Method of obtaining potato plant with knockout mutations in pain-1 gene encoding region using crispr / cas9 genome editing method

CRISPR/Cas9 genome editing technology enables precise mutation of the Pain-1 gene in potatoes, addressing the limitations of traditional breeding and genetic engineering by stabilizing resistance to cold saccharification and acrylamide formation.

RU2865706C1Active Publication Date: 2026-07-08FEDERALNOE GOSUDARSTVENNOE BYUDZHETNOE NAUCHNOE UCHREZHDENIE VSEROSSIJSKIJ NAUCHNO ISSLEDOVATELSKIJ INST SELSKOKHOZYAJSTVENNOJ BIOTEKHNOLOGII (FGBNU VNIISB)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
RU2025104152
Authority / Receiving Office
RU · RU
Patent Type
Patents
Current Assignee / Owner
Filing Date
2025-02-24
Publication Date
2026-07-08
Estimated Expiration
2045-02-24

AI Technical Summary

Technical Problem

Traditional breeding methods for developing potato varieties resistant to cold saccharification are lengthy and limited by the need for compatible genotypes, while existing genetic engineering techniques lack stability studies over extended periods, leading to challenges in altering the nucleotide sequence of the Pain-1 gene effectively.

Method used

A method using CRISPR/Cas9 genome editing technology introduces mutations into the coding region of the Pain-1 gene by transferring a pKSE401-sgRNA-P construct via Agrobacterium tumefaciens, enabling precise editing and stable mutation fixation in potato plants.

Benefits of technology

This approach effectively inactivates the Pain-1 gene, reducing cold-induced sweetening and acrylamide formation, ensuring consistent consumer quality traits in potato tubers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000001
    Figure 00000001
  • Figure 00000002
    Figure 00000002
  • Figure 00000003
    Figure 00000003
Patent Text Reader

Abstract

FIELD: biotechnology.SUBSTANCE: method for producing a potato plant with mutations in the coding region of the Pain-1 gene, as well as to a potato plant with mutations in the coding region of the Pain-1 gene for further use in the breeding process.EFFECT: development of a method for producing a potato plant with a mutation in the coding region of the Pain-1 gene for further use of this plant in the breeding process.2 cl, 4 dwg, 2 ex
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Field of technology to which the invention relates

[0002] The invention relates to the field of biotechnology and genetic engineering of plants, namely to a method for producing a dicotyledonous plant using CRISPR / Cas9 genome editing technology, by targeted action on the nucleotide sequences of the coding regions of the potato Pain-1 gene using CRISPR / Cas9 genome editing systems, which use RNA guide molecules or an expression DNA vector constructed on their basis.

[0003] Prior Art

[0004] In temperate climates, year-round potato cultivation is impossible. Therefore, harvested tubers intended for consumption require long-term storage. Tubers are typically stored at a low temperature, around 2-4°C, to prevent wrinkling, sprouting, and disease. However, storage at low temperatures promotes more active sucrose synthesis, which is transported to the vacuole, where it is hydrolyzed into hexoses: glucose and fructose. The process of accumulation of reducing sugars in tubers is called cold saccharification [1]. As a result of prolonged storage, tubers have a sweeter taste, but when fried, they acquire a dark color and a bitter taste due to the Maillard reaction. At high temperatures, a reaction occurs between asparagine and reducing sugars, one of the byproducts of which is acrylamide, a neurotoxic and carcinogenic substance.

[0005] Numerous studies in this area have shown that the catalytic activity of vacuolar invertase (Inv-V), encoded by the Pain-1 gene, is the primary cause of cold saccharification. Furthermore, Inv-V activity significantly increases with decreasing temperature, which is likely a mechanism for maintaining osmotic pressure in potato tubers [2].

[0006] Attempts have been made to address the problem of cold saccharification through both classical breeding and various genetic engineering approaches. One such approach was the targeted increase in the expression of endogenous vacuolar invertase inhibitors or the constitutive expression of foreign invertase inhibitors [3]. Another approach to reducing vacuolar invertase activity was the use of RNA interference technology [4]. By suppressing Inv-V activity in the MegaChip, Dakota Pearl, Russet Burbank, and Atlantic varieties, it was possible to eliminate potato browning during frying and significantly reduce the acrylamide content in the finished product. However, detailed studies on the stability of the effect caused by Pain-1 gene interference over a longer period of time in the resulting plants have not been conducted.

[0007] A significant breakthrough in the creation of potato plants whose tubers are resistant to cold saccharification was the use of technologies that allow mutations to be introduced directly into the organism's genome. For example, in 2016, using TALE nucleases, Ranger Russet potato plants with an inactivated Pain-1 gene were obtained [5]. In 2022, a group from Pakistan published the first work on obtaining potato plants with a knockout Pain-1 gene using CRISPR / Cas9 technology [6].

[0008] Traditional breeding methods enable the development of potato varieties with enhanced consumer qualities. However, creating a variety with desired traits is a lengthy process, and beneficial genes can only be obtained from compatible genotypes. The ability to significantly improve the consumer qualities of tubers by precisely altering the nucleotide sequence of the Pain-1 gene will simplify the process of developing new, high-quality varieties that meet modern requirements. However, producing plants with mutations in the coding regions of the Pain-1 gene on an unchanged genetic background presents a technical challenge that requires expanding the arsenal of tools available to breeders. To address this problem, the present invention proposes a method for producing potato plants with the coding region sequence of the Pain-1 gene altered using CRISPR / Cas9 genome editing technology.

[0009] Essence of the invention

[0010] The objective of the invention is to develop a method for producing a potato plant with a mutation in the coding region of the Pain-1 gene for the further use of this plant in the breeding process.

[0011] To solve this problem, a method is proposed according to which the pKSE401-sgRNA-P construct is obtained, carrying a sequence that encodes the Cas9 nuclease and a guide RNA molecule (sgRNA), this construct is transferred into potato cells using the bacterium Agrobacterium tumefaciens to introduce mutations into the coding region of the Pain-1 gene, and regenerated plants with an edited genome are selected.

[0012] In another aspect, the present invention also relates to a potato plant obtained by this method.

[0013] The use of RNA guides in the expression vector pKSE401 (Addgene Plasmid #62202) in the described example made it possible to effectively introduce mutations into the target sequence of the coding region of the Pain-1 gene of potato plants without affecting other parts of the genome, and subsequently fix the obtained mutations in the next generation of plants.

[0014] Brief description of drawings

[0015] Figure 1. Map of the pKSE401 vector. KanR is the gene encoding resistance to the antibiotic kanamycin for selection in bacteria, ori is the origin of replication, RB T-DNA repeat and LB T-DNA repeat are the left and right borders of T-DNA, respectively, Cas9 is a nuclease, gRNA scaffold is a scaffold of guide RNA, NeoR / KanR is the gene encoding resistance to the antibiotic kanamycin in plants.

[0016] Figure 2. Alignment of the nucleotide sequences of the Pain-1 gene alleles in the genome-edited 56-2 potato cultivar Fritella. Targeted NGS sequencing of the exon 3 region of the Pain-1 gene in the Fritella potato cultivar revealed three sequence variants.

[0017] Figure 3. Genomic editing events in the target region of the nucleotide sequence of the Pain-1 gene region in plant 56-2. The nucleotide sequences of the guide RNA molecule (sgRNA-P) and alleles resulting from genomic editing are shown.

[0018] Figure 4. Evaluation of the color of potato chips of the obtained transgenic line 56-2 containing mutations in the coding part of the Pain-1 gene.

[0019] Example 1

[0020] Obtaining a transgenic plant of cultivated potato Solanum tuberosum containing mutations in the coding region of the Pain-1 gene by genome editing using CRISPR / Cas9 technology.

[0021] Selection of target genes for genome editing

[0022] The Pain-1 gene, which affects the consumer qualities of potato tubers - the content of reducing sugars - was selected as a target gene for editing.

[0023] Sequencing of the Pain-1 gene in potato plants of the Fritella variety and design of a guide RNA molecule

[0024] Cultivated potatoes are tetraploids, making gene sequencing using the Sanger method quite labor-intensive. A much more convenient approach for determining the nucleotide sequences of multiple alleles of a gene is NGS sequencing, which allows for multiple reads of a single fragment and reliably reveals allelic diversity.

[0025] To inactivate the enzyme, modifications to the region encoding the catalytic domain, which is typically located in the central region of the protein, are usually sufficient. Based on this assumption, we selected oligonucleotides for sequencing a fragment of the third exon of the potato Pain-1 gene. Next, using a sample of isolated total DNA, we amplified the selected region of the Pain-1 gene using the following oligonucleotides (SEQ ID NO: 1 and SEQ ID NO: 2):

[0026] PAIN-1 EX3 NGS F

[0027] 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAATGGCTTTTAACAATCGGG 3'

[0028] PAIN-1 EX3 NGS R

[0029] 5' GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTTTGTCAAGTCATACGTCCC 3'

[0030] The resulting 280 bp PCR product of the Pain-1 gene fragment was isolated from agarose gel using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific) and used to prepare libraries according to the 16S Metagenomic Sequencing Library Preparation protocol (Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System). The libraries were then sequenced on an Illumina MiSeq.

[0031] For each sequenced sample, the read length, quality, and read count in the resulting fastq files were assessed using FastQC 0.11.9. Primary read processing was performed using Trimmomatic-0.39. After trimming, the fastq files were analyzed using CRISPResso2 (http: / / crispresso2.pinellolab.org / submission). The number of reads per sample ranged from 722 to 2874.

[0032] As a result of targeted NGS sequencing of the Pain-1 gene region of the Fritella potato variety, we identified four alleles of the gene with an identical sequence: SEQ ID NO: 3.

[0033] Analysis of the available potato genome (variety Solyntus, BioProject: PRJNA631911) showed that the Pain-1 gene is contained in the potato genome in a single locus, which is indirectly confirmed by the detection of no more than four alleles as a result of sequencing.

[0034] We used the CRISPOR application package (http: / / crispor.gi.ucsc.edu / ) [7] to design sgRNA. When designing guide RNAs, we paid attention to the following aspects:

[0035] 1) For spCas9 to function, the presence of the PAM sequence NGG, where N is any nucleotide, is required in the 5' region relative to the protospacer sequence.

[0036] 2) An important condition for successful editing is to minimize possible non-target editing - the “off-target” effect.

[0037] 3) It was necessary to take into account the absence of secondary structures in the variable part of sgRNA, the presence of which can reduce the efficiency of editing.

[0038] Thus, the guide RNA sequence SEQ ID NO: 4 was selected to inactivate the Pain-1 gene of the Fritella potato variety in the conserved region of the 3rd exon of the gene.

[0039] Creation of a genetic construct to inactivate the Pain-1 gene

[0040] Pain-1 gene inactivation constructs were generated based on the pKSE401 vector [8] (Figure 1).

[0041] The sequence SEQ ID NO: 4 of the sgRNA molecule we selected was cloned into the pKSE401 vector.

[0042] Cloning was performed using Golden Gate technology. Sequencing of the resulting clones was used to select a clone that demonstrated the absence of mutations in the sgRNA expression cassette sequences.

[0043] The prepared genetic vector was used to transform Agrobacterium strain AGL0. These bacteria were then used to produce transgenic Fritella potato plants.

[0044] Agrobacterium-mediated transformation of potato plants

[0045] Preliminary selection of conditions enabled effective Agrobacterium-mediated transformation of Fritella potato plants. One hundred leaf explants were co-cultured with Agrobacterium and then grown on P-2 medium. On the 45th day of cultivation (from the moment of co-culture), callus formation was observed at the edges of 60-70% of the explants using each genetic construct. After 120 days of cultivation, morphogenic callus formation, regenerating shoots, was observed in 50-58% of the explants using each genetic construct.

[0046] Through genetic transformation, plant 56-2 was selected to exhibit resistance to a selective herbicide.

[0047] The presence of insertion / deletion mutations in the target coding region of the Pain-1 gene was confirmed by targeted high-throughput sequencing. For this purpose, the corresponding Pain-1 gene fragment was amplified using the aforementioned primers SEQ ID NO: 1 and SEQ ID NO: 2.

[0048] The resulting PCR products were purified using the GeneJET PCR Purification Kit (Thermo) and used to prepare libraries according to the 16S Metagenomic Sequencing Library Preparation protocol (Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System). The libraries were then sequenced on the Illumina MiSeq as described above.

[0049] Genotyping of the nucleotide sequence of exon 1 of the Pain-1 gene of the selected plant 56-2 showed a deletion of 1 nucleotide in alleles 1 and 2 (SEQ ID NO: 5 in the sequence listing), a deletion of 4 nucleotides in allele 3 (SEQ ID NO: 6 in the sequence listing), and a deletion of 2 nucleotides in allele 4 (SEQ ID NO: 7 in the sequence listing) compared with the unmodified Pain-1 sequence (Figure 3).

[0050] These mutations arose as a result of the functional activity of the sgRNA-P guide RNA SEQ ID NO: 4, since the changes were detected in the region of the expected cleavage site of the DNA molecule by the Cas9-guide RNA complex (Figure 3). Thus, a potato plant carrying four alleles of the coding region of the Pain-1 gene with the nucleotide sequences SEQ ID NO: 5, 6, 7 in the sequence listing, all of which are mutant, was obtained.

[0051] Example 2

[0052] Study of the phenotype of the obtained transgenic line 56-2 of cultivated potato S. tuberosum variety Fritella, containing mutations in the coding region of the Pain-1 gene, obtained by genome editing using CRIPSR / Cas9 technology.

[0053] Evaluation of the color of chips from tubers of the obtained transgenic cultivated potato.

[0054] The expected potato phenotype was confirmed by frying chips from tubers of the first vegetative generation of the resulting transgenic potato line. The potato tubers were cut into thin chips and then fried in vegetable oil at 180°C for 2 minutes. Color change was determined by comparing chips from transgenic potato line 56-2 with chips from a control potato line lacking mutations in the coding region of the Pain-1 gene (Figure 4).

[0055] Bibliography:

[0056] 1. Samotus B. et al. Storage and reconditioning of tubers of Polish potato varieties and strains. 1. Influence of storage temperature on sugar level in potato tubers of different varieties and strains / / Potato Research. - 1974. - Т. 17. - С. 64-81.

[0057] 2. Zrenner R., Schüler K., Sonnewald U. Soluble acid invertase determines the hexose-to-sucrose ratio in cold-stored potato tubers / / Planta. - 1996. - Т. 198. - С. 246-252.

[0058] 3. Greiner S. et al. Ectopic expression of a tobacco invertase inhibitor homolog prevents cold-induced sweetening of potato tubers / / Nature biotechnology. - 1999. - Т. 17. - №. 7. - С. 708-711.

[0059] 4. Bhaskar PB, Wu L, Busse JS, Whitty BR, Hamernik AJ, Jansky SH, Buell CR, Bethke PC, Jiang J (2010) Suppression of the vacuolar invertase gene prevents cold-induced sweetening in potato. Plant Physiol 154(2):939-948.

[0060] 5. Clasen B. M. et al. Improving cold storage and processing traits in potato through targeted gene knockout / / Plant biotechnology journal. - 2016. - Т. 14. - №. 1. - С. 169-176.

[0061] 6. Yasmeen A. et al. CRISPR / Cas-mediated knockdown of vacuolar invertase gene expression lowers the cold-induced sweetening in potatoes / / Planta. - 2022. - Т. 256. - №. 6. - С. 107.

[0062] 7. Concordet J. P., Haeussler M. CRISPOR: intuitive guide selection for CRISPR / Cas9 genome editing experiments and screens / / Nucleic acids research. - 2018. - Т. 46. - №. W1. - С. W242-W245.

[0063] 8. Xing H. L. et al. A CRISPR / Cas9 toolkit for multiplex genome editing in plants / / BMC plant biology. - 2014. - Т. 14. - С. 1-12.

[0064] --->

[0065] <?xml version="1.0" encoding="UTF-8"?>

[0066] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0067] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0068] <st26sequencelisting dtdversion="V1_3" filename="Перечень

[0069] последовательностей PAIN.xml" softwarename="WIPO Sequence"

[0070] softwareversion="2.3.0" productiondate="2024-12-10">

[0071] <applicationidentification>

[0072] <ipofficecode>RU< / ipofficecode>

[0073] <applicationnumbertext>< / applicationnumbertext>

[0074] <filingdate>< / filingdate>

[0075] < / applicationidentification>

[0076] <applicantfilereference> PAIN< / applicantfilereference>

[0077] <applicantname languagecode="ru"> Federal State Budgetary Scientific Institution All-Russian Research Institute of Standardization and Biotechnology< / applicantname>

[0078] <applicantnamelatin>All-Russia Research Institute of Agricultural

[0079] Biotechnology< / applicantnamelatin>

[0080] <inventiontitle languagecode="ru">METHOD OF OBTAINING THE PLANT

[0081] POTATOES WITH KNOCKOUT MUTATIONS IN THE CODING REGION OF THE PAIN-1 GENE

[0082] USING GENOME EDITING TECHNOLOGY

[0083] CRISPR / CAS9< / inventiontitle>

[0084] <sequencetotalquantity> 7< / sequencetotalquantity>

[0085] <sequencedata sequenceidnumber="1">

[0086] <insdseq>

[0087] <INSDSeq_length> 54< / INSDSeq_length>

[0088] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0089] <INSDSeq_division> PAT< / INSDSeq_division>

[0090] <INSDSeq_feature-table>

[0091] <insdfeature>

[0092] <INSDFeature_key>source< / INSDFeature_key>

[0093] <INSDFeature_location>1..54< / INSDFeature_location>

[0094] <INSDFeature_quals>

[0095] <insdqualifier>

[0096] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0097] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0098] < / insdqualifier>

[0099] <insdqualifier id="q2">

[0100] <INSDQualifier_name>organism< / INSDQualifier_name>

[0101] <INSDQualifier_value>Artificial sequence< / INSDQualifier_value>

[0102] < / insdqualifier>

[0103] < / INSDFeature_quals>

[0104] < / insdfeature>

[0105] < / INSDSeq_feature-table>

[0106] <INSDSeq_sequence> tcgtcggcagcgtcagatgtgtataagacagcaatggctttaacaa

[0107] tcggg< / INSDSeq_sequence>

[0108] < / insdseq>

[0109] < / sequencedata>

[0110] <sequencedata sequenceidnumber="2">

[0111] <insdseq>

[0112] <INSDSeq_length>55< / INSDSeq_length>

[0113] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0114] <INSDSeq_division>PAT< / INSDSeq_division>

[0115] <INSDSeq_feature-table>

[0116] <insdfeature>

[0117] <INSDFeature_key>source< / INSDFeature_key>

[0118] <INSDFeature_location>1..55< / INSDFeature_location>

[0119] <INSDFeature_quals>

[0120] <insdqualifier>

[0121] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0122] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0123] < / insdqualifier>

[0124] <insdqualifier id="q4">

[0125] <INSDQualifier_name>organism< / INSDQualifier_name>

[0126] <INSDQualifier_value>Artificial sequence< / INSDQualifier_value>

[0127] < / insdqualifier>

[0128] < / INSDFeature_quals>

[0129] < / insdfeature>

[0130] < / INSDSeq_feature-table>

[0131] <INSDSeq_sequence>gtctcgtgggctcggagatgtgtataagagacagctttgtcaagtcata

[0132] cgtccc< / INSDSeq_sequence>

[0133] < / insdseq>

[0134] < / sequencedata>

[0135] <sequencedata sequenceidnumber="3">

[0136] <insdseq>

[0137] <INSDSeq_length> 228< / INSDSeq_length>

[0138] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0139] <INSDSeq_division> PAT< / INSDSeq_division>

[0140] <INSDSeq_feature-table>

[0141] <insdfeature>

[0142] <INSDFeature_key>source< / INSDFeature_key>

[0143] <INSDFeature_location>1..228< / INSDFeature_location>

[0144] <INSDFeature_quals>

[0145] <insdqualifier>

[0146] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0147] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0148] < / insdqualifier>

[0149] <insdqualifier id="q6">

[0150] <INSDQualifier_name>organism< / INSDQualifier_name>

[0151] <INSDQualifier_value>Solanum tuberosum< / INSDQualifier_value>

[0152] < / insdqualifier>

[0153] < / INSDFeature_quals>

[0154] < / insdfeature>

[0155] < / INSDSeq_feature-table>

[0156] <INSDSeq_sequence> gcaatggcttttaacaatcgggtctaagattggtaaaacgggtattgca

[0157] cttgtttatgaaacttccaacttcacaagctttaagctattggatgaagtgctgcatgcggttccgggta

[0158] cgggtatgtgggagtgtgtggacttttacccggtatcgactgaaaaaacaaacgggttggacacatcata

[0159] taacggcccgggtgtaaagcatgtgttaaaagcaagttt< / INSDSeq_sequence>

[0160] < / insdseq>

[0161] < / sequencedata>

[0162] <sequencedata sequenceidnumber="4">

[0163] <insdseq>

[0164] <INSDSeq_length> 20< / INSDSeq_length>

[0165] <INSDSeq_moltype> RNA< / INSDSeq_moltype>

[0166] <INSDSeq_division> PAT< / INSDSeq_division>

[0167] <INSDSeq_feature-table>

[0168] <insdfeature>

[0169] <INSDFeature_key>source< / INSDFeature_key>

[0170] <INSDFeature_location>1..20< / INSDFeature_location>

[0171] <INSDFeature_quals>

[0172] <insdqualifier>

[0173] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0174] <INSDQualifier_value>other RNA< / INSDQualifier_value>

[0175] < / insdqualifier>

[0176] <insdqualifier id="q8">

[0177] <INSDQualifier_name>organism< / INSDQualifier_name>

[0178] <INSDQualifier_value>Artificial sequence< / INSDQualifier_value>

[0179] < / insdqualifier>

[0180] < / INSDFeature_quals>

[0181] < / insdfeature>

[0182] < / INSDSeq_feature-table>

[0183] <INSDSeq_sequence> helphelpacggccc< / INSDSeq_sequence>

[0184] < / insdseq>

[0185] < / sequencedata>

[0186] <sequencedata sequenceidnumber="5">

[0187] <insdseq>

[0188] <INSDSeq_length> 227< / INSDSeq_length>

[0189] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0190] <INSDSeq_division> PAT< / INSDSeq_division>

[0191] <INSDSeq_feature-table>

[0192] <insdfeature>

[0193] <INSDFeature_key>source< / INSDFeature_key>

[0194] <INSDFeature_location>1..227< / INSDFeature_location>

[0195] <INSDFeature_quals>

[0196] <insdqualifier>

[0197] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0198] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0199] < / insdqualifier>

[0200] <insdqualifier id="q10">

[0201] <INSDQualifier_name>organism< / INSDQualifier_name>

[0202] <INSDQualifier_value>Solanum tuberosum< / INSDQualifier_value>

[0203] < / insdqualifier>

[0204] < / INSDFeature_quals>

[0205] < / insdfeature>

[0206] < / INSDSeq_feature-table>

[0207] <INSDSeq_sequence> gcaatggcttttaacaatcgggtctaagattggtaaaacgggtattgca

[0208] cttgtttatgaaacttccaacttcacaagctttaagctattggatgaagtgctgcatgcggttccgggta

[0209] cgggtatgtgggagtgtgtggacttttacccggtatcgactgaaaaaacaaacgggttggacacatcata

[0210] taacgcccgggtgtaaagcatgtgttaaaagcaagttt< / INSDSeq_sequence>

[0211] < / insdseq>

[0212] < / sequencedata>

[0213] <sequencedata sequenceidnumber="6">

[0214] <insdseq>

[0215] <INSDSeq_length> 224< / INSDSeq_length>

[0216] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0217] <INSDSeq_division> PAT< / INSDSeq_division>

[0218] <INSDSeq_feature-table>

[0219] <insdfeature>

[0220] <INSDFeature_key>source< / INSDFeature_key>

[0221] <INSDFeature_location>1..224< / INSDFeature_location>

[0222] <INSDFeature_quals>

[0223] <insdqualifier>

[0224] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0225] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0226] < / insdqualifier>

[0227] <insdqualifier id="q12">

[0228] <INSDQualifier_name>organism< / INSDQualifier_name>

[0229] <INSDQualifier_value>Solanum tuberosum< / INSDQualifier_value>

[0230] < / insdqualifier>

[0231] < / INSDFeature_quals>

[0232] < / insdfeature>

[0233] < / INSDSeq_feature-table>

[0234] <INSDSeq_sequence> gcaatggcttttaacaatcgggtctaagattggtaaaacgggtattgca

[0235] cttgtttatgaaacttccaacttcacaagctttaagctattggatgaagtgctgcatgcggttccgggta

[0236] cgggtatgtgggagtgtgtggacttttacccggtatcgactgaaaaaacaaacgggttggacacatcata

[0237] tacccgggtgtaaagcatgtgttaaaagcaagttt< / INSDSeq_sequence>

[0238] < / insdseq>

[0239] < / sequencedata>

[0240] <sequencedata sequenceidnumber="7">

[0241] <insdseq>

[0242] <INSDSeq_length> 226< / INSDSeq_length>

[0243] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0244] <INSDSeq_division> PAT< / INSDSeq_division>

[0245] <INSDSeq_feature-table>

[0246] <insdfeature>

[0247] <INSDFeature_key>source< / INSDFeature_key>

[0248] <INSDFeature_location>1..226< / INSDFeature_location>

[0249] <INSDFeature_quals>

[0250] <insdqualifier>

[0251] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0252] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0253] < / insdqualifier>

[0254] <insdqualifier id="q14">

[0255] <INSDQualifier_name>organism< / INSDQualifier_name>

[0256] <INSDQualifier_value>Solanum tuberosum< / INSDQualifier_value>

[0257] < / insdqualifier>

[0258] < / INSDFeature_quals>

[0259] < / insdfeature>

[0260] < / INSDSeq_feature-table>

[0261] <INSDSeq_sequence> gcaatggcttttaacaatcgggtctaagattggtaaaacgggtattgca

[0262] cttgtttatgaaacttccaacttcacaagctttaagctattggatgaagtgctgcatgcggttccgggta

[0263] cgggtatgtgggagtgtgtggacttttacccggtatcgactgaaaaaacaaacgggttggacacatcata

[0264] taaccccgggtgtaaagcatgtgttaaaagcaagttt< / INSDSeq_sequence>

[0265] < / insdseq>

[0266] < / sequencedata>

[0267] < / st26sequencelisting>

[0268] <---

Claims

1. A method for producing a potato plant with mutations in the coding region of the Pain-1 gene, comprising the following steps: obtaining a construct based on the pKSE401 vector containing the nucleotide sequence of the guide RNA SEQ ID NO: 4; transfer of this construct into potato cells using the bacterium Agrobacterium tumefaciens to introduce mutations into the coding region of the Pain-1 gene; selection of regenerated plants with mutations in the coding region of the Pain-1 gene, where the plant has alleles of the coding region of the Pain-1 gene with nucleotide sequences SEQ ID NO: 5, 6, 7.

2. A potato plant with mutations in the coding region of the Pain-1 gene for further use in the breeding process, obtained by the method according to claim 1, wherein the plant has alleles of the coding region of the Pain-1 gene with nucleotide sequences SEQ ID NO: 5, 6, 7.