Method for assessing replacements of kholmogory cattle breed based on rate of live weight gain
By evaluating Kholmogory cattle based on live weight gain and kappa-casein gene polymorphism, the method enhances selection accuracy and reduces costs by predicting rapid weight gain and milk production potential, addressing the limitations of existing methods.
Patent Information
- Application Number
- RU2025133914
- Authority / Receiving Office
- RU · RU
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2025-12-02
- Publication Date
- 2026-07-08
- Estimated Expiration
- 2045-12-02
AI Technical Summary
Existing methods for selecting replacement young animals for first insemination in the Kholmogory cattle breed lack accuracy and are influenced by feeding and maintenance conditions, and they do not effectively evaluate live weight gain or milk production potential.
Evaluate replacement young animals based on the rate of live weight gain and polymorphism of the kappa-casein gene CSN3 using DNA isolation and polymerase chain reaction with specific primers, identifying genotypes AA, AB, and BB to predict live weight and milk production potential.
This method increases the accuracy of selection and reduces development costs by identifying animals capable of rapid live weight gain for early insemination, improving milk productivity in first-calf cows.
Smart Images

Figure 00000001 
Figure 00000002 
Figure 00000003
Abstract
Description
[0001] The invention relates to the field of animal husbandry, namely to methods for evaluating replacement young animals of the Kholmogory cattle breed for the first insemination based on the rate of live weight gain and the polymorphism of the kappa-casein gene CSN3, and can be used as a criterion in the selection of replacement young animals.
[0002] A known method [Method for selecting calves with high potential for live weight gain / Nikolaev S.V. / / Patent for invention RU 2784587 C1 dated 11 / 28 / 2022 Application No. RU 2784587 C1 dated 09 / 05 / 2022], includes a biochemical blood test and a study of alkaline phosphatase activity to predict the rate of live weight gain in young cattle for selection and more accurately select calves with the desired phenotype, which in turn allows for a reduction in costs through early culling of young animals.
[0003] The disadvantages of the invention include the need for routine repeated blood collection from animals, the inaccuracy of forecasting, the effectiveness of which depends to a large extent on the feeding and maintenance of the animals.
[0004] A known method [Method for selection of young cattle by growth rate / Korotkevich O.S., Lyukhanov M.P., Narozhnykh K.N., Konovalova T.V., Petukhov V.L., Sebezhko O.I., Zaiko O.A., Kamaltdinov E.V., Soloshenko V.A. / / Patent for invention RU 2015130930 / 10 dated 07 / 24 / 2016. Application No. 2015130930 / 10 dated 07 / 24 / 2015], involves isolating DNA from animal blood and, using polymerase chain reaction, selecting calves from homozygous A / A and heterozygous A / G animals for the TNF-α-8 gene24. The method allows for early selection of animals with higher growth rates to increase meat yield and improve the efficiency of breeding work.
[0005] The disadvantages of this method include the impossibility of using it to evaluate the rate of live weight gain in replacement young cattle to reach the age of first productive insemination.
[0006] The technical result consists in the fact that the method allows for the evaluation of replacement young animals of the Kholmogory cattle breed for the first insemination based on the rate of live weight gain and on the polymorphism of the kappa-casein gene CSN3, which is also used to evaluate the predisposition of animals to high-fat milk production, which in turn will reduce the costs of the duration of calf development and improve the milk productivity of first-calf cows.
[0007] Regularly assessing replacement calves using this criterion to identify animals capable of gaining the required live weight at an earlier age for their first insemination will reduce development costs and improve milk production in first-calf heifers. This is because live weight positively correlates with many economically beneficial traits. Larger animals have a stronger constitution and better nutrient uptake and redistribution within the body. Live weight depends on the type of feeding, rearing conditions, and the animal's genotype. [1, 6]
[0008] The influence of the CSN3 gene on the growth and development of young cattle of various breeds has been studied by many Russian scientists, noting the superiority of the CSN3 genotype BB in terms of live weight at different ages, compared with young animals with the CSN3 genotype AA and genotype CSN3 AB [2, 4, 5].
[0009] In our studies of Kholmogory cattle, a positive relationship was established between the CSN3 genotypes AA , CSN3 AB and live weight indicators at birth, 6 and 10 months. Live weight at birth in calves with the CSN3 genotype AA was 4 kg more than that of calves with the CSN3 genotype AB At the age of 6 months, in young animals with the CSN3 genotype AB live weight was 11.5 kg greater than with the CSN3 genotype AA By 10 months of age, animals with the CSN3 genotype AB had a live weight 23 kg higher than their peers with CSN3 AA .
[0010] However, in young animals with CSN3 genotypes AA and CSN3 BB A relationship was found with live weight indicators at the age of 10 and 18 months, as well as at the first insemination.
[0011] Animals with the CSN3 genotype BB at the age of 10 months, their live weight was 38 kg higher than that of their peers with CSN3 AA, and also 12 months - 31 kg, at the first insemination - 24.5 kg.
[0012] Young animals with the CSN3 genotype BB had a greater weight by 51.7 kg than peers with the CSN3 genotype AA at the age of 18 months. At the time of the first insemination in replacement young animals with the CSN3 genotype BB greater live weight compared to replacement young animals with the CSN3 genotype AB , by 12.5 kg.
[0013] As a result, in all three groups of animals it was found that more than 50% were inseminated before the age of 15 months. Among heifers with the CSN3 genotype AA 30 heads (58%) reached the age of the first fruitful insemination up to and including 15 months, 22 heads (42%) - older than 15 months. Of the total number of animals with the CSN3 genotype AB 25 heads (71%) - animals that reached the age of the first fruitful insemination up to 15 months inclusive, 10 heads (29%) - older than 15 months. Of the 11 individuals with the CSN3 genotype BB, 6 heads reached the age of the first fruitful insemination up to and including 15 months, and 5 heads were inseminated at the age of over 15 months.
[0014] Thus, the genotype of replacement young animals for the milk gene kappa-casein (CSN3) can be considered as an indicator of the ability of young animals to gain weight more quickly before the first insemination in general.
[0015] There are 2 pairs of specific primers for identifying the CSN3 gene in cows:
[0016] Forward primer - 5' -ATAGCCAAATATATCCCAATTCAGT -3';
[0017] reverse - 5' -TTTATTAATAAGTCCATGAATCTTG -3'.
[0018] The technical problem solved by the invention is to increase the accuracy of assessment and selection based on the rate of body weight gain by using marker selection.
[0019] The set task in the method of evaluation and selection of dairy cattle by the rate of body weight gain according to the polymorphism of the kappa-casein gene is achieved by isolating DNA from the blood with subsequent genotyping of cows using the polymerase chain reaction, animals "BB" belonged to the high type of body weight gain, "AB" - to the average type of body weight gain, "AA" - to the low type, cows of high and average type are selected.
[0020] Example of execution.
[0021] The research was conducted at the Laboratory of Innovative Technologies in the Agro-Industrial Complex, part of the N.P. Laverov Federal Research Center for Integrated Arctic Studies, Ural Branch of the Russian Academy of Sciences (FSBI FICCIA UB RAS) in 2024-2025. We analyzed DNA samples from Kholmogory replacement cattle (n=98).
[0022] Blood collected from the jugular vein in vacuum tubes containing EDTA K3 was used as the biological material for DNA extraction. DNA was isolated from whole animal blood using the MagnoPrime VET reagent kit for DNA / RNA extraction from biological material and animal food products (NextBio, Russia).
[0023] For determination of CSN3 alleles A and CSN3 B The PCR-RFLP (polymerase chain reaction of restriction fragment lengths) method was used, PCR - special primers produced by ZAO Syntol (forward primer - 5'- ATAGCCAAATATATCCCAATTCAGT -3'; reverse - 5'- TTTATTAATAAGTCCATGAATCTTG -3').
[0024] Amplification of the k-casein gene was carried out with primers on an Applied Biosystems MiniAmp Plus DNA amplifier (USA) in a volume of 25 μl using a PCR kit with HS-Taq (+MgCl2) from Biolabmix according to the program: hot start - 5 min. at 95 °C; subsequent 40 cycles (denaturation - 30 sec. at 95 °C, annealing - 45 sec. at 60 °C, synthesis - 30 sec. at 72 °C; elongation - 5 min. at 72 °C).
[0025] The resulting product was placed on a 2% agarose gel and subjected to horizontal electrophoresis for 40 minutes at 100 V. To stain and visualize the fragments, the agarose gel after electrophoresis was soaked in a 0.005% ethidium bromide solution for 15 minutes and then viewed in the Vzglyad gel documentation system with a QuantumM-312B transilluminator at a wavelength of 310 nm. A positive result indicates the presence of DNA fragments 530 base pairs long.
[0026] The resulting amplifications were then subjected to restriction digestion. The amplification fragments were separated by horizontal electrophoresis in a 3% agarose gel for 40 minutes at 100 V, and the results were detected using the Vzglyad system.
[0027] Depending on the genotype of the animal being studied, fragments of 530, 400, and 130 nucleotide pairs were formed in the CSN3 gene. Genotype CSN3 AA corresponds to the presence of up to one fragment of 530 nucleotide pairs in length, CSN3 AB - two fragments 400 and 130 nucleotide pairs long, CSN3 BB - all three fragments.
[0028] The frequency of occurrence of genotypes was calculated using the formula [6]:
[0029]
[0030] where P is the frequency of a certain genotype, n is the number of animals with a certain genotype, N is the total number of animals.
[0031] The frequency of individual alleles was determined using the formulas:
[0032]
[0033] where RА - allele frequency A; Q B - frequency of allele B; nAA, nAB and nBB - number of animals with a certain genotype, N - total number of animals.
[0034] The obtained data were statistically processed using the SPSS Statistics 23 software using the Kruskal-Wallis H test, pairwise comparison using the Mann-Whitney test, followed by adjustment of values using the Benjamin-Hochberg correction.
[0035] Table 1 presents the CSN3 polymorphism in replacement young stock of the Holsteinized Kholmogory breed. The CSN3 allele A The kappa-casein gene is dominant in the studied sample of cattle and its frequency of occurrence is 70.9%, the CSN3 allele B - 29.1%. By frequency of occurrence, the CSN3 genotype AA amounted to 53.1%, CSN3 AB - 35.7, CSN3 BB - 11.2%.
[0036]
[0037] Median values of live weight indicators at 6, 10, 12, 18 months and at the first insemination depending on the CSN3 genotype are presented in Table 2.
[0038] A significant relationship was found between CSN3 genotypes AA , CSN3 AB and live weight indicators at birth, 6 and 10 months. Live weight at birth in calves with the CSN3 genotype AA was 4 kg more than that of calves with CSN3 AB Live weight at 6 months of age in young animals with CSN3 AB was 11.5 kg more than with CSN3 AA By 10 months of age, animals with the CSN3 genotype AB had a live weight 23 kg higher than their peers with CSN3 AA .
[0039] However, in young animals with CSN3 genotypes AA and CSN3 BB A correlation was found with live weight indicators at 10 and 18 months of age, as well as at first insemination. Animals with the CSN3 genotype BBat the age of 10 months, their live weight was 38 kg higher than that of their peers with CSN3 AA , and also 12 months - 31 kg, at the first insemination - 24.5 kg.
[0040] Young stock with genotype CSN3 BB had a greater weight by 51.7 kg than peers with the CSN3 genotype AA at the age of 18 months. At the time of the first insemination in replacement young animals with the CSN3 genotype BB greater live weight compared to replacement young animals with the CSN3 genotype AB , by 12.5 kg.
[0041]
[0042] Despite the fact that the Kholmogory breed replacement young animals with the CSN3 genotype AA At birth, a significantly higher live weight was observed than in peers with CSN3 AB , subsequently there was a reverse situation between animals with the same genotypes in terms of live weight at the age of 6 and 10 months. A significant superiority of young animals with CSN3 BB over peers with CSN3 AAwas observed in terms of weight at the age of 10, 12, 18 months and at the first insemination. A significant advantage in terms of live weight at the time of first insemination was revealed in replacement young animals with CSN3. BB , relative to young animals with CSN3 AB .
[0043] Thus, individuals with CSN3 AA They gain live weight better during the prenatal period of development, taking more biological resources from mother cows during pregnancy, and then are inferior in the rate of live weight gain in the postnatal period to young animals with CST3 genotypes AB and CSN3 BB , which has greater growth energy and is predisposed to rapid gain in live weight, necessary for the first insemination and increased productivity in the first and subsequent lactations.
[0044] Sources of information.
[0045] 1. Akhmetov T.M., Zinnatov F.F., Zinnatova F.F., Shamsova A.R. Relationship between polymorphic variants of the kappa-casein (CSN3) and beta-lactoglobulin (LGB) genes and milk productivity indicators in cows / / Modern scientific research: current issues, achievements and innovations in the agro-industrial complex: collection of scientific papers of the All-Russian scientific and practical conference: Kazan State Academy of Veterinary Medicine named after N.E. Bauman. Kazan, 2018. pp. 3-8.
[0046] 2. Barshinova A.V., Kalashnikova L.A. Polymorphism of the kappa-casein gene in young Red-Pied cattle in the Central Black Earth Zone of the Russian Federation / / Modern achievements and problems of biotechnology of agricultural animals: collection of scientific papers. Dubrovitsy, 2003. P. 83-84.
[0047] 3. Yudina O.P., Delyan A.S., et al. The influence of the genotypes of the kappa-casein gene and the country of origin of Holstein breeding bulls on the main economically useful traits of their daughters / / Bulletin of the TSA. 2020. No. 1. P. 76-94. https: / / doi.org / 10.26897 / 0021-342X-2020-l-76-94
[0048] 4. Chetvertakova E.V., Golubkov A.I., Eremina I.Yu. The influence of different genotypes at the kappa-casein gene locus on the growth and development indicators of Yenisei-type heifers of the Red-Pied breed of Central Siberia / / Bulletin of the Krasnoyarsk State Agrarian University. 2012. No. 8. P. 128-130.
[0049] 5. Shaidullin PP Association of CSN3 and DGAT1 gene polymorphism with live weight of heifers / / Bulletin of the Ulyanovsk State Agricultural Academy. 2018. No. 1 (41). P. 139-143. https: / / doi.org / 10.18286 / 1816-4501-2018-l-139-143
[0050] 6. Khorkova O.A., Soloviev A.G. Statistical methods and mathematical modeling / / Study guide. SSMU, Arkhangelsk, 2017. 177 p.
Claims
A method for assessing replacement young animals of the Kholmogory cattle breed for the first insemination based on the rate of live weight gain and the polymorphism of the kappa-casein gene CSN3, including the extraction of DNA from blood with subsequent genotyping of cows using the polymerase chain reaction, characterized in that animals with the genotype "BB" are classified as having a high type of live weight gain, "AB" - as having a medium type of live weight gain, "AA" - as having a low type, and cows of high and medium types are selected.
Citation Information
Patent Citations
Method for carrying out real time PCR for genotyping cattle on alleles a and b of the CSN3 gene
RU2701648C2
Method for the identification of bovine milk protein genetic polymorphisms
WO2007107862A2