INSDQualifier_name>organism< / INSDQualifier_name>
[1050] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[1051] < / insdqualifier>
[1052] < / INSDFeature_quals>
[1053] < / insdfeature>
[1054] < / INSDSeq_feature-table>
[1055] <INSDSeq_sequence>taccgagccgacgttaaaca< / INSDSeq_sequence>
[1056] < / insdseq>
[1057] < / sequencedata>
[1058] <sequencedata sequenceidnumber="33">
[1059] <insdseq>
[1060] <INSDSeq_length>20< / INSDSeq_length>
[1061] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[1062] <INSDSeq_division>PAT< / INSDSeq_division>
[1063] <INSDSeq_feature-table>
[1064] <insdfeature>
[1065] <INSDFeature_key>source< / INSDFeature_key>
[1066] <INSDFeature_location>1..20< / INSDFeature_location>
[1067] <INSDFeature_quals>
[1068] <insdqualifier>
[1069] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[1070] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[1071] < / insdqualifier>
[1072] <insdqualifier>
[1073] <INSDQualifier_name>organism< / INSDQualifier_name>
[1074] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[1075] < / insdqualifier>
[1076] < / INSDFeature_quals>
[1077] < / insdfeature>
[1078] < / INSDSeq_feature-table>
[1079] <INSDSeq_sequence>ccagtgacatcgtcccattg< / INSDSeq_sequence>
[1080] < / insdseq>
[1081] < / sequencedata>
[1082] <sequencedata sequenceidnumber="34">
[1083] <insdseq>
[1084] <INSDSeq_length>19< / INSDSeq_length>
[1085] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[1086] <INSDSeq_division>PAT< / INSDSeq_division>
[1087] <INSDSeq_feature-table>
[1088] <insdfeature>
[1089] <INSDFeature_key>source< / INSDFeature_key>
[1090] <INSDFeature_location>1..19< / INSDFeature_location>
[1091] <INSDFeature_quals>
[1092] <insdqualifier>
[1093] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[1094] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[1095] < / insdqualifier>
[1096] <insdqualifier>
[1097] <INSDQualifier_name>organism< / INSDQualifier_name>
[1098] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[1099] < / insdqualifier>
[1100] < / INSDFeature_quals>
[1101] < / insdfeature>
[1102] < / INSDSeq_feature-table>
[1103] <INSDSeq_sequence>gagccgacgttaaacaccg< / INSDSeq_sequence>
[1104] < / insdseq>
[1105] < / sequencedata>
[1106] <sequencedata sequenceidnumber="35">
[1107] <insdseq>
[1108] <INSDSeq_length>20< / INSDSeq_length>
[1109] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[1110] <INSDSeq_division>PAT< / INSDSeq_division>
[1111] <INSDSeq_feature-table>
[1112] <insdfeature>
[1113] <INSDFeature_key>source< / INSDFeature_key>
[1114] <INSDFeature_location>1..20< / INSDFeature_location>
[1115] <INSDFeature_quals>
[1116] <insdqualifier>
[1117] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[1118] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[1119] < / insdqualifier>
[1120] <insdqualifier>
[1121] <INSDQualifier_name>organism< / INSDQualifier_name>
[1122] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[1123] < / insdqualifier>
[1124] < / INSDFeature_quals>
[1125] < / insdfeature>
[1126] < / INSDSeq_feature-table>
[1127] <INSDSeq_sequence>cccattgacgtgcttttccg< / INSDSeq_sequence>
[1128] < / insdseq>
[1129] < / sequencedata>
[1130] <sequencedata sequenceidnumber="36">
[1131] <insdseq>
[1132] <INSDSeq_length> 26< / INSDSeq_length>
[1133] <INSDSeq_moltype> RNA< / INSDSeq_moltype>
[1134] <INSDSeq_division> PAT< / INSDSeq_division>
[1135] <INSDSeq_feature-table>
[1136] <insdfeature>
[1137] <INSDFeature_key>source< / INSDFeature_key>
[1138] <INSDFeature_location>1..26< / INSDFeature_location>
[1139] <INSDFeature_quals>
[1140] <insdqualifier>
[1141] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[1142] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[1143] < / insdqualifier>
[1144] <insdqualifier>
[1145] <INSDQualifier_name>organism< / INSDQualifier_name>
[1146] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[1147] < / insdqualifier>
[1148] < / INSDFeature_quals>
[1149] < / insdfeature>
[1150] < / INSDSeq_feature-table>
[1151] <INSDSeq_sequence> cgcaatcggattatagttaacaaggt< / INSDSeq_sequence>
[1152] < / insdseq>
[1153] < / sequencedata>
[1154] <sequencedata sequenceidnumber="37">
[1155] <insdseq>
[1156] <INSDSeq_length>20< / INSDSeq_length>
[1157] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[1158] <INSDSeq_division>PAT< / INSDSeq_division>
[1159] <INSDSeq_feature-table>
[1160] <insdfeature>
[1161] <INSDFeature_key>source< / INSDFeature_key>
[1162] <INSDFeature_location>1..20< / INSDFeature_location>
[1163] <INSDFeature_quals>
[1164] <insdqualifier>
[1165] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[1166] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[1167] < / insdqualifier>
[1168] <insdqualifier>
[1169] <INSDQualifier_name>organism< / INSDQualifier_name>
[1170] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[1171] < / insdqualifier>
[1172] < / INSDFeature_quals>
[1173] < / insdfeature>
[1174] < / INSDSeq_feature-table>
[1175] <INSDSeq_sequence>cacttttcttcagcaccgcg< / INSDSeq_sequence>
[1176] < / insdseq>
[1177] < / sequencedata>
[1178] <sequencedata sequenceidnumber="38">
[1179] <insdseq>
[1180] <INSDSeq_length>20< / INSDSeq_length>
[1181] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[1182] <INSDSeq_division>PAT< / INSDSeq_division>
[1183] <INSDSeq_feature-table>
[1184] <insdfeature>
[1185] <INSDFeature_key>source< / INSDFeature_key>
[1186] <INSDFeature_location>1..20< / INSDFeature_location>
[1187] <INSDFeature_quals>
[1188] <insdqualifier>
[1189] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[1190] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[1191] < / insdqualifier>
[1192] <insdqualifier>
[1193] <INSDQualifier_name>organism< / INSDQualifier_name>
[1194] <INSDQualifier_value>CTX-M15< / INSDQualifier_value>
[1195] < / insdqualifier>
[1196] < / INSDFeature_quals>
[1197] < / insdfeature>
[1198] < / INSDSeq_feature-table>
[1199] <INSDSeq_sequence>ccgcggccatcactttactg< / INSDSeq_sequence>
[1200] < / insdseq>
[1201] < / sequencedata>
[1202] < / st26sequencelisting>
[1203] <---
Claims
1. A method for producing a preparation of the CRISPR-Cas ribonucleoprotein complex, characterized in that it comprises the following steps: (i) combining the CRISPR-Cas family Cas protein LbCpf1 from Lachnospiraceae into a complex with at least one guide RNA of SEQ ID NO: 1-7 and, if necessary, (ii) lyophilizing the CRISPR-Cas ribonucleoprotein complex obtained in step (i), thus obtaining a preparation of the CRISPR-Cas ribonucleoprotein complex.
2. A preparation of the CRISPR-Cas ribonucleoprotein complex for detecting the bla-CTX-M-15 antibiotic resistance gene, obtained by the method according to claim 1, containing the Cas protein of the CRISPR-Cas family LbCpf1 from Lachnospiraceae in a complex with at least one guide RNA with SEQ ID NO: 1-7.
3. The drug according to claim 2, wherein the drug is a solution of the said CRISPR-Cas ribonucleoprotein complex.
4. The drug according to paragraph 2, wherein said drug is lyophilized.
Citation Information
Patent Citations
Crispr-CAS system for detecting the antibiotic resistance gene blavim-2 (metallo-beta-lactamase class b VIM-2) pseudomonas aeruginosa at ultra-low concentrations
RU2743861C1
Method for obtaining the crispr / CAS ribonucleoprotein complex preparation and preparation for detection of the blavim-2 (metal-beta-lactamase class b VIM-2) pseudomonas aeruginosa antibiotic resistance gene in ultra-low concentrations
RU2745637C1
METHOD FOR OBTAINING A PREPARATION OF THE RIBONUCLEOPROTEIN COMPLEX CRISPR-Cas AND A PREPARATION FOR DETECTING THE mecA ANTIBIOTIC RESISTANCE GENE OF STAPHYLOCOCCUS AUREUS IN ULTRA-LOW CONCENTRATIONS
RU2782315C1