A group of yeast microorganisms that accumulate less by-products for improved fuel, chemical, and amino acid production.

Abstract

DC60 (14 / 08 / 55) This invention involves various types of hybrid microorganisms that possess a biosynthetic pathway. Various methods and techniques for using the aforementioned hybrid microorganisms in the production of substances in the metabolic process. And it breaks down many beneficial substances in various aspects of this invention, such hybrid microorganisms. This may be further comprised of one or more modifications that result in a reduction or Eliminate 3-keto acids (e.g., acetolactate and 2-aceto-2-hydroxybutyrate) and / or The by-products derived from aldehydes in various combinations are described in this document. Such hybrid microorganisms may be various types of Kled Saccharomyces or yeast. Crabtree-negative yeast, Crabtree-positive yeast, and post-WGD (Whole Genome Multiplication). Pre-WGD (Whole Genome Multiplication) and non-fermenting yeast microorganisms.

Description

YEAST MICROORGANISMS WITH REDUCED BY-PRODUCT ACCUMULATION FOR IMPROVED PRODUCTION OF FUELS, CHEMICALS, AND AMINO ACIDSCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application Serial No. 61 / 304,069, filed February 12, 2010; U.S. Provisional Application Serial No. 61 / 308,568, filed February 26, 2010; U.S. Provisional Application Serial No. 61 / 282,641 , filed March 10, 2010; U.S. Provisional Application Serial No. 61 / 352,133, filed June 7, 2010; U.S. Provisional Application Serial No. 61 / 41 1 ,885, filed November 9, 2010; and U.S. Provisional Application Serial No. 61 / 430,801 , filed January 7, 201 1 , each of which is herein incorporated by reference in its entirety for all purposes.ACKNOWLEDGMENT OF GOVERNMENTAL SUPPORT

[0002] This invention was made with government support under Contract No. 2009-10006-05919, awarded by the United States Department of Agriculture, and under Contract No. W91 1 NF-09-2-0022, awarded by the United States Army Research Laboratory. The government has certain rights in the invention.TECHNICAL FIELD

[0003] Recombinant microorganisms and methods of producing such organisms are provided. Also provided are methods of producing beneficial metabolites'including fuels, chemicals, and amino acids by contacting a suitable substrate with recombinant microorganisms and enzymatic preparations therefrom.DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY

[0004] The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety: A computer readable format copy of the Sequence Listing (filename: GEVO_045_03WO_SeqList_ST25.txt, date recorded: February 9, 2011 , file size: 306 kilobytes).BACKGROUND

[0005] The ability of microorganisms to convert pyruvate to beneficial metabolites including fuels, chemicals, and amino acids has been widely described in the literature in recent years. See, e.g., Alper et ai., 2009, Nature Microbiol. Rev. 7: 715- 723. Recombinant engineering techniques have enabled the creation of microorganisms that express biosynthetic pathways capable of producing a number of useful products, such as valine, isoleucine, leucine, and panthothenic acid (vitamin B5). In addition, fuels such as isobutanol have been produced recombinantly in microorganisms expressing a heterologous metabolic pathway (See, e.g., WO / 2007 / 050671 to Donaldson et ai, and WO / 2008 / 098227 to Liao, et ai.). Although engineered microorganisms represent potentially useful tools for the renewable production of fuels, chemicals, and amino acids, many of these microorganisms have fallen short of commercial relevance due to their low performance characteristics, including low productivity, low titers, and low yields.

[0006] One of the primary reasons for the sub-optimal performance observed in many existing microorganisms is the undesirable conversion of pathway intermediates to unwanted by-products. The present inventors have identified various by-products, including 2,3-dihydroxy-2-methylbutanoic acid (DH2MB) (CAS #14868-24-7), 2-ethyl-2,3-dihydroxybutyrate, 2,3-dihydroxy-2-methyl-butanonate, isobutyrate, 3-methyl-1-butyrate, 2-methyl-1 -butyrate, and propionate, which are derived from various intermediates of biosynthetic pathways used to produce fuels, chemicals, and amino acids. The accumulation of these by-products negatively impacts the synthesis and yield of desirable metabolites in a variety of fermentation reactions. Until now, the enzymatic activities responsible for the production of these unwanted by-products had not been characterized. More particularly, the present application shows that the activities of a 3-ketoacid reductase (3-KAR) and an aldehyde dehydrogenase (ALDH) allow for the formation of these by-products from important biosynthetic pathway intermediates.

[0007] The present invention results from the study of these enzymatic activities and shows that the suppression of the 3-KAR and / or ALDH enzymes considerably reduces or eliminates the formation of unwanted by-products, and concomitantly improves the yields and titers of beneficial metabolites. The present application shows moreover, that enhancement of the 3-KAR and / or ALDH enzymatic activitiescan be used to increase the production of various by-products, such 2,3-dihydroxy-2- methylbutanoic acid (DH2MB), 2-ethyl-2,3-dihydroxybutyrate, 2,3-dihydroxy-2- methyl-butanonate, isobutyrate, 3-methyl-1 -butyrate, 2-methyl-1 -butyrate, and propionate.SUMMARY OF THE INVENTION

[0008] The present inventors have discovered that unwanted by-products can accumulate during various fermentation processes, including fermentation of the biofuel candidate, isobutanol. The accumulation of these unwanted by-products results from the undesirable conversion of pathway intermediates including the 3- keto acids, acetolactate and 2-aceto-2-hydroxybutyrate, and / or aldehydes, such as isobutyraldehyde, 1 -butanal, 1 -propanal, 2-methyl-1 -butanal, and 3-methyl-1 - butanal. The conversion of these intermediates to unwanted by-products can hinder the optimal productivity and yield of a 3-keto acid- and / or aldehyde-derived products. Therefore, the present inventors have developed methods for reducing the conversion of 3-keto acid and / or aldehyde intermediates to various fermentation byproducts during processes where a 3-keto acid and / or an aldehyde acts as a pathway intermediate.

[0009] In a first aspect, the present invention relates to a recombinant microorganism comprising a biosynthetic pathway of which a 3-keto acid and / or an aldehyde is / are intermediate(s), wherein said recombinant microorganism is (a) substantially free of an enzyme catalyzing the conversion of a 3-keto acid to a 3- hydroxyacid; (b) substantially free of an enzyme catalyzing the conversion of an aldehyde to an acid by-product; (c) engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of a 3-keto acid to a 3- hydroxyacid; and / or (d) engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of an aldehyde to acid by-product. In one embodiment, the 3-keto acid is acetolactate. In another embodiment, the 3-keto acid is 2-aceto-2-hydroxybutyrate.

[0010] In one embodiment, the invention is directed to a recombinant microorganism comprising a biosynthetic pathway which uses the 3-keto acid, acetolactate, as an intermediate, wherein said recombinant microorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of acetolactate to the corresponding 3-hydroxyacid, DH2MB. Insome embodiments, the enzyme catalyzing the conversion of acetolactate to DH2MB is a 3-ketoacid reductase (3-KAR).

[0011] In one embodiment, the invention is directed to a recombinant microorganism comprising a biosynthetic pathway which uses the 3-keto acid, 2- aceto-2-hydroxybutyrate, as an intermediate, wherein said recombinant microorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of acetolactate to the corresponding 3- hydroxyacid, 2-ethyl-2,3-dihydroxybutanoate. In some embodiments, the enzyme catalyzing the conversion of 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3- dihydroxybutanoate is a 3-ketoacid reductase (3-KAR).

[0012] In one embodiment, the invention is directed to a recombinant microorganism comprising a biosynthetic pathway which uses an aldehyde as an intermediate, wherein said recombinant microorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of the aldehyde to an acid by-product. In some embodiments, the enzyme catalyzing the conversion of the aldehyde to an acid by-product is an aldehyde dehydrogenase (ALDH).

[0013] In one embodiment, the invention is directed to a recombinant microorganism comprising a biosynthetic pathway which uses both a 3-keto acid and an aldehyde as intermediates, wherein said recombinant microorganism is (a) engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of a 3-keto acid intermediate to a 3-hydroxyacid by-product; and (b) engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of an aldehyde intermediate to an acid by-product. In one embodiment, the 3-keto acid is acetolactate and the 3-hydroxyacid by-product is DH2MB. In another embodiment, the 3-keto acid is 2-aceto-2-hydroxybutyrate and the 3-hydroxyacid by-product is 2-ethyl-2,3-dihydroxybutanoate. In some embodiments, the enzyme catalyzing the conversion of acetolactate to DH2MB is a 3-ketoacid reductase (3-KAR). In some other embodiments, the enzyme catalyzing the conversion of 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutanoate is a 3-ketoacid reductase (3-KAR). In some other embodiments, the enzyme catalyzing the conversion of the aldehyde to an acid by-product is an aldehyde dehydrogenase (ALDH). In yet some other embodiments, the enzyme catalyzing the conversion of acetolactate to DH2MB is a 3-ketoacid reductase (3-KAR) and the enzymecatalyzing the conversion of the aldehyde to an acid by-product is an aldehyde dehydrogenase (ALDH). In yet some other embodiments, the enzyme catalyzing the conversion of 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutanoate is a 3- ketoacid reductase (3-KAR) and the enzyme catalyzing the conversion of the aldehyde to an acid by-product is an aldehyde dehydrogenase (ALDH).

[0014] In various embodiments described herein, the recombinant microorganisms of the invention may comprise a reduction or deletion of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of a 3-keto acid intermediate to a 3-hydroxyacid by-product. In one embodiment, the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of a 3-keto acid intermediate to a 3-hydroxyacid byproduct is reduced by at least about 50%. In another embodiment, the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of a 3-keto acid intermediate to a 3-hydroxyacid by-product is reduced by at least about 60%, by at least about 65%, by at least about 70%, by at least about 75%, by at least about 80%, by at least about 85%, by at least about 90%, by at least about 95%, or by at least about 99% as compared to a recombinant microorganism not comprising a reduction or deletion of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of a 3-keto acid intermediate to a 3-hydroxyacid by-product. In one embodiment, the 3-keto acid intermediate is acetolactate and the 3-hydroxyacid by-product is DH2MB. In another embodiment, the 3-keto acid intermediate is 2-aceto-2-hydroxybutyrate and the 3- hydroxyacid by-product is 2-ethyl-2,3-dihydroxybutanoate.

[0015] In various embodiments described herein, the protein involved in catalyzing the conversion of a 3-keto acid intermediate to a 3-hydroxyacid by-product is a ketoreductase. In an exemplary embodiment, the ketoreductase is a 3-ketoacid reductase (3-KAR). In another embodiment, the protein is a short chain alcohol dehydrogenase. In yet another embodiment, the protein is a medium chain alcohol dehydrogenase. In yet another embodiment, the protein is an aldose reductase. In yet another embodiment, the protein is a D-hydroxyacid dehydrogenase. In yet another embodiment, the protein is a lactate dehydrogenase. In yet another embodiment, the protein is selected from the group consisting of YAL060W, YJR 59W, YGL157W, YBL1 14W, YOR120W, YKL055C, YBR159W, YBR149W, YDL168W, YDR368W, YLR426W, YCR107W, YIL124W, YML054C, YOL151W,YMR318C, YMR226C, YBR046C, YHR104W, YIR036C, YDL174C, YDR541 C, YBR145W, YGL039W, YCR105W, YDL124W, YIR035C, YFL056C, YNL274C, YLR255C, YGL185C, YGL256W, YJR096W, YMR226C, YJR155W, YPL275W, YOR388C, YLR070C, YMR083W, YER081W, YJR139C, YDL243C, YPL1 13C, YOL165C, YML086C, YMR303C, YDL246C, YLR070C, YHR063C, YNL331 C, YFL057C, YIL155C, YOL086C, YAL061W, YDR127W, YPR127W, YCI018W, YIL074C, YIL124W, and YEL071W genes of S. cerevisiae and homologs thereof.

[0016] In one embodiment, the endogenous protein is a 3-ketoacid reductase (3- KAR). In an exemplary embodiment, the 3-ketoacid reductase is the S. cerevisiae YMR226C (SEQ ID NO: 1 ) protein, used interchangeably herein with "TMA29". In some embodiments, the endogenous protein may be the S. cerevisiae YMR226C (SEQ ID NO: 1 ) protein or a homolog or variant thereof. In one embodiment, the homolog may be selected from the group consisting of Vanderwaltomzyma polyspora (SEQ ID NO: 2), Saccharomyces castellii (SEQ ID NO: 3), Candida glabrata (SEQ ID NO: 4), Saccharomyces bayanus (SEQ ID NO: 5), Zygosaccharomyces rouxii (SEQ ID NO: 6), Kluyveromyces lactis (SEQ ID NO: 7), Ashbya gossypii (SEQ ID NO: 8), Saccharomyces kluyveri (SEQ ID NO: 9), Kluyveromyces thermotolerans (SEQ ID NO: 10), Kluyveromyces waltii (SEQ ID NO: 11 ), Pichia stipitis (SEQ ID NO: 12), Debaromyces hansenii (SEQ ID NO: 3), Pichia pastoris (SEQ ID NO: 14), Candida dubliniensis (SEQ ID NO: 15), Candida albicans (SEQ ID NO: 16), Yarrowia lipolytica (SEQ ID NO: 17), Issatchenkia orientalis (SEQ ID NO: 18), Aspergillus nidulans (SEQ ID NO: 19), Aspergillus niger (SEQ ID NO: 20), Neurospora crassa (SEQ ID NO: 21 ), Schizosaccharomyces pombe (SEQ ID NO: 22), and Kluyveromyces marxianus (SEQ ID NO: 23).

[0017] In one embodiment, the recombinant microorganism includes a mutation in at least one gene encoding for a 3-ketoacid reductase resulting in a reduction of 3- ketoacid reductase activity of a polypeptide encoded by said gene. In another embodiment, the recombinant microorganism includes a partial deletion of gene encoding for a 3-ketoacid reductase resulting in a reduction of 3-ketoacid reductase activity of a polypeptide encoded by the gene. In another embodiment, the recombinant microorganism comprises a complete deletion of a gene encoding for a 3-ketoacid reductase resulting in a reduction of 3-ketoacid reductase activity of a polypeptide encoded by the gene. In yet another embodiment, the recombinant microorganism includes a modification of the regulatory region associated with thegene encoding for a 3-ketoacid reductase resulting in a reduction of expression of a polypeptide encoded by said gene. In yet another embodiment, the recombinant microorganism comprises a modification of the transcriptional regulator resulting in a reduction of transcription of a gene encoding for a 3-ketoacid reductase. In yet another embodiment, the recombinant microorganism comprises mutations in all genes encoding for a 3-ketoacid reductase resulting in a reduction of activity of a polypeptide encoded by the gene(s). In one embodiment, the 3-ketoacid reductase activity or expression is reduced by at least about 50%. In another embodiment, the 3-ketoacid reductase activity or expression is reduced by at least about 60%, by at least about 65%, by at least about 70%, by at least about 75%, by at least about 80%, by at least about 85%, by at least about 90%, by at least about 95%, or by at least about 99% as compared to a recombinant microorganism not comprising a reduction of the 3-ketoacid reductase activity or expression. In one embodiment, said 3-ketoacid reductase is encoded by the S. cerevisiae TMA29 (YMR226C) gene or a homolog thereof.

[0018] In various embodiments described herein, the recombinant microorganisms of the invention may comprise a reduction or deletion of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of an aldehyde to an acid by-product. In one embodiment, the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of an aldehyde to an acid by-product is reduced by at least about 50%. In another embodiment, the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of an aldehyde to an acid by-product is reduced by at least about 60%, by at least about 65%, by at least about 70%, by at least about 75%, by at least about 80%, by at least about 85%, by at least about 90%, by at least about 95%, or by at least about 99% as compared to a recombinant microorganism not comprising a reduction or deletion of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of an aldehyde to an acid by-product.

[0019] In various embodiments described herein, the endogenous protein involved in catalyzing the conversion of an aldehyde to an acid by-product is an aldehyde dehydrogenase (ALDH). In one embodiment, the aldehyde dehydrogenase is encoded by a gene selected from the group consisting of ALD2, ALD3, ALD4, ALD5, ALD6, and HFD1, and homologs and variants thereof. In an exemplaryembodiment, the aldehyde dehydrogenase is the S. cerevisiae ALD6 (SEQ ID NO: 25) protein. In some embodiments, the aldehyde dehydrogenase is the S. cerevisiae ALD6 (SEQ ID NO: 25) protein or a homolog or variant thereof. In one embodiment, the homolog is selected from the group consisting of Saccharomyces castelli (SEQ ID NO: 26), Candida glabrata (SEQ ID NO: 27), Saccharomyces bayanus (SEQ ID NO: 28), Kluyveromyces lactis (SEQ ID NO: 29), Kluyveromyces thermotolerans (SEQ ID NO: 30), Kluyveromyces waltii (SEQ ID NO: 31 ), Saccharomyces cerevisiae YJ789 (SEQ ID NO: 32), Saccharomyces cerevisiae JAY291 (SEQ ID NO: 33), Saccharomyces cerevisiae EC1118 (SEQ ID NO: 34), Saccharomyces cerevisiae DBY939 (SEQ ID NO: 35), Saccharomyces cerevisiae AWRI1631 (SEQ ID NO: 36), Saccharomyces cerevisiae RM11 -1 a (SEQ ID NO: 37), Pichia pastoris (SEQ ID NO: 38), Kluyveromyces marxianus (SEQ ID NO: 39), Schizosaccharomyces pombe (SEQ ID NO: 40), and Schizosaccharomyces pombe (SEQ ID NO: 41 ).

[0020] In one embodiment, the recombinant microorganism includes a mutation in at least one gene encoding for an aldehyde dehydrogenase resulting in a reduction of aldehyde dehydrogenase activity of a polypeptide encoded by said gene. In another embodiment, the recombinant microorganism includes a partial deletion of gene encoding for an aldehyde dehydrogenase resulting in a reduction of aldehyde dehydrogenase activity of a polypeptide encoded by the gene. In another embodiment, the recombinant microorganism comprises a complete deletion of a gene encoding for an aldehyde dehydrogenase resulting in a reduction of aldehyde dehydrogenase activity of a polypeptide encoded by the gene. In yet another embodiment, the recombinant microorganism includes a modification of the regulatory region associated with the gene encoding for an aldehyde dehydrogenase resulting in a reduction of expression of a polypeptide encoded by said gene. In yet another embodiment, the recombinant microorganism comprises a modification of the transcriptional regulator resulting in a reduction of transcription of a gene encoding for an aldehyde dehydrogenase. In yet another embodiment, the recombinant microorganism comprises mutations in all genes encoding for an aldehyde dehydrogenase resulting in a reduction of activity of a polypeptide encoded by the gene(s). In one embodiment, the aldehyde dehydrogenase activity or expression is reduced by at least about 50%. In another embodiment, the aldehyde dehydrogenase activity or expression is reduced by at least about 60%, by at least about 65%, by at least about 70%, by at least about 75%, by at least about 80%, byat least about 85%, by at least about 90%, by at least about 95%, or by at least about 99% as compared to a recombinant microorganism not comprising a reduction of the aldehyde dehydrogenase activity or expression. In one embodiment, said aldehyde dehydrogenase is encoded by the S. cerevisiae ALD6 gene or a homolog thereof.

[0021] In various embodiments described herein, the recombinant microorganism may comprise a biosynthetic pathway which uses a 3-keto acid as an intermediate. In one embodiment, the 3-keto acid intermediate is acetoiactate. The biosynthetic pathway which uses acetoiactate as an intermediate may be selected from a pathway for the biosynthesis of isobutanol, 2-butanol, 1 -butanol, 2-butanone, 2,3- butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl- 1 -butanol, 4-methyl-1 -pentanol, and coenzyme A. In another embodiment, the 3- keto acid intermediate is 2-aceto-2-hydroxybutyrate. The biosynthetic pathway which uses 2-aceto-2-hydroxybutyrate as an intermediate may be selected from a pathway for the biosynthesis of 2-methyl-1-butanol, isoleucine, 3-methyl-1 -pentanol, 4-methyl- 1 -hexanol, and 5-methyl-1 -heptanol.

[0022] In various embodiments described herein, the recombinant microorganism may comprise a biosynthetic pathway which uses an aldehyde as an intermediate. The biosynthetic pathway which uses an aldehyde as an intermediate may be selected from a pathway for the biosynthesis of isobutanol, 1 -butanol, 2-methyl-1- butanol, 3-methyl-1 -butanol, 1 -propanol, 1 -pentanol, 1 -hexanol, 3-methyl-1 -pentanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol. In various embodiments described herein, the aldehyde intermediate may be selected from isobutyraldehyde, 1-butanal, 2-methyl-1 -butanal, 3-methyl-1 -butanal, 1 -propanal, 1 - pentanal, 1-hexanal, 3-methyl-1 -pentanal, 4-methyl-1 -pentanal, 4-methyl-1 -hexanal, and 5-methyl-1 -heptanal.

[0023] In various embodiments described herein, the recombinant microorganism may comprise a biosynthetic pathway which uses a 3-keto acid and an aldehyde as intermediates. In one embodiment, the 3-keto acid intermediate is acetoiactate. The biosynthetic pathway which uses acetoiactate and an aldehyde as intermediates may be selected from a pathway for the biosynthesis of isobutanol, 1 -butanol, and 3- methyl-1 -butanol. In another embodiment, the 3-keto acid intermediate is 2-aceto-2- hydroxybutyrate. The biosynthetic pathway which uses 2-aceto-2-hydroxybutyrate and an aldehyde as intermediates may be selected from a pathway for thebiosynthesis of 2-methyl-l -butanol, 3-methyl-1 -pentanol, 4-methyl-l -hexanol, and 5- methyl-1 -heptanol.

[0024] In one embodiment, the invention is directed to a recombinant microorganism for producing isobutanol, wherein said recombinant microorganism comprises an isobutanol producing metabolic pathway and wherein said microorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of acetolactate to DH2MB. In some embodiments, the enzyme catalyzing the conversion of acetolactate to DH2MB is a 3-ketoacid reductase (3-KAR). In a specific embodiment, the 3-ketoacid reductase is encoded by the S. cerevisiae TMA29 (YMR226C) gene or a homolog thereof.

[0025] In another embodiment, the invention is directed to a recombinant microorganism for producing isobutanol, wherein said recombinant microorganism comprises an isobutanol producing metabolic pathway and wherein said microorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of isobutyraldehyde to isobutyrate. In some embodiments, the enzyme catalyzing the conversion of isobutyraldehyde to isobutyrate is an aldehyde dehydrogenase. In a specific embodiment, the aldehyde dehydrogenase is encoded by the S. cerevisiae ALD6 gene or a homolog thereof.

[0026] In yet another embodiment, the invention is directed to a recombinant microorganism for producing isobutanol, wherein said recombinant microorganism comprises an isobutanol producing metabolic pathway and wherein said microorganism is (i) engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of acetolactate to DH2MB and (ii) engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of isobutyraldehyde to isobutyrate. In some embodiments, the enzyme catalyzing the conversion of acetolactate to DH2MB is a 3-ketoacid reductase (3- KAR). In a specific embodiment, the 3-ketoacid reductase is encoded by the S. cerevisiae TMA29 (YMR226C) gene or a homolog thereof. In some embodiments, the enzyme catalyzing the conversion of isobutyraldehyde to isobutyrate is an aldehyde dehydrogenase. In a specific embodiment, the aldehyde dehydrogenase is encoded by the S. cerevisiae ALD6 gene or a homolog thereof.

[0027] In one embodiment, the isobutanol producing metabolic pathway comprises at least one exogenous gene that catalyzes a step in the conversion of pyruvate to isobutanol. In another embodiment, the isobutanol producing metabolicpathway comprises at least two exogenous genes that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at least three exogenous genes that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at least four exogenous genes that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at five exogenous genes that catalyze steps in the conversion of pyruvate to isobutanol.

[0028] In one embodiment, one or more of the isobutanol pathway genes encodes an enzyme that is localized to the cytosol. In one embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least one isobutanol pathway enzyme localized in the cytosol. In another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least two isobutanol pathway enzymes localized in the cytosol. In yet another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least three isobutanol pathway enzymes localized in the cytosol. In yet another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least four isobutanol pathway enzymes localized in the cytosol. In an exemplary embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with five isobutanol pathway enzymes localized in the cytosol.

[0029] In various embodiments described herein, the isobutanol pathway genes encodes enzyme(s) selected from the group consisting of acetolactate synthase (ALS), ketol-acid reductoisomerase (KARI), dihydroxyacid dehydratase (DHAD), 2- keto-acid decarboxylase (KIVD), and alcohol dehydrogenase (ADH).

[0030] In another aspect, the recombinant microorganism may be engineered to reduce the conversion of isobutanol to isobutyraldehyde by reducing and / or eliminating the expression of one or more alcohol dehydrogenases. In a specific embodiment, the alcohol dehydrogenase is encoded by a gene selected from the group consisting of ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, and ADH7, and homologs and variants thereof.

[0031] In another aspect, the present invention relates to modified alcohol dehydrogenase (ADH) enzymes that exhibit an enhanced ability to convert isobutyraldehyde to isobutanol. In general, cells expressing these improved ADHenzymes will produce increased levels of isobutanol during fermentation reactions. While the modified ADH enzymes of the present invention have utility in isobutanol- producing fermentation reactions, it will be understood by those skilled in the art equipped with this disclosure that the modified ADH enzymes also have usefulness in fermentation reactions producing other alcohols such as 1 -propanol, 2-propanol, 1 -butanol, 2-butanol, 1 -pentanol, 2-methyl-l-butanol, and 3-methyl-1-butanol.

[0032] In certain aspects, the invention is directed to alcohol dehydrogenases (ADHs), which have been modified to enhance the enzyme's ability to convert isobutyraldehyde to isobutanol. Examples of such ADHs include enzymes having one or more mutations at positions corresponding to amino acids selected from: (a) tyrosine 50 of the L. lactis AdhA (SEQ ID NO: 185); (b) glutamine 77 of the L. lactis AdhA (SEQ ID NO: 185); (c) valine 108 of the L. lactis AdhA (SEQ ID NO: 185); (d) tyrosine 1 13 of the L. lactis AdhA (SEQ ID NO: 185); (e) isoleucine 212 of the L. lactis AdhA (SEQ ID NO: 185); and (f) leucine 264 of the L. lactis AdhA (SEQ ID NO: 185), wherein AdhA (SEQ ID NO: 185) is encoded by the L. lactis alcohol dehydrogenase (ADH) gene adhA (SEQ ID NO: 184) or a codon-optimized version thereof (SEQ ID NO: 206).

[0033] In one embodiment, the modified ADH enzyme contains a mutation at the amino acid corresponding to position 50 of the L. lactis AdhA (SEQ ID NO: 185). In another embodiment, the modified ADH enzyme contains a mutation at the amino acid corresponding to position 77 of the L. lactis AdhA (SEQ ID NO: 185). In yet another embodiment, the modified ADH enzyme contains a mutation at the amino acid corresponding to position 108 of the L. lactis AdhA (SEQ ID NO: 185). In yet another embodiment, the modified ADH enzyme contains a mutation at the amino acid corresponding to position 1 13 of the L. lactis AdhA (SEQ ID NO: 185). In yet another embodiment, the modified ADH enzyme contains a mutation at the amino acid corresponding to position 212 of the L. lactis AdhA (SEQ ID NO: 185). In yet another embodiment, the modified ADH enzyme contains a mutation at the amino acid corresponding to position 264 of the L. lactis AdhA (SEQ ID NO: 185).

[0034] In one embodiment, the ADH enzyme contains two or more mutations at the amino acids corresponding to the positions described above. In another embodiment, the ADH enzyme contains three or more mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the ADH enzyme contains four or more mutations at the amino acids corresponding tothe positions described above. In yet another embodiment, the ADH enzyme contains five or more mutations at the amino acids corresponding to the positions described above. In yet another embodiment, the ADH enzyme contains six mutations at the amino acids corresponding to the positions described above.

[0035] In one specific embodiment, the invention is directed to ADH enzymes wherein the tyrosine at position 50 is replaced with a phenylalanine or tryptophan residue. In another specific embodiment, the invention is directed to ADH enzymes wherein the glutamine at position 77 is replaced with an arginine or serine residue. In another specific embodiment, the invention is directed to ADH enzymes wherein the valine at position 108 is replaced with a serine or alanine residue. In another specific embodiment, the invention is directed to ADH enzymes wherein the tyrosine at position 1 13 is replaced with a phenylalanine or glycine residue. In another specific embodiment, the invention is directed to ADH enzymes wherein the isoleucine at position 212 is replaced with a threonine or valine residue. In yet another specific embodiment, the invention is directed to ADH enzymes wherein the leucine at position 264 is replaced with a valine residue. In one embodiment, the ADH enzyme contains two or more mutations at the amino acids corresponding to the positions described in these specific embodiments. In another embodiment, the ADH enzyme contains three or more mutations at the amino acids corresponding to the positions described in these specific embodiments. In yet another embodiment, the ADH enzyme contains four or more mutations at the amino acids corresponding to the positions described in these specific embodiments. In yet another embodiment, the ADH enzyme contains five or more mutations at the amino acids corresponding to the positions described in these specific embodiments. In yet another embodiment, the ADH enzyme contains six mutations at the amino acids corresponding to the positions described in these specific embodiments.

[0036] In certain exemplary embodiments, the ADH enzyme comprises a sequence selected SEQ ID NO: 189, SEQ ID NO: 191 , SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201 , SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, and homologs or variants thereof comprising corresponding mutations as compared to the wild-type or parental enzyme.

[0037] As alluded to in the preceding paragraph, further included within the scopeof the invention are ADH enzymes, other than the L. lactis AdhA (SEQ ID NO: 185), which contain alterations corresponding to those set out above. Such ADH enzymes may include, but are not limited to, the ADH enzymes listed in Table 97.

[0038] In some embodiments, the ADH enzymes to be modified are NADH- dependent ADH enzymes. Examples of such NADH-dependent ADH enzymes are described in commonly owned and co-pending U.S. Patent Publication No. 2010 / 0143997, which is herein incorporated by reference in its entirety for all purposes. In some embodiments, genes originally encoding NADPH-utilizing ADH enzymes are modified to switch the co-factor preference of the enzyme to NADH.

[0039] As described herein, the modified ADHs will generally exhibit an enhanced ability to convert isobutyraldehyde to isobutanol as compared to the wild-type or parental ADH. Preferably, the catalytic efficiency (kcat / Kivi) of the modified ADH enzyme is enhanced by at least about 5% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 15% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 25% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 50% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 75% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 100% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 200% as compared to the wild- type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 500% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 1000% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 2000% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 3000% as compared to the wild-type or parental ADH. Most preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 3500% as compared to the wild-type or parental ADH.

[0040] In additional aspects, the invention is directed to modified ADH enzymes that have been codon optimized for expression in certain desirable host organisms, such as yeast and E. coli. In other aspects, the present invention is directed to recombinant host cells comprising a modified ADH enzyme of the invention. According to this aspect, the present invention is also directed to methods of using the modified ADH enzymes in any fermentation process, where the conversion of isobutyraldehyde to isobutanol is desired. In one embodiment according to this aspect, the modified ADH enzymes may be suitable for enhancing a host cell's ability to produce isobutanol. In another embodiment according to this aspect, the modified ADH enzymes may be suitable for enhancing a host cell's ability to produce 1 - propanol, 2-propanol, 1 -butanol, 2-butanol, 1 -pentanol, 2-methyl-1 -butanol, and 3- methyl-1 -butanol.

[0041] In various embodiments described herein, the recombinant microorganisms comprising a modified ADH may be further engineered to express an isobutanol producing metabolic pathway. In one embodiment, the recombinant microorganism may be engineered to express an isobutanol producing metabolic pathway comprising at least one exogenous gene. In one embodiment, the recombinant microorganism may be engineered to express an isobutanol producing metabolic pathway comprising at least two exogenous genes. In another embodiment, the recombinant microorganism may be engineered to express an isobutanol producing metabolic pathway comprising at least three exogenous genes. In another embodiment, the recombinant microorganism may be engineered to express an isobutanol producing metabolic pathway comprising at least four exogenous genes. In another embodiment, the recombinant microorganism may be engineered to express an isobutanol producing metabolic pathway comprising five exogenous genes. Thus, the present invention further provides recombinant microorganisms that comprise an isobutanol producing metabolic pathway and methods of using said recombinant microorganisms to produce isobutanol.

[0042] In various embodiments described herein, the isobutanol pathway enzyme(s) is / are selected from acetolactate synthase (ALS), ketol-acid reductoisomerase (KARI), dihydroxyacid dehydratase (DHAD), 2-keto-acid decarboxylase (KIVD), and alcohol dehydrogenase (ADH).

[0043] In various embodiments described herein, the isobutanol pathway enzymes may be derived from a prokaryotic organism. In alternative embodimentsdescribed herein, the isobutanol pathway enzymes may be derived from a eukaryotic organism. An exemplary metabolic pathway that converts pyruvate to isobutanol may be comprised of a acetohydroxy acid synthase (ALS) enzyme encoded by, for example, alsS from B. subtilis, a ketol-acid reductoisomerase (KARI) encoded by, for example ilvC from E. coli, a dihyroxy-acid dehydratase (DHAD), encoded by, for example, ilvD from L. lactis, a 2-keto-acid decarboxylase (KIVD) encoded by, for example kivD from L. lactis, and an alcohol dehydrogenase (ADH) (e.g. a modified ADH described herein), encoded by, for example, adhA from L lactis with one or more mutations at positions Y50, Q77, V108, Y1 13, 1212, and L264 as described herein.

[0044] In various embodiments described herein, the recombinant microorganisms may be microorganisms of the Saccharomyces clade, Saccharomyces sensu stricto microorganisms, Crabtree-negative yeast microorganisms, Crabtree-positive yeast microorganisms, post-WGD (whole genome duplication) yeast microorganisms, pre-WGD (whole genome duplication) yeast microorganisms, and non-fermenting yeast microorganisms.

[0045] In some embodiments, the recombinant microorganisms may be yeast recombinant microorganisms of the Saccharomyces clade.

[0046] In some embodiments, the recombinant microorganisms may be Saccharomyces sensu stricto microorganisms. In one embodiment, the Saccharomyces sensu stricto is selected from the group consisting of S. cerevisiae, S. kudriavzevii, S. mikatae, S. bayanus, S. uvarum. S. carocanis and hybrids thereof.

[0047] In some embodiments, the recombinant microorganisms may be Crabtree- negative recombinant yeast microorganisms. In one embodiment, the Crabtree- negative yeast microorganism is classified into a genera selected from the group consisting of Saccharomyces, Kluyveromyces, Pichia, Issatchenkia, Hansenula, or Candida. In additional embodiments, the Crabtree-negative yeast microorganism is selected from Saccharomyces kluyveri, Kluyveromyces lactis, Kluyveromyces marxianus, Pichia anomala, Pichia stipitis, Hansenula anomala, Candida utilis and Kluyveromyces waltii.

[0048] In some embodiments, the recombinant microorganisms may be Crabtree- positive recombinant yeast microorganisms. In one embodiment, the Crabtree- positive yeast microorganism is classified into a genera selected from the group consisting of Saccharomyces, Kluyveromyces, Zygosaccharomyces, Debaryomyces,Candida, Pichia and Schizosaccharomyces. In additional embodiments, the Crabtree-positive yeast microorganism is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces uvarum, Saccharomyces bayanus, Saccharomyces paradoxus, Saccharomyces castelli, Kluyveromyces thermotoierans, Candida glabrata, Z. bailli, Z. rouxii, Debaryomyces hansenii, Pichia pastorius, Schizosaccharomyces pombe, and Saccharomyces uvarum.

[0049] In some embodiments, the recombinant microorganisms may be post- WGD (whole genome duplication) yeast recombinant microorganisms. In one embodiment, the post-WGD yeast recombinant microorganism is classified into a genera selected from the group consisting of Saccharomyces or Candida. In additional embodiments, the post-WGD yeast is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces uvarum, Saccharomyces bayanus, Saccharomyces paradoxus, Saccharomyces castelli, and Candida glabrata.

[0050] In some embodiments, the recombinant microorganisms may be pre-WGD (whole genome duplication) yeast recombinant microorganisms. In one embodiment, the pre-WGD yeast recombinant microorganism is classified into a genera selected from the group consisting of Saccharomyces, Kluyveromyces, Candida, Pichia, Issatchenkia, Debaryomyces, Hansenula, Pachysolen, Yarrowia and Schizosaccharomyces. In additional embodiments, the pre-WGD yeast is selected from the group consisting of Saccharomyces kluyveri, Kluyveromyces thermotoierans, Kluyveromyces marxianus, Kluyveromyces waltii, Kluyveromyces lactis, Candida tropicalis, Pichia pastoris, Pichia anomala, Pichia stipitis, Issatchenkia orientalis, Issatchenkia occidentalis, Debaryomyces hansenii, Hansenula anomala, Pachysolen tannophilis, Yarrowia lipolytica, and Schizosaccharomyces pombe.

[0051] In some embodiments, the recombinant microorganisms may be microorganisms that are non-fermenting yeast microorganisms, including, but not limited to those, classified into a genera selected from the group consisting of Tricosporon, Rhodotorula, Myxozyma, or Candida. In a specific embodiment, the non-fermenting yeast is C. xestobii.

[0052] In another aspect, the present invention provides methods of producing beneficial metabolites including fuels, chemicals, and amino acids using a recombinant microorganism as described herein. In one embodiment, the method includes cultivating the recombinant microorganism in a culture medium containing afeedstock providing the carbon source until a recoverable quantity of the metabolite is produced and optionally, recovering the metabolite. In one embodiment, the microorganism produces the metabolite from a carbon source at a yield of at least about 5 percent theoretical. In another embodiment, the microorganism produces the metabolite at a yield of at least about 10 percent, at least about 15 percent, about least about 20 percent, at least about 25 percent, at least about 30 percent, at least about 35 percent, at least about 40 percent, at least about 45 percent, at least about 50 percent, at least about 55 percent, at least about 60 percent, at least about 65 percent, at least about 70 percent, at least about 75 percent, at least about 80 percent, at least about 85 percent, at least about 90 percent, at least about 95 percent, or at least about 97.5 percent theoretical. In one embodiment, the metabolite may be derived from a biosynthetic pathway which uses a 3-keto acid as an intermediate. In one embodiment, the 3-keto acid intermediate is acetolactate. Accordingly, the metabolite may be derived from a biosynthetic pathway which uses acetolactate as an intermediate, including, but not limited to, isobutanol, 2-butanol, 1 - butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl-1 -butanol, 4-methyl-1 -pentanol, and coenzyme A. In another embodiment, the 3-keto acid intermediate is 2-aceto-2-hydroxybutyrate. Accordingly, the metabolite may be derived from a biosynthetic pathway which uses 2-aceto-2-hydroxybutyrate as an intermediate, including, but not limited to, 2-methyl- 1 -butanol, isoleucine, 3-methyl-1 -pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 - heptanol. In another embodiment, the metabolite may be derived from a biosynthetic pathway which uses an aldehyde as an intermediate, including, but not limited to, isobutanol, 1 -butanol, 2-methyl-1-butanol, 3-methyl-1 -butanol, 1 -propanol, 1 - pentanol, 1 -hexanol, 3-methyl-1 -pentanol, 4-methyl-1-pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 -heptanol. In yet another embodiment, the metabolite may be derived from a biosynthetic pathway which uses acetolactate and an aldehyde as intermediates, including, but not limited to, isobutanol, 1 -butanol, and 3-methyl-1 - butanol biosynthetic pathways. In yet another embodiment, the metabolite may be derived from a biosynthetic pathway which uses 2-aceto-2-hydroxybutyrate and an aldehyde as intermediates, including, but not limited to, 2-methyl-1-butanol, 3- methyl-1 -pentanol, 4-methyl-1-hexanol, and 5-methyl-1 -heptanol biosynthetic pathways.

[0053] In one embodiment, the recombinant microorganism is grown under aerobic conditions. In another embodiment, the recombinant microorganism is grown under microaerobic conditions. In yet another embodiment, the recombinant microorganism is grown under anaerobic conditions.BRIEF DESCRIPTION OF DRAWINGS

[0054] Illustrative embodiments of the invention are illustrated in the drawings, in which:

[0055] Figure 1 illustrates an exemplary embodiment of an isobutanol pathway.

[0056] Figure 2 illustrates exemplary reactions capable of being catalyzed by 3- ketoacid reductases.

[0057] Figure 3 illustrates a non-limiting list of exemplary 3-ketoacid reductases and their corresponding enzyme classification numbers.

[0058] Figure 4 illustrates exemplary reactions capable of being catalyzed by aldehyde dehydrogenases.

[0059] Figure 5 illustrates a strategy for reducing the production of DH2MB and isobutyrate in isobutanol-producing recombinant microorganisms.

[0060] Figure 6 illustrates a strategy for reducing the production of DH2MB and 3- methyl-1 -butyrate in 3-methyl-1-butanol-producing recombinant microorganisms.

[0061] Figure 7 illustrates a strategy for reducing the production of 2-ethyl-2,3- dihydroxybutyrate and 2-methyl-1 -butyrate in 2-methyl-1 -butanol producing recombinant microorganisms.

[0062] Figure 8 illustrates a stacked overlay of LC4 chromatograms showing a sample containing DH2MB and acetate (top) and a sample containing acetate and DHIV (bottom). Elution order: DH2MB followed by acetate (top); lactate, acetate, DHIV, isobutyrate, pyruvate (bottom).

[0063] Figure 9 illustrates a chromatogram for sample fraction collected at retention time corresponding to DHIV collected on LC1 and analyzed by LC4 on an AS-1 1 Column with Conductivity Detection.

[0064] Figure 10 illustrates a 1 H-COSY spectrum of the peak isolated from LC1 . The spectrum indicates that DH2MB methyl protons (doublet) at 0.95 ppm are coupled to methine proton (quartet) at 3.7 ppm.

[0065] Figure 1 1 illustrates a 1 H-NMR spectrum of the peak isolated from LC1.The spectrum indicates the presence of DH2MB: a singlet of methyl protons (a) at 1 .2 ppm with integral value 3, a doublet of methyl protons (b) at 0.95 ppm with integral value 3 and a quartet of methine proton (c) at 3.7 ppm with integral value of 1 .84. Integral value of methine proton (c) is greater than 1 due to overlap with glucose resonance in the same region.

[0066] Figure 12 illustrates a LC-MS analysis of the peak isolated from LC1 . Several molecular ions were identified in the sample as indicated at the top portion of the figure. Further fragmentation (MS2) of 134 molecular ion indicated that isolated LC1 fraction contains hydroxyl carboxylic acid by characteristic loss of C02(*) and H20 + C02(**).

[0067] Figure 3 illustrates the diastereomeric and enantiomeric structures of 2,3- dihydroxy-2-methylbutanoic acid (2R,3S)-1 a, (2S,3R)-1 b, (2R,3R)-2a, (2S,3S)-2b.

[0068] Figure 14 illustrates the 1 H spectrum of crystallized DH2MB in D20. 1 H NMR (TSP) 1 .1 (d, 6.5 Hz, 3H), 1 .3 (s, 3H), 3.9 (q, 6.5 Hz, 3H)

[0069] Figure 15 illustrates the 13C spectrum of crystallized DH2MB in D20. The spectrum indicates five different carbon resonances one of them being characteristic carboxylic acid resonance at 181 ppm.

[0070] Figure 6 illustrates the fermentation profile of isobutanol and by-products from a single fermentation with GEVO3160. Production aeration was reduced from an OTR of 0.8 mlWh to 0.3 mM / h at 93 h post inoculation. Open diamond = iBuOH, square = unknown quantified as DH2MB, asterisk = cell dry weight (cdw), and closed triangle = total byproducts.

[0071] Figure 17 illustrates a structural alignment of the L lactis AdhA amino acid sequence with the structure of G. stearothermophilus (Pymol). Active site mutations are shown (Y50F and L264V). Mutations in the co-factor binding domain are also shown (1212T and N219Y).

[0072] Figure 18 illustrates biosynthetic pathways utilizing acetolactate as an intermediate. Biosynthetic pathways for the production of 1 -butanol, isobutanol, 3- methyl-1 -butanol, and 4-methyl-1 -pentanol use both acetolactate and an aldehyde as an intermediate.

[0073] Figure 19 illustrates biosynthetic pathways utilizing 2-aceto-2- hydroxybutyrate as an intermediate. Biosynthetic pathways for the production of 2- methyl-1 -butanol, 3-methyl-1-pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 -heptanol use both 2-aceto-2-hydroxybutyrate and an aldehyde as an intermediate.

[0074] Figure 20 illustrates additional biosynthetic pathways utilizing an aldehyde as an intermediate.DETAILED DESCRIPTION

[0075] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the microorganism" includes reference to one or more microorganisms, and so forth.

[0076] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein.

[0077] Any publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure.

[0078] The term "microorganism" includes prokaryotic and eukaryotic microbial species from the Domains Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista. The terms "microbial cells" and "microbes" are used interchangeably with the term microorganism.

[0079] The term "genus" is defined as a taxonomic group of related species according to the Taxonomic Outline of Bacteria and Archaea (Garrity, G.M., Lilburn, T.G., Cole, J.R., Harrison, S.H., Euzeby, J., and Tindall, B.J. (2007) The Taxonomic Outline of Bacteria and Archaea. TOBA Release 7.7, March 2007. Michigan State University Board of Trustees, [http: / / www.taxonomicoutline.org / ]).

[0080] The term "species" is defined as a collection of closely related organisms with greater than 97% 16S ribosomal RNA sequence homology and greater than 70% genomic hybridization and sufficiently different from all other organisms so as to be recognized as a distinct unit.

[0081] The terms "recombinant microorganism," "modified microorganism," and "recombinant host cell" are used interchangeably herein and refer to microorganismsthat have been genetically modified to express or overexpress endogenous polynucleotides, to express heterologous polynucleotides, such as those included in a vector, in an integration construct, or which have an alteration in expression of an endogenous gene. By "alteration" it is meant that the expression of the gene, or level of a RNA molecule or equivalent RNA molecules encoding one or more polypeptides or polypeptide subunits, or activity of one or more polypeptides or polypeptide subunits is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the alteration. For example, the term "alter" can mean "inhibit," but the use of the word "alter" is not limited to this definition.

[0082] The term "expression" with respect to a gene sequence refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein. Thus, as will be clear from the context, expression of a protein results from transcription and translation of the open reading frame sequence. The level of expression of a desired product in a host cell may be determined on the basis of either the amount of corresponding mRNA that is present in the cell, or the amount of the desired product encoded by the selected sequence. For example, mRNA transcribed from a selected sequence can be quantitated by qRT-PCR or by Northern hybridization (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989)). Protein encoded by a selected sequence can be quantitated by various methods, e.g., by ELISA, by assaying for the biological activity of the protein, or by employing assays that are independent of such activity, such as western blotting or radioimmunoassay, using antibodies that recognize and bind the protein. See Sambrook et al., 1989, supra. The polynucleotide generally encodes a target enzyme involved in a metabolic pathway for producing a desired metabolite. It is understood that the terms "recombinant microorganism" and "recombinant host cell" refer not only to the particular recombinant microorganism but to the progeny or potential progeny of such a microorganism. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

[0083] The term "overexpression" refers to an elevated level (e.g., aberrant level) of mRNAs encoding for a protein(s) (e.g., an TMA29 protein or homolog thereof),and / or to elevated levels of protein(s) (e.g., TMA29) in cells as compared to similar corresponding unmodified cells expressing basal levels of mRNAs (e.g., those encoding Aft proteins) or having basal levels of proteins. In particular embodiments, TMA29, or homologs thereof, may be overexpressed by at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 12-fold, 15-fold or more in microorganisms engineered to exhibit increased TMA29 mRNA, protein, and / or activity.

[0084] As used herein and as would be understood by one of ordinary skill in the art, "reduced activity and / or expression" of a protein such as an enzyme can mean either a reduced specific catalytic activity of the protein (e.g. reduced activity) and / or decreased concentrations of the protein in the cell (e.g. reduced expression), while "deleted activity and / or expression" or "eliminated activity and / or expression" of a protein such as an enzyme can mean either no or negligible specific catalytic activity of the enzyme (e.g. deleted activity) and / or no or negligible concentrations of the enzyme in the cell (e.g. deleted expression).

[0085] The term "wild-type microorganism" describes a cell that occurs in nature, i.e. a cell that has not been genetically modified. A wild-type microorganism can be genetically modified to express or overexpress a first target enzyme. This microorganism can act as a parental microorganism in the generation of a microorganism modified to express or overexpress a second target enzyme. In turn, the microorganism modified to express or overexpress a first and a second target enzyme can be modified to express or overexpress a third target enzyme.

[0086] Accordingly, a "parental microorganism" functions as a reference cell for successive genetic modification events. Each modification event can be accomplished by introducing a nucleic acid molecule in to the reference cell. The introduction facilitates the expression or overexpression of a target enzyme. It is understood that the term "facilitates" encompasses the activation of endogenous polynucleotides encoding a target enzyme through genetic modification of e.g., a promoter sequence in a parental microorganism. It is further understood that the term "facilitates" encompasses the introduction of heterologous polynucleotides encoding a target enzyme in to a parental microorganism

[0087] The term "engineer" refers to any manipulation of a microorganism that results in a detectable change in the microorganism, wherein the manipulation includes but is not limited to inserting a polynucleotide and / or polypeptideheterologous to the microorganism and mutating a polynucleotide and / or polypeptide native to the microorganism.

[0088] The term "mutation" as used herein indicates any modification of a nucleic acid and / or polypeptide which results in an altered nucleic acid or polypeptide. Mutations include, for example, point mutations, deletions, or insertions of single or multiple residues in a polynucleotide, which includes alterations arising within a protein-encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences. A genetic alteration may be a mutation of any type. For instance, the mutation may constitute a point mutation, a frame-shift mutation, a nonsense mutation, an insertion, or a deletion of part or all of a gene. In addition, in some embodiments of the modified microorganism, a portion of the microorganism genome has been replaced with a heterologous polynucleotide. In some embodiments, the mutations are naturally-occurring. In other embodiments, the mutations are identified and / or enriched through artificial selection pressure. In still other embodiments, the mutations in the microorganism genome are the result of genetic engineering.

[0089] The term "biosynthetic pathway", also referred to as "metabolic pathway", refers to a set of anabolic or catabolic biochemical reactions for converting one chemical species into another. Gene products belong to the same "metabolic pathway" if they, in parallel or in series, act on the same substrate, produce the same product, or act on or produce a metabolic intermediate {i.e., metabolite) between the same substrate and metabolite end product.

[0090] As used herein, the term "isobutanol producing metabolic pathway" refers to an enzyme pathway which produces isobutanol from pyruvate.

[0091] The term "heterologous" as used herein with reference to molecules and in particular enzymes and polynucleotides, indicates molecules that are expressed in an organism other than the organism from which they originated or are found in nature, independently of the level of expression that can be lower, equal or higher than the level of expression of the molecule in the native microorganism.

[0092] On the other hand, the term "native" or "endogenous" as used herein with reference to molecules, and in particular enzymes and polynucleotides, indicates molecules that are expressed in the organism in which they originated or are found in nature, independently of the level of expression that can be lower equal or higherthan the level of expression of the molecule in the native microorganism. It is understood that expression of native enzymes or polynucleotides may be modified in recombinant microorganisms.

[0093] The term "feedstock" is defined as a raw material or mixture of raw materials supplied to a microorganism or fermentation process from which other products can be made. For example, a carbon source, such as biomass or the carbon compounds derived from biomass are a feedstock for a microorganism that produces a biofuel in a fermentation process. However, a feedstock may contain nutrients other than a carbon source.

[0094] The term "substrate" or "suitable substrate" refers to any substance or compound that is converted or meant to be converted into another compound by the action of an enzyme. The term includes not only a single compound, but also combinations of compounds, such as solutions, mixtures and other materials which contain at least one substrate, or derivatives thereof. Further, the term "substrate" encompasses not only compounds that provide a carbon source suitable for use as a starting material, such as any biomass derived sugar, but also intermediate and end product metabolites used in a pathway associated with a recombinant microorganism as described herein.

[0095] The term "C2-compound" as used as a carbon source for engineered yeast microorganisms with mutations in all pyruvate decarboxylase (PDC) genes resulting in a reduction of pyruvate decarboxylase activity of said genes refers to organic compounds comprised of two carbon atoms, including but not limited to ethanol and acetate.

[0096] The term "fermentation" or "fermentation process" is defined as a process in which a microorganism is cultivated in a culture medium containing raw materials, such as feedstock and nutrients, wherein the microorganism converts raw materials, such as a feedstock, into products.

[0097] The term "volumetric productivity" or "production rate" is defined as the amount of product formed per volume of medium per unit of time. Volumetric productivity is reported in gram per liter per hour (g / L / h).

[0098] The term "specific productivity" or "specific production rate" is defined as the amount of product formed per volume of medium per unit of time per amount of cells. Specific productivity is reported in gram or milligram per liter per hour per OD (g / L / h / OD).

[0099] The term "yield" is defined as the amount of product obtained per unit weight of raw material and may be expressed as g product per g substrate (g / g). Yield may be expressed as a percentage of the theoretical yield. "Theoretical yield" is defined as the maximum amount of product that can be generated per a given amount of substrate as dictated by the stoichiometry of the metabolic pathway used to make the product. For example, the theoretical yield for one typical conversion of glucose to isobutanol is 0.41 g / g. As such, a yield of isobutanol from glucose of 0.39 g / g would be expressed as 95% of theoretical or 95% theoretical yield.

[0100] The term "titer" is defined as the strength of a solution or the concentration of a substance in solution. For example, the titer of a biofuel in a fermentation broth is described as g of biofuel in solution per liter of fermentation broth (g / L).

[0101] "Aerobic conditions" are defined as conditions under which the oxygen concentration in the fermentation medium is sufficiently high for an aerobic or facultative anaerobic microorganism to use as a terminal electron acceptor.

[0102] In contrast, "anaerobic conditions" are defined as conditions under which the oxygen concentration in the fermentation medium is too low for the microorganism to use as a terminal electron acceptor. Anaerobic conditions may be achieved by sparging a fermentation medium with an inert gas such as nitrogen until oxygen is no longer available to the microorganism as a terminal electron acceptor. Alternatively, anaerobic conditions may be achieved by the microorganism consuming the available oxygen of the fermentation until oxygen is unavailable to the microorganism as a terminal electron acceptor. Methods for the production of isobutanol under anaerobic conditions are described in commonly owned and copending publication, US 2010 / 0143997, the disclosures of which are herein incorporated by reference in its entirety for all purposes.

[0103] "Aerobic metabolism" refers to a biochemical process in which oxygen is used as a terminal electron acceptor to make energy, typically in the form of ATP, from carbohydrates. Aerobic metabolism occurs e.g. via glycolysis and the TCA cycle, wherein a single glucose molecule is metabolized completely into carbon dioxide in the presence of oxygen.

[0104] In contrast, "anaerobic metabolism" refers to a biochemical process in which oxygen is not the final acceptor of electrons contained in NADH. Anaerobic metabolism can be divided into anaerobic respiration, in which compounds other than oxygen serve as the terminal electron acceptor, and substrate levelphosphorylation, in which the electrons from NADH are utilized to generate a reduced product via a "fermentative pathway."

[0105] In "fermentative pathways", NAD(P)H donates its electrons to a molecule produced by the same metabolic pathway that produced the electrons carried in NAD(P)H. For example, in one of the fermentative pathways of certain yeast strains, NAD(P)H generated through glycolysis transfers its electrons to pyruvate, yielding ethanol. Fermentative pathways are usually active under anaerobic conditions but may also occur under aerobic conditions, under conditions where NADH is not fully oxidized via the respiratory chain. For example, above certain glucose concentrations, Crabtree positive yeasts produce large amounts of ethanol under aerobic conditions.

[0106] The term "byproduct" or "by-product" means an undesired product related to the production of an amino acid, amino acid precursor, chemical, chemical precursor, biofuel, or biofuel precursor.

[0107] The term "substantially free" when used in reference to the presence or absence of enzymatic activities (3-KAR, ALDH, PDC, GPD, etc.) in carbon pathways that compete with the desired metabolic pathway (e.g., an isobutanol-producing metabolic pathway) means the level of the enzyme is substantially less than that of the same enzyme in the wild-type host, wherein less than about 50% of the wild-type level is preferred and less than about 30% is more preferred. The activity may be less than about 20%, less than about 10%, less than about 5%, or less than about 1 % of wild-type activity. Microorganisms which are "substantially free" of a particular enzymatic activity (3-KAR, ALDH, PDC, GPD, etc.) may be created through recombinant means or identified in nature.

[0108] The term "non-fermenting yeast" is a yeast species that fails to demonstrate an anaerobic metabolism in which the electrons from NADH are utilized to generate a reduced product via a fermentative pathway such as the production of ethanol and CO2from glucose. Non-fermentative yeast can be identified by the "Durham Tube Test" (J.A. Barnett, R.W. Payne, and D. Yarrow. 2000. Yeasts Characteristics and Identification. 3rdedition, p. 28-29. Cambridge University Press, Cambridge, UK) or by monitoring the production of fermentation productions such as ethanol and CO2.

[0109] The term "polynucleotide" is used herein interchangeably with the term "nucleic acid" and refers to an organic polymer composed of two or more monomersincluding nucleotides, nucleosides or analogs thereof, including but not limited to single stranded or double stranded, sense or antisense deoxyribonucleic acid (DNA) of any length and, where appropriate, single stranded or double stranded, sense or antisense ribonucleic acid (RNA) of any length, including siRNA. The term "nucleotide" refers to any of several compounds that consist of a ribose or deoxyribose sugar joined to a purine or a pyrimidine base and to a phosphate group, and that are the basic structural units of nucleic acids. The term "nucleoside" refers to a compound (as guanosine or adenosine) that consists of a purine or pyrimidine base combined with deoxyribose or ribose and is found especially in nucleic acids. The term "nucleotide analog" or "nucleoside analog" refers, respectively, to a nucleotide or nucleoside in which one or more individual atoms have been replaced with a different atom or with a different functional group. Accordingly, the term polynucleotide includes nucleic acids of any length, DNA, RNA, analogs and fragments thereof. A polynucleotide of three or more nucleotides is also called nucleotidic oligomer or oligonucleotide.

[0110] It is understood that the polynucleotides described herein include "genes" and that the nucleic acid molecules described herein include "vectors" or "plasmids." Accordingly, the term "gene", also called a "structural gene" refers to a polynucleotide that codes for a particular sequence of amino acids, which comprise all or part of one or more proteins or enzymes, and may include regulatory (non- transcribed) DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. The transcribed region of the gene may include untranslated regions, including introns, 5'-untranslated region (UTR), and 3'-UTR, as well as the coding sequence.

[0111] The term "operon" refers to two or more genes which are transcribed as a single transcriptional unit from a common promoter. In some embodiments, the genes comprising the operon are contiguous genes. It is understood that transcription of an entire operon can be modified (i.e., increased, decreased, or eliminated) by modifying the common promoter. Alternatively, any gene or combination of genes in an operon can be modified to alter the function or activity of the encoded polypeptide. The modification can result in an increase in the activity of the encoded polypeptide. Further, the modification can impart new activities on the encoded polypeptide. Exemplary new activities include the use of alternative substrates and / or the ability to function in alternative environmental conditions.

[0112] A "vector" is any means by which a nucleic acid can be propagated and / or transferred between organisms, cells, or cellular components. Vectors include viruses, bacteriophage, pro-viruses, plasmids, phagemids, transposons, and artificial chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), and PLACs (plant artificial chromosomes), and the like, that are "episomes," that is, that replicate autonomously or can integrate into a chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine -conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that are not episomal in nature, or it can be an organism which comprises one or more of the above polynucleotide constructs such as an agrobacterium or a bacterium.

[0113] "Transformation" refers to the process by which a vector is introduced into a host cell. Transformation (or transduction, or transfection), can be achieved by any one of a number of means including chemical transformation (e.g. lithium acetate transformation), electroporation, microinjection, biolistics (or particle bombardment- mediated delivery), or agrobacterium mediated transformation.

[0114] The term "enzyme" as used herein refers to any substance that catalyzes or promotes one or more chemical or biochemical reactions, which usually includes enzymes totally or partially composed of a polypeptide, but can include enzymes composed of a different molecule including polynucleotides.

[0115] The term "protein," "peptide," or "polypeptide" as used herein indicates an organic polymer composed of two or more amino acidic monomers and / or analogs thereof. As used herein, the term "amino acid" or "amino acidic monomer" refers to any natural and / or synthetic amino acids including glycine and both D or L optical isomers. The term "amino acid analog" refers to an amino acid in which one or more individual atoms have been replaced, either with a different atom, or with a different functional group. Accordingly, the term polypeptide includes amino acidic polymer of any length including full length proteins, and peptides as well as analogs and fragments thereof. A polypeptide of three or more amino acids is also called a protein oligomer or oligopeptide

[0116] The term "homolog," used with respect to an original enzyme or gene of a first family or species, refers to distinct enzymes or genes of a second family or species which are determined by functional, structural or genomic analyses to be anenzyme or gene of the second family or species which corresponds to the original enzyme or gene of the first family or species. Most often, homologs will have functional, structural or genomic similarities. Techniques are known by which homologs of an enzyme or gene can readily be cloned using genetic probes and PCR. Identity of cloned sequences as homolog can be confirmed using functional assays and / or by genomic mapping of the genes.

[0117] A protein has "homology" or is "homologous" to a second protein if the amino acid sequence encoded by a gene has a similar amino acid sequence to that of the second gene. Alternatively, a protein has homology to a second protein if the two proteins have "similar" amino acid sequences. (Thus, the term "homologous proteins" is defined to mean that the two proteins have similar amino acid sequences).

[0118] The term "analog" or "analogous" refers to nucleic acid or protein sequences or protein structures that are related to one another in function only and are not from common descent or do not share a common ancestral sequence. Analogs may differ in sequence but may share a similar structure, due to convergent evolution. For example, two enzymes are analogs or analogous if the enzymes catalyze the same reaction of conversion of a substrate to a product, are unrelated in sequence, and irrespective of whether the two enzymes are related in structure.Recombinant Microorganisms with Reduced Bv-Product Accumulation

[0119] Yeast cells convert sugars to produce pyruvate, which is then utilized in a number of pathways of cellular metabolism. In recent years, yeast cells have been engineered to produce a number of desirable products via pyruvate-d riven biosynthetic pathways. In many of these biosynthetic pathways, the initial pathway step is the conversion of endogenous pyruvate to a 3-keto acid.

[0120] As used herein, a "3-keto acid" refers to an organic compound which contains a carboxylic acid moiety on the C1 carbon and a ketone moiety on the C3 carbon. For example, acetolactate and 2-hydroxy-2-methyl-3-oxobutanoic acid are 3- keto acids with a ketone group at the C3 carbon (See, e.g., Figure 2).

[0121] An example of a 3-keto acid which is common to many biosynthetic pathways is acetolactate, which is formed from pyruvate by the action of the enzyme acetolactate synthase (also known as acetohydroxy acid synthase). Amongst the biosynthetic pathways using acetolactate as intermediate include pathways for theproduction of isobutanol, 2-butanol, 1 -butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl-1 -butanol, 4-methyl- 1 -pentanol, and coenzyme A. Engineered biosynthetic pathways for the synthesis of these beneficial acetolactate-derived metabolites are found in Table 1 and Figure 18.Table 1. Biosynthetic Pathways Utilizing Acetolactate as an Intermediatea - The contents of each of the references in this table are herein incorporated by reference in their entireties for all purposes.

[0122] Each of the biosynthetic pathways listed in Table 1 shares the common 3- keto acid intermediate, acetolactate. Therefore, the product yield from these biosynthetic pathways will in part depend upon the amount of acetolactate that is available to downstream enzymes of said biosynthetic pathways.

[0123] Another example of a 3-keto acid which is common to many biosynthetic pathways is 2-aceto-2-hydroxybutyrate, which is formed from pyruvate and 2- ketobutyrate by the action of the enzyme acetolactate synthase (also known as acetohydroxy acid synthase). Amongst the biosynthetic pathways using 2-aceto-2- hydroxybutyrate as intermediate include pathways for the production of 2-methyl-1 - butanol, isoleucine, 3-methyl-1 -pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 -heptanol. Engineered biosynthetic pathways for the synthesis of these beneficial 2- aceto-2-hydroxybutyrate-derived metabolites are found in Table 2 and Figure 19.Table 2. Biosynthetic Pathways Utilizing 2-Aceto-2-Hydroxybutyrate as an Intermediate3- The contents of each of the references in this table are herein incorporated by reference in their entireties for all purposes.

[0124] Each of the biosynthetic pathways listed in Table 2 shares the common 3- keto acid intermediate, 2-aceto-2-hydroxybutyrate. Therefore, the product yield from these biosynthetic pathways will in part depend upon the amount of acetolactate that is available to downstream enzymes of said biosynthetic pathways.

[0125] Likewise, yeast cells can be engineered to produce a number of desirable products via biosynthetic pathways that utilize an aldehyde as a pathway intermediate. Engineered biosynthetic pathways comprising an aldehyde intermediate include biosynthetic pathways for the production of isobutanol, 1 - butanol, 2-methyl-1 -butanol, 3-methyl-1 -butanol, 1-propanol, 1 -pentanol, 1 -hexanol, 3-methyl-l -pentanol, 4-methyl-l -pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 - heptanol (See Table 3 and Figures 18, 19, and 20).Table 3. Biosynthetic Pathways Utilizing an Aldehyde as an IntermediateButanol Butanal 451 : 86-89, and Connor et ai , 2008, Appl. Environ.Microbiol. 74: 5769-57751 -Propanol 1 -Propanal WO / 2008 / 098227 (Liao ei ai)1 -Pentanol 1 -Pentanal WO / 2010 / 045629 (Liao et a / .), Zhang ei a / ., 2008, Proc NatlAcad Sci USA 105:20653-206581 -Hexanol 1 -Hexanal WO / 2010 / 045629 (Liao et ai), Zhang et a / ., 2008, Proc NatlAcad Sci USA 105:20653-206583-Methyl-1 - 3-Methyl-1 - WO / 2010 / 045629 (Liao et a / .), Zhang et ai, 2008, Proc Natl Pentanol Pentanal Acad Sci USA 105:20653-206584-Methyl-1 - 4-Methyl-1 - WO / 2010 / 045629 (Liao ei a / .), Zhang et ai, 2008, Proc Natl Pentanol Pentanal Acad Sci USA 105:20653-206584-Methyl-1 - 4-Methyl-1 - WO / 2010 / 045629 (Liao et a / .), Zhang et ai, 2008, Proc Natl Hexanol Hexanal Acad Sci USA 105:20653-206585-Methyl-1 - 5-Methyl-1 - WO / 2010 / 045629 (Liao ei a / .), Zhang et ai, 2008, Proc Natl Heptanol Heptanal Acad Sci USA 05:20653-20658a - The contents of each of the references in this table are herein incorporated by reference entireties for all purposes.

[0126] Each of the biosynthetic pathways listed in Table 3 have an aldehyde intermediate. For example, the aldehyde intermediate in the isobutanol producing metabolic pathway is isobutyraldehyde (See Figure 1 ), while pathways for the production of 1 -butanol, 2-methyl-1 -butanol, 3-methyl-1 -butanol, 1 -propanol, 1 - pentanol, 1 -hexanol, 3-methyl-1 -pentanol, 4-methyl-l -pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 -heptanol utilize 1 -butanal, 2-methyl-1 -butanal, 3-methyl-1 -butanal, 1 - propanal, 1 -pentanal, 1 -hexanal, 3-methyl-l -pentanal, 4-methyl-1-pentanal, 4- methyl-1 -hexanal, and 5-methyl-1 -heptanol as aldehyde intermediates, respectively. Therefore, the product yield in biosynthetic pathways that utilize these aldehyde intermediates will in part depend upon the amount of the aldehyde intermediate that is available to downstream enzymes of said biosynthetic pathways.

[0127] As described herein, the present inventors have discovered the enzymatic activities responsible for the accumulation of unwanted by-products derived from 3- keto acid and / or aldehyde intermediates. Specifically, they have determined that a 3- ketoacid reductase and an aldehyde dehydrogenase are responsible for the conversion of 3-keto acids and aldehydes, respectively, to unwanted by-products. The activities of these enzymes are shown to hinder the optimal productivity and yield of 3-keto acid- and / or aldehyde-derived products, including, but not limited to, those listed in Tables 1 -3. The present inventors have found that suppressing these newly-characterized enzymatic activities considerably reduces or eliminates the formation of unwanted by-products, and concomitantly improves the yields and titers of beneficial metabolites.Reduced Accumulation of 3-Hydroxyacicls from 3-Keto Acids

[0128] As described herein, the present inventors have discovered that unwanted by-products, 3-hydroxyacids, can accumulate during fermentation reactions with microorganisms comprising a pathway involving a 3-keto acid intermediate.

[0129] As used herein, a "3-hydroxyacid" is an organic compound which contains a carboxylic acid moiety on the C1 carbon and an alcohol moiety on the C3 carbon. 3-hydroxyacids can be obtained from 3-keto acids by chemical reduction of the 3- keto acid ketone moiety to an alcohol moiety. For example, reduction of the ketone moiety in acetolactate or 2-hydroxy-2-methyl-3-oxobutanoic acid results in the formation of 3-hydroxyacid 2,3-dihydroxy-2-methylbutanoic acid (DH2MB) (See, e.g., Figure 2).

[0130] The present inventors have discovered that the 3-hydroxyacid by-product, 2,3-dihydroxy-2-methylbutanoic acid (CAS # 14868-24-7) (DH2MB), accumulates during fermentation reactions with microorganisms comprising biosynthetic pathways involving the 3-keto acid intermediate, acetolactate. The accumulation of this byproduct was found to hinder optimal productivity and yield of the biosynthetic pathway's target metabolite. The present inventors found that the production of DH2MB is caused by the reduction of acetolactate. To reduce or eliminate the activity responsible for the production of DH2MB, the corresponding enzymatic activity catalyzing this reaction had to be identified and reduced or eliminated. The inventors have found in S. cerevisiae that one such enzyme catalyzing the conversion of acetolactate to DH2MB is YMR226C (also known as TMA29). This the first report of a protein in yeast that converts acetolactate to DH2MB.

[0131] The present inventors have also discovered that the 3-hydroxyacid byproduct, 2-ethyl-2,3-dihydroxybutanoate, accumulates during fermentation reactions with microorganisms comprising biosynthetic pathways involving the 3-keto acid intermediate, 2-aceto-2-hydroxybutyrate. The accumulation of this by-product was found to hinder optimal productivity and yield of the biosynthetic pathway's target metabolite. The present inventors found that the production of 2-ethyl-2,3- dihydroxybutanoate is caused by the reduction of 2-aceto-2-hydroxybutyrate. To reduce or eliminate the activity responsible for the production of 2-ethyl-2,3- dihydroxybutanoate, the corresponding enzymatic activity catalyzing this reaction had to be identified and reduced or eliminated. The inventors have found in S.cerevisiae, the enzyme YMR226C (also known as TMA29) which catalyzes the conversion of acetolactate to DH2MB also catalyzes the conversion of 2-aceto-2- hydroxybutyrate to 2-ethyl-2,3-dihydroxybutanoate. This the first report of a protein in yeast that converts 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutanoate.

[0132] The present inventors describe herein multiple strategies for reducing the conversion of the 3-keto acid intermediate to the corresponding 3-hydroxyacid byproduct, a process which is accompanied by an increase in the yield of desirable metabolites. In one embodiment, the 3-keto acid intermediate is acetolactate and the corresponding 3-hydroxyacid is DH2MB. As described herein, reducing the conversion of acetolactate to DH2MB enables the increased production of beneficial metabolites such as isobutanol, 2-butanol, 1 -butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl-1 -butanol, 4-methyl-1 -pentanol, and coenzyme A which are derived from biosynthetic pathways which use acetolactate as an intermediate. In another embodiment, the 3-keto acid intermediate is 2-aceto-2-hydroxybutyrate and the corresponding 3-hydroxyacid is 2- ethyl-2,3-dihydroxybutanoate. As described herein, reducing the conversion of 2- aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutanoate enables the increased production of beneficial metabolites such as 2-methyl-1 -butanol, isoleucine, 3- methyl-1 -pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 -heptanol.

[0133] Accordingly, one aspect of the invention is directed to a recombinant microorganism comprising a biosynthetic pathway which uses a 3-keto acid as an intermediate, wherein said recombinant microorganism is substantially free of an enzyme that catalyzes the conversion of the 3-keto acid intermediate to a 3- hydroxyacid by-product. In one embodiment, the 3-keto acid intermediate is acetolactate and the 3-hydroxyacid by-product is DH2MB. In another embodiment, the 3-keto acid intermediate is 2-aceto-2-hydroxybutyrate and the 3-hydroxyacid byproduct is 2-ethyl-2,3-dihydroxybutanoate.

[0134] In another aspect, the invention is directed to a recombinant microorganism comprising a biosynthetic pathway which uses a 3-keto acid as an intermediate, wherein said recombinant microorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of the 3- keto acid intermediate to a 3-hydroxyacid by-product. In one embodiment, the 3- keto acid intermediate is acetolactate and the 3-hydroxyacid by-product is DH2MB.In another embodiment, the 3-keto acid intermediate is 2-aceto-2-hydroxybutyrate and the 3-hydroxyacid by-product is 2-ethyl-2,3-dihydroxybutanoate.

[0135] In various embodiments described herein, the protein involved in catalyzing the conversion of the 3-keto acid intermediate to the 3-hydroxyacid byproduct is a ketoreductase. In an exemplary embodiment, the ketoreductase is a 3- ketoacid reductase (3-KAR). As used herein, the term "3-ketoacid reductase" refers to a ketoreductase (i.e. ketone reductase) active towards the 3-oxo group of a 3-keto acid. An illustration of exemplary reactions capable of being catalyzed by 3-ketoacid reductases is shown in Figure 2. Suitable 3-ketoacid reductases are generally found in the enzyme classification subgroup 1 .1 . .X, the final digit X being dependent upon the substrate. A non-limiting list of exemplary 3-ketoacid reductases and their corresponding enzyme classification number is shown in Figure 3.

[0136] In an exemplary embodiment, the 3-ketoacid reductase is the S. cerevisiae YMR226C (SEQ ID NO: 1 ) protein, used interchangeably herein with "TMA29". In some embodiments, the 3-ketoacid reductase is the S. cerevisiae YMR226C (SEQ ID NO: 1 ) protein or a homolog or variant thereof. In one embodiment, the homolog may be selected from the group consisting of Vanderwaltomzyma polyspora (SEQ ID NO: 2), Saccharomyces castellii (SEQ ID NO: 3), Candida glabrata (SEQ ID NO: 4), Saccharomyces bayanus (SEQ ID NO: 5), Zygosaccharomyces rouxii (SEQ ID NO: 6), K. lactis (SEQ ID NO: 7), Ashbya gossypii (SEQ ID NO: 8), Saccharomyces kluyveri (SEQ ID NO: 9), Kluyveromyces thermotolerans (SEQ ID NO: 10), Kluyveromyces waltii (SEQ ID NO: 11 ), Pichia stipitis (SEQ ID NO: 12), Debaromyces hansenii (SEQ ID NO: 13), Pichia pastoris (SEQ ID NO: 4), Candida dubliniensis (SEQ ID NO: 15), Candida albicans (SEQ ID NO: 16), Yarrowia lipolytica (SEQ ID NO: 17), Issatchenkia orientalis (SEQ ID NO: 18), Aspergillus nidulans (SEQ ID NO: 19), Aspergillus niger (SEQ ID NO: 20), Neurospora crassa (SEQ ID NO: 21 ), Schizosaccharomyces pombe (SEQ ID NO: 22), and Kluyveromyces marxianus (SEQ ID NO: 23).

[0137] In one embodiment, the recombinant microorganism of the invention includes a mutation in at least one gene encoding for a 3-ketoacid reductase resulting in a reduction of 3-ketoacid reductase activity of a polypeptide encoded by said gene. In another embodiment, the recombinant microorganism includes a partial deletion of a gene encoding for a 3-ketoacid reductase gene resulting in a reduction of 3-ketoacid reductase activity of a polypeptide encoded by the gene. Inanother embodiment, the recombinant microorganism comprises a complete deletion of a gene encoding for a 3-ketoacid reductase resulting in a reduction of 3-ketoacid reductase activity of a polypeptide encoded by the gene. In yet another embodiment, the recombinant microorganism includes a modification of the regulatory region associated with the gene encoding for a 3-ketoacid reductase resulting in a reduction of expression of a polypeptide encoded by said gene. In yet another embodiment, the recombinant microorganism comprises a modification of the transcriptional regulator resulting in a reduction of transcription of gene encoding for a 3-ketoacid reductase. In yet another embodiment, the recombinant microorganism comprises mutations in all genes encoding for a 3-ketoacid reductase resulting in a reduction of activity of a polypeptide encoded by the gene(s). In one embodiment, said 3-ketoacid reductase gene is the S. cerevisiae TMA29 (YMR226C) gene or a homolog thereof. As would be understood in the art, naturally occurring homologs of TMA29 in yeast other than S. cerevisiae can similarly be inactivated using the methods of the present invention. TMA29 homologs and methods of identifying such TMA29 homologs are described herein.

[0138] As is understood by those skilled in the art, there are several additional mechanisms available for reducing or disrupting the activity of a protein such as 3- ketoacid reductase, including, but not limited to, the use of a regulated promoter, use of a weak constitutive promoter, disruption of one of the two copies of the gene in a diploid yeast, disruption of both copies of the gene in a diploid yeast, expression of an anti-sense nucleic acid, expression of an siRNA, over expression of a negative regulator of the endogenous promoter, alteration of the activity of an endogenous or heterologous gene, use of a heterologous gene with lower specific activity, the like or combinations thereof.

[0139] As described herein, the recombinant microorganisms of the present invention are engineered to produce less of the 3-hydroxyacid by-product than an unmodified parental microorganism. In one embodiment, the recombinant microorganism produces the 3-hydroxyacid by-product from a carbon source at a carbon yield of less than about 20 percent. In another embodiment, the microorganism is produces the 3-hydroxyacid by-product from a carbon source at a carbon yield of less than about 10, less than about 5, less than about 2, less than about 1 , less than about 0.5, less than about 0.1 , or less than about 0.01 percent. In one embodiment, the 3-hydroxyacid by-product is DH2MB, derived from the 3-ketoacid, acetolactate. in another embodiment, the 3-hydroxyacid by-product is 2-ethyl- 2,3-dihydroxybutanoate, derived from the 3-keto acid, 2-aceto-2-hydroxybutyrate.

[0140] In one embodiment, the 3-hydroxyacid by-product carbon yield derived from the 3-ketoacid is reduced by at least about 50% in a recombinant microorganism as compared to a parental microorganism that does not comprise a reduction or deletion of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of the 3-ketoacid intermediate to the 3- hydroxyacid by-product. In another embodiment, the 3-hydroxyacid by-product derived from the 3-ketoacid is reduced by at least about 60%, by at least about 65%, by at least about 70%, by at least about 75%, by at least about 80%, by at least about 85%, by at least about 90%, by at least about 95%, by at least about 99%, by at least about 99.9%, or by at least about 100% as compared to a parental microorganism that does not comprise a reduction or deletion of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of the 3-ketoacid to the 3-hydroxyacid by-product. In one embodiment, the 3-hydroxyacid by-product is DH2MB, derived from the 3-keto acid, acetolactate. In another embodiment, the 3-hydroxyacid by-product is 2-ethyl-2,3- dihydroxybutanoate, derived from the 3-keto acid, 2-aceto-2-hydroxybutyrate.

[0141] In an additional embodiment, the yield of a desirable fermentation product is increased in the recombinant microorganisms comprising a reduction or elimination of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of the 3-ketoacid intermediate to the 3-hydroxyacid byproduct. In one embodiment, the yield of a desirable fermentation product is increased by at least about 1 % as compared to a parental microorganism that does not comprise a reduction or elimination of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of the 3-ketoacid intermediate to the 3-hydroxyacid by-product. In another embodiment, the yield of a desirable fermentation product is increased by at least about 5%, by at least about 10%, by at least about 25%, or by at least about 50% as compared to a parental microorganism that does not comprise a reduction or elimination of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of the 3-ketoacid intermediate to the 3-hydroxyacid by-product. In one embodiment, the 3-hydroxyacid by-product is DH2MB, derived from the 3-keto acid, acetolactate. Accordingly, in one embodiment, the desirable fermentation product isderived from any biosynthetic pathway in which acetolactate acts as an intermediate, including, but not limited to, isobutanol, 2-butanol, 1 -butanol, 2-butanone, 2,3- butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl- 1 -butanol, 4-methyl-1 -pentanol, and coenzyme A. In another embodiment, the 3- hydroxyacid by-product is 2-ethyl-2,3-dihydroxybutanoate, derived from the 3-keto acid, 2-aceto-2-hydroxybutyrate. Accordingly, in another embodiment, the desirable fermentation product is derived from any biosynthetic pathway in which 2-aceto-2- hydroxybutyrate acts as an intermediate, including, but not limited to, 2-methyl-1- butanol, isoleucine, 3-methyl-1 -pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 - heptanol.

[0142] In further embodiments, additional enzymes potentially catalyzing the conversion of a 3-ketoacid intermediate to a 3-hydroxyacid by-product are deleted from the genome of a recombinant microorganism comprising a biosynthetic pathway which uses a 3-ketoacid as an intermediate. Endogenous yeast genes with the potential to convert of a 3-ketoacid intermediate to a 3-hydroxyacid by-product include ketoreductases, short chain alcohol dehydrogenases, medium chain alcohol dehydrogenases, members of the aldose reductase family, members of the D- hydroxyacid dehydrogenase family, alcohol dehydrogenases, and lactate dehydrogenases. In one embodiment, the 3-hydroxyacid by-product is DH2MB, derived from the 3-keto acid, acetolactate. In another embodiment, the 3- hydroxyacid by-product is 2-ethyl-2,3-dihydroxybutanoate, derived from the 3-keto acid, 2-aceto-2-hydroxybutyrate.

[0143] Methods for identifying additional enzymes catalyzing the conversion of a 3-ketoacid intermediate to a 3-hydroxyacid by-product are outlined as follows: endogenous yeast genes coding for ketoreductases, short chain alcohol dehydrogenases, medium chain alcohol dehydrogenases, members of the aldose reductase family, members of the D-hydroxyacid dehydrogenase family, alcohol dehydrogenases, and lactate dehydrogenases are deleted from the genome of a yeast strain comprising a biosynthetic pathway in which a 3-ketoacid (e.g., acetolactate or 2-aceto-2-hydroxybutyrate) is an intermediate. These deletion strains are compared to the parent strain by fermentation and analysis of the fermentation broth for the presence and concentration of the corresponding 3-hydroxyacid byproduct (e.g., DH2MB or 2-ethyl-2,3-dihydroxybutanoate, derived from acetolactate and 2-aceto-2-hydroxybutyrate, respectively). In S. cerevisiae, deletions that reducethe production of the 3-hydroxyacid by-product are combined by construction of strains carrying multiple deletions. Candidate genes can include, but are not limited to, YAL060W, YJR159W, YGL157W, YBL1 14W, YOR120W, YKL055C, YBR159W, YBR149W, YDL168W, YDR368W, YLR426W, YCR107W, YILL24W, YML054C, YOL151W, YMR318C, YBR046C, YHR104W, YIR036C, YDL174C, YDR541 C, YBR145W, YGL039W, YCR105W, YDL124W, YIR035C, YFL056C, YNL274c, YLR255C, YGL185C, YGL256W, YJR096W, YJR155W, YPL275W, YOR388C, YLR070C, YMR083W, YER081W, YJR139C, YDL243C, YPL1 13C, YOL165C, YML086C, YMR303C, YDL246C, YLR070C, YHR063C, YNL331 C, YFL057C, YIL155C, YOL086C, YAL061W, YDR127W, YPR127W, YCL018W, YIL074C, YIL124W, and YEL071 W. Many of these deletion strains are available commercially (for example Open Biosystems YSC1054). These deletion strains are transformed with a plasmid pGV2435 from which the ALS gene (e.g., the B. subtilis alsS) is expressed under the control of the CUP1 promoter. The transformants are cultivated in YPD medium containing 150 g / L glucose in shake flasks at 30°C, 75 rpm in a shaking incubator for 48 hours. After 48 h samples from the shake flasks are analyzed by HPLC for the concentration of the 3-hydroxyacid by-product {e.g., DH2MB and 2-ethyl-2,3-dihydroxybutanoate, derived from acetolactate and 2-aceto- 2-hydroxybutyrate, respectively). As would be understood in the art, naturally occurring homologs of 3-ketoacid reductase genes (e.g., TMA29) in yeast other than S. cerevisiae can similarly be inactivated. 3-ketoacid reductase gene (e.g., TMA29) homologs and methods of identifying such 3-ketoacid reductase gene homologs are described herein.

[0144] Another way to screen the deletion library is to incubate yeast cells with the 3-ketoacid intermediate (e.g., acetolactate or 2-aceto-2-hydroxybutyrate) and analyze the broth for the production of the corresponding 3-hydroxyacid by-product (e.g., DH2MB or 2-ethyl-2,3-dihydroxybutanoate, derived from acetolactate and 2- aceto-2-hydroxybutyrate, respectively).

[0145] Some of the listed genes are the result of tandem duplication or whole genome duplication events and are expected to have similar substrate specificities. Examples are YAL061W (BDH1 ), and YAL060W (BDH2), YDR368W (YPR1 ) and YOR120W (GCY1 ). Deletion of just one of the duplicated genes is likely not to result in a phenotype. These gene pairs have to be analyzed in strains carrying deletions in both genes.

[0146] An alternative approach to find additional endogenous activity responsible for the production of the 3-hydroxyacid by-product (e.g., DH2MB or 2-ethyl-2,3- dihydroxybutanoate, derived from acetolactate and 2-aceto-2-hydroxybutyrate, respectively) is to analyze yeast strains that overexpress the genes suspected of encoding the enzyme responsible for production of the 3-hydroxyacid by-product. Such strains are commercially available for many of the candidate genes listed above (for example Open Biosystems YSC3870). The ORF overexpressing strains are processed in the same way as the deletion strains. They are transformed with a plasmid for ALS expression and screened for 3-hydroxyacid by-product {e.g., DH2MB or 2-ethyl-2,3-dihydroxybutanoate) production levels. To narrow the list of possible genes causing the production of the 3-hydroxyacid by-product (e.g. , DH2MB or 2-ethyl-2,3-dihydroxybutanoate), their expression can be analyzed in fermentation samples. Genes that are not expressed during a fermentation that produced the 3-hydroxyacid by-product (e.g., DH2MB or 2-ethyl-2,3- dihydroxybutanoate) can be excluded from the list of possible targets. This analysis can be done by extraction of RNA from fermenter samples and submitting these samples to whole genome expression analysis, for example, by Roche NimbleGen.

[0147] As described herein, strains that naturally produce low levels of one or more 3-hydroxyacid by-products can also have applicability for producing increased levels of desirable fermentation products that are derived from biosynthetic pathways comprising a 3-ketoacid intermediate. As would be understood by one skilled in the art equipped with the instant disclosure, strains that naturally produce low levels of one or more 3-hydroxyacid by-products may inherently exhibit low or undetectable levels of endogenous enzyme activity, resulting in the reduced conversion of 3- ketoacids to 3-hydroxyacids, a trait favorable for the production of a desirable fermentation product such as isobutanol. Described herein are several approaches for identifying a native host microorganism which is substantially free of 3-ketoacid reductase activity. For example, one approach to finding a host microorganism which exhibits inherently low or undetectable endogenous enzyme activity responsible for the production of the 3-hydroxyacid by-product (e.g., DH2MB or 2-ethyl-2,3- dihydroxybutanoate) is to analyze yeast strains by incubating the yeast cells with a 3-keto acid (e.g., acetolactate or 2-aceto-2-hydroxybutyrate) and analyze the broth for the production of the corresponding 3-hydroxyacid by-product (e.g., DH2MB or 2-ethyl-2,3-dihydroxybutanoate, derived from acetolactate and 2-aceto-2- hydroxybutyrate, respectively).

[0148] The recombinant microorganisms described herein which produce a beneficial metabolite derived from a biosynthetic pathway which uses a 3-keto acid as an intermediate may be further engineered to reduce or eliminate enzymatic activity for the conversion of pyruvate to products other than the 3-keto acid (e.g., acetolactate and / or 2-aceto-2-hydroxybutyrate). In one embodiment, the enzymatic activity of pyruvate decarboxylase (PDC), lactate dehydrogenase (LDH), pyruvate oxidase, pyruvate dehydrogenase, and / or glycerol-3-phosphate dehydrogenase (GPD) is reduced or eliminated.

[0149] In a specific embodiment, the beneficial metabolite is produced in a recombinant PDC-minus GPD-minus yeast microorganism that overexpresses an acetolactate synthase (ALS) gene. In another specific embodiment, the ALS is encoded by the B. subtilis a / sS.Reduced Accumulation of Acid By-Prod ucts from Aldehyde Intermediates

[0150] As described further in the Examples, the present inventors have also discovered that unwanted acid by-products (e.g., isobutyrate in the case of isobutanol), can accumulate during fermentation reactions with microorganisms comprising a pathway involving an aldehyde intermediate (e.g., isobutyraldehyde in the case of isobutanol).

[0151] As used herein, an "acid by-product" refers to an organic compound which contains a carboxylic acid moiety. An acid by-product can be obtained by the oxidation of an aldehyde. For example, the oxidation of isobutyraldehyde results in the formation of isobutyric acid (See, e.g., Figure 4).

[0152] The present inventors have found that accumulation of these acid byproducts hinders the optimal productivity and yield of the biosynthetic pathway which utilize aldehyde intermediates. The present inventors found that the production of these acid by-products is caused by dehydrogenation of the corresponding aldehyde. To reduce or eliminate the activity responsible for the production of the acid by-product, the corresponding enzymatic activity catalyzing this reaction had to be identified and reduced or eliminated. The inventors have found in S. cerevisiae that one such enzyme catalyzing the conversion of aldehydes to acid by-products is aldehyde dehydrogenase.

[0153] The present inventors describe herein multiple strategies for reducing acid by-product formation, a process which is accompanied by an increase in the yield of desirable metabolites such as isobutanol, 1 -butanol, 2-methyl-1 -butanol, 3-methyl-1 - butanol, 1 -propanol, 1 -pentanol, 1 -hexanol, 3-methyl-1 -pentanol, 4-methyl-1 - pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 -heptanol.

[0154] Accordingly, one aspect of the invention is directed to a recombinant microorganism comprising a biosynthetic pathway which uses an aldehyde as an intermediate, wherein said recombinant microorganism is substantially free of an enzyme that catalyzes the conversion of an aldehyde to an acid by-product.

[0155] In another aspect, the invention is directed to a recombinant microorganism comprising a biosynthetic pathway which uses an aldehyde as an intermediate, wherein said recombinant microorganism is engineered to reduce or eliminate the expression or activity of one or more enzymes catalyzing the conversion of the aldehyde to an acid by-product.

[0156] In one embodiment, the aldehyde intermediate is isobutyraldehyde and the acid by-product is isobutyrate. In another embodiment, the aldehyde intermediate is 1 -butanal and the acid by-product is butyrate. In yet another embodiment, the aldehyde intermediate is 2-methyl-1 -butanal and the acid by-product is 2-methyl-1 - butyrate. In yet another embodiment, the aldehyde intermediate is 3-methyl-1 - butanal and the acid by-product is 3-methyl-1 -butyrate. In yet another embodiment, the aldehyde intermediate is 1 -propanal and the acid by-product is propionate. In yet another embodiment, the aldehyde intermediate is 1 -pentanal and the acid byproduct is pentanoate. In yet another embodiment, the aldehyde intermediate is 1 - hexanal and the acid by-product is hexanoate. In yet another embodiment, the aldehyde intermediate is 3-methyl-1 -pentanal and the acid by-product is 3-methyl-1 - pentanoate. In yet another embodiment, the aldehyde intermediate is 4-methyl-1- pentanal and the acid by-product is 4-methyl-1 -pentanoate. In yet another embodiment, the aldehyde intermediate is 4-methyl-1-hexanal and the acid byproduct is 4-methyl-1 -hexanoate. In yet another embodiment, the aldehyde intermediate is 5-methyl-1 -heptanal and the acid by-product is 5-methyl-1 - heptanoate.

[0157] In various embodiments described herein, the protein involved in catalyzing the conversion of an aldehyde to acid by-product is an aldehyde dehydrogenase (ALDH).

[0158] As used herein, the term "aldehyde dehydrogenase" refers to an enzyme catalyzing the reaction: an aldehyde + oxidized cofactor + H2O = an acid + reduced cofactor + H+

[0159] An illustration of exemplary reactions capable of being catalyzed by aldehyde dehydrogenases is shown in Figure 4. Suitable aldehyde dehydrogenases are generally found in the enzyme classification subgroup EC 1 .2.1 .X, wherein the final digit X is dependent upon the substrate or the cofactor. For example, EC 1 .2.1 .3 catalyzes the following reaction: an aldehyde + NAD++ H2O = an acid + NADH + H+); EC 1 .2.1 .4 catalyzes the following reaction: an aldehyde + NADP++ H2O = an acid + NADPH + H+); and EC1 .2.1 .5 catalyzes the following reaction: an aldehyde + NAD(P)++ H2O = an acid + NAD(P)H + H+.

[0160] As described herein, the protein involved in catalyzing the conversion of an aldehyde to an acid by-product is an aldehyde dehydrogenase (ALDH). In one embodiment, the aldehyde dehydrogenase is encoded by a gene selected from the group consisting of ALD2, ALD3, ALD4, ALD5, ALD6, and HFD1, and homologs and variants thereof. In an exemplary embodiment, the aldehyde dehydrogenase is the S. cerevisiae aldehyde dehydrogenase ALD6 (SEQ ID NO: 25) or a homolog or variant thereof. In one embodiment, the homolog may be selected from the group consisting of Saccharomyces castelli (SEQ ID NO: 26), Candida glabrata (SEQ ID NO: 27), Saccharomyces bayanus (SEQ ID NO: 28), Kluyveromyces lactis (SEQ ID NO: 29), Kluyveromyces thermotolerans (SEQ ID NO: 30), Kluyveromyces waltii (SEQ ID NO: 31 ), Saccharomyces cerevisiae YJ789 (SEQ ID NO: 32), Saccharomyces cerevisiae JAY291 (SEQ ID NO: 33), Saccharomyces cerevisiae EC1118 (SEQ ID NO: 34), Saccharomyces cerevisiae DBY939 (SEQ ID NO: 35), Saccharomyces cerevisiae AWRI1631 (SEQ ID NO: 36), Saccharomyces cerevisiae RM 1 - a (SEQ ID NO: 37), Pichia pastoris (SEQ ID NO: 38), Kluyveromyces marxianus (SEQ ID NO: 39), Schizosaccharomyces pombe (SEQ ID NO: 40), and Schizosaccharomyces pombe (SEQ ID NO: 41 ).

[0161] In one embodiment, the recombinant microorganism includes a mutation in at least one gene encoding for an aldehyde dehydrogenase resulting in a reduction of aldehyde dehydrogenase activity of a polypeptide encoded by said gene. In another embodiment, the recombinant microorganism includes a partial deletion ofgene encoding for an aldehyde dehydrogenase resulting in a reduction of aldehyde dehydrogenase activity of a polypeptide encoded by the gene. In another embodiment, the recombinant microorganism comprises a complete deletion of a gene encoding for an aldehyde dehydrogenase resulting in a reduction of aldehyde dehydrogenase activity of a polypeptide encoded by the gene. In yet another embodiment, the recombinant microorganism includes a modification of the regulatory region associated with the gene encoding for an aldehyde dehydrogenase resulting in a reduction of expression of a polypeptide encoded by said gene. In yet another embodiment, the recombinant microorganism comprises a modification of the transcriptional regulator resulting in a reduction of transcription of a gene encoding for an aldehyde dehydrogenase. In yet another embodiment, the recombinant microorganism comprises mutations in all genes encoding for an aldehyde dehydrogenase resulting in a reduction of activity of a polypeptide encoded by the gene(s). In one embodiment, said aldehyde dehydrogenase is encoded by a gene selected from the group consisting of ALD2, ALD3, ALD4, ALD5, ALD6, and HFD1, and homologs and variants thereof. As would be understood in the art, naturally occurring homologs of aldehyde dehydrogenase in yeast other than S. cerevisiae can similarly be inactivated using the methods of the present invention. Aldehyde dehydrogenase homologs and methods of identifying such aldehyde dehydrogenase homologs are described herein.

[0162] As is understood by those skilled in the art, there are several additional mechanisms available for reducing or disrupting the activity of a protein such as aldehyde dehydrogenase, including, but not limited to, the use of a regulated promoter, use of a weak constitutive promoter, disruption of one of the two copies of the gene in a diploid yeast, disruption of both copies of the gene in a diploid yeast, expression of an anti-sense nucleic acid, expression of an siRNA, over expression of a negative regulator of the endogenous promoter, alteration of the activity of an endogenous or heterologous gene, use of a heterologous gene with lower specific activity, the like or combinations thereof.

[0163] As would be understood by one skilled in the art, the activity or expression of more than one aldehyde dehydrogenase can be reduced or eliminated. In one specific embodiment, the activity or expression of ALD4 and ALD6 or homologs or variants thereof is reduced or eliminated. In another specific embodiment, the activity or expression of ALD5 and ALD6 or homologs or variants thereof is reducedor eliminated. In yet another specific embodiment, the activity or expression of ALD4, ALD5, and ALD6 or homologs or variants thereof is reduced or eliminated. In yet another specific embodiment, the activity or expression of the cytosolically localized aldehyde dehydrogenases ALD2, ALD3, and ALD6 or homologs or variants thereof is reduced or eliminated. In yet another specific embodiment, the activity or expression of the mitochondrially localized aldehyde dehydrogenases, ALD4 and ALD5 or homologs or variants thereof, is reduced or eliminated.

[0164] As described herein, the recombinant microorganisms of the present invention are engineered to produce less of the acid by-product than an unmodified parental microorganism. In one embodiment, the recombinant microorganism produces the acid by-product from a carbon source at a carbon yield of less than about 50 percent as compared to a parental microorganism. In another embodiment, the microorganism is produces the acid by-product from a carbon source from a carbon source at a carbon yield of less than about 25, less than about 10, less than about 5, less than about 1 , less than about 0.5, less than about 0.1 , or less than about 0.01 percent as compared to a parental microorganism. In one embodiment, the acid by-product is isobutyrate, derived from isobutyraldehyde, an intermediate of the isobutanol biosynthetic pathway. In another embodiment, the acid by-product is butyrate, derived from 1-butanal, an intermediate of the 1 -butanol biosynthetic pathway. In yet another embodiment, the acid by-product is 2-methyl-1 - butyrate, derived from 2-methyl-1 -butanal, an intermediate of the 2-methyl-1 -butanol biosynthetic pathway. In yet another embodiment, the acid by-product is 3-methyl-1 - butyrate, derived from 3-methyl-1-butanal, an intermediate of the 3-methyl-1 -butanol biosynthetic pathway. In yet another embodiment, the acid by-product is propionate, derived from 1 -propanal, an intermediate of the 1 -propanol biosynthetic pathway. In yet another embodiment, the acid by-product is pentanoate, derived from 1 -pentanal, an intermediate of the 1 -pentanol biosynthetic pathway. In yet another embodiment, the acid by-product is hexanoate, derived from 1 -hexanal, an intermediate of the 1 - hexanol biosynthetic pathway. In yet another embodiment, the acid by-product is 3- methyl-1 -pentanoate, derived from 3-methyl-1-pentanal, an intermediate of the 3- methyl-1 -pentanol biosynthetic pathway. In yet another embodiment, the acid byproduct is 4-methyl-1 -pentanoate, derived from 4-methyl-1-pentanal, an intermediate of the 4-methyl-1 -pentanol biosynthetic pathway. In yet another embodiment, the acid by-product is 4-methyl-1 -hexanoate, derived from 4-methyl-1-hexanal, anintermediate of the 4-methyl-1 -hexanol biosynthetic pathway. In yet another embodiment, the acid by-product is 5-methyl-1 -heptanoate, derived from 5-methyl-1 - heptanal, an intermediate of the 5-methyl-1-heptanol biosynthetic pathway.

[0165] In one embodiment, the acid by-product carbon yield from the corresponding aldehyde is reduced by at least about 50% in a recombinant microorganism as compared to a parental microorganism that does not comprise a reduction or deletion of the activity or expression of one or more proteins involved in catalyzing the conversion of an aldehyde to an acid by-product. In another embodiment, the acid by-product carbon yield from acetolactate is reduced by at least about 60%, by at least about 65%, by at least about 70%, by at least about 75%, by at least about 80%, by at least about 85%, by at least about 90%, by at least about 95%, by at least about 99%, by at least about 99.9%, or by at least about 100% as compared to a parental microorganism that does not comprise a reduction or deletion of the activity or expression of one or more proteins involved in catalyzing the conversion of an aldehyde to an acid by-product. In one embodiment, the acid by-product is isobutyrate, derived from isobutyraldehyde, an intermediate of the isobutanol biosynthetic pathway. In another embodiment, the acid by-product is butyrate, derived from 1 -butanal, an intermediate of the 1 -butanol biosynthetic pathway. In yet another embodiment, the acid by-product is 2-methyl-1 -butyrate, derived from 2-methyl-1 -butanal, an intermediate of the 2-methyl-1-butanol biosynthetic pathway. In yet another embodiment, the acid by-product is 3-methyl-1 - butyrate, derived from 3-methyl-1 -butanal, an intermediate of the 3-methyl-1-butanol biosynthetic pathway. In yet another embodiment, the acid by-product is propionate, derived from 1-propanal, an intermediate of the 1 -propanol biosynthetic pathway. In yet another embodiment, the acid by-product is pentanoate, derived from 1 -pentanal, an intermediate of the 1 -pentanol biosynthetic pathway. In yet another embodiment, the acid by-product is hexanoate, derived from 1-hexanal, an intermediate of the 1- hexanol biosynthetic pathway. In yet another embodiment, the acid by-product is 3- methyl-1 -pentanoate, derived from 3-methyl-1-pentanal, an intermediate of the 3- methyl-1 -pentanol biosynthetic pathway. In yet another embodiment, the acid byproduct is 4-methyl-1 -pentanoate, derived from 4-methyl-1-pentanal, an intermediate of the 4-methyl-1 -pentanol biosynthetic pathway. In yet another embodiment, the acid by-product is 4-methyl-1 -hexanoate, derived from 4-methyl-1 -hexanal, an intermediate of the 4-methyl-1-hexanol biosynthetic pathway. In yet anotherembodiment, the acid by-product is 5-methy!-1-heptanoate, derived from 5-methyl-1- heptanal, an intermediate of the 5-methyl-1 -heptanol biosynthetic pathway.

[0166] In an additional embodiment, the yield of a desirable fermentation product is increased in the recombinant microorganisms comprising a reduction or elimination of the activity or expression of one or more proteins involved in catalyzing the conversion of an aldehyde to acid by-product. In one embodiment, the yield of a desirable fermentation product is increased by at least about 1 % as compared to a parental microorganism that does not comprise a reduction or elimination of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of an aldehyde to acid by-product. In another embodiment, the yield of a desirable fermentation product is increased by at least about 5%, by at least about 10%, by at least about 25%, or by at least about 50% as compared to a parental microorganism that does not comprise a reduction or elimination of the activity or expression of one or more endogenous proteins involved in catalyzing the conversion of an aldehyde to acid by-product. As described herein, the desirable fermentation product may be derived from any biosynthetic pathway in which an aldehyde acts as an intermediate, including, but not limited to, isobutanol, 1 -butanol, 2-methyl-1 -butanol, 3-methyl-1 -butanol, 1 -propanol, 1 -pentanol, 1 -hexanol, 3-methyl- 1 -pentanol, 4-methyl-1-pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 -heptanol biosynthetic pathways.

[0167] Methods for identifying additional enzymes catalyzing the conversion of an aldehyde to acid by-product are outlined as follows: endogenous yeast genes coding for putative aldehyde and alcohol dehydrogenases are deleted from the genome of a yeast strain. These deletion strains are compared to the parent strain by enzymatic assay. Many of these deletion strains are available commercially (for example Open Biosystems YSC1054).

[0168] Another way to screen the deletion library is to incubate yeast cells with an aldehyde (e.g., isobutyraldehyde or 1 -butanal) and analyze the broth for the production of the corresponding acid by-product (e.g., isobutyrate or butyrate, derived from isobutyraldehyde or 1 -butanal, respectively).

[0169] An alternative approach to find additional endogenous activity responsible for the production of the acid by-product (e.g., isobutyrate or butyrate, derived from isobutyraldehyde or 1 -butanal, respectively) is to analyze yeast strains that overexpress the genes suspected of encoding the enzyme responsible forproduction of the acid by-product. Such strains are commercially available for many of the candidate genes listed above (for example Open Biosystems YSC3870). The ORF overexpressing strains are screened for increased acid by-product production levels. Alternatively, the cell lysates of the ORF overexpressing strains are assayed for increased aldehyde oxidation activity. To narrow the list of possible genes causing the production of acid by-products, their expression can be analyzed in fermentation samples. Genes that are not expressed during a fermentation that produces an acid by-product can be excluded from the list of possible targets. This analysis can be done by extraction of RNA from fermenter samples and submitting these samples to whole genome expression analysis, for example, by Roche NimbleGen.

[0170] As described herein, strains that naturally produce low levels of one or more acid by-products can also have applicability for producing increased levels of desirable fermentation products that are derived from biosynthetic pathways comprising an aldehyde intermediate. As would be understood by one skilled in the art equipped with the instant disclosure, strains that naturally produce low levels of one or more acid by-products may inherently exhibit low or undetectable levels of endogenous enzyme activity, resulting in the reduced conversion of aldehydes to acid by-products, a trait favorable for the production of a desirable fermentation product such as isobutanol. Described herein are several approaches for identifying a native host microorganism which is substantially free of aldehyde dehydrogenase activity. For example, one approach to finding a host microorganism which exhibits inherently low or undetectable endogenous enzyme activity responsible for the production of the acid by-product (e.g., isobutyrate or butyrate) is to analyze yeast strains by incubating the yeast cells with an aldehyde (e.g., isobutyraldehyde or 1- butanal) and analyze the broth for the production of the corresponding acid byproduct (e.g., isobutyrate or butyrate, derived from isobutyraldehyde or 1-butanal, respectively).

[0171] As described above, one strategy reducing the production of the acid byproduct, isobutyrate, is to reduce or eliminate the activity or expression of one or more endogenous aldehyde dehydrogenase proteins present in yeast that may be converting isobutyraldehyde to isobutyrate.

[0172] Another strategy for reducing the production of isobutyrate is the reduction or elimination of activity or expression of one more endogenous yeast alcoholdehydrogenases. Reducing the expression of or deleting one or more alcohol dehydrogenases including, but not limited to, S. cerevisiae ADH1 , ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, and SFA1 , and homologs or variants thereof, will generally lead to a reduced production of isobutyrate and a concomitant increase in isobutanol yield. The reduction and / or deletion of additional dehydrogenases are envisioned herein and are considered within the scope of the present invention. These dehydrogenases include additional alcohol dehydrogenases such as S. cerevisiae BDH1 , BDH2, SOR1 , SOR2, and XYL1 , and homologs or variants thereof, as well as aryl alcohol dehydrogenases such as AAD3, AAD4, AAD6, AAD10, AAD14, AAD15, AAD16, and YPL088W, and homologs or variants thereof.

[0173] In another embodiment, the invention provides recombinant microorganisms engineered to reduce and / or deletion one or more additional genes encoding carbonyl / aldehyde reductases. These carbonyl / aldehyde reductases include S. cerevisiae ARM , YPR1 , TMA29, YGL039W, and UGA2, and homologs or variants thereof.

[0174] An additional strategy described herein for reducing the production of the by-product isobutyrate is to reduce or eliminate the activity or expression of endogenous proteins present in yeast that may be producing isobutyrate from the isobutanol pathway intermediate 2-ketoisovalerate. Such enzymes are generally referred to as ketoacid dehydrogenases (KDH). Elimination or reduction of the activity or expression of these endogenous proteins can reduce or eliminate the production of the unwanted byproduct, isobutyrate. KDH enzyme activity has been identified in S. cerevisiae (Dickinson, J. R., and I. W. Dawes, 1992, The catabolism of branched-chain amino acids occurs via a 2-oxoacid dehydrogenase in S. cerevisiae. J. Gen. Microbiol. 138: 2029-2033). Reducing the expression of or deleting one or more ketoacid dehydrogenases and homologs or variants thereof, will generally lead to a reduced production of isobutyrate and a concomitant increase in isobutanol yield.

[0175] The reduction in expression of or deletion of genes in S. cerevisiae and other yeast can be achieved by methods known to those of skill in the art, such as allelic replacement or exchange, as well as gene disruption by the insertion of another gene or marker cassette.

[0176] Another strategy described herein for reducing the production of the byproduct isobutyrate is to increase the activity and / or expression of an alcoholdehydrogenase (ADH) responsible for the conversion of isobutyraldehyde to isobutanol. This strategy prevents competition by endogenous enzymes for the isobutanol pathway intermediate, isobutyraldehyde. An increase in the activity and / or expression of the alcohol dehydrogenase may be achieved by various means. For example, alcohol dehydrogenase activity can be increased by utilizing a promoter with increased promoter strength, by increasing the copy number of the alcohol dehydrogenase gene, or by utilizing an alternative or modified alcohol dehydrogenase with increased specific activity.

[0177] An alternative strategy described herein for reducing the production of the by-product isobutyrate is to utilize an alcohol dehydrogenase (ADH) in the isobutanol pathway responsible for the conversion of isobutyraldehyde to isobutanol which exhibits a decrease in Michaelis-Menten constant (KM). This strategy also prevents competition by endogenous enzymes for the isobutanol pathway intermediate, isobutyraldehyde.

[0178] Another strategy described herein for reducing the production of the byproduct isobutyrate is to utilize an alcohol dehydrogenase (ADH) in the isobutanol pathway responsible for the conversion of isobutyraldehyde to isobutanol which exhibits increased activity and a decrease in Michaelis-Menten constant (KM). This strategy also prevents competition by endogenous enzymes for the isobutanol pathway intermediate, isobutyraldehyde.

[0179] Further, by utilizing a modified ADH enzyme, the present inventors may establish a situation in which the forward reaction (i.e. the isobutyraldehyde conversion to isobutanol) is the favored reaction over the reverse reaction (i.e. the conversion of isobutanol to isobutyraldehyde).

[0180] The strategies described above generally lead to a decrease in isobutyrate yield, which is accompanied by an increase in isobutanol yield. Hence, the above strategies are useful for decreasing the isobutyrate yield and / or titer and for increasing the ratio of isobutanol yield over isobutyrate yield.

[0181] In one embodiment, the isobutyrate yield (mol isobutyrate per mol glucose) is less than about 5%. In another embodiment, the isobutyrate yield (mol isobutyrate per mol glucose) is less than about 1 %. In yet another embodiment, the isobutyrate yield (mol isobutyrate per mol glucose) is less than about 0.5%, less than about 0.1 %, less than about 0.05%, or less than about 0.01 %.

[0182] In one embodiment, the isobutanol to isobutyrate yield ratio is at least about 2. In another embodiment, the isobutanol to isobutyrate yield is at least about 5. In yet another embodiment, the isobutanol to isobutyrate yield ratio at least about 20, at least about 100, at least about 500, or at least about 1000.

[0183] The recombinant microorganisms described herein which produce a beneficial metabolite derived from a biosynthetic pathway which uses an aldehyde as an intermediate may be further engineered to reduce or eliminate enzymatic activity for the conversion of pyruvate to products other than a 3-keto acid (e.g., acetolactate and / or 2-aceto-2-hydroxybutyrate). In one embodiment, the enzymatic activity of pyruvate decarboxylase (PDC), lactate dehydrogenase (LDH), pyruvate oxidase, pyruvate dehydrogenase, and / or glycerol-3-phosphate dehydrogenase (GPD) is reduced or eliminated.

[0184] In a specific embodiment, the beneficial metabolite is produced in a recombinant PDC-minus GPD-minus yeast microorganism that overexpresses an acetolactate synthase (ALS) gene. In another specific embodiment, the ALS is encoded by the B. subtilis a / sS.Reduced Accumulation of 3-Hydroxyacid Bv-Products and Acid Bv-Products

[0185] The present inventors describe herein multiple strategies for reducing the conversion of a 3-keto acid intermediate to a corresponding 3-hydroxyacid byproduct, a process which is accompanied by an increase in the yield of desirable metabolites. The present inventors also describe herein multiple strategies for reducing the conversion of an aldehyde intermediate to a corresponding acid byproduct, a process which is accompanied by a further increase in the yield of desirable metabolites.

[0186] Accordingly, in one aspect, the invention is directed to a recombinant microorganism comprising a biosynthetic pathway which uses a 3-keto acid as an intermediate and an aldehyde as an intermediate, wherein said recombinant microorganism is (i) substantially free of an enzyme that catalyzes the conversion of the 3-keto acid intermediate to a 3-hydroxyacid by-product and (ii) substantially free of an enzyme that catalyzes the conversion of an aldehyde to an acid by-product. In one embodiment, the 3-keto acid intermediate is acetolactate. The biosynthetic pathway which uses acetolactate and an aldehyde as intermediates may be selected from a pathway for the biosynthesis of isobutanol, 1 -butanol, and 3-methyl-1 -butanol.In another embodiment, the 3-keto acid intermediate is 2-aceto-2-hydroxybutyrate. The biosynthetic pathway which uses 2-aceto-2-hydroxybutyrate and an aldehyde as intermediates may be selected from a pathway for the biosynthesis of 2-methyl-1 - butanol, 3-methyl-1 -pentanol, 4-methyl-l -hexanol, and 5-methyl-1 -heptanol.

[0187] In another aspect, the invention is directed to a recombinant microorganism comprising a biosynthetic pathway which uses a 3-keto acid as an intermediate and an aldehyde as an intermediate, wherein said recombinant microorganism is (i) engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of the 3-keto acid intermediate to a 3- hydroxyacid by-product and (ii) engineered to reduce or eliminate the expression or activity of one or more enzymes catalyzing the conversion of the aldehyde to an acid by-product. In one embodiment, the 3-keto acid intermediate is acetolactate. The biosynthetic pathway which uses acetolactate and an aldehyde as intermediates may be selected from a pathway for the biosynthesis of isobutanol, 1 -butanol, and 3- methyl-1 -butanol. In another embodiment, the 3-keto acid intermediate is 2-aceto-2- hydroxybutyrate. The biosynthetic pathway which uses 2-aceto-2-hydroxybutyrate and an aldehyde as intermediates may be selected from a pathway for the biosynthesis of 2-methyl-1 -butanol, 3-methyl-1 -pentanol, 4-methyl-1 -hexanol, and 5- methyl-1 -heptanol.

[0188] In various embodiments described herein, the protein involved in catalyzing the conversion of the 3-keto acid intermediate to the 3-hydroxyacid byproduct is a keto reductase. In an exemplary embodiment, the ketoreductase is a 3- ketoacid reductase (3-KAR). In a further exemplary embodiment, the 3-ketoacid reductase is the S. cerevisiae YMR226C (SEQ ID NO: 1 ) protein or a homolog or variant thereof. In one embodiment, the homolog may be selected from the group consisting of Vanderwaltomzyma polyspora (SEQ ID NO: 2), Saccharomyces castellii (SEQ ID NO: 3), Candida glabrata (SEQ ID NO: 4), Saccharomyces bayanus (SEQ ID NO: 5), Zygosaccharomyces rouxii (SEQ ID NO: 6), K lactis (SEQ ID NO: 7), Ashbya gossypii (SEQ ID NO: 8), Saccharomyces kluyveri (SEQ ID NO: 9), Kluyveromyces thermotolerans (SEQ ID NO: 10), Kluyveromyces waltii (SEQ ID NO: 11 ), Pichia stipitis (SEQ ID NO: 12), Debaromyces hansenii (SEQ ID NO: 13), Pichia pastoris (SEQ ID NO: 14), Candida dubliniensis (SEQ ID NO: 15), Candida albicans (SEQ ID NO: 16), Yarrowia lipolytica (SEQ ID NO: 17), Issatchenkia orientalis (SEQ ID NO: 18), Aspergillus nidulans (SEQ ID NO: 19), Aspergillus niger(SEQ ID NO: 20), Neurospora crassa (SEQ ID NO: 21 ), Schizosaccharomyces pombe (SEQ ID NO: 22), and Kluyveromyces marxianus (SEQ ID NO: 23).

[0189] In various embodiments described herein, the protein involved in catalyzing the conversion of an aldehyde to an acid by-product is an aldehyde dehydrogenase (ALDH). In one embodiment, the aldehyde dehydrogenase is encoded by a gene selected from the group consisting of ALD2, ALD3, ALD4, ALD5, ALD6, and HFD1, and homologs and variants thereof. In an exemplary embodiment, the aldehyde dehydrogenase is the S. cerevisiae aldehyde dehydrogenase ALD6 (SEQ ID NO: 25) or homolog or variant thereof. In one embodiment, the homolog may be selected from the group consisting of Saccharomyces castelli (SEQ ID NO: 26), Candida glabrata (SEQ ID NO: 27), Saccharomyces bayanus (SEQ ID NO: 28), Kluyveromyces lactis (SEQ ID NO: 29), Kluyveromyces thermotolerans (SEQ ID NO: 30), Kluyveromyces waltii (SEQ ID NO: 31 ), Saccharomyces cerevisiae YJ789 (SEQ ID NO: 32), Saccharomyces cerevisiae JAY291 (SEQ ID NO: 33), Saccharomyces cerevisiae EC1118 (SEQ ID NO: 34), Saccharomyces cerevisiae DBY939 (SEQ ID NO: 35), Saccharomyces cerevisiae AW Rl 1631 (SEQ ID NO: 36), Saccharomyces cerevisiae RM11-1 a (SEQ ID NO: 37), Pichia pastoris (SEQ ID NO: 38), Kluyveromyces marxianus (SEQ ID NO: 39), Schizosaccharomyces pombe (SEQ ID NO: 40), and Schizosaccharomyces pombe (SEQ ID NO: 41 ).

[0190] The recombinant microorganisms described herein which produce a beneficial metabolite derived from a biosynthetic pathway which uses a 3-keto acid and an aldehyde as an intermediate may be further engineered to reduce or eliminate enzymatic activity for the conversion of pyruvate to products other than a 3- keto acid (e.g., acetolactate and / or 2-aceto-2-hydroxybutyrate). In one embodiment, the enzymatic activity of pyruvate decarboxylase (PDC), lactate dehydrogenase (LDH), pyruvate oxidase, pyruvate dehydrogenase, and / or glycerol-3-phosphate dehydrogenase (GPD) is reduced or eliminated.

[0191] In a specific embodiment, the beneficial metabolite is produced in a recombinant PDC-minus GPD-minus yeast microorganism that overexpresses an acetolactate synthase (ALS) gene. In another specific embodiment, the ALS is encoded by the B. subtilis alsS.Illustrative Embodiments of Strategies for Reducing Accumulation of 3-HydroxyacidBy-Products and / or Acid By-Products

[0192] In a specific illustrative embodiment, the recombinant microorganism comprises an isobutanol producing metabolic pathway of which acetolactate and isobutyraldehyde are intermediates, wherein said recombinant microorganism is substantially free of enzymes catalyzing the conversion of the acetolactate intermediate to DH2MB and of the isobutyraldehyde intermediate to isobutyrate. In another specific embodiment, the recombinant microorganism comprises an isobutanol producing metabolic pathway of which acetolactate and isobutyraldehyde are intermediates, wherein said recombinant microorganism is (i) engineered to reduce or eliminate the expression or activity of one or more enzymes catalyzing the conversion of acetolactate to DH2MB and (ii) engineered to reduce or eliminate the expression or activity of one or more enzymes catalyzing the conversion of isobutyraldehyde to isobutyrate. In one embodiment, the enzyme catalyzing the conversion of acetolactate to DH2MB is a 3-ketoacid reductase (3-KAR). In another embodiment, the enzyme catalyzing the conversion of isobutyraldehyde to isobutyrate is an aldehyde dehydrogenase (ALDH). A non-limiting example of such a pathway in which a 3-ketoacid reductase (3-KAR) and an aldehyde dehydrogenase (ALDH) are eliminated is depicted in Figure 5.

[0193] In a further specific illustrative embodiment, the recombinant microorganism comprises a 3-methyl-1 -butanol producing metabolic pathway of which acetolactate and 3-methyl-1 -butanal are intermediates, wherein said recombinant microorganism is substantially free of enzymes catalyzing the conversion of the acetolactate intermediate to DH2MB and of the 3-methyl-1 -butanal intermediate to 3-methyl-1 -butyrate. In another specific embodiment, the recombinant microorganism comprises a 3-methyl-1-butanol producing metabolic pathway of which acetolactate and 3-methyl-1 -butanal are intermediates, wherein said recombinant microorganism is (i) engineered to reduce or eliminate the expression or activity of one or more enzymes catalyzing the conversion of acetolactate to DH2MB and (ii) engineered to reduce or eliminate the expression or activity of one or more enzymes catalyzing the conversion of 3-methyl-1 -butanal to 3-methyl-1 -butyrate. In one embodiment, the enzyme catalyzing the conversion of acetolactate to DH2MB is a 3-ketoacid reductase (3-KAR). In another embodiment, the enzyme catalyzing the conversion of 3-methyl-1 -butanal to 3-methyl-1 -butyrate is an aldehyde dehydrogenase (ALDH). A non-limiting example of such a pathway inwhich a 3-ketoacid reductase (3-KAR) and an aldehyde dehydrogenase (ALDH) are eliminated is depicted in Figure 6.

[0194] In a further specific illustrative embodiment, the recombinant microorganism comprises a 2-methyl-1-butanol producing metabolic pathway of which acetolactate and 2-methyl-1 -butanal are intermediates, wherein said recombinant microorganism is substantially free of enzymes catalyzing the conversion of the 2-aceto-2-hydroxybutyrate intermediate to 2-ethyl-2,3- dihydroxybutyrate and of the 2-methyl-1 -butanal intermediate to 2-methyl-1-butyrate. In another specific embodiment, the recombinant microorganism comprises a 2- methyl-1 -butanol producing metabolic pathway of which 2-aceto-2-hydroxybutyrate and 2-methyl-1 -butanal are intermediates, wherein said recombinant microorganism is (i) engineered to reduce or eliminate the expression or activity of one or more enzymes catalyzing the conversion of 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3- dihydroxybutyrate and (ii) engineered to reduce or eliminate the expression or activity of one or more enzymes catalyzing the conversion of 2-methyl-1 -butanal to 2-methyl-1 -butyrate. In one embodiment, the enzyme catalyzing the conversion of 2- aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutyrate is a 3-ketoacid reductase (3-KAR). In another embodiment, the enzyme catalyzing the conversion of 2-methyl- 1 -butanal to 2-methyl-1 -butyrate is an aldehyde dehydrogenase (ALDH). A non- limiting example of such a pathway in which a 3-ketoacid reductase (3-KAR) and an aldehyde dehydrogenase (ALDH) are eliminated is depicted in Figure 7.Overexpression of Enzymes Converting DH2MB into Isobutanol Pathway Intermediates

[0195] A different approach to reduce or eliminate the production of 2,3- dihydroxy-2-methylbutanoic acid (CAS# 14868-24-7) in isobutanol producing yeast is to overexpress an enzyme that converts DH2MB into an isobutanol pathway intermediate. One way to accomplish this is through the use of an enzyme that catalyzes the interconversion of DH2MB and acetolactate, but favors the oxidation of DH2MB. Therefore, in one embodiment, the present invention provides a recombinant microorganism for producing isobutanol, wherein said recombinant microorganism overexpresses an endogenous or heterologous protein capable of converting DH2MB into acetolactate.

[0196] In one embodiment, the endogenous or heterologous protein kinetically favors the oxidative reaction. In another embodiment, the endogenous or heterologous protein has a low KMfor DH2MB and a high KMfor acetolactate. In yet another embodiment, the endogenous or heterologous protein has a low KMfor the oxidized form of its cofactor and a high KMfor the corresponding reduced form of its cofactor. In yet another embodiment, the endogenous or heterologous protein has a higher kcatfor the oxidative reaction than for the reductive direction. This endogenous or heterologous protein should preferably have the ability to use a redox cofactor with a high concentration of its oxidized form versus its reduced form.

[0197] In one embodiment, the endogenous or heterologous protein is encoded by a gene selected from the group consisting of YAL060W, YJR159W, YGL157W, YBL1 4W, YOR120W, YKL055C, YBR159W, YBR149W, YDL168W, YDR368W, YLR426W, YCR107W, YILL24W, YML054C, YOL151W, YMR318c, YBR046C, YHR104W, YIR036C, YDL1 74C, YDR541 C, YBR145W, YGL039W, YCR105W, YDL124W, YIR035C, YFL056C, YNL274c, YLR255C, YGL185C, YGL256W, YJR096W, YJR155W, YPL275W, YOR388C, YLR070C, YMR083W, YER081W, YJR139C, YDL243C, YPL1 13C, YOL165C, YML086C, YMR303C, YDL246C, YLR070C, YHR063C, YNL331 C, YFL057C, YIL155C, YOL086C, YAL061W, YDR127W, YPR127W, YCL018W, YIL074C, YIL124W, and YEL071W. In addition, heterologous genes can be overexpressed in isobutanol producing yeast. For examples beta-hydroxy acid dehydrogenases (EC1 .1 .1 .45 and EC1 .1.1 .60) would be candidates for overexpression.

[0198] In another embodiment, the endogenous or heterologous protein kinetically that favors the reductive reaction is engineered to favor the oxidative reaction. In another embodiment, the protein is engineered to have a low KMfor DH2MB and a high K for acetolactate. In yet another embodiment, the protein is engineered to have a low KMfor the oxidized form of its cofactor and a high KMfor the corresponding reduced form of its cofactor. In yet another embodiment, the protein is engineered to have a higher kcat for the oxidative reaction than for the reductive direction. This engineered protein should preferably have the ability to use a redox cofactor with a high concentration of its oxidized form versus its reduced form.

[0199] Alternatively, an enzyme could be overexpressed that isomerizes DH2MB into DHIV. This approach represents a novel pathway for the production ofisobutanol from pyruvate. Thus, in one embodiment, the present invention provides a recombinant microorganism for producing isobutanol, wherein said recombinant microorganism overexpresses an endogenous or heterologous protein capable of converting DH2MB into 2,3-dihydroxyisovalerate.Overexpression of Enzymes Converting 2-Ethyl-2,3-Dihvdroxybutanoate into Biosynthetic Pathway Intermediates

[0200] A different approach to reduce or eliminate the production of 2-ethyl-2,3- dihydroxybutanoate in yeast is to overexpress an enzyme that converts 2-ethyl-2,3- dihydroxybutanoate into a biosynthetic pathway intermediate. This approach is useful for any biosynthetic pathway which uses 2-aceto-2-hydroxybutyrate as an intermediate, including, but not limited to, 2-methyl-1 -butanol, isoleucine, 3-methyl-1 - pentanol, 4-methyl-1 -hexanol, and 5-methyl-1 -heptanol. One way to accomplish this is through the use of an enzyme that catalyzes the interconversion of 2-ethyl-2,3- dihydroxybutanoate and 2-aceto-2-hydroxybutyrate, but favors the oxidation of 2- ethyl-2,3-dihydroxybutanoate. Therefore, in one embodiment, the present invention provides a recombinant microorganism for producing a product selected from 2- methyl-1 -butanol, isoleucine, 3-methyl-1 -pentanol, 4-methyl-1 -hexanol, and 5- methyl-1 -heptanol wherein said recombinant microorganism overexpresses an endogenous or heterologous protein capable of converting 2-ethyl-2,3- dihydroxybutanoate into 2-aceto-2-hydroxybutyrate.

[0201] In one embodiment, the endogenous or heterologous protein kinetically favors the oxidative reaction. In another embodiment, the endogenous or heterologous protein has a low KMfor 2-ethyl-2,3-dihydroxybutanoate and a high KMfor 2-aceto-2-hydroxybutyrate. In yet another embodiment, the endogenous or heterologous protein has a low KMfor the oxidized form of its cofactor and a high KMfor the corresponding reduced form of its cofactor. In yet another embodiment, the endogenous or heterologous protein has a higher kcat for the oxidative reaction than for the reductive direction. This endogenous or heterologous protein should preferably have the ability to use a redox cofactor with a high concentration of its oxidized form versus its reduced form.

[0202] In one embodiment, the endogenous or heterologous protein is encoded by a gene selected from the group consisting of YAL060W, YJR159W, YGL157W, YBL1 14W, YOR120W, YKL055C, YBR159W, YBR149W, YDL168W, YDR368W,YLR426W, YCR107W, YILL24W, YML054C, YOL151W, YMR318c, YBR046C, YHR104W, YIR036C, YDL174C, YDR541 C, YBR145W, YGL039W, YCR105W, YDL124W, YIR035C, YFL056C, YNL274c, YLR255C, YGL185C, YGL256W, YJR096W, YJR155W, YPL275W, YOR388C, YLR070C, YMR083W, YER081W, YJR139C, YDL243C, YPL1 13C, YOL165C, YML086C, YMR303C, YDL246C, YLR070C, YHR063C, YNL331 C, YFL057C, YIL155C, YOL086C, YAL061W, YDR127W, YPR127W, YCL018W, YIL074C, YIL124W, and YEL071W. In addition, heterologous genes can be overexpressed in isoleucine producing yeast. For examples beta-hydroxy acid dehydrogenases (EC1 .1 .1 .45 and EC1.1 .1 .60) would be candidates for overexpression.

[0203] Alternatively an enzyme could be overexpressed that isomerizes 2-ethyl- 2,3-dihydroxybutanoate into 2,3-dihydroxy-3-methylvalerate. This approach represents a novel pathway for the production of 2-methyl-1-butanol, isoleucine, 3- methyl-1 -pentanol, 4-methyl-l -hexanol, and 5-methyl-1 -heptanol from pyruvate. Thus, in one embodiment, the present invention provides a recombinant microorganism for producing a product selected from 2-methyl-1 -butanol, isoleucine, 3-methyl-1 -pentanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol, wherein said recombinant microorganism overexpresses an endogenous or heterologous protein capable of converting 2-ethyl-2,3-dihydroxybutanoate into a,p-dihydroxy-P- methylvalerate.Use of Overexpressed Ketol-Acid Reductoisomerase (KARI) and / or Modified Ketol-Acid Reductoisomerase (KARI) to Reduce the Production of DH2MB

[0204] As described herein, the conversion of acetolactate to DH2MB competes with the isobutanol pathway for the intermediate acetolactate. In the current yeast isobutanol production strains, ketol-acid reductoisomerase (KARI) catalyzes the conversion of acetolactate to DHIV.

[0205] In one embodiment, the present invention provides recombinant microorganisms having an overexpressed ketol-acid reductoisomerase (KARI), which catalyzes the conversion of acetolactate to 2,3-dihydroxyisovalerate (DHIV). The overexpression of KARI has the effect of reducing DH2MB production. In one embodiment, the KARI has at least 0.01 U / mg of activity in the lysate. In another embodiment, the KARI has at least 0.03 U / mg of activity in the lysate. In yetanother embodiment, the KARI has at least 0.05, 0.1 , 0.5, 1 , 2, 5, or 10 U / mg of activity in the lysate.

[0206] In a preferred embodiment, the overexpressed KARI is engineered to exhibit a reduced KMfor acetolactate as compared to a wild-type or parental KARI. The use of the modified KARI with lower KMfor acetolactate is expected to reduce the production of the by-product DH2MB. A KARI with lower substrate KMis identified by screening homologs. In the alternative, the KARI can be engineered to exhibit reduced KMby directed evolution using techniques known in the art.

[0207] In each of these embodiments, the KARI may be a variant enzyme that utilizes NADH (rather than NADPH) as a co-factor. Such enzymes are described in the commonly owned and co-pending publication, US 2010 / 0143997, which is herein incorporated by reference in its entirety for all purposes.Use of Overexpressed Dihvdroxy Acid Dehydratase (DHAD) to Reduce the Production of DH2MB

[0208] As described herein, the present inventors have found that overexpression of the isobutanol pathway enzyme, dihydroxyacid dehydratase (DHAD), reduces the production of the by-product, DH2MB.

[0209] Accordingly, in one embodiment, the present invention provides recombinant microorganisms having an dihydroxyacid dehydratase (DHAD), which catalyzes the conversion of 2,3-dihydroxyisovalerate (DHIV) to 2-ketoisovalerate (KIV). The overexpression of DHAD has the effect of reducing DH2MB production. In one embodiment, the DHAD has at least 0.01 U / mg of activity in the lysate. In another embodiment, the DHAD has at least 0.03 U / mg of activity in the lysate. In yet another embodiment, the DHAD has at least 0.05, 0.1 , 0.5, 1 , 2, 5, or 10 U / mg of activity in the lysate.Recombinant Microorganisms for the Production of 3-Hydroxyacids

[0210] The present invention provides in additional aspects recombinant microorganisms for the production of 3-hydroxyacids as a product or a metabolic intermediate. In one embodiment, these 3-hydroxyacid-producing recombinant microorganisms express acetolactate synthase (ALS) and a 3-ketoacid reductase catalyzing the reduction of 2-acetolactate to DH2MB. In another embodiment, these3-hydroxyacid-producing recombinant microorganisms express acetolactate synthase (ALS) and a 3-ketoacid reductase catalyzing the reduction of 2-aceto-2-hydroxybutyrate into 2-ethyl-2,3-dihydroxybutyrate.

[0211] These 3-hydroxyacid-producing recombinant microorganisms may be further engineered to reduce or eliminate enzymatic activity for the conversion of pyruvate to products other than acetolactate. In one embodiment, the enzymatic activity of pyruvate decarboxylase (PDC), lactate dehydrogenase (LDH), pyruvate oxidase, pyruvate dehydrogenase, and / or glycerol-3-phosphate dehydrogenase (GPD) is reduced or eliminated.

[0212] In a specific embodiment, DH2MB is produced in a recombinant PDC- minus GPD-minus yeast microorganism that overexpresses an ALS gene and expresses a 3-ketoacid reductase. In one embodiment, the 3-ketoacid reductase is natively expressed. In another embodiment, the 3-ketoacid reductase is heterologously expressed. In yet another embodiment, the 3-ketoacid reductase is overexpressed. In a specific embodiment, the 3-ketoacid reductase is encoded by the S. cerevisiae TMA29 gene or a homolog thereof. In another specific embodiment, the ALS is encoded by the β. subtilis AlsS.

[0213] In another specific embodiment, 2-ethyl-2,3-dihydroxybutyrate is produced in a recombinant PDC-minus GPD-minus yeast microorganism that overexpresses an ALS gene and expresses a 3-ketoacid reductase. In one embodiment, the 3- ketoacid reductase is natively expressed. In another embodiment, the 3-ketoacid reductase is heterologously expressed. In yet another embodiment, the 3-ketoacid reductase is overexpressed. In a specific embodiment, the 3-ketoacid reductase is encoded by the S. cerevisiae TMA29 gene or a homolog thereof. In another specific embodiment, the ALS is encoded by the B. subtilis AlsS.

[0214] In accordance with these additional aspects, the present invention also provides a method of producing 2,3-dihydroxy-2-methylbutanoic acid (DH2MB), comprising: (a) providing a DH2MB-producing recombinant microorganism that expresses acetolactate synthase (ALS) and a 3-ketoacid reductase catalyzing the reduction of 2-acetolactate to DH2MB, and (b) cultivating said recombinant microorganism in a culture medium containing a feedstock providing the carbon source, until a recoverable quantity of DH2MB is produced.

[0215] In accordance with these additional aspects, the present invention also provides a method of producing 2-ethyl-2,3-dihydroxybutyrate, comprising: (a) providing a 2-ethyl-2,3-dihydroxybutyrate-producing recombinant microorganism that expresses acetolactate synthase (ALS) and a 3-ketoacid reductase catalyzing thereduction of 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutyrate, and (b) cultivating said recombinant microorganism in a culture medium containing a feedstock providing the carbon source, until a recoverable quantity of 2-ethyl-2,3- dihydroxybutyrate is produced.Recombinant Microorganisms for the Production of Acid Products

[0216] The present invention provides in additional aspects recombinant microorganisms for the production of acid products derived from aldehydes. In one embodiment, these acid product producing recombinant microorganisms express an aldehyde dehydrogenase catalyzing the conversion of an aldehyde to a corresponding acid product. These acid product producing recombinant microorganisms may be further engineered to reduce or eliminate competing enzymatic activity for the undesirable conversion of metabolites upstream of the desired acid product.

[0217] In a specific embodiment, the acid product is produced in a recombinant yeast microorganism that overexpresses an aldehyde dehydrogenase. In one embodiment, the aldehyde dehydrogenase is natively expressed. In another embodiment, the aldehyde dehydrogenase is heterologously expressed. In yet another embodiment, the aldehyde dehydrogenase is overexpressed. In a specific embodiment, the aldehyde dehydrogenase is encoded by the S. cerevisiae ALD6 gene or a homolog thereof.

[0218] In accordance with this additional aspect, the present invention also provides a method of producing an acid product, comprising: (a) providing an acid product-producing recombinant microorganism that expresses an aldehyde dehydrogenase catalyzing the conversion of an aldehyde to acid product, and (b) cultivating said recombinant microorganism in a culture medium containing a feedstock providing the carbon source, until a recoverable quantity of the desired acid product is produced.The Microorganism in General

[0219] The recombinant microorganisms provided herein can express a plurality of heterologous and / or native enzymes involved in pathways for the production of beneficial metabolites such as isobutanol, 2-butanol, 1 -butanol, 2-butanone, 2,3- butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl-1 -butanol, coenzyme A, 2-methyl-1 -butanol, isoleucine, 1 -pentanol, 1 -hexanol, 3- methyl-1 -pentanol, 4-methyl-1 -pentanol, 4-methyl-1 -hexanol, 5-methyl-1 -heptanol, and 1 -propanol from a suitable carbon source. A non-limiting list of beneficial metabolites produced in engineered biosynthetic pathways is found herein at Tables 1-3.

[0220] As described herein, "engineered" or "modified" microorganisms are produced via the introduction of genetic material into a host or parental microorganism of choice and / or by modification of the expression of native genes, thereby modifying or altering the cellular physiology and biochemistry of the microorganism. Through the introduction of genetic material and / or the modification of the expression of native genes the parental microorganism acquires new properties, e.g., the ability to produce a new, or greater quantities of, an intracellular and / or extracellular metabolite. As described herein, the introduction of genetic material into and / or the modification of the expression of native genes in a parental microorganism results in a new or modified ability to produce beneficial metabolites such as isobutanol, 2-butanol, 1 -butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl-1-butanol, coenzyme A, 2-methyl-1 -butanol, isoleucine, 1 -pentanol, 1 -hexanol, 3-methyl-1 - pentanol, 4-methyl-1 -pentanol, 4-methyl-1 -hexanol, 5-methyl-1 -heptanol, and 1 - propanol from a suitable carbon source. The genetic material introduced into and / or the genes modified for expression in the parental microorganism contains gene(s), or parts of genes, coding for one or more of the enzymes involved in a biosynthetic pathway for the production of one or more metabolites selected from isobutanol, 2- butanol, 1 -butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl-1-butanol, coenzyme A, 2-methyl-1-butanol, isoleucine, 1-pentanol, 1 -hexanol, 3-methyl-1 -pentanol, 4-methyl-1-pentanol, 4- methyl-1-hexanol, 5-methyl-1 -heptanol, and 1 -propanoi and may also include additional elements for the expression and / or regulation of expression of these genes, e.g., promoter sequences.

[0221] In addition to the introduction of a genetic material into a host or parental microorganism, an engineered or modified microorganism can also include alteration, disruption, deletion or knocking-out of a gene or polynucleotide to alter the cellular physiology and biochemistry of the microorganism. Through the alteration, disruption, deletion or knocking-out of a gene or polynucleotide the microorganismacquires new or improved properties (e.g., the ability to produce a new metabolite or greater quantities of an intracellular metabolite, to improve the flux of a metabolite down a desired pathway, and / or to reduce the production of by-products).

[0222] Recombinant microorganisms provided herein may also produce metabolites in quantities not available in the parental microorganism. A "metabolite" refers to any substance produced by metabolism or a substance necessary for or taking part in a particular metabolic process. A metabolite can be an organic compound that is a starting material (e.g., glucose or pyruvate), an intermediate (e.g., 2-ketoisovalerate), or an end product (e.g., isobutanol) of metabolism. Metabolites can be used to construct more complex molecules, or they can be broken down into simpler ones. Intermediate metabolites may be synthesized from other metabolites, perhaps used to make more complex substances, or broken down into simpler compounds, often with the release of chemical energy.

[0223] The disclosure identifies specific genes useful in the methods, compositions and organisms of the disclosure; however it will be recognized that absolute identity to such genes is not necessary. For example, changes in a particular gene or polynucleotide comprising a sequence encoding a polypeptide or enzyme can be performed and screened for activity. Typically such changes comprise conservative mutations and silent mutations. Such modified or mutated polynucleotides and polypeptides can be screened for expression of a functional enzyme using methods known in the art.

[0224] Due to the inherent degeneracy of the genetic code, other polynucleotides which encode substantially the same or functionally equivalent polypeptides can also be used to clone and express the polynucleotides encoding such enzymes.

[0225] As will be understood by those of skill in the art, it can be advantageous to modify a coding sequence to enhance its expression in a particular host. The genetic code is redundant with 64 possible codons, but most organisms typically use a subset of these codons. The codons that are utilized most often in a species are called optimal codons, and those not utilized very often are classified as rare or low- usage codons. Codons can be substituted to reflect the preferred codon usage of the host, in a process sometimes called "codon optimization" or "controlling for species codon bias."

[0226] Optimized coding sequences containing codons preferred by a particular prokaryotic or eukaryotic host (Murray et a / ., 1989, Nucl Acids Res. 17: 477-508) canbe prepared, for example, to increase the rate- of translation or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, as compared with transcripts produced from a non-optimized sequence. Translation stop codons can also be modified to reflect host preference. For example, typical stop codons for S. cerevisiae and mammals are UAA and UGA, respectively. The typical stop codon for monocotyledonous plants is UGA, whereas insects and E. coli commonly use UAA as the stop codon (Dalphin et a / ., 1996, Nucl Acids Res. 24: 216-8). Methodology for optimizing a nucleotide sequence for expression in a plant is provided, for example, in U.S. Pat. No. 6,015,891 , and the references cited therein.

[0227] Those of skill in the art will recognize that, due to the degenerate nature of the genetic code, a variety of DNA compounds differing in their nucleotide sequences can be used to encode a given enzyme of the disclosure. The native DNA sequence encoding the biosynthetic enzymes described above are referenced herein merely to illustrate an embodiment of the disclosure, and the disclosure includes DNA compounds of any sequence that encode the amino acid sequences of the polypeptides and proteins of the enzymes utilized in the methods of the disclosure. In similar fashion, a polypeptide can typically tolerate one or more amino acid substitutions, deletions, and insertions in its amino acid sequence without loss or significant loss of a desired activity. The disclosure includes such polypeptides with different amino acid sequences than the specific proteins described herein so long as the modified or variant polypeptides have the enzymatic anabolic or catabolic activity of the reference polypeptide. Furthermore, the amino acid sequences encoded by the DNA sequences shown herein merely illustrate embodiments of the disclosure.

[0228] In addition, homologs of enzymes useful for generating metabolites are encompassed by the microorganisms and methods provided herein.

[0229] As used herein, two proteins (or a region of the proteins) are substantially homologous when the amino acid sequences have at least about 30%, 40%, 50% 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and nonhomologous sequences can be disregarded for comparison purposes). In oneembodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, typically at least 40%, more typically at least 50%, even more typically at least 60%, and even more typically at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

[0230] When "homologous" is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions. A "conservative amino acid substitution" is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent sequence identity or degree of homology may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art (See, e.g., Pearson W.R., 1994, Methods in Mol Biol 25: 365-89).

[0231] The following six groups each contain amino acids that are conservative substitutions for one another: 1 ) Serine (S), Threonine (T); 2) Aspartic Acid (D), Glutamic Acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Alanine (A), Valine (V), and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

[0232] Sequence homology for polypeptides, which is also referred to as percent sequence identity, is typically measured using sequence analysis software. See commonly owned and co-pending application US 2009 / 0226991 . A typical algorithm used comparing a molecule sequence to a database containing a large number of sequences from different organisms is the computer program BLAST. When searching a database containing sequences from a large number of differentorganisms, it is typical to compare amino acid sequences. Database searching using amino acid sequences can be measured by algorithms described in commonly owned and co-pending application US 2009 / 0226991 .

[0233] It is understood that a range of microorganisms can be modified to include a recombinant metabolic pathway suitable for the production of beneficial metabolites from acetolactate- and / or aldehyde intermediate-requiring biosynthetic pathways. In various embodiments, microorganisms may be selected from yeast microorganisms. Yeast microorganisms for the production of a metabolite such as isobutanol, 2-butanol, 1 -butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl-l -butanol, coenzyme A, 2- methyl-1 -butanol, isoleucine, 1 -pentanol, 1 -hexanol, 3-methyl-1 -pentanol, 4-methyl- 1 -pentanol, 4-methyl-1 -hexanol, 5-methyl-1 -heptanol, and 1 -propanol may be selected based on certain characteristics:

[0234] One characteristic may include the property that the microorganism is selected to convert various carbon sources into beneficial metabolites such as isobutanol, 2-butanol, 1 -butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl-1 -butanol, coenzyme A, 2- methyl-1 -butanol, isoleucine, 1 -pentanol, 1 -hexanol, 3-methyl-1 -pentanol, 4-methyl- 1 -pentanol, 4-methyl-1 -hexanol, 5-methyl-1 -heptanol, and 1-propanol. The term "carbon source" generally refers to a substance suitable to be used as a source of carbon for prokaryotic or eukaryotic cell growth. Examples of suitable carbon sources are described in commonly owned and co-pending application US 2009 / 0226991. Accordingly, in one embodiment, the recombinant microorganism herein disclosed can convert a variety of carbon sources to products, including but not limited to glucose, galactose, mannose, xylose, arabinose, lactose, sucrose, and mixtures thereof.

[0235] The recombinant microorganism may thus further include a pathway for the production of isobutanol, 2-butanol, 1-butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl-1 -butanol, coenzyme A, 2-methyl-1 -butanol, isoleucine, 1-pentanol, 1 -hexanol, 3-methyl-1 - pentanol, 4-methyl-1 -pentanol, 4-methyl-1 -hexanol, 5-methyl-1-heptanol, and 1- propanol from five-carbon (pentose) sugars including xylose. Most yeast species metabolize xylose via a complex route, in which xylose is first reduced to xylitol via a xylose reductase (XR) enzyme. The xylitol is then oxidized to xylulose via a xylitoldehydrogenase (XDH) enzyme. The xylulose is then phosphorylated via a xylulokinase (XK) enzyme. This pathway operates inefficiently in yeast species because it introduces a redox imbalance in the cell. The xylose-to-xylitol step uses NADH as a cofactor, whereas the xylitol-to-xylulose step uses NADPH as a cofactor. Other processes must operate to restore the redox imbalance within the cell. This often means that the organism cannot grow anaerobically on xylose or other pentose sugars. Accordingly, a yeast species that can efficiently ferment xylose and other pentose sugars into a desired fermentation product is therefore very desirable.

[0236] Thus, in one aspect, the recombinant microorganism is engineered to express a functional exogenous xylose isomerase. Exogenous xylose isomerases functional in yeast are known in the art. See, e.g., Rajgarhia et ai, US2006 / 0234364, which is herein incorporated by reference in its entirety. In an embodiment according to this aspect, the exogenous xylose isomerase gene is operatively linked to promoter and terminator sequences that are functional in the yeast cell. In a preferred embodiment, the recombinant microorganism further has a deletion or disruption of a native gene that encodes for an enzyme (e.g., XR and / or XDH) that catalyzes the conversion of xylose to xylitol. In a further preferred embodiment, the recombinant microorganism also contains a functional, exogenous xylulokinase (XK) gene operatively linked to promoter and terminator sequences that are functional in the yeast cell. In one embodiment, the xylulokinase (XK) gene is overexpressed.

[0237] In one embodiment, the microorganism has reduced or no pyruvate decarboxylase (PDC) activity. PDC catalyzes the decarboxylation of pyruvate to acetaldehyde, which is then reduced to ethanol by ADH via an oxidation of NADH to NAD+. Ethanol production is the main pathway to oxidize the NADH from glycolysis. Deletion of this pathway increases the pyruvate and the reducing equivalents (NADH) available for the biosynthetic pathway. Accordingly, deletion of PDC genes can further increase the yield of desired metabolites.

[0238] In another embodiment, the microorganism has reduced or no glycerol-3- phosphate dehydrogenase (GPD) activity. GPD catalyzes the reduction of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P) via the oxidation of NADH to NAD+. Glycerol is then produced from G3P by Glycerol-3- phosphatase (GPP). Glycerol production is a secondary pathway to oxidize excess NADH from glycolysis. Reduction or elimination of this pathway would increase thepyruvate and reducing equivalents (NADH) available for the biosynthetic pathway. Thus, deletion of GPD genes can further increase the yield of desired metabolites.

[0239] In yet another embodiment, the microorganism has reduced or no PDC activity and reduced or no GPD activity. PDC-minus / GPD-minus yeast production strains are described in commonly owned and co-pending publications, US 2009 / 0226991 and US 201 1 / 0020889, both of which are herein incorporated by reference in their entireties for all purposes.

[0240] In one embodiment, the yeast microorganisms may be selected from the "Saccharomyces Yeast Clade", as described in commonly owned and co-pending application US 2009 / 0226991 .

[0241] The term "Saccharomyces sensu stricto" taxonomy group is a cluster of yeast species that are highly related to S. cerevisiae (Rainieri et a / ., 2003, J. Biosci Bioengin 96: 1 -9). Saccharomyces sensu stricto yeast species include but are not limited to S. cerevisiae, S. kudriavzevii, S. mikatae, S. bayanus, S. uvarum, S. carocanis and hybrids derived from these species (Masneuf et a!., 1998, Yeast 7: 61 - 72).

[0242] An ancient whole genome duplication (WGD) event occurred during the evolution of the hemiascomycete yeast and was discovered using comparative genomic tools (Kellis et a / ., 2004, Nature 428: 617-24; Dujon et a / ., 2004, Nature 430:35-44; Langkjaer et al., 2003, Nature 428: 848-52; Wolfe et a / ., 1997, Nature 387: 708-13). Using this major evolutionary event, yeast can be divided into species that diverged from a common ancestor following the WGD event (termed "post-WGD yeast" herein) and species that diverged from the yeast lineage prior to the WGD event (termed "pre-WGD yeast" herein).

[0243] Accordingly, in one embodiment, the yeast microorganism may be selected from a post-WGD yeast genus, including but not limited to Saccharomyces and Candida. The favored post-WGD yeast species include: S. cerevisiae, S. uvarum, S. bayanus, S. paradoxus, S. castelli, and C. glabrata.

[0244] In another embodiment, the yeast microorganism may be selected from a pre-whole genome duplication (pre-WGD) yeast genus including but not limited to Saccharomyces, Kluyveromyces, Candida, Pichia, Issatchenkia, Debaryomyces, Hansenula, Yarrowia and, Schizosaccharomyces. Representative pre-WGD yeast species include: S. kluyveri, K. thermotolerans, K. marxianus, K. waltii, K. lactis, C.tropicalis, P. pastoris, P. anomala, P. stipitis, I. orientalis, I. occidentalis, I. scutulata, D. hansenii, H. anomala, Y. lipolytica, and S. pombe.

[0245] A yeast microorganism may be either Crabtree-negative or Crabtree- positive as described in described in commonly owned and co-pending application US 2009 / 0226991 . In one embodiment the yeast microorganism may be selected from yeast with a Crabtree-negative phenotype including but not limited to the following genera: Saccharomyces, Kluyveromyces, Pichia, Issatchenkia, Hansenula, and Candida. Crabtree-negative species include but are not limited to: S. kluyveri, K. lactis, K. marxianus, P. anomala, P. stipitis, I. orientalis, I. occidentalis, I. scutulata, H. anomala, and C. utilis. In another embodiment, the yeast microorganism may be selected from yeast with a Crabtree-positive phenotype, including but not limited to Saccharomyces, Kluyveromyces, Zygosaccharomyces, Debaryomyces, Pichia and Schizosaccharomyces. Crabtree-positive yeast species include but are not limited to: S. cerevisiae, S. uvarum, S. bayanus, S. paradoxus, S. castelli, K. thermotolerans, C. glabrata, Z. bailli, Z. rouxii, D. hansenii, P. pastorius, and S. pombe.

[0246] Another characteristic may include the property that the microorganism is that it is non-fermenting. In other words, it cannot metabolize a carbon source anaerobically while the yeast is able to metabolize a carbon source in the presence of oxygen. Nonfermenting yeast refers to both naturally occurring yeasts as well as genetically modified yeast. During anaerobic fermentation with fermentative yeast, the main pathway to oxidize the NADH from glycolysis is through the production of ethanol. Ethanol is produced by alcohol dehydrogenase (ADH) via the reduction of acetaldehyde, which is generated from pyruvate by pyruvate decarboxylase (PDC). In one embodiment, a fermentative yeast can be engineered to be non-fermentative by the reduction or elimination of the native PDC activity. Thus, most of the pyruvate produced by glycolysis is not consumed by PDC and is available for the isobutanol pathway. Deletion of this pathway increases the pyruvate and the reducing equivalents available for the biosynthetic pathway. Fermentative pathways contribute to low yield and low productivity of desired metabolites such as isobutanol. Accordingly, deletion of PDC genes may increase yield and productivity of desired metabolites such as isobutanol.

[0247] In some embodiments, the recombinant microorganisms may be microorganisms that are non-fermenting yeast microorganisms, including, but notlimited to those, classified into a genera selected from the group consisting of Tricosporon, Rhodotorula, Myxozyma, or Candida. In a specific embodiment, the non-fermenting yeast is C. xestobii.Isobutanol-Producing Yeast Microorganisms

[0248] As described herein, in one embodiment, a yeast microorganism is engineered to convert a carbon source, such as glucose, to pyruvate by glycolysis and the pyruvate is converted to isobutanol via an isobutanol producing metabolic pathway (See, e.g., WO / 2007 / 050671 , WO / 2008 / 098227, and Atsumi et al., 2008, Nature 45: 86-9). Alternative pathways for the production of isobutanol have been described in WO / 2007 / 050671 and in Dickinson et al., 1998, J Biol Chem 273:25751 -6.

[0249] Accordingly, in one embodiment, the isobutanol producing metabolic pathway to convert pyruvate to isobutanol can be comprised of the following reactions:1 . 2 pyruvate→ acetolactate + CO22. acetolactate + NAD(P)H→ 2,3-dihydroxyisovalerate + NAD(P)+3. 2,3-dihydroxyisovalerate→ alpha-ketoisovalerate4. alpha-ketoisovalerate→ isobutyraldehyde + CO25. isobutyraldehyde +NAD(P)H→ isobutanol + NAD(P)+

[0250] These reactions are carried out by the enzymes ) Acetolactate Synthase (ALS), 2) Ketol-acid Reducto-lsomerase (KARI), 3) Dihydroxy-acid dehydratase (DHAD), 4) Keto-isovalerate decarboxylase (KIVD), and 5) an Alcohol dehydrogenase (ADH) (Figure 1 ). In another embodiment, the yeast microorganism is engineered to overexpress these enzymes. For example, these enzymes can be encoded by native genes. Alternatively, these enzymes can be encoded by heterologous genes. For example, ALS can be encoded by the alsS gene of B. subtilis, alsS of L. lactis, or the ilvK gene of K. pneumonia. For example, KARI can be encoded by the HvC genes of E. coli, C. glutamicum, M. maripaludis, or Piromyces sp E2. For example, DHAD can be encoded by the ilvD genes of E. coli, C. glutamicum, or L. lactis. For example, KIVD can be encoded by the kivD gene of L. lactis. ADH can be encoded by ADH2, ADH6, or ADH7 of S. cerevisiae or adh of L lactis.

[0251] In one embodiment, pathway steps 2 and 5 may be carried out by KARI and ADH enzymes that utilize NADH (rather than NADPH) as a co-factor. Such enzymes are described in the commonly owned and co-pending publication, US 2010 / 0143997, which is herein incorporated by reference in its entirety for all purposes. The present inventors have found that utilization of NADH-dependent KARI and ADH enzymes to catalyze pathway steps 2 and 5, respectively, surprisingly enables production of isobutanol under anaerobic conditions. Thus, in one embodiment, the recombinant microorganisms of the present invention may use an NADH-dependent KARI to catalyze the conversion of acetolactate (+NADH) to produce 2,3-dihydroxyisovalerate. In another embodiment, the recombinant microorganisms of the present invention may use an NADH-dependent ADH to catalyze the conversion of isobutyraldehyde (+NADH) to produce isobutanol. In yet another embodiment, the recombinant microorganisms of the present invention may use both an NADH-dependent KARI to catalyze the conversion of acetolactate (+NADH) to produce 2,3-dihydroxyisovalerate, and an NADH-dependent ADH to catalyze the conversion of isobutyraldehyde (+NADH) to produce isobutanol.

[0252] In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to isobutanol. In one embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to isobutyraldehyde. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to keto-isovalerate. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to 2,3-dihydroxyisovalerate. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to acetolactate.

[0253] Furthermore, any of the genes encoding the foregoing enzymes (or any others mentioned herein (or any of the regulatory elements that control or modulate expression thereof)) may be optimized by genetic / protein engineering techniques, such as directed evolution or rational mutagenesis, which are known to those of ordinary skill in the art. Such action allows those of ordinary skill in the art to optimize the enzymes for expression and activity in yeast.

[0254] In addition, genes encoding these enzymes can be identified from other fungal and bacterial species and can be expressed for the modulation of this pathway. A variety of organisms could serve as sources for these enzymes,including, but not limited to, Saccharomyces spp., including S. cerevisiae and S. uvarum, Kluyveromyces spp., including K. thermotolerans, K. lactis, and K. marxianus, Pichia spp., Hansenula spp., including H. polymorpha, Candida spp., Trichosporon spp., Yamadazyma spp., including Y. spp. stipitis, Torulaspora pretoriensis, Issatchenkia orientalis, Schizosaccharomyces spp., including S. pombe, Cryptococcus spp., Aspergillus spp., Neurospora spp., or Ustilago spp. Sources of genes from anaerobic fungi include, but not limited to, Piromyces spp., Orpinomyces spp., or Neocallimastix spp. Sources of prokaryotic enzymes that are useful include, but not limited to, Escherichia, coli, Zymomonas mobilis, Staphylococcus aureus, Bacillus spp., Clostridium spp., Corynebacterium spp., Pseudomonas spp., Lactococcus spp., Enterobacter spp., and Salmonella spp.

[0255] In one embodiment, the invention is directed to a recombinant microorganism for producing isobutanol, wherein said recombinant microorganism comprises an isobutanol producing metabolic pathway and wherein said microorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of acetolactate to DH2MB. In some embodiments, the enzyme catalyzing the conversion of acetolactate to DH2MB is a 3-ketoacid reductase (3-KAR). In a specific embodiment, the 3-ketoacid reductase is encoded by the S. cerevisiae TMA29 (YMR226C) gene or a homolog thereof. In one embodiment, the homolog may be selected from the group consisting of Vanderwaltomzyma polyspora (SEQ ID NO: 2), Saccharomyces castellii (SEQ ID NO: 3), Candida glabrata (SEQ ID NO: 4), Saccharomyces bayanus (SEQ ID NO: 5), Zygosaccharomyces rouxii (SEQ ID NO: 6), Kluyveromyces lactis (SEQ ID NO: 7), Ashbya gossypii (SEQ ID NO: 8), Saccharomyces kluyveri (SEQ ID NO: 9), Kluyveromyces thermotolerans (SEQ ID NO: 10), Kluyveromyces waltii (SEQ ID NO: 11 ), Pichia stipitis (SEQ ID NO: 12), Debaromyces hansenii (SEQ ID NO: 13), Pichia pastoris (SEQ ID NO: 14), Candida dubliniensis (SEQ ID NO: 15), Candida albicans (SEQ ID NO: 16), Yarrowia lipolytica (SEQ ID NO: 17), Issatchenkia orientalis (SEQ ID NO: 18), Aspergillus nidulans (SEQ ID NO: 19), Aspergillus niger (SEQ ID NO: 20), Neurospora crassa (SEQ ID NO: 21 ), Schizosaccharomyces pombe (SEQ ID NO: 22), and Kluyveromyces marxianus (SEQ ID NO: 23).

[0256] In another embodiment, the invention is directed to a recombinant microorganism for producing isobutanol, wherein said recombinant microorganism comprises an isobutanol producing metabolic pathway and wherein saidmicroorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of isobutyraldehyde to isobutyrate. In some embodiments, the enzyme catalyzing the conversion of isobutyraldehyde to isobutyrate is an aldehyde dehydrogenase. In an exemplary embodiment, the aldehyde dehydrogenase is the S. cerevisiae aldehyde dehydrogenase ALD6 (SEQ ID NO: 25) or a homolog or variant thereof. In one embodiment, the homolog is selected from the group consisting of Saccharomyces castelli (SEQ ID NO: 26), Candida glabrata (SEQ ID NO: 27), Saccharomyces bayanus (SEQ ID NO: 28), Kluyveromyces lactis (SEQ ID NO: 29), Kluyveromyces thermotolerans (SEQ ID NO: 30), Kluyveromyces waltii (SEQ ID NO: 31 ), Saccharomyces cerevisiae YJ789 (SEQ ID NO: 32), Saccharomyces cerevisiae JAY291 (SEQ ID NO: 33), Saccharomyces cerevisiae EC1118 (SEQ ID NO: 34), Saccharomyces cerevisiae DBY939 (SEQ ID NO: 35), Saccharomyces cerevisiae AWR11631 (SEQ ID NO: 36), Saccharomyces cerevisiae RM11 -1 a (SEQ ID NO: 37), Pichia pastoris (SEQ ID NO: 38), Kluyveromyces marxianus (SEQ ID NO: 39), Schizosaccharomyces pombe (SEQ ID NO: 40), and Schizosaccharomyces pombe (SEQ ID NO: 41 ).

[0257] In yet another embodiment, the invention is directed to a recombinant microorganism for producing isobutanol, wherein said recombinant microorganism comprises an isobutanol producing metabolic pathway and wherein said microorganism is (i) engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of acetolactate to DH2MB and (ii) engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of isobutyraldehyde to isobutyrate. In some embodiments, the enzyme catalyzing the conversion of acetolactate to DH2MB is a 3-ketoacid reductase (3- KAR). In a specific embodiment, the 3-ketoacid reductase is encoded by the S. cerevisiae TMA29 (YMR226C) gene or a homolog or variant thereof. In one embodiment, the homolog is selected from the group consisting of Vanderwaltomzyma polyspora (SEQ ID NO: 2), Saccharomyces castellii (SEQ ID NO: 3), Candida glabrata (SEQ ID NO: 4), Saccharomyces bayanus (SEQ ID NO: 5), Zygosaccharomyces rouxii (SEQ ID NO: 6), Kluyveromyces lactis (SEQ ID NO: 7), Ashbya gossypii (SEQ ID NO: 8), Saccharomyces kluyveri (SEQ ID NO: 9), Kluyveromyces thermotolerans (SEQ ID NO: 10), Kluyveromyces waltii (SEQ ID NO: 11 ), Pichia stipitis (SEQ ID NO: 12), Debaromyces hansenii (SEQ ID NO: 13), Pichia pastoris (SEQ ID NO: 14), Candida dubliniensis (SEQ ID NO: 15), Candida albicans(SEQ ID NO: 16), Yarrowia lipolytica (SEQ ID NO: 17), Issatchenkia orientalis (SEQ ID NO: 18), Aspergillus nidulans (SEQ ID NO: 19), Aspergillus niger (SEQ ID NO: 20), Neurospora crassa (SEQ ID NO: 21 ), Schizosaccharomyces pombe (SEQ ID NO: 22), and Kluyveromyces marxianus (SEQ ID NO: 23). In some embodiments, the enzyme catalyzing the conversion of isobutyraldehyde to isobutyrate is an aldehyde dehydrogenase. In a specific embodiment, the aldehyde dehydrogenase is the S. cerevisiae aldehyde dehydrogenase ALD6 (SEQ ID NO: 25) or a homolog or variant thereof. In one embodiment, the homolog is selected from the group consisting of Saccharomyces castelli (SEQ ID NO: 26), Candida glabrata (SEQ ID NO: 27), Saccharomyces bayanus (SEQ ID NO: 28), Kluyveromyces lactis (SEQ ID NO: 29), Kluyveromyces thermotolerans (SEQ ID NO: 30), Kluyveromyces waltii (SEQ ID NO: 31 ), Saccharomyces cerevisiae YJ789 (SEQ ID NO: 32), Saccharomyces cerevisiae JAY291 (SEQ ID NO: 33), Saccharomyces cerevisiae EC1118 (SEQ ID NO: 34), Saccharomyces cerevisiae DBY939 (SEQ ID NO: 35), Saccharomyces cerevisiae AWRI 1631 (SEQ ID NO: 36), Saccharomyces cerevisiae RM11 -1 a (SEQ ID NO: 37), Pichia pastoris (SEQ ID NO: 38), Kluyveromyces marxianus (SEQ ID NO: 39), Schizosaccharomyces pombe (SEQ ID NO: 40), and Schizosaccharomyces pombe (SEQ ID NO: 41 ).

[0258] In one embodiment, the isobutanol producing metabolic pathway comprises at least one exogenous gene that catalyzes a step in the conversion of pyruvate to isobutanol. In another embodiment, the isobutanol producing metabolic pathway comprises at least two exogenous genes that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at least three exogenous genes that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at least four exogenous genes that catalyze steps in the conversion of pyruvate to isobutanol. In yet another embodiment, the isobutanol producing metabolic pathway comprises at five exogenous genes that catalyze steps in the conversion of pyruvate to isobutanol.

[0259] In one embodiment, one or more of the isobutanol pathway genes encodes an enzyme that is localized to the cytosol. In one embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least one isobutanol pathway enzyme localized in the cytosol. In another embodiment, the recombinant microorganisms comprise an isobutanol producingmetabolic pathway with at least two isobutanol pathway enzymes localized in the cytosol. In yet another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least three isobutanol pathway enzymes localized in the cytosol. In yet another embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with at least four isobutanol pathway enzymes localized in the cytosol. In an exemplary embodiment, the recombinant microorganisms comprise an isobutanol producing metabolic pathway with five isobutanol pathway enzymes localized in the cytosol. Isobutanol producing metabolic pathways in which one or more genes are localized to the cytosol are described in commonly owned and co-pending U.S. Application Serial No. 12 / 855,276, which is herein incorporated by reference in its entirety for all purposes.Expression of Modified Alcohol Dehydrogenases in the Production of Isobutanol

[0260] Another strategy described herein for reducing the production of the byproduct isobutyrate is to increase the activity and / or expression of an alcohol dehydrogenase (ADH) responsible for the conversion of isobutyraldehyde to isobutanol. This strategy prevents competition by endogenous enzymes for the isobutanol pathway intermediate, isobutyraldehyde. An increase in the activity and / or expression of ADH may be achieved by various means. For example, ADH activity can be increased by utilizing a promoter with increased promoter strength or by increasing the copy number of the alcohol dehydrogenase gene.

[0261] In alternative embodiments, the production of the by-product isobutyrate may be reduced by utilizing an ADH with increased specific activity for isobutyraldehyde. Such ADH enzymes with increased specific activity for isobutyraldehyde may be identified in nature, or may result from modifications to the ADH enzyme, such as the modifications described herein. In some embodiments, these modifications will produce a decrease in the Michaelis-Menten constant (KM) for isobutyraldehyde. Through the use of such modified ADH enzymes, competition by endogenous enzymes for isobutyraldehyde is further limited. In one embodiment, the isobutyrate yield (mol isobutyrate per mol glucose) in a recombinant microorganism comprising a modified ADH as described herein is less than about 5%. In another embodiment, the isobutyrate yield (mol isobutyrate per mol glucose) in a recombinant microorganism comprising a modified ADH as described herein isless than about 1 %. In yet another embodiment, the isobutyrate yield (mol isobutyrate per mol glucose) in a recombinant microorganism comprising a modified ADH as described herein is less than about 0.5%, less than about 0.1 %, less than about 0.05%, or less than about 0.01 %.

[0262] Further, by utilizing a modified ADH enzyme, the present inventors may establish a situation in which the forward reaction {i.e. the isobutyraldehyde conversion to isobutanol) is the favored reaction over the reverse reaction {i.e. the conversion of isobutanol to isobutyraldehyde).

[0263] The strategies described above generally lead to a decrease in isobutyrate yield, which is accompanied by an increase in isobutanol yield. Hence, the above strategies are useful for decreasing the isobutyrate yield and / or titer and for increasing the ratio of isobutanol yield over isobutyrate yield.

[0264] Accordingly, in one aspect, the present application describes the generation of modified ADHs with enhanced activity that can facilitate improved isobutanol production when co-expressed with the remaining four isobutanol pathway enzymes. In one embodiment according to this aspect, the present application is directed to recombinant microorganisms comprising one or more modified ADHs. In one embodiment, the recombinant microorganism is further engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of acetolactate to DH2MB as described herein. In another embodiment, the recombinant microorganism is further engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of isobutyraldehyde to isobutyrate as described herein.

[0265] In addition to the isobutanol biosynthetic pathway, other biosynthetic pathways utilize ADH enzymes for the conversion of an aldehyde to an alcohol. For example, ADH enzymes convert various aldehydes to alcohols as part of biosynthetic pathways for the production of 1-propanol, 2-propanol, 1 -butanol, 2- butanol, 1 -pentanol, 2-methyl-1 -butanol, 3-and methyl-1 -butanol.

[0266] As used herein, the terms "ADH" or "ADH enzyme" or "alcohol dehydrogenase" are used interchangeably herein to refer to an enzyme that catalyzes the conversion of isobutyraldehyde to isobutanol. ADH sequences are available from a vast array of microorganisms, including, but not limited to, L. lactis (SEQ ID NO: 175), Streptococcus pneumoniae, Staphylococcus aureus, and Bacillus cereus. ADH enzymes modifiable by the methods of the present invention include,but are not limited to those, disclosed in commonly owned and co-pending U.S. Patent Publication No. 2010 / 0143997. A representative list of ADH enzymes modifiable by the methods described herein can be found in Table 97.Modified ADH Enzymes

[0267] In accordance with the invention, any number of mutations can be made to the ADH enzymes, and in one embodiment, multiple mutations can be made to result in an increased ability to convert isobutyraldehyde to isobutanol. Such mutations include point mutations, frame shift mutations, deletions, and insertions, with one or more (e.g., one, two, three, four, five, or six, etc.) point mutations preferred. In an exemplary embodiment, the modified ADH enzyme comprises one or more mutations at positions corresponding to amino acids selected from: (a) tyrosine 50 of the L. lactis AdhA (SEQ ID NO: 185); (b) glutamine 77 of the L. lactis AdhA (SEQ ID NO: 185); (c) valine 108 of the L. lactis AdhA (SEQ ID NO: 185); (d) tyrosine 1 13 of the L. lactis AdhA (SEQ ID NO: 185); (e) isoleucine 212 of the L. lactis AdhA (SEQ ID NO: 185); and (f) leucine 264 of the L. lactis AdhA (SEQ ID NO: 185), wherein AdhA (SEQ ID NO: 185) is encoded by the L. lactis alcohol dehydrogenase (ADH) gene adhA (SEQ ID NO: 184) or a codon-optimized version thereof (SEQ ID NO: 206).

[0268] Mutations may be introduced into the ADH enzymes of the present invention using any methodology known to those skilled in the art. Mutations may be introduced randomly by, for example, conducting a PCR reaction in the presence of manganese as a divalent metal ion cofactor. Alternatively, oligonucleotide directed mutagenesis may be used to create the modified ADH enzymes which allows for all possible classes of base pair changes at any determined site along the encoding DNA molecule. In general, this technique involves annealing an oligonucleotide complementary (except for one or more mismatches) to a single stranded nucleotide sequence coding for the ADH enzyme of interest. The mismatched oligonucleotide is then extended by DNA polymerase, generating a double-stranded DNA molecule which contains the desired change in sequence in one strand. The changes in sequence can, for example, result in the deletion, substitution, or insertion of an amino acid. The double-stranded polynucleotide can then be inserted into an appropriate expression vector, and a mutant or modified polypeptide can thus beproduced. The above-described oligonucleotide directed mutagenesis can, for example, be carried out via PCR.

[0269] Enzymes for use in the compositions and methods of the invention include any enzyme having the ability to convert isobutyraldehyde to isobutanol. Such enzymes include, but are not limited to, the L. lactis AdhA, the S. pneumoniae AdhA, the S. aureus AdhA, and the Bacillus cereus AdhA, amongst others. Additional ADH enzymes modifiable by the methods of the present invention include, but are not limited to those, disclosed in commonly owned and co-pending U.S. Patent Publication No. 2010 / 0143997. A representative list of ADH enzymes modifiable by the methods described herein can be found in Table 16. As will be understood by one of ordinary skill in the art, modified ADH enzymes may be obtained by recombinant or genetic engineering techniques that are routine and well-known in the art. Modified ADH enzymes can, for example, be obtained by mutating the gene or genes encoding the ADH enzyme of interest by site-directed or random mutagenesis. Such mutations may include point mutations, deletion mutations, and insertional mutations. For example, one or more point mutations (e.g., substitution of one or more amino acids with one or more different amino acids) may be used to construct modified ADH enzymes of the invention.

[0270] The invention further includes homologous ADH enzymes which are 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical at the amino acid level to a wild-type ADH enzyme (e.g., L. lactis AdhA or E. coli AdhA) and exhibit an increased ability to convert isobutyraldehyde to isobutanol. Also included within the invention are ADH enzymes, which are 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical at the amino acid level to an ADH enzyme comprising the amino acid sequence set out in SEQ ID NO: 185 and exhibit an increased ability to convert isobutyraldehyde to isobutanol as compared to the unmodified wild-type enzyme. The invention also includes nucleic acid molecules, which encode the above- described ADH enzymes.

[0271] The invention also includes fragments of ADH enzymes which comprise at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 amino acid residues and retain one or more activities associated with ADH enzymes. Such fragments may be obtained by deletion mutation, by recombinant techniques that are routine and well-known in the art, or by enzymatic digestion of the ADH enzyme(s) ofinterest using any of a number of well-known proteolytic enzymes. The invention further includes nucleic acid molecules, which encode the above described modified ADH enzymes and ADH enzyme fragments.

[0272] By a protein or protein fragment having an amino acid sequence at least, for example, 50% "identical" to a reference amino acid sequence, it is intended that the amino acid sequence of the protein is identical to the reference sequence except that the protein sequence may include up to 50 amino acid alterations per each 100 amino acids of the amino acid sequence of the reference protein. In other words, to obtain a protein having an amino acid sequence at least 50% identical to a reference amino acid sequence, up to 50% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 50% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino (N-) and / or carboxy (C-) terminal positions of the reference amino acid sequence and / or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence and / or in one or more contiguous groups within the reference sequence. As a practical matter, whether a given amino acid sequence is, for example, at least 50% identical to the amino acid sequence of a reference protein can be determined conventionally using known computer programs such as those described above for nucleic acid sequence identity determinations, or using the CLUSTAL W program (Thompson, J. D., et ai, Nucleic Acids Res. 22:4673 4680 (1994)).

[0273] In one aspect, amino acid substitutions are made at one or more of the above identified positions (i.e., amino acid positions equivalent or corresponding to Y50, Q77, V108, Y1 13, 1212, or L264 of L. lactis AdhA (SEQ ID NO: 185)). Thus, the amino acids at these positions may be substituted with any other amino acid including Ala, Asn, Arg, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val. A specific example of a ADH enzyme which exhibits an increased ability to convert isobutyraldehyde to isobutanol is an ADH in which (1 ) the tyrosine at position 50 has been replaced with a phenylalanine or tryptophan residue,(2) the glutamine at position 77 has been replaced with an arginine or serine residue,(3) the valine at position 108 has been replaced with a serine or alanine residue, (4) the tyrosine at position 113 has been replaced with a phenylalanine or glycine residue, (5), the isoleucine at position 212 has been replaced with a threonine orvaline residue, and / or (6) the leucine at position 264 is replaced with a valine residue.

[0274] Polypeptides having the ability to convert isobutyraldehyde to isobutanol for use in the invention may be isolated from their natural prokaryotic or eukaryotic sources according to standard procedures for isolating and purifying natural proteins that are well-known to one of ordinary skill in the art (see, e.g., Houts, G. E., et al., J. Virol. 29:517 (1979)). In addition, polypeptides having the ability to convert isobutyraldehyde to isobutanol may be prepared by recombinant DNA techniques that are familiar to one of ordinary skill in the art (see, e.g., Kotewicz, M. L, et al., Nucl. Acids Res. 16:265 (1988); Soltis, D. A., and Skalka, A. M., Proc. Natl. Acad. Sci. USA 85:3372 3376 (1988)).

[0275] In one aspect of the invention, modified ADH enzymes are made by recombinant techniques. To clone a gene or other nucleic acid molecule encoding an ADH enzyme which will be modified in accordance with the invention, isolated DNA which contains the ADH enzyme gene or open reading frame may be used to construct a recombinant DNA library. Any vector, well known in the art, can be used to clone the ADH enzyme of interest. However, the vector used must be compatible with the host in which the recombinant vector will be transformed.

[0276] Prokaryotic vectors for constructing the plasmid library include plasmids such as those capable of replication in E. coli such as, for example, pBR322, ColE1 , pSC 0 , pUC-vectors (pUC18, pUC19, etc.: In: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1982); and Sambrook et al., In: Molecular Cloning A Laboratory Manual (2d ed.) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)). Bacillus plasmids include pC194, pUB1 10, pE194, pC221 , pC217, etc. Such plasmids are disclosed by Glyczan, T. In: The Molecular Biology Bacilli, Academic Press, York (1982), 307 329. Suitable Streptomyces plasmids include pi J101 (Kendall et al., J. Bacteriol. 169:4177 4183 (1987)). Pseudomonas plasmids are reviewed by John et al., (Rad. Insec. Dis. 8:693 704 (1986)), and Igaki, (Jpn. J. Bacteriol. 33:729 742 (1978)). Broad-host range plasmids or cosmids, such as pCP13 (Darzins and Chakrabarty, J. Bacteriol. 159:9 18 (1984)) can also be used for the present invention.

[0277] Suitable hosts for cloning the ADH nucleic acid molecules of interest are prokaryotic hosts. One example of a prokaryotic host is E. coli. However, the desired ADH nucleic acid molecules of the present invention may be cloned in otherprokaryotic hosts including, but not limited to, hosts in the genera Escherichia, Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and Proteus.

[0278] Eukaryotic hosts for cloning and expression of the ADH enzyme of interest include yeast and fungal cells. A particularly preferred eukaryotic host is yeast. Expression of the desired ADH enzyme in such eukaryotic cells may require the use of eukaryotic regulatory regions which include eukaryotic promoters. Cloning and expressing the ADH nucleic acid molecule in eukaryotic cells may be accomplished by well known techniques using well known eukaryotic vector systems.

[0279] In accordance with the invention, one or more mutations may be made in any ADH enzyme of interest in order to increase the ability of the enzyme to convert isobutyraldehyde to isobutanol, or confer other properties described herein upon the enzyme, in accordance with the invention. Such mutations include point mutations, frame shift mutations, deletions, and insertions. Preferably, one or more point mutations, resulting in one or more amino acid substitutions, are used to produce ADH enzymes having an enhanced ability to convert isobutyraldehyde to isobutanol. In a preferred aspect of the invention, one or more mutations at positions equivalent or corresponding to position Y50 (e.g., Y50W or Y50F), Q77 (e.g., Q77S or Q77R), V108 (e.g. V108S or V108A), Y1 13 (e.g., Y1 13F or Y1 13G), 1212 (e.g., I212T or 1212V), and / or L264 (e.g. L264V) of the L. lactis AdhA (SEQ ID NO: 185) enzyme may be made to produce the desired result in other ADH enzymes of interest.

[0280] The corresponding positions of the ADH enzymes identified herein (e.g. the L. lactis AdhA of SEQ ID NO: 185) may be readily identified for other ADH enzymes by one of skill in the art. Thus, given the defined region and the assays described in the present application, one with skill in the art can make one or a number of modifications, which would result in an increased ability to convert isobutyraldehyde to isobutanol in any ADH enzyme of interest.

[0281] In a preferred embodiment, the modified ADH enzymes have from 1 to 6 amino acid substitutions selected from positions corresponding to Y50, Q77, V108, Y1 13, 1212, or L264 as compared to the wild-type ADH enzymes. In other embodiments, the modified ADH enzymes have additional amino acid substitutions at other positions as compared to the respective wild-type ADH enzymes. Thus, modified ADH enzymes may have at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40 different residues in other positions as compared to the respectivewild-type ADH enzymes. As will be appreciated by those of skill in the art, the number of additional positions that may have amino acid substitutions will depend on the wild-type ADH enzyme used to generate the variants. Thus, in some instances, up to 50 different positions may have amino acid substitutions.

[0282] It is understood that various microorganisms can act as "sources" for genetic material encoding ADH enzymes suitable for use in a recombinant microorganism provided herein. For example, In addition, genes encoding these enzymes can be identified from other fungal and bacterial species and can be expressed for the modulation of this pathway. A variety of organisms could serve as sources for these enzymes, including, but not limited to, Lactococcus sp., including L. lactis, Lactobacillus sp., including L. brevis, L. buchneri, L. hilgardii, L. fermentum, L. reuteri, L. vaginalis, L. antri, L. oris, and L. coleohominis, Pediococcus sp., including P. acidilactici, Bacillus sp., including B. cereus, B. thuringiensis, B. coagulans, B. anthracis, B. weihenstephanensis, B. mycoides, and B. amyloliquefaciens, Leptotrichia sp., including L. goodfellowii, L. buccalis, and L. hofstadii, Actinobacillus sp., including A. pleuropneumoniae, Streptococcus sp., including S. sanguinis, S. parasanguinis, S. gordonii, S. pneumoniae, and S. mitis, Streptobacillus sp., including S. moniliformis, Staphylococcus sp., including S. aureus, Eikenella sp., including E. corrodens, Weissella sp., including W. paramesenteroides, Kingella sp., including K. oralis, and Rothia sp., including R. dentocariosa, and Exiguobacterium sp.

[0283] The nucleotide sequences for several ADH enzymes are known. For instance, the sequences of ADH enzymes are available from a vast array of microorganisms, including, but not limited to, L lactis (SEQ ID NO: 185), S. pneumoniae, S. aureus, and Bacillus cereus. ADH enzymes modifiable by the methods of the present invention include, but are not limited to those, disclosed in commonly owned and co-pending U.S. Patent Publication No. 2010 / 0143997. A representative list of ADH enzymes modifiable by the methods described herein can be found in Table 97.

[0284] In addition, any method can be used to identify genes that encode for ADH enzymes with a specific activity. Generally, homologous or analogous genes with similar activity can be identified by functional, structural, and / or genetic analysis. In most cases, homologous or analogous genes with similar activity will have functional, structural, or genetic similarities. Techniques known to those skilled in theart may be suitable to identify homologous genes and homologous enzymes. Generally, analogous genes and / or analogous enzymes can be identified by functional analysis and will have functional similarities. Techniques known to those skilled in the art may be suitable to identify analogous genes and analogous enzymes. For example, to identify homologous or analogous genes, proteins, or enzymes, techniques may include, but not limited to, cloning a gene by PCR using primers based on a published sequence of a gene / enzyme or by degenerate PCR using degenerate primers designed to amplify a conserved region among a gene. Further, one skilled in the art can use techniques to identify homologous or analogous genes, proteins, or enzymes with functional homology or similarity. Techniques include examining a cell or cell culture for the catalytic efficiency or the specific activity of an enzyme through in vitro enzyme assays for said activity, then isolating the enzyme with said activity through purification, determining the protein sequence of the enzyme through techniques such as Edman degradation, design of PCR primers to the likely nucleic acid sequence, amplification of said DNA sequence through PCR, and cloning of said nucleic acid sequence. To identify homologous or analogous genes with similar activity, techniques also include comparison of data concerning a candidate gene or enzyme with databases such as BRENDA, KEGG, or MetaCYC. The candidate gene or enzyme may be identified within the above mentioned databases in accordance with the teachings herein. Furthermore, enzymatic activity can be determined phenotypically.Methods of Making ADH Enzymes with Enhanced Catalytic Efficiency

[0285] The present invention further provides methods of engineering ADH enzymes to enhance their catalytic efficiency.

[0286] One approach to increasing the catalytic efficiency of ADH enzymes is by saturation mutagenesis with NNK libraries. These libraries may be screened for increases in catalytic efficiency in order to identify, which single mutations contribute to an increased ability to convert isobutyraldehyde to isobutanol. Combinations of mutations at aforementioned residues may be investigated by any method. For example, a combinatorial library of mutants may be designed based on the results of the saturation mutagenesis studies.

[0287] Another approach is to use random oligonucleotide mutagenesis to generate diversity by incorporating random mutations, encoded on a syntheticoligonucleotide, into the enzyme. The number of mutations in individual enzymes within the population may be controlled by varying the length of the target sequence and the degree of randomization during synthesis of the oligonucleotides. The advantages of this more defined approach are that all possible amino acid mutations and also coupled mutations can be found.

[0288] If the best variants from the experiments described above do not display sufficient activity, directed evolution via error-prone PCR may be used to obtain further improvements. Error-prone PCR mutagenesis of the ADH enzyme may be performed followed by screening for ADH activity.Enhanced ADH Catalytic Efficiency

[0289] In one aspect, the catalytic efficiency of the modified ADH enzyme is enhanced. As used herein, the phrase "catalytic efficiency" refers to the property of the ADH enzyme that allows it to convert isobutyraldehyde to isobutanol.

[0290] In one embodiment, the catalytic efficiency of the modified ADH is enhanced as compared to the wild-type or parental ADH. Preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 5% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 15% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 25% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 50% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 75% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 100% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 200% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 500% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 1000% as compared to the wild-type or parental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 2000% as compared to the wild-type orparental ADH. More preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 3000% as compared to the wild-type or parental ADH. Most preferably, the catalytic efficiency of the modified ADH enzyme is enhanced by at least about 3500% as compared to the wild-type or parental ADH.Gene Expression of Modified ADH Enzymes

[0291] Provided herein are methods for the expression of one or more of the modified ADH enzyme genes involved the production of beneficial metabolites and recombinant DNA expression vectors useful in the method. Thus, included within the scope of the disclosure are recombinant expression vectors that include such nucleic acids. The term expression vector refers to a nucleic acid that can be introduced into a host microorganism or cell-free transcription and translation system. An expression vector can be maintained permanently or transiently in a microorganism, whether as part of the chromosomal or other DNA in the microorganism or in any cellular compartment, such as a replicating vector in the cytoplasm. An expression vector also comprises a promoter that drives expression of an RNA, which typically is translated into a polypeptide in the microorganism or cell extract. For efficient translation of RNA into protein, the expression vector also typically contains a ribosome-binding site sequence positioned upstream of the start codon of the coding sequence of the gene to be expressed. Other elements, such as enhancers, secretion signal sequences, transcription termination sequences, and one or more marker genes by which host microorganisms containing the vector can be identified and / or selected, may also be present in an expression vector. Selectable markers, i.e., genes that confer antibiotic resistance or sensitivity, are used and confer a selectable phenotype on transformed cells when the cells are grown in an appropriate selective medium.

[0292] The various components of an expression vector can vary widely, depending on the intended use of the vector and the host cell(s) in which the vector is intended to replicate or drive expression. Expression vector components suitable for the expression of genes and maintenance of vectors in E. coli, yeast, Streptomyces, and other commonly used cells are widely known and commercially available. For example, suitable promoters for inclusion in the expression vectors of the disclosure include those that function in eukaryotic or prokaryotic host microorganisms. Promoters can comprise regulatory sequences that allow forregulation of expression relative to the growth of the host microorganism or that cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus. For E. coli and certain other bacterial host cells, promoters derived from genes for biosynthetic enzymes, antibiotic-resistance conferring enzymes, and phage proteins can be used and include, for example, the galactose, lactose (lac), maltose, tryptophan (trp), beta-lactamase (bla), bacteriophage lambda PL, and T5 promoters. In addition, synthetic promoters, such as the tac promoter (U.S. Pat. No. 4,551 ,433), can also be used. For E. coli expression vectors, it is useful to include an E. coli origin of replication, such as from pUC, p1 P, p1 , and pBR.

[0293] Thus, recombinant expression vectors contain at least one expression system, which, in turn, is composed of at least a portion of a biosynthetic gene coding sequences operably linked to a promoter and optionally termination sequences that operate to effect expression of the coding sequence in compatible host cells. The host cells are modified by transformation with the recombinant DNA expression vectors of the disclosure to contain the expression system sequences either as extrachromosomal elements or integrated into the chromosome.

[0294] Moreover, methods for expressing a polypeptide from a nucleic acid molecule that are specific to a particular microorganism (i.e. a yeast microorganism) are well known. For example, nucleic acid constructs that are used for the expression of heterologous polypeptides within Kluyveromyces and Saccharomyces are well known (see, e.g., U.S. Pat. Nos. 4,859,596 and 4,943,529, each of which is incorporated by reference herein in its entirety for Kluyveromyces and, e.g., Gellissen et al., Gene 190(1 ):87-97 (1997) for Saccharomyces. Yeast plasmids have a selectable marker and an origin of replication, also known as Autonomously Replicating Sequences (ARS). In addition certain plasmids may also contain a centromeric sequence. These centromeric plasmids are generally a single or low copy plasmid. Plasmids without a centromeric sequence and utilizing either a 2 micron (S. cerevisiae) or 1.6 micron (K. lactis) replication origin are high copy plasmids. The selectable marker can be either prototrophic, such as HIS3, TRP1, LEU2, URA3 or ADE2, or antibiotic resistance, such as, bar, ble, hph, or kan.

[0295] A nucleic acid of the disclosure can be amplified using cDNA, mRNA synthetic DNA, or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques and those procedures described in the Examples section below. The nucleic acid soamplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to nucleotide sequences can be prepared by standard synthetic techniques, e.g. , using an automated DNA synthesizer.

[0296] It is also understood that an isolated nucleic acid molecule encoding a polypeptide homologous to the enzymes described herein can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence encoding the particular polypeptide, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into the polynucleotide by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. In contrast to those positions where it may be desirable to make a non-conservative amino acid substitutions (see above), in some positions it is preferable to make conservative amino acid substitutions. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g. , lysine, arginine, histidine), acidic side chains (e.g. , aspartic acid, glutamic acid), uncharged polar side chains (e.g. , glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g. , alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g. , threonine, valine, isoleucine) and aromatic side chains (e.g. , tyrosine, phenylalanine, tryptophan, histidine).

[0297] Although the effect of an amino acid change varies depending upon factors such as phosphorylation, glycosylation, intra-chain linkages, tertiary structure, and the role of the amino acid in the active site or a possible allosteric site, it is generally preferred that the substituted amino acid is from the same group as the amino acid being replaced. To some extent the following groups contain amino acids, which are interchangeable: the basic amino acids lysine, arginine, and histidine; the acidic amino acids aspartic and glutamic acids; the neutral polar amino acids serine, threonine, cysteine, glutamine, asparagine and, to a lesser extent, methionine; the nonpolar aliphatic amino acids glycine, alanine, valine, isoleucine, and leucine (however, because of size, glycine and alanine are more closely related and valine, isoleucine and leucine are more closely related); and the aromatic aminoacids phenylalanine, tryptophan, and tyrosine. In addition, although classified in different categories, alanine, glycine, and serine seem to be interchangeable to some extent, and cysteine additionally fits into this group, or may be classified with the polar neutral amino acids.Methods in GeneralIdentification of 3-Ketoacid Reductase Homologs

[0298] Any method can be used to identify genes that encode for enzymes with 3- ketoacid reductase activity, including, but not limited to S. cerevisiae TMA29. Generally, genes that are homologous or similar to 3-ketoacid reductases such as TMA29 can be identified by functional, structural, and / or genetic analysis. In most cases, homologous or similar genes and / or homologous or similar enzymes will have functional, structural, or genetic similarities.

[0299] The S. cerevisiae gene TMA29 is also known as YMR226C. The open reading frame (ORF) YMR226C is found on the S. cerevisiae Chromosome XIII at positions 722395...721592. The chromosomal location of YMR226C is a region that is highly syntenic to chromosomes in many related yeast [Byrne, K.R and K. H. Wolfe (2005) "The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species." Genome Res. 15(10): 1456- 61 . Scannell, D. R., K. P. Byrne, J. L. Gordon, S. Wong, and K. H. Wolfe (2006) "Multiple rounds of speciation associated with reciprocal gene loss in polyploidy yeasts." Nature 440: 341 -5. Scannell, D. R., A. C. Frank, G. C. Conant, K. P. Byrne, M. Woolfit, and K. H. Wolfe (2007)" Independent sorting-out of thousands of duplicated gene pairs in two yeast species descended from a whole-genome duplication." Proc Natl Acad Sci U S A 104: 8397-402.]

[0300] For example, locations of the syntenic versions of YMR226C from other yeast species can be found on Chromosome 13 in Candida glabrata, Chromosome 1 in Zygosaccharomyces rouxii, Chromosome 2 in K. lactis, Chromosome 6 in Ashbya gossypii, Chromosome 8 in S. kluyveri, Chromosome 4 in K. thermotolerance and Chromosome 8 from the inferred ancestral yeast species [Gordon, J. L, K. P. Byrne, and K. H. Wolfe (2009) "Additions, losses, and rearrangements on the evolutionary route from a reconstructed ancestor to the modern Saccharomyces cerevisiae genome." PLoS Genet. 5: e1000485.]

[0301] Using this syntenic relationship, species-specific versions of this gene are readily identified and examples can be found in Table 4.Table 4. Y R226C and homologs thereof.

[0302] In addition to synteny, fungal homologs to the S. cerevisiae TMA29 gene may be identified by one skilled in the art through tools such as BLAST and sequence alignment. These other homologs may be deleted in a similar manner from the respective yeast species to eliminate the accumulation of the 3-hydroxyacid by-product. Examples of homologous proteins can be found in Vanderwaltomzyma polyspora (SEQ ID NO: 2), Saccharomyces castellii (SEQ ID NO: 3), Candida glabrata (SEQ ID NO: 4), Saccharomyces bayanus (SEQ ID NO: 5), Zygosaccharomyces rouxii (SEQ ID NO: 6), K. lactis (SEQ ID NO: 7), Ashbya gossypii (SEQ ID NO: 8), Saccharomyces kluyveri (SEQ ID NO: 9), Kluyveromyces thermotolerans (SEQ ID NO: 10), Kluyveromyces waltii (SEQ ID NO: 11 ), Pichia stipitis (SEQ ID NO: 12), Debaromyces hansenii (SEQ ID NO: 13), Pichia pastoris (SEQ ID NO: 14), Candida dubliniensis (SEQ ID NO: 15), Candida albicans (SEQ ID NO: 16), Yarrowia lipolytica (SEQ ID NO: 17), Issatchenkia orientalis (SEQ ID NO:18), Aspergillus nidulans (SEQ ID NO: 19), Aspergillus niger (SEQ ID NO: 20), Neurospora crassa (SEQ ID NO: 21 ), Schizosaccharomyces pombe (SEQ ID NO: 22), and Kluyveromyces marxianus (SEQ ID NO: 23).

[0303] Techniques known to those skilled in the art may be suitable to identify additional homologous genes and homologous enzymes. Generally, analogous genes and / or analogous enzymes can be identified by functional analysis and will have functional similarities. Techniques known to those skilled in the art may be suitable to identify analogous genes and analogous enzymes. For example, to identify homologous or analogous genes, proteins, or enzymes, techniques may include, but not limited to, cloning a dehydratase gene by PCR using primers based on a published sequence of a gene / enzyme or by degenerate PCR using degenerate primers designed to amplify a conserved region among dehydratase genes. Further, one skilled in the art can use techniques to identify homologous or analogous genes, proteins, or enzymes with functional homology or similarity. Techniques include examining a cell or cell culture for the catalytic activity of an enzyme through in vitro enzyme assays for said activity (e.g. as described herein or in Kiritani, K. Branched- Chain Amino Acids Methods Enzymology, 1970), then isolating the enzyme with said activity through purification, determining the protein sequence of the enzyme through techniques such as Edman degradation, design of PCR primers to the likely nucleic acid sequence, amplification of said DNA sequence through PCR, and cloning of said nucleic acid sequence. To identify homologous or similar genes and / or homologous or similar enzymes, analogous genes and / or analogous enzymes or proteins, techniques also include comparison of data concerning a candidate gene or enzyme with databases such as BRENDA, KEGG, or MetaCYC. The candidate gene or enzyme may be identified within the above mentioned databases in accordance with the teachings herein.Identification of Aldehyde Dehydrogenase Homologs

[0304] Any method can be used to identify genes that encode for enzymes with aldehyde dehydrogenase activity, including, but not limited, to the S. cerevisiae ALD6. Generally, genes that are homologous or similar to aldehyde dehydrogenases such as ALD6 can be identified by functional, structural, and / or genetic analysis. In most cases, homologous or similar genes and / or homologous or similar enzymes will have functional, structural, or genetic similarities.

[0305] The S. cerevisiae gene ALD6 is also known by its systematic name YPL061W. The open reading frame (ORF) YPL061W is found on the S. cerevisiae Chromosome XVI at positions 432585...434087. The chromosomal location of YPL061W is a region that is highly syntenic to chromosomes in many related yeast [Byrne, K.P. and K. H. Wolfe (2005) "The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species." Genome Res. 15: 1456-61 . Scannell, D. R., K. P. Byrne, J. L. Gordon, S. Wong, and K. H. Wolfe (2006) "Multiple rounds of speciation associated with reciprocal gene loss in polyploidy yeasts." Nature 440: 341 -5. Scannell, D. R., A. C. Frank , G. C. Conant , K. P. Byrne , M. Woolfit, and K. H. Wolfe (2007)" Independent sorting-out of thousands of duplicated gene pairs in two yeast species descended from a whole- genome duplication." Proc Natl Acad Sci U S A 104: 8397-402.]

[0306] For example, locations of the syntenic versions of YPL061W from other yeast species can be found on Chromosome 8 in Candida glabrata, Chromosome 5 in K. lactis, Chromosome 5 in K. thermotolerans and Chromosome 8 from the inferred ancestral yeast species [Gordon, J. L, K. P. Byrne, and K. H. Wolfe (2009) "Additions, losses, and rearrangements on the evolutionary route from a reconstructed ancestor to the modern Saccharomyces cerevisiae genome." PLoS Genet. 5: e1000485.].

[0307] Using this syntenic relationship, species-specific versions of this gene are readily identified and examples can be found in Table 5.Table 5. ALD6 and homologs thereof.

[0308] In addition to synteny, fungal homologs to the S. cerevisiae ALD6 gene may be identified by one skilled in the art through tools such as BLAST and sequence alignment. These other homologs may be deleted in a similar manner from the respective yeast species to eliminate the accumulation of the aldehyde byproduct. Examples of homologous proteins can be found in Saccharomyces castelli (SEQ ID NO: 26), Candida glabrata (SEQ ID NO: 27), Saccharomyces bayanus (SEQ ID NO: 28), Kluyveromyces lactis (SEQ ID NO: 29), Kluyveromyces thermotolerans (SEQ ID NO: 30), Kluyveromyces waltii (SEQ ID NO: 31 ), Saccharomyces cerevisiae YJ789 (SEQ ID NO: 32), Saccharomyces cerevisiae JAY291 (SEQ ID NO: 33), Saccharomyces cerevisiae EC1118 (SEQ ID NO: 34), Saccharomyces cerevisiae DBY939 (SEQ ID NO: 35), Saccharomyces cerevisiae AWRI1631 (SEQ ID NO: 36), Saccharomyces cerevisiae RM11 -1 a (SEQ ID NO: 37), Pichia pastoris (SEQ ID NO: 38), Kluyveromyces marxianus (SEQ ID NO: 39), Schizosaccharomyces pombe (SEQ ID NO: 40), and Schizosaccharomyces pombe (SEQ ID NO: 41 ).Identification of an ADH or KDH in a Microorganism

[0309] Any method can be used to identify genes that encode for enzymes with alcohol dehydrogenase (ADH) or ketoacid dehydrogenase (KDH) activity. Alcohol dehydrogenase (ADH) can catalyze the reversible conversion of isobutanol to isobutyraldehyde. Ketoacid dehydrogenases (KDH) can catalyze the conversion of 2-ketoisovalerate to isobutyryl-CoA, which can be converted further to isobutyrate by the action of transacetylase and carboxylic acid kinase enzymes. Generally, genes that are homologous or similar to known alcohol dehydrogenases and ketoacid dehydrogenases can be identified by functional, structural, and / or genetic analysis. In most cases, homologous or similar alcohol dehydrogenase genes and / or homologous or similar alcohol dehydrogenase enzymes will have functional, structural, or genetic similarities. Likewise, homologous or similar ketoacid dehydrogenase genes and / or homologous or similar ketoacid dehydrogenase enzymes will have functional, structural, or genetic similarities.Identification of PDC and GPP in a Yeast Microorganism

[0310] Any method can be used to identify genes that encode for enzymes with pyruvate decarboxylase (PDC) activity or glycerol-3-phosphate dehydrogenase (GPD) activity. Suitable methods for the identification of PDC and GPD are described in commonly owned and co-pending publications, US 2009 / 0226991 and US 201 1 / 0020889, both of which are herein incorporated by reference in their entireties for all purposes..Genetic Insertions and Deletions

[0311] Any method can be used to introduce a nucleic acid molecule into yeast and many such methods are well known. For example, transformation and electroporation are common methods for introducing nucleic acid into yeast cells. See, e.g., Gietz et al„ 1992, Nuc Acids Res. 27: 69-74; Ito et al., 1983, J. Bacteriol. 153: 163-8; and Becker et al., 1991 , Methods in Enzymology 194: 182-7.

[0312] In an embodiment, the integration of a gene of interest into a DNA fragment or target gene of a yeast microorganism occurs according to the principle of homologous recombination. According to this embodiment, an integration cassette containing a module comprising at least one yeast marker gene and / or the gene to be integrated (internal module) is flanked on either side by DNA fragments homologous to those of the ends of the targeted integration site (recombinogenic sequences). After transforming the yeast with the cassette by appropriate methods, a homologous recombination between the recombinogenic sequences may result in the internal module replacing the chromosomal region in between the two sites of the genome corresponding to the recombinogenic sequences of the integration cassette. (Orr-Weaver et al., 1981 , PNAS USA 78: 6354-58).

[0313] In an embodiment, the integration cassette for integration of a gene of interest into a yeast microorganism includes the heterologous gene under the control of an appropriate promoter and terminator together with the selectable marker flanked by recombinogenic sequences for integration of a heterologous gene into the yeast chromosome. In an embodiment, the heterologous gene includes an appropriate native gene desired to increase the copy number of a native gene(s). The selectable marker gene can be any marker gene used in yeast, including but not limited to, HIS3, TRP1, LEU2, URA3, bar, ble, hph, and kan. The recombinogenic sequences can be chosen at will, depending on the desired integration site suitable for the desired application.

[0314] In another embodiment, integration of a gene into the chromosome of the yeast microorganism may occur via random integration (Kooistra et al., 2004, Yeast 21 : 781 -792).

[0315] Additionally, in an embodiment, certain introduced marker genes are removed from the genome using techniques well known to those skilled in the art. For example, URA3 marker loss can be obtained by plating URA3 containing cells in FOA (5-fluoro-orotic acid) containing medium and selecting for FOA resistant colonies (Boeke et al., 1984, Mol. Gen. Genet 197: 345-47).

[0316] The exogenous nucleic acid molecule contained within a yeast cell of the disclosure can be maintained within that cell in any form. For example, exogenous nucleic acid molecules can be integrated into the genome of the cell or maintained in an episomal state that can stably be passed on ("inherited") to daughter cells. Such extra-chromosomal genetic elements (such as plasmids, mitochondrial genome, etc.) can additionally contain selection markers that ensure the presence of such genetic elements in daughter cells. Moreover, the yeast cells can be stably or transiently transformed. In addition, the yeast cells described herein can contain a single copy, or multiple copies of a particular exogenous nucleic acid molecule as described above.Reduction of Enzymatic Activity

[0317] Yeast microorganisms within the scope of the invention may have reduced enzymatic activity such as reduced 3-ketoacid reductase, PDC, ALDH, or glycerol-3- phosphate dehydrogenase (GPD) activity. The term "reduced" as used herein with respect to a particular enzymatic activity refers to a lower level of enzymatic activity than that measured in a comparable yeast cell of the same species. The term reduced also refers to the elimination of enzymatic activity as compared to a comparable yeast cell of the same species. Thus, yeast cells lacking 3-ketoacid reductase, PDC, ALDH or glycerol-3-phosphate dehydrogenase (GPD) activity are considered to have reduced 3-ketoacid reductase, PDC, ALDH or glycerol-3- phosphate dehydrogenase (GPD) activity since most, if not all, comparable yeast strains have at least some 3-ketoacid reductase, PDC, ALDH, or glycerol-3- phosphate dehydrogenase (GPD) activity. Such reduced enzymatic activities can be the result of lower enzyme concentration, lower specific activity of an enzyme, or a combination thereof. Many different methods can be used to make yeast havingreduced enzymatic activity. For example, a yeast cell can be engineered to have a disrupted enzyme-encoding locus using common mutagenesis or knock-out technology. See, e.g. , Methods in Yeast Genetics (1997 edition), Adams, Gottschling, Kaiser, and Stems, Cold Spring Harbor Press (1998). In addition, certain point-mutation(s) can be introduced which results in an enzyme with reduced activity. Also included within the scope of this invention are yeast strains which when found in nature, are substantially free of one or more activities selected from 3- ketoacid reductase, PDC, ALDH, or glycerol-3-phosphate dehydrogenase (GPD) activity.

[0318] Alternatively, antisense technology can be used to reduce enzymatic activity. For example, yeast can be engineered to contain a cDNA that encodes an antisense molecule that prevents an enzyme from being made. The term "antisense molecule" as used herein encompasses any nucleic acid molecule that contains sequences that correspond to the coding strand of an endogenous polypeptide. An antisense molecule also can have flanking sequences (e.g. , regulatory sequences). Thus antisense molecules can be ribozymes or antisense oligonucleotides. A ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axhead structures, provided the molecule cleaves RNA.

[0319] Yeast having a reduced enzymatic activity can be identified using many methods. For example, yeast having reduced 3-ketoacid reductase, PDC, ALDH, or glycerol-3-phosphate dehydrogenase (GPD) activity can be easily identified using common methods, which may include, for example, measuring glycerol formation via liquid chromatography.Overexpression of Heterologous Genes

[0320] Methods for overexpressing a polypeptide from a native or heterologous nucleic acid molecule are well known. Such methods include, without limitation, constructing a nucleic acid sequence such that a regulatory element promotes the expression of a nucleic acid sequence that encodes the desired polypeptide. Typically, regulatory elements are DNA sequences that regulate the expression of other DNA sequences at the level of transcription. Thus, regulatory elements include, without limitation, promoters, enhancers, and the like. For example, the exogenous genes can be under the control of an inducible promoter or a constitutive promoter. Moreover, methods for expressing a polypeptide from an exogenousnucleic acid molecule in yeast are well known. For example, nucleic acid constructs that are used for the expression of exogenous polypeptides within Kluyveromyces and Saccharomyces are well known (see, e.g., U.S. Pat. Nos. 4,859,596 and 4,943,529, for Kluyveromyces and, e.g., Gellissen et ai, Gene 190(1 ):87-97 (1997) for Saccharomyces). Yeast plasmids have a selectable marker and an origin of replication. In addition certain plasmids may also contain a centromeric sequence. These centromeric plasmids are generally a single or low copy plasmid. Plasmids without a centromeric sequence and utilizing either a 2 micron (S. cerevisiae) or 1 .6 micron (K. lactis) replication origin are high copy plasmids. The selectable marker can be either prototrophic, such as HIS3, TRP1, LEU2, URA3 or ADE2, or antibiotic resistance, such as, bar, ble, hph, or kan.

[0321] In another embodiment, heterologous control elements can be used to activate or repress expression of endogenous genes. Additionally, when expression is to be repressed or eliminated, the gene for the relevant enzyme, protein or RNA can be eliminated by known deletion techniques.

[0322] As described herein, any yeast within the scope of the disclosure can be identified by selection techniques specific to the particular enzyme being expressed, over-expressed or repressed. Methods of identifying the strains with the desired phenotype are well known to those skilled in the art. Such methods include, without limitation, PCR, RT-PCR, and nucleic acid hybridization techniques such as Northern and Southern analysis, altered growth capabilities on a particular substrate or in the presence of a particular substrate, a chemical compound, a selection agent and the like. In some cases, immunohistochemistry and biochemical techniques can be used to determine if a cell contains a particular nucleic acid by detecting the expression of the encoded polypeptide. For example, an antibody having specificity for an encoded enzyme can be used to determine whether or not a particular yeast cell contains that encoded enzyme. Further, biochemical techniques can be used to determine if a cell contains a particular nucleic acid molecule encoding an enzymatic polypeptide by detecting a product produced as a result of the expression of the enzymatic polypeptide. For example, transforming a cell with a vector encoding acetolactate synthase and detecting increased acetolactate concentrations compared to a cell without the vector indicates that the vector is both present and that the gene product is active. Methods for detecting specific enzymatic activities or the presence of particular products are well known to those skilled in the art. Forexample, the presence of acetolactate can be determined as described by Hugenholtz and Starrenburg, 1992, Appl. Micro. Biot. 38:17-22.Increase of Enzymatic Activity

[0323] Yeast microorganisms of the invention may be further engineered to have increased activity of enzymes (e.g., increased activity of enzymes involved in an isobutanol producing metabolic pathway). The term "increased" as used herein with respect to a particular enzymatic activity refers to a higher level of enzymatic activity than that measured in a comparable yeast cell of the same species. For example, overexpression of a specific enzyme can lead to an increased level of activity in the cells for that enzyme. Increased activities for enzymes involved in glycolysis or the isobutanol pathway would result in increased productivity and yield of isobutanol.

[0324] Methods to increase enzymatic activity are known to those skilled in the art. Such techniques may include increasing the expression of the enzyme by increased copy number and / or use of a strong promoter, introduction of mutations to relieve negative regulation of the enzyme, introduction of specific mutations to increase specific activity and / or decrease the Km for the substrate, or by directed evolution. See, e.g., Methods in Molecular Biology (vol. 231 ), ed. Arnold and Georgiou, Humana Press (2003).Methods of Using Recombinant Microorganisms for High-Yield Fermentations

[0325] For a biocatalyst to produce a beneficial metabolite most economically, it is desirable to produce said metabolite at a high yield. Preferably, the only product produced is the desired metabolite, as extra products (i.e. by-products) lead to a reduction in the yield of the desired metabolite and an increase in capital and operating costs, particularly if the extra products have little or no value. These extra products also require additional capital and operating costs to separate these products from the desired metabolite.

[0326] In one aspect, the present invention provides a method of producing a beneficial metabolite derived from a recombinant microorganism comprising a biosynthetic pathway.

[0327] In one embodiment, the method includes cultivating a recombinant microorganism comprising a biosynthetic pathway which uses a 3-ketoacid as an intermediate in a culture medium containing a feedstock providing the carbon sourceuntil a recoverable quantity of the beneficial metabolite is produced and optionally, recovering the metabolite. In one embodiment, the 3-ketoacid intermediate is acetolactate. In an exemplary embodiment, said recombinant microorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of acetolactate to DH2MB. The beneficial metabolite may be derived from any biosynthetic pathway which uses acetolactate as intermediate, including, but not limited to, biosynthetic pathways for the production of isobutanol, 2-butanol, 1 -butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, valine, leucine, pantothenic acid, isobutylene, 3-methyl-1 -butanol, 4-methyl-1 -pentanol, and coenzyme A. In a specific embodiment, the beneficial metabolite is isobutanol. In another embodiment, the 3-ketoacid intermediate is 2-aceto-2-hydroxybutyrate. In an exemplary embodiment, said recombinant microorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of 2- aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutyrate. The beneficial metabolite may be derived from any biosynthetic pathway which uses 2-aceto-2- hydroxybutyrate as intermediate, including, but not limited to, biosynthetic pathways for the production of 2-methyl-1 -butanol, isoleucine, 3-methyl-1 -pentanol, 4-methyl-1 - hexanol, and 5-methyl-1 -heptanol.

[0328] In another embodiment, the method includes cultivating a recombinant microorganism comprising a biosynthetic pathway which uses an aldehyde as an intermediate in a culture medium containing a feedstock providing the carbon source until a recoverable quantity of the beneficial metabolite is produced and optionally, recovering the metabolite. In an exemplary embodiment, said recombinant microorganism is engineered to reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of an aldehyde to acid by-product. The beneficial metabolite may be derived from any biosynthetic pathway which uses an aldehyde as intermediate, including, but not limited to, biosynthetic pathways for the production of isobutanol, 1 -butanol, 2-methyl-l-butanol, 3-methyl-1 -butanol, 1 - propanol, 1 -pentanol, 1 -hexanol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, 4- methyl-1 -hexanol, and 5-methyl-1 -heptanol. In a specific embodiment, the beneficial metabolite is isobutanol.

[0329] In another embodiment, the method includes cultivating a recombinant microorganism comprising a biosynthetic pathway which uses acetolactate and an aldehyde as intermediates in a culture medium containing a feedstock providing thecarbon source until a recoverable quantity of the beneficial metabolite is produced and optionally, recovering the metabolite. In an exemplary embodiment, said recombinant microorganism is engineered to (i) reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of acetolactate to DH2MB and (ii) reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of an aldehyde to acid by-product. The beneficial metabolite may be derived from any biosynthetic pathway which uses acetolactate and an aldehyde as intermediate, including, but not limited to, biosynthetic pathways for the production of isobutanol, 1 -butanol, and 3-methyl-1-butanol. In a specific embodiment, the beneficial metabolite is isobutanol.

[0330] In another embodiment, the method includes cultivating a recombinant microorganism comprising a biosynthetic pathway which uses 2-aceto-2- hydroxybutyrate and an aldehyde as intermediates in a culture medium containing a feedstock providing the carbon source until a recoverable quantity of the beneficial metabolite is produced and optionally, recovering the metabolite. In an exemplary embodiment, said recombinant microorganism is engineered to (i) reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of 2- aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutyrate and (ii) reduce or eliminate the expression or activity of an enzyme catalyzing the conversion of an aldehyde to acid by-product. The beneficial metabolite may be derived from any biosynthetic pathway which uses 2-aceto-2-hydroxybutyrate and an aldehyde as intermediate, including, but not limited to, biosynthetic pathways for the production of 2-methyl-1 - butanol, 3-methyl-1-pentanol, 4-methyl-l-hexanol, and 5-methyl-1 -heptanol.

[0331] In another embodiment, the present invention provides a method of producing a beneficial metabolite derived from an alcohol dehydrogenase (ADH)- requiring biosynthetic pathway. In one embodiment, the method includes cultivating a recombinant microorganism comprising a modified ADH described herein in a culture medium containing a feedstock providing the carbon source until a recoverable quantity of the beneficial metabolite is produced and optionally, recovering the metabolite. The beneficial metabolite may be derived from any ADH- requiring biosynthetic pathway, including, but not limited to, biosynthetic pathways for the production of 1 -propanol, 2-propanol, 1 -butanol, 2-butanol, 1 -pentanol, 2-methyl- 1 -butanol, and 3-methyl-1 -butanol. In a specific embodiment, the beneficial metabolite is isobutanol.

[0332] In a method to produce a beneficial metabolite from a carbon source, the yeast microorganism is cultured in an appropriate culture medium containing a carbon source. In certain embodiments, the method further includes isolating the beneficial metabolite from the culture medium. For example, isobutanol may be isolated from the culture medium by any method known to those skilled in the art, such as distillation, pervaporation, or liquid-liquid extraction.

[0333] In one embodiment, the recombinant microorganism may produce the beneficial metabolite from a carbon source at a yield of at least 5 percent theoretical. In another embodiment, the microorganism may produce the beneficial metabolite from a carbon source at a yield of at least about 10 percent, at least about 15 percent, about least about 20 percent, at least about 25 percent, at least about 30 percent, at least about 35 percent, at least about 40 percent, at least about 45 percent, at least about 50 percent, at least about 55 percent, at least about 60 percent, at least about 65 percent, at least about 70 percent, at least about 75 percent, at least about 80 percent, at least about 85 percent, at least about 90 percent, at least about 95 percent, or at least about 97.5% theoretical. In a specific embodiment, the beneficial metabolite is isobutanol.

[0334] This invention is further illustrated by the following examples that should not be construed as limiting. The contents of all references, patents, and published patent applications cited throughout this application, as well as the Figures and the Sequence Listing, are incorporated herein by reference for all purposes.EXAMPLESGeneral Methods for Examples 1-26

[0335] Sequences: Amino acid and nucleotide sequences disclosed herein are shown in Table 6.Table 6. Amino Acid and Nucleotide Sequences of Enzymes and Genes Disclosed in Various Examples.D.Dm_ADH (SEQ ID NO: 54) Dm_Adh (SEQ ID NO: 55) melanogasterADH L. lactis Ll^adhA (SEQ ID NO: 56) LLAdhA (SEQ ID NO: 57)L. lactis LI_adhA_coSchise(SEQ ID NO: 58) LI_AdhAhis6(SEQ ID NO: 59)L. lactis LI_adhARE1_coSchis6(SEQ ID NO: 60) LI_AdhARE1"his6(SEQ ID NO: 61 )

[0336] Media: Medium used was standard yeast medium (see, for example Sambrook, J., Russel, D.W. Molecular Cloning, A Laboratory Manual. 3rd ed. 2001 , Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press and Guthrie, C. and Fink, G.R. eds. Methods in Enzymology Part B: Guide to Yeast Genetics and Molecular and Cell Biology 350:3-623 (2002)). YP medium contains 1 % (w / v) yeast extract, 2% (w / v) peptone. YPD is YP containing 2% glucose unless specified otherwise. YPE is YP containing 25 mL / L ethanol. SC medium is 6.7 g / L Difco™ Yeast Nitrogen Base, 14g / L Sigma™ Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), 0.076 g / L histidine, 0.076 g / L tryptophan, 0.380 g / L leucine, and 0.076 g / L uracil. SCD is SC containing 2% (w / v) glucose unless otherwise noted. Drop-out versions of SC and SCD media are made by omitting one or more of histidine (-H), tryptophan (-W), leucine (-L), or uracil (-U). Solid versions of the above described media contain 2% (w / v) agar.

[0337] Cloning techniques: Standard molecular biology methods for cloning and plasmid construction were generally used, unless otherwise noted (Sambrook, J., Russel, D.W. Molecular Cloning, A Laboratory Manual. 3 ed. 2001 , Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press). Cloning techniques included digestion with restriction enzymes, PCR to generate DNA fragments (KOD Hot Start Polymerase, Cat# 71086, Merck, Darmstadt, Germany), ligations of two DNA fragments using the DNA Ligation Kit (Mighty Mix Cat# TAK 6023, Clontech Laboratories, Madison, Wl), and bacterial transformations into competent E.coli cells (Xtreme Efficiency DH5a Competent Cells, Cat# ABP-CE-CC02096P, Allele Biotechnology, San Diego, CA). Plasmid DNA was purified from E. coli cells using the Qiagen QIAprep Spin Miniprep Kit (Cat# 27106, Qiagen, Valencia, CA). DNA was purified from agarose gels using the Zymoclean Gel DNA Recovery Kit (Zymo Research, Orange, CA; Catalog #D4002) according to manufacturer's protocols.

[0338] Colony PCR: Yeast colony PCR used the FailSafe™ PCR System (EPICENTRE® Biotechnologies, Madison, Wl; Catalog #FS99250) according tomanufacturer's protocols. A PCR cocktail containing 15 pL of Master Mix E buffer, 10.5 pL water, 2 pL of each primer at 10 pM concentration, 0.5 pL polymerase enzyme mix from the kit was added to a 0.2 mL PCR tube for each sample (30 pL each). For each candidate a small amount of cells was added to the reaction tube using a sterile pipette tip. Presence of the positive PCR product was assessed using agarose gel electrophoresis.

[0339] SOE PCR: The PCR reactions were incubated in a thermocycler using the following PCR conditions: 1 cycle of 94°C x 2 min, 35 cycles of 94°C x 30 s, 53°C x 30 s, 72°C x 2 min and 1 cycle of 72°C x 10 min. A master mix was made such that each reaction contained the following: 3 pL MgS04(25 mM), 5 pL 10X KOD buffer, 5 pL 50% DMSO, 5 pL dNTP mix (2 mM each), 1 pL KOD, 28 pL dH2O, 1 .5 pL forward primer (10 pM), 1 .5 pL reverse primer (10 pM), 0.5 pL template (plasmid or genomic DNA).

[0340] Genomic DNA Isolation: The Zymo Research ZR Fungal / Bacterial DNA Kit (Zymo Research Orange, CA; Catalog #D6005) was used for genomic DNA isolation according to manufacturer's protocols with the following modifications. Following resuspension of pellets, 200 pL was transferred to 2 separate ZR BashingBead™ Lysis Tubes (to maximize yield). Following lysis by bead beating, 400 pL of supernatant from each of the ZR BashingBead™ Lysis Tubes was transferred to 2 separate Zymo-Spin™ IV Spin Filters and centrifuged at 7,000 rpm for 1 min. Following the spin, 1 .2 mL of Fungal / Bacterial DNA Binding Buffer was added to each filtrate. In 800 pi aliquots, filtrate from both filters was transferred to a single Zymo-Spin™ IIC Column in a collection tube and centrifuged at 10,000 x g for 1 min. For the elution step, instead of eluting in 100 pL of EB (elution buffer, Qiagen), 50 pL of EB was added, incubated 1 min then the columns were centrifuged for 1 min. This elution step was repeated for a final elution volume of 100 pL.

[0341] S. cerevisiae Transformations. S. cerevisiae strains were grown in YPD containing 1 % ethanol. Transformation-competent cells were prepared by resuspension of S. cerevisiae cells in 100 mM lithium acetate. Once the cells were prepared, a mixture of DNA (final volume of 15 pL with sterile water), 72 pL 50% PEG, 10 pL 1 M lithium acetate, and 3 pL of denatured salmon sperm DNA (10 mg / mL) was prepared for each transformation. In a 1 .5 mL tube, 15 pL of the cell suspension was added to the DNA mixture (100 pL), and the transformation suspension was vortexed for 5 short pulses. The transformation was incubated for30 min at 30°C, followed by incubation for 22 min at 42°C. The cells were collected by centrifugation (18,000 x g, 10 seconds, 25°C). The cells were resuspended in 350 μΙ_ YPD and after an overnight recovery shaking at 30°C and 250 rpm, the cells were spread over YPD plates containing 0.2 g / L G418 selective plates. Transformants were then single colony purified onto G418 selective plates.

[0342] K. marxianus transformations: K. marxianus strains were grown in 3 mL of an appropriate culture medium at 250 rpm and 30°C overnight. The following day, cultures were diluted in 50 mL of the same medium and grown to an OD6oo of between 1 and 4. The cells were collected in a sterile 50 mL conical tube by centrifugation (1600 x g, 5 min at room temperature). The cells were resuspended in 10 mL of electroporation buffer (10 mM Tris-C1 , 270 mM sucrose, 1 mM MgCI2, pH 7.5), and collected at 1600 x g for 5 min at room temperature. The cells were resuspended in 10 mL IB (YPE, 25 mM DTT, 20 mM HEPES, pH 8.0; prepared fresh by diluting 100 pL of 2.5 M DTT and 200 pL of 1 M HEPES, pH 8.0 into 10 mL of YPD). The cells were incubated for 30 min, 250 rpm, 30°C (tube standing vertical). The cells were collected at 1600 x g for 5 min at room temperature and resuspended in 10 mL of chilled electroporation buffer. The cells were pelleted at 1600 x g for 5 min at 4°C. The cells were resuspended in 1 mL of chilled electroporation buffer and transferred to a microfuge tube. The cells were collected by centrifugation at >10,000 x g for 20 sec at 4°C. The cells were resuspended in appropriate amount of chilled electroporation buffer for a final biomass concentration of 30-38 OD6oo / mL. 400 pL of cells was added to a chilled electroporation cuvette (0.4 cm gap), 50 pL of SOE PCR product (or water control) was added and mixed by pipetting up and down, and the cuvette was incubated on ice for 30 min. The samples were electroporated at 1.8 kV, 1000 Ohm, 25 pF. The samples were then transferred to a 50 mL tube with 1 mL of an appropriate culture medium, and the samples were incubated for overnight at 250 rpm at 30°C. After incubation the cells were plated onto appropriate agar plates.

[0343] K. lactis transformations: K. lactis strains were grown in 3 mL YPD at 250 rpm and 30°C overnight. The following day, cultures were diluted in 50 mL YPD and allowed to grow until they reached an OD6oo of -0.8. Cells from 50 mL YPD cultures were collected by centrifugation (2700 rcf, 2 min, 25°C). The cells were washed with 50 mL sterile water and collected by centrifugation at 2700 rcf for 2 min at RT. The cells were washed again with 25 mL sterile water and collected by centrifugation at 2700 rcf for 2 min at RT. The cells were resuspended in 1 mL 100mM lithium acetate and transferred to a 1.5 mL Eppendorf tube. The cells were collected by centrifugation for 10 sec at 18,000 rcf at RT. The cells were resuspended in a volume of 100 mM lithium acetate that was approximately 4x the volume of the cell pellet. A volume of 10-15 μΙ_ of DNA, 72 μΙ_ 50% PEG (3350), 10 μΐ_ 1 M lithium acetate, 3 pl_ denatured salmon sperm DNA, and sterile water were combined to a final volume of 100 μΙ_ for each transformation. In a 1 .5 mL tube, 15 μΙ_ of the cell suspension was added to the DNA mixture and the transformation suspension was vortexed with 5 short pulses. The transformation was incubated for 30 min at 30°C, followed by incubation for 22 min at 42°C. The cells were collected by centrifugation for 10 sec at 18,000 rcf at RT. The cells were resuspended in 400 μΙ_ of an appropriate medium and spread over agar plates containing an appropriate medium to select for transformed cells.Analytical Chemistry:

[0344] Gas Chromatography (method GC1). Analysis of volatile organic compounds, including ethanol and isobutanol was performed on a Agilent 5890 / 6890 / 7890 gas chromatograph fitted with an Agilent 7673 Autosampler, a ZB- FFAP column (J&W; 30 m length, 0.32 mm ID, 0.25 μΜ film thickness) or equivalent connected to a flame ionization detector (FID). The temperature program was as follows: 200°C for the injector, 300°C for the detector, 100°C oven for 1 minute, 70°C / minute gradient to 230°C, and then hold for 2.5 min. Analysis was performed using authentic standards (>99%, obtained from Sigma-Aldrich, and a 5-point calibration curve with 1 -pentanol as the internal standard.

[0345] High Performance Liquid Chromatography (method LC1): Analysis of organic acid metabolites including 2,3-dihydroxyisovalerate (DHIV), 2,3-dihydroxy-2- methylbutanoic acid (DH2MB), isobutyrate and glucose was performed on an Agilent 1200 or equivalent High Performance Liquid Chromatography system equipped with a Bio-Rad Micro-guard Cation H Cartridge and two Phenomenex Rezex RFQ-Fast Fruit H+ (8%), 100 x 7.8-mm columns in series, or equivalent. Organic acid metabolites were detected using an Agilent 1100 or equivalent UV detector (210 nm) and a refractive index detector. The column temperature was 60°C. This method was isocratic with 0.0180 N H2SO4in Milli-Q water as mobile phase. Flow was set to 1 .1 mL / min. Injection volume was 20 pL and run time was 16 min. Quantitation of organic acid metabolites was performed using a 5-point calibration curve withauthentic standards (>99% or highest purity available), with the exception of DHIV (2,3-dihidroxy-3-methyl-butanoate, CAS 1756-18-9), which was synthesized according to Cioffi et al. (Cioffi, E. et al. Anal Biochem 1980, 104, pp.485) and DH2MB which quantified based on the assumption that DHIV and DH2MB exhibit the same response factor. In this method, DHIV and DH2MB co-elute, hence their concentrations are reported as the sum of the two concentrations.

[0346] High Performance Liquid Chromatography (method LC4): Analysis of oxo acids, including 2,3-dihydroxyisovalerate (DHIV, CAS 1756-18-9), 2,3-dihydroxy- 2-methylbutyrate acid (DH2MB), lactate, acetate, acetolactate, isobutyrate, and pyruvate) was performed on a Agilent-1 100 High Performance Liquid Chromatography system equipped with an lonPac AS1 1 -HC Analytical column (Dionex: 9 pm, 4.6 x 250 mm) coupled with an lonPac AG1 1 -HC guard column (Dionex: 13 pm, 4.6 x 50 mm) and an lonPac ATC-3 Anion Trap column (Dionex: 9 x 24 mm). Acetolactate was detected using a UV detector at 225nm, while all other analytes were detected using a conductivity detector (ED50-suppressed conductivity with ASRS 4 mm in AutoSuppression recycle mode, 200 mA suppressor current). The column temperature was 35°C. Injection size was 10 pL. This method used the following elution profile: 0.25 mM NaOH for 3 min, followed by a linear gradient from 0.25 to 5 mM NaOH in 22 min and a second linear gradient from 5 mM to 38.25 mM in 0.1 min, followed by 38.25 mM NaOH for 4.9 min and a final linear gradient from 38.25 mM to 0.25 mM for 0.1 min before re-equilibrating at 0.25 mM NaOH for 7 min. Flow was set at 2 mL / min. Analysis was performed using a 4-point calibration curve with authentic standards (>99%, or highest purity available), with the following exceptions: DHIV was synthesized according to Cioffi et al. (Cioffi, E. et al. Anal Biochem 1980, 104, pp.485). DH2MB was synthesized as described in Example 8 and quantified based on the assumption that DHIV and DH2MB exhibit the same response factor. Racemic acetolactate was made by hydrolysis of Ethyl-2-acetoxy-2- methylacetoacetate (EAMMA) with NaOH (Krampitz, L.O. Methods in Enzymology 1957, 3, 277-283.). In this method, DHIV and DH2MB are separated (Figure 8).Enzyme Assays

[0347] Determination of protein concentration: Protein concentration (of yeast lysate or of purified protein) was determined using the BioRad Bradford Protein Assay Reagent Kit (Cat# 500-0006, BioRad Laboratories, Hercules, CA) and usingBSA for the standard curve. A standard curve for the assay was made using a dilution series of a standard protein stock of 500 pg / mL BSA. An appropriate dilution of cell lysate was made in water to obtain Οϋ595measurements of each lysate that fell within linear range of the BioRad protein standard curve. Ten μΙ_ of the lysate dilution was added to 500 μΙ_ of diluted BioRad protein assay dye, samples were mixed by vortexing, and incubated at room temperature for 6 min. Samples were transferred to cuvettes and read at 595 nm in a spectrophotometer. The linear regression of the standards was used to calculate the protein concentration of each sample.

[0348] Alcohol Dehydrogenase (ADH) Assay. Cells were thawed on ice and resuspended in lysis buffer (100 mM Tris-HCI pH 7.5). 1000 μΙ_ of glass beads (0.5 mm diameter) were added to a 1 .5 mi_ Eppendorf tube and 875 μί_ of cell suspension was added. Yeast cells were lysed using a Retsch MM301 mixer mill (Retsch Inc. Newtown, PA), mixing 6 X 1 min each at full speed with 1 min incubations on ice between each bead-beating step. The tubes were centrifuged for 10 min at 23,500xg at 4°C and the supernatant was removed for use. These lysates were held on ice until assayed. Yeast lysate protein concentrations were determined as described.

[0349] Dilutions of the samples were made such that an activity reading could be obtained. Generally the samples from strains expected to have low ADH activity were diluted 1 :5 in lysis buffer (100 mM Tris-HCI pH 7.5) and the samples from strains with expected high ADH activity such as strains where the ADH gene is expressed from a high copy number plasmid were diluted 1 :40 to 1 :100. Reactions were performed in triplicate using 10 pL of appropriately diluted cell extract with 90 pL of reaction buffer (100 mM Tris-HCI, pH 7.5; 150 μΜ NADH; 1 1 mM isobutyraldehyde) in a 96-well plate in a SpectraMax®340PC multi-plate reader (Molecular Devices, Sunnyvale, CA). The reaction was followed at 340nm for 5 minutes, with absorbance readings every 10 seconds. The reactions were performed at 30°C. The reactions were performed in complete buffer and also in buffer with no substrate.

[0350] Isobutyraldehyde Oxidation Assay (ALD6 assay): Cell pellets were thawed on ice and resuspended in lysis buffer (10 mM sodium phosphate pH7.0, 1 mM dithiothreitol, 5% w / v glycerol). One ml_ of glass beads (0.5 mm diameter) was added to a 1.5 ml_ Eppendorf tube for each sample and 850 μΙ_ of cell suspension were added. Yeast cells were lysed using a Retsch MM301 mixer mill (Retsch Inc.Newtown, PA), mixing 6 X 1 min each at full speed with 1 min incubation on ice between. The tubes were centrifuged for 10 min at 21 ,500xg at 4°C and the supernatant was transferred to a fresh tube. Extracts were held on ice until assayed. Yeast lysate protein concentrations were determined as described.

[0351] The method used to measure enzyme activity of enzymes catalyzing the oxidation of isobutyraldehyde to isobutyrate in cell lysates was modified from Meaden et al. 1997, Yeast 13: 1319-1327 and Postma et al. 1988, Appl. Environ. Microbiol. 55: 468-477. Briefly, for each sample, 10 pL of undiluted cell lysate was added to 6 wells of a UV microtiter plate. Three wells received 90 μΙ_ assay buffer containing 50 mM HEPES-NaOH at pH 7.5, 0.4 mM NADP+, 3.75 mM MgCI2, and 0.1 mM, 1 mM, or 10 mM isobutyraldehyde. The other 3 wells received 90 μΙ_ of no substrate buffer (same as assay buffer but without isobutyraldehyde). The buffers were mixed with the lysate in the wells by pipetting up and down. The reactions were then monitored at 340 nm for 5 minutes, with absorbance readings taken every 10 seconds in a SpectraMax®340PC plate reader (Molecular Devices, Sunnyvale, CA). The reactions were performed at 30°C. The Vmaxfor each sample was determined by subtracting the background reading of the no substrate control. A no lysate control was also performed in triplicate for each substrate concentration.

[0352] ALS Assay: For ALS assays described in Examples 1 -18, cells were thawed on ice and resuspended in lysis buffer (50 mM potassium phosphate buffer pH 6.0 and 1 mM MgS04). 1000 pL of glass beads (0.5 mm diameter) were added to a 1.5 mL Eppendorf tube and 875 pl_ of cell suspension was added. Yeast cells were lysed using a Retsch MM301 mixer mill (Retsch Inc. Newtown, PA), mixing 6 X 1 min each at full speed with 1 min incubations on ice between each bead-beating step. The tubes were centrifuged for 10 min at 23,500xg at 4°C and the supernatant was removed for use. These lysates were held on ice until assayed. Protein content of the lysates was measured as described. All ALS assays were performed in triplicate for each lysate, both with and without substrate. To assay each lysate, 15 pL of lysate was mixed with 135 pL of buffer (50 mM potassium phosphate buffer pH 6.0, 1 mM MgSO4, 1 mM thiamin-pyrophosphate, 1 10 mM pyruvate), and incubated for 15 minutes at 30°C. Buffers were prepared at room temperature. A no substrate control (buffer without pyruvate) and a no lysate control (lysis buffer instead of lysate) were also included. After incubation 21 .5 pL of 35% H2S04was added to each reaction and incubated at 37°C for 1 h.

[0353] For ALS assays described in Examples 19-25, cells were thawed on ice and resuspended in lysis buffer (100 mM NaPO4pH 7.0, 5 mM MgCI2and 1 mM DTT). One mL of glass beads (0.5 mm diameter) were added to a 1 .5 mL Eppendorf tube and 800 pL of the cell suspension was added to the tube containing glass beads. Yeast cells were lysed using a Retsch MM301 mixer mill (Retsch Inc. Newtown, PA) and a cooling block by mixing six times for 1 min each at 30 cycles / second with 1 min icing in between mixing. The tubes were centrifuged for 10 min at 21 ,500xg at 4°C and the supernatant was removed. Extracts were held on ice until assayed. Yeast lysate protein concentration was determined using the BioRad Bradford Protein Assay Reagent Kit (Cat# 500-0006, BioRad Laboratories, Hercules, CA) and using BSA for the standard curve as described. All ALS assays were performed in triplicate for each lysate. All buffers, lysates and reaction tubes were pre-cooled on ice. To assay each lysate, 15 pL of lysate (diluted with lysis buffer as needed) was mixed with 135 pL of assay buffer (50 mM KPi, pH 7.0, 1 mM MgSO4, 1 mM thiamin-pyrophosphate, 0 mM pyruvate), and incubated for 5 min at 30°C. A no substrate control (buffer without pyruvate) and a no lysate control (lysis buffer instead of lysate) were also included. After incubation each reaction was mixed with 21 .5 pL of 35% H2SO4, incubated at 37°C for 1 h and centrifuged for 5 min at 5,000 x g to remove any insoluble precipitants.

[0354] All assay samples were analyzed for the assay substrate (pyruvate) and product (acetoin) via high performance liquid chromatography an HP-1200 High Performance Liquid Chromatography system equipped with two Restek RFQ 150 x 4.6 mm columns in series. Organic acid metabolites were detected using an HP- 1 100 UV detector (210 nm) and refractive index. The column temperature was 60°C. This method was isocratic with 0.0180 N H2SO4(in Milli-Q water) as mobile phase. Flow was set to 1.1 mL / min. Injection volume was 20 pL and run time was 8 min. Analysis was performed using authentic standards (>99%, obtained from Sigma- Aldrich) and a 5-point calibration curve.

[0355] TMA29 enzyme assay: Cell pellets were thawed on ice and resuspended in lysis buffer (10 mM sodium phosphate pH7.0, 1 mM dithiothreitol, 5% w / v glycerol). One mL of glass beads (0.5 mm diameter) was added to a 1.5 mL Eppendorf tube for each sample and 850 pL of cell suspension were added. Yeast cells were lysed using a Retsch MM301 mixer mill (Retsch Inc. Newtown, PA), mixing 6 X 1 min each at full speed with 1 min incubation on ice between. The tubeswere centrifuged for 10 min at 21 ,500 x g at 4°C and the supernatant was transferred to a fresh tube. Extracts were held on ice until assayed. Yeast lysate protein concentration was determined using the BioRad Bradford Protein Assay Reagent Kit (Cat# 500-0006, BioRad Laboratories, Hercules, CA) and using BSA for the standard curve as described.

[0356] Enzymatic synthesis of (S)-2-acetolactate ((S)-AL) was performed in an anaerobic flask The reaction was carried out in a total volume of 55 ml_ containing 20 mM potassium phosphate pH 7.0, 1 mM MgCI2, 0.05 mM thiamine pyrophosphate (TPP), and 200 mM sodium pyruvate. The synthesis was initiated by the addition of 65 units of purified B. subtilis AlsS, and the reaction was incubated at 30°C in a static incubator for 7.5 h.

[0357] Chemical synthesis of racemic 2-acetolactate ((R S)-2-AL) was performed by mixing 50 μΙ_ of ethyl-2-acetoxy-2-methylacetoacetate (EAMMA) with 990 μΙ_ of water. 260 pl_ of 2 N NaOH was then added in 10 pL increments with 15 seconds of vortexing after each addition. The solution was then mixed on an orbital shaker for 20 minutes.

[0358] Chemical synthesis of racemic AHB (( ? / S)-AHB) was performed by mixing 50 μΙ_ of ethyl-2-acetoxy-2-ethyl-3-oxobutanoate with 990 μΙ_ of water. 2 N NaOH was then added in 10 μΙ_ increments with 15 seconds of vortexing after each addition. The NaOH was added until the pH of the solution was 12 (-180 pL of 2 N NaOH). The solution was then mixed on an orbital shaker for 20 minutes.

[0359] For determination of (S)-AL, (R / S)-AL or (ft / S)-AHB reduction activity, 10 μΐ_ of undiluted cell lysate was added to 6 wells of a UV microtiter plate. Three wells received 90 μΙ_ assay buffer containing 100 mM KPO4at pH 7.0, 150 μΜ NADPH, and 5 mM (S)-AL or 10 mM (R / S)-AL or 10 mM (R / S)-A B as substrate. The other 3 wells received 90 μί. of assay buffer but without substrate. The buffers were mixed with the lysate in the wells by pipetting up and down. The reactions were then monitored at 340 nm, with absorbance readings taken every 10 seconds in a SpectraMax® 340PC plate reader (Molecular Devices, Sunnyvale, CA). The reactions were performed at 30°C. The (S)-AL, (R / S)-AL or (R / S)-AHB reduction activity for each sample was determined by subtracting the background reading of the no substrate control. A no lysate control was also performed in triplicate.

[0360] DHAD Enzyme Assay: Cell pellets were thawed on ice and resuspended in lysis buffer (50 mM Tris pH 8.0, 5 mM MgSO , and G Biosciences Yeast / FungalProteaseArrest™ (St. Louis, MO, USA, Catalog #788-333)). One ml_ of glass beads (0.5 mm diameter) was added to a 1 .5 ml_ Eppendorf tube for each sample and 850 μΙ_ of cell suspension were added. Yeast cells were lysed using a Retsch MM301 mixer mill (Retsch Inc. Newtown, PA), mixing 6 X 1 min each at full speed with 1 min incubation on ice between. The tubes were centrifuged for 10 min at 21 ,500 x g at 4°C and the supernatant was transferred to a fresh tube. Extracts were held on ice until assayed. Yeast lysate protein concentration was determined as described. Protein from each sample was diluted in DHAD assay buffer (50 mM Tris pH8, 5 mM MgSO4) to a final concentration of 0.5 pg / pL. Three samples of each lysate were assayed, along with no lysate controls. 10 pL of each sample (or DHAD assay buffer) was added to 0.2 ml_ PCR tubes. Using a multi-channel pipette, 90 μΙ_ of the substrate was added to each tube (substrate mix was prepared by adding 4 ml_ DHAD assay buffer to 0.5 ml_ 100 mM DHIV). Samples were put in a thermocycler (Eppendorf Mastercycler) at 35°C for 30 min followed by a 5 min incubation at 95°C. Samples were cooled to 4°C on the thermocycler, then centrifuged at 3000xg for 5 minutes. Finally, 75 pL of supernatant was transferred to new PCR tubes and analyzed by HPLC as follows 100 μΙ_ DNPH reagent (12 mM 2,4 - Dinitrophenyl Hydrazine 10 mM Citric Acid pH 3.0 80% Acetonitrile 20% MilliQ H20) was added to 100 μΙ_ of each sample. Samples were incubated for 30 min at 70°C in a thermocycler (Eppendorf, Mastercycler). Analysis of keto-isovalerate and isobutyraldehyde was performed on an HP-1200 High Performance Liquid Chromatography system equipped with an Eclipse XDB C-18 reverse phase column (Agilent) and a C-18 reverse phase column guard (Phenomenex). Ketoisovalerate and isobutyraldehyde were detected using an HP-1 100 UV detector (210 nm). The column temperature was 50°C. This method was isocratic with 70% acetonitrile to water as mobile phase with 2.5% dilute phosphoric acid (4%). Flow was set to 3 mL / min. Injection size was 10 pL and run time is 2 min.Example 1 : Increased Isobutanol / lsobutyrate Ratio by Increasing ADH Activity in S. cerevisiae

[0361] The purpose of this example is to demonstrate that increased alcohol dehydrogenase activity results in an increased isobutanol yield, a decreased isobutyrate yield, and an increase in the ratio of isobutanol yield to isobutyrate yield.

[0362] Strains and plasmids disclosed in this example are shown in Tables 7 and8, respectively.Table 7. Genotype of Strains Disclosed in Example 1 .GEVO Number GenotypeS. cerevisiae, MATa ura3 Ieu2 his3 trplpdc1A::PCUpi:[Bs_alsS1_coSc:TcYci: PPGKI- LI_kivD2: PEN02: Sp_HIS5] pdc5A::[LEU2: bla: PJEF1: ILV3AN: PTDM: Ec_ilvC__coScQ110V]GEV02843pdc6A::[URA3: bla: PTEF1: LI__kivD2: PTDH3: Dm_ADH ]{evolved for C2 supplement-independence, glucose tolerance and faster growth}Table 8. Plasmids Disclosed in Example 1 .2μ on, bla, G418R

[0363] S. cerevisiae strain GEV02843, which expresses a single alcohol dehydrogenase (D. melanogaster ADH, Dm_ADH) from its chromosomal DNA was transformed with 2μ plasmids pGV201 1 carrying only the KARI and DHAD (Ec_ilvC_Q110V and LIJIvD_coSc, respectively) or pGV2485 carrying the KARI, DHAD and ADH (Ec_ilvC_Q110V, LIJIvD_coSc, and LI_adhA, respectively) as described.

[0364] To start fermentation cultures, small overnight cultures of the transformed strains were started in YPD medium containing 1 % ethanol and 0.2 g / L G418 and incubated overnight at 30°C and 250 rpm. Three biological replicates of each strain were tested. The next morning, the OD6oo of these cultures was determined and an appropriate amount used to inoculate 50 mL of the same medium in a 50 mL baffled flask to an OD60o of approximately 0.1 . These precultures were incubated at 30°C and 250 rpm overnight. When the cultures had reached an OD6oo of approximately 5- 6 they were centrifuged at 2700 rpm for 5 min at 25°C in 50 mL Falcon tubes. The cells from one 50 mL culture (one clone) were resuspended in YPD containing 8% glucose, 0.2 g / L G418, 1 % (v / v) ethanol (containing 3 g / L ergosterol and 132 g / L Tween-80), and buffered at pH 6.5 with 200 mM MES. The cultures were then transferred into 250 mL unbaffled flasks and incubated at 30°C and 75 rpm.

[0365] At the 72 h timepoint, samples from each fermentation flask were taken fordetermining OD600, ADH activity, and for analysis by GC1 and LC1 . To prepare samples for GC1 and LC1 analyis, an appropriate volume of cell culture was spun in a microcentrifuge for 10 minutes at maximum speed and the supernatant was removed for GC1 and LC1 analysis. Cell pellets were prepared for ADH assays by centrifuging 14 mL of culture medium at 3000 x g for 5 minutes at 4°C. The supernatant was removed and the cells washed in 3 mL cold, sterile water. The tubes were then centrifuged as per above for 2 minutes, the supernatant removed, and the tubes reweighed to determine total cell weight. The Falcon tubes were stored at -80°C. ADH assays were performed as described.

[0366] Table 9 shows the OD60o for each strain during the course of the fermentation. During the 72 h of this fermentation, the OD6oo of the strains were similar: they started at an OD6oo of around 7 and ended at an OD6oo of around 9. The in vitro ADH enzymatic activity of lysates from GEV02843 transformed with the two plasmids was measured for the 72 h timepoint. Table 9 shows the ADH activity in the lysates as measured in vitro. The strain carrying the plasmid with no ADH (pGV201 1 ) showed an activity of about 0.04 U / mg. The strain carrying the plasmid with the U_adhA gene, (pGV2485), had approximately 7-fold more ADH activity.Table 9. OD6oo and Alcohol Dehydrogenase Activity of Strain GEV02843Transformed with Plasmids pGV201 1 or pGV2485 After 72h of Fermentation.

[0367] Isobutanol and isobutyrate titers after 72 h of fermentation are shown in Table 10. The isobutanol titer in the strain with low ADH activity of 0.04 U / mg was significantly lower compared to the strain with high ADH activity of 0.29 U / mg. The isobutyrate titer in the strain with low ADH activity of 0.04 U / mg was significantly higher compared to the strain with high ADH activity of 0.29 U / mg. Table 6 also shows the yield for isobutyrate and isobutanol after 72 h of fermentation. The isobutanol yield in the strain with low ADH activity of 0.04 U / mg was significantly lower compared to the strain with high ADH activity of 0.29 U / mg. The isobutyrate yield in the strain with low ADH activity of 0.04 U / mg was significantly higher compared to the strain with high ADH activity of 0.29 U / mg.Table 10. Titers and Yields for Isobutanol and Isobutyrate in Strain GEV02843 Transformed with Plasmids pGV201 1 or pGV2485 After 72h of Fermentation.Example 2: Further Increased Isobutanol / lsobutyrate Ratio by Use of Variant ADH LI AdhARE1in S. cerevisiae

[0368] The purpose of this example is to demonstrate that expression of an alcohol dehydrogenase with increased kcat and decreased KMresults in a further increase in isobutanol yield, decrease in isobutyrate yield, and increase in the ratio of isobutanol yield to isobutyrate yield.Table 11. Genotype of Strains Disclosed in Example 2.

[0369] S. cerevisiae strain GEV02843, which expresses a single alcohol dehydrogenase (D. melanogaster ADH, Dm_ADH) from its chromosomal DNA was transformed with 2μ plasmids pGV2543 carrying KARI, DHAD, KIVD and his-tagged, codon-optimized wild-type ADH (Ec_ilvCQ110V, LIJIvD_coSc, and LI_adhA_coSchis6, respectively) or pGV2545 carrying KARI, DHAD, KIVD and his-tagged, codon-optimized mutant ADH (EcJvCQ110V, LIJivD_coSc, and LI_adhARE1_coSchis6, respectively). These strains were cultured and evaluated for ADH enzyme activity and the production of extracellular metabolites by GC1 and LC1 as described.

[0370] The kinetic parameters of the gene products of LI_adhA_coSchls6LI_adhARE1_coSchis6(LI_adhAhis6and LI_adhARE1-his6, respectively) are shown in Table 13.Table 13. Comparison of Kinetic Parameters of Wild-Type LI_adhAhls6with Modified LI_adhARE1Measured for Isobutyraldehyde with NADH as Cofactor.

[0371] Table 14 shows the OD6oo for each strain during the course of the fermentation. During the 72 h of this fermentation, the OD6oo of the strains were similar: they started at an OD6oo of around 6 and ended at an OD6oo of around 9. The in vitro ADH enzymatic activity of lysates from GEV02843 transformed with the two plasmids was measured for the 72 h timepoint. Table 14 shows the ADH activity in the lysates as measured in vitro as described above. The strain carrying the plasmid with LI_adhA_coSchis6(pGV2543) showed an activity of about 0.38 U / mg. The strain carrying the plasmid with the LI_adhARE1_coSchis6gene, (pGV2545), had approximately 7-fold more ADH activity.Table 14. OD60o, and Alcohol Dehydrogenase Activity of Strain GEV02843Transformed with Plasmids pGV2543 or pGV2545 After 72h of Fermentation.

[0372] Isobutanol and isobutyrate titers and yield after 72h of fermentation are shown in Table 1 5. The isobutanol titer and yield in the strain carrying pGV2543 was lower compared to the strain carrying pGV2545. The isobutyrate titer and yield in the strain carrying pGV2543 was significantly higher compared to the strain carrying pGV2545.Table 15. Titers and Yields for Isobutanol and Isobutyrate in Strain GEV02843 Transformed with Plasmids pGV2453 or pGV2485 After 72h of Fermentation.Example 3: Further Increased Isobutanol / lsobutyrate Ratio in S. cerevisiae by Expression of RE

[0373] The purpose of this example is to demonstrate that expression of an alcohol dehydrogenase with increased kcatand decreased KMresults in an increase in isobutanol yield and a decrease in isobutyrate yield in fermentations performed in fermenter vessels.

[0374] A fermentation was performed to compare performance of S. cerevisiae strains GEV03519 and GEV03523. Isobutanol and isobutyrate titers and yields were measured during the fermentation. GEV03519 carries a 2μ plasmid pGV2524 that contains genes encoding the following enzymes: KARI, DHAD, KIVD and his- tagged, codon-optimized wild-type Lactococcus lactis ADH. GEV03523 carries a 2μ plasmid pGV2524 that contains genes encoding the following enzymes: KARI, DHAD, KIVD and an improved variant of the his-tagged, codon-optimized Lactococcus lactis ADH having decreased KMand increased kcat. These strains were evaluated for isobutanol, isobutyraldehyde, glucose consumption by LC1 and GC1 , as well as for OD6oo during a fermentation in DasGip fermenter vessels.Table 16. Genotype of Strains Disclosed in Exam2μ οή, bla, G418R

[0375] S. cerevisiae strain GEVO3128 was transformed with either 2μ plasmid pGV2524 or pGV2546, to generate strains GEV03519 and GEV03523, respectively as described. Inoculum cultures of GEV03519 and GEV03523 were started by inoculating 500 ml_ baffled flasks containing 80 ml_ of YPD medium 0.2g / L G418 antibiotic, 1 % v / v ethanol, and 0.019 g / L tryptophan. The cultures were incubated for approximately 34 h. The orbital shaker was set at 250 rpm and 30°C in both experiments. Similar cell mass was achieved for GEV03519 and GEV03523 strains. The cell density achieved after incubation was 8.0 OD6oo- Batch fermentations were conducted in YPD medium containing 80 g / L glucose, 0.2 g / L G418, 1 % v / v ethanol, and 0.019 g / L tryptophan using 2 L top drive motor DasGip vessels with a working volume of 0.9 L per vessel. Vessels were sterilized, along with the appropriate dissolved oxygen and pH probes, for 60 minutes at 121 °C. Dissolved oxygen probes were calibrated post sterilization in order to allow for polarization, however, pH probes were calibrated prior to sterilization. The pH was controlled at pH 6.0 using 6N KOH and 2N H2S04. During the growth phase of the culture the oxygen transfer rate (OTR) was 10 mM / h and during the production phase of the culture the OTR was 0.2 mM / h.

[0376] Table 18 shows the isobutanol titer and yield (as % theoretical) as calculated for the production phase of the culture. Both isobutanol titer and yield are increased in strain GEVO3523 carrying the alcohol dehydrogenase with decreased KM and increased kcat- Table 18 also shows the isobutyrate titer, reported as maximum titer reached, and yield as carbon yield in %. Both isobutyrate titer and yield are decreased in strain GEVO3523 carrying the alcohol dehydrogenase with decreased KM and increased kcat.Table 18. Isobutanol and Isobutyrate Titers and Yields.Example 4: Decreased Isobutyrate and Acetate Production in Fermentations with Deletion of ALD6 Gene in S. cerevisiae

[0377] The following example illustrates that deletion of the ALD6 gene leads to a decrease in isobutyrate and acetate production in fermentations.

[0378] Construction of ALD6 Deletion Strains: PCR was used to generate a DNA fragment that contained a deletion allele of ALD6 for deletion of ALD6 from S. cerevisiae. One PCR reaction amplified a DNA fragment (A) comprising the upstream flanking region of ALD6 and a region of overlap at the 3' end of the DNA fragment with the 5' end of the Psc_ccwi2 promoter region from pGV1954, using primers oGV2834 and OGV2835. Another PCR reaction amplified a DNA fragment (D) comprising the downstream flanking region of ALD6 and a region of overlap at the 5' end of the DNA fragment with the 3' end of the hph hygromycin resistance ORF from pGV2074, using primers oGV2836 and oGV2837. Another PCR reaction amplified a DNA fragment (B) comprising the Psc_ccwi2 promoter region from pGV1954 with a region of overlap at the 5' end of the DNA fragment with the 3' end of the upstream flanking region of ALD6 (fragment A) and a region at the 3' end of the DNA fragment with the 5' end of the hph hygromycin resistance ORF from pGV2074, using primers oGV2631 and oGV2632. Another PCR reaction amplified a DNA fragment (C) comprising the hph hygromycin resistance ORF from pGV2074 with a region of overlap at the 5' end of the DNA fragment with the 3' end of the Psc_ccwi2 promoter region from pGV1954 (fragment B) and a region of overlap at the 3' end of the DNA fragment with the 5' end of the downstream flanking region of ALD6 (fragment D), using primers oGV2633 and oGV2634. DNA fragments A and B were combined by PCR using primers oGV2834 and oGV2632 to generate DNA fragment AB and DNA fragments C and D were combined by PCR using primers 0GV2633 and OGV2837 to generate DNA fragment CD. DNA fragments AB and CD were combined by PCR using primers oGV2834 and oGV2837 to generate the final DNA fragment ABCD that contained the deletion allele of ALD6.Table 19. Primer Sequences Disclosed in Example 4.OGV2633 CACTATATCAATAATGGGTAAAAAGCCTGAACTCAC (SEQ ID NO: 66)OGV2634 TTATTCCTTTGCCCTCGGACG (SEQ ID NO: 67)OGV2680 TGCACTGCTGTCTTCACTTC (SEQ ID NO: 68)OGV2796 TGTCAGCGCTTCAGACTC (SEQ ID NO: 69)OGV2797 AAGTATTTTTAAGGATTCGCTC (SEQ ID NO: 70)OGV2798 CTTCATTACGGCATAACGTATTGAAGTATTTTTAAGGATTCGCTC (SEQ ID NO: 71 )OGV2800 CGTCCGAGGGCAAAGGAATAAGATAGTTATCATTATGTAAGTGCG (SEQ ID NO: 72)OGV2801 GGGAGTTTAGCAATCAGC (SEQ ID NO: 73)OGV2802 TG GTTG ACCCG CAAACTTC (SEQ ID NO: 74)OGV2803 ACAATCTCCCTGTCTCCTCCC (SEQ ID NO: 75)OGV2804 AAG GTG ATTTG G C AC AAATTTTAC (SEQ ID NO: 76)OGV2805 GGTACAATTCTGTCCTGAATTGTAG (SEQ ID NO: 77)OGV2806 AG G TC CTAG AAATC CCTTAAG (SEQ ID NO: 78)OGV2808 CTTCATTACGGCATAACGTATTGCGATATCAGTATACAAGGTAGGC (SEQ ID NO: 79)OGV2810 CGTCCGAGGGCAAAGGAATAAGGATTTAAGATGAGTGGTATTGG (SEQ ID NO: 80)OGV281 1 TGTTCGTAACTTTTGTCATCAC (SEQ ID NO: 81 )OGV2812 TCAGCATGCGGAACAATTG (SEQ ID NO: 82)OGV2813 TCCACACGGTATCATACGATC (SEQ ID NO: 83)OGV2814 GCGGTCGACAAGTTCAATATG (SEQ ID NO: 84)OGV2815 TACTGAGCCGCCAACCTTAGTA (SEQ ID NO: 85)OGV2816 CATAACTATACCCGTACGCAG (SEQ ID NO: 86)OGV2818 CTTCATTACGGCATAACGTATTGAGCGTAGATCTACTGAACATGC (SEQ ID NO: 87)OGV2820 CGTCCGAGGGCAAAGGAATAACATGAGATTGTCAAAGAGG (SEQ ID NO: 88)OGV2821 CACCAGGCTTATTGATGACC (SEQ ID NO: 89)OGV2822 CATTACCGGCAGTTGCTC (SEQ ID NO: 90)OGV2824 TATG ACAGTGCCTATCAAG C (SEQ ID NO: 91 )OGV2825 AATGGGTTCTACCAGTATC (SEQ ID NO: 92)OGV2826 AAGCCGGGAACGTGCGTAAC (SEQ ID NO: 93)OGV2827 CTTCATTACGGCATAACGTATTGGGAACGCGTAATGGTGCTTG (SEQ ID NO: 94)OGV2828 CGTCCGAGGGCAAAGGAATAACCCGAGTTGACTGCTCATTG (SEQ ID NO: 95)OGV2829 AATACTCGCCGAGGCGTAGG (SEQ ID NO: 96)OGV2830 TTGGAGCTGGGAGGTAAATC (SEQ ID NO: 97)OGV2831 TGCGGCTAACCCATATTGAG (SEQ ID NO: 98)OGV2832 TACGCTGAGCGTAGTACAAC (SEQ ID NO: 99)OGV2833 TAAAGCGCTGGGTGGACAACCG (SEQ ID NO: 00)OGV2834 GCACCGAGACGTCATTGTTG (SEQ ID NO: 101 )OGV2835 CTTCATTACGGCATAACGTATTGTAAACACGCCAGGCTTGACC (SEQ ID NO: 102)OGV2836 CGTC CG AG G G C AAAG G AATAATCCATTCGGTGGTGTTAAG C (SEQ ID NO: 103)OGV2837 ATGGCGAAATGGCAGTACTC (SEQ ID NO: 104)OGV2838 ACCAACGACCCAAGAATC (SEQ ID NO: 105)OGV2839 CTTTGCGACAGTGACAAC (SEQ ID NO: 106)OGV2840 CCTCACGTAAGGGCATGATAG (SEQ ID NO: 107)OGV2841 GCATTGCAGCGGTATTGTCAGG (SEQ ID NO: 108)OGV2842 C AG C AG CC AC AT AGT AT AC C (SEQ ID NO: 109)OGV2843 CTTCATTACGGCATAACGTATTGAGCCGTCGTTTGACATGTTG (SEQ ID NO: 10)OGV2844 CGTCCGAGGGCAAAGGAATAACGCTCCATTTGGAGGGATCG (SEQ ID NO: 1 11 )OGV2845 GAATGCGCTTGCTGCTAGGG (SEQ ID NO: 1 12)OGV2846 CAGCTCTTGCTGCAGGTAACAC (SEQ ID NO: 3)OGV2847 GGCACAATCTTGGAGCCGTTAG (SEQ ID NO: 1 14)OGV2848 ACCAAGCCATCAAGGTTGTC (SEQ ID NO: 1 15)OGV2849 TGGGTGATGGTTTGGCGAATGC (SEQ ID NO: 1 16)OGV2896 GAAATGATGACATGTGGAAATATAACAG (SEQ ID NO: 1 17)

[0379] Strains to demonstrate decreased isobutyrate and acetate production by deletion of ALD6 were constructed by transformation of GEV03198 with the ABCD DNA fragment that contained the deletion allele of ALD6. Transformants were selected for resistance to 0.1 g / L hygromycin and transformant colonies were screened by colony PCR for the correct integration of the ABCD DNA fragment using primer pairs oGV2840 / oGV2680, oGV968 / oGV2841 , and oGV2838 / oGV2839. Strains GEV0371 1 , GEV03712 and GEV03713 were identified by this colony PCR as having ALD6 deleted by correct integration of the ABCD DNA fragment.

[0380] Strains containing an isobutanol production pathway to demonstrate decreased isobutyrate and acetate production by deletion of ALD6 were constructed by transformation of GEV0371 1 , GEV03712 and GEV03713 with a 2μ origin of replication plasmid, pGV2247, carrying genes expressing KARI, DHAD, KIVD and ADH (EcJlvC_coScP2D1-A1, LIJIvD_coSc, LI_kivD2_coEc, and LI_adhA, respectively). Transformants were selected for resistance to 0.2 g / L G418 and 0.1 g / L hygromycin and purified by re-streaking onto media containing 0.1 g / L hygromycin and 0.2 g / L G418, generating strains GEV03714, GEV03715 and GEVO3716. An ALD6 control strain containing an isobutanol production pathway, GEV03466, was generated by transformation of GEV03198 with plasmid pGV2247. Transformants were selected for resistance to 0.2 g / L G4 8 and purified by re- streaking onto media containing 0.2 g / L G418.

[0381] Construction of ald2A, ald3A, ald4A, ald5A and hfdI Deletion Strains:PCR was used to generate separate DNA fragments that contained individual deletion alleles of ALD2, ALD3, ALD4, ALD5 and HFD1 for deletion of ALD2, ALD3, ALD4, ALD5 and HFD1 individually from S. cerevisiae in separate strains. Additionally, PCR was used to generate a DNA fragment that contained a deletion allele covering both ALD2 and ALD3, which are adjacent genes in the S. cerevisiae genome, for deletion of ALD2 and ALD3 together (ald2A ald3A) from S. cerevisiae in an individual strain. Four-component fragments containing the upstream flankingregion, the Psc__ccwi2 promoter region from pGV1954, the hph hygromycin resistance ORF from pGV2074 and the downstream flanking region for each individual gene were generated by PCR as for the generation of the ABCD fragment for deletion of ALD6 except using the primer pairs listed in Table 20. The four-component fragment for deletion of ALD2 and ALD3 together contained the upstream flanking region from ALD2 and the downstream flanking region from ALD3 and was similarly constructed by PCR using the primer pairs listed in Table 20. The Psc_ccwi2 promoter region from pGV1954 was always amplified with primer pair oGV2631 / oGV2632 and the hph hygromycin resistance ORF from pGV2074 was always amplified with primer pair oGV2633 / oGV2634.Table 20. Primers Used to Amplify Upstream and Downstream Regions for Gene Deletions.

[0382] Strains with deletion of ALD2, ALD3, ALD4, ALD5 and HFD1 individually and with deletion of ALD2 and ALD3 together were constructed by transformation of GEV03198 or GEV03466 with the individual four-component DNA fragment that contained the individual deletion allele of ALD2, ALD3, ALD4, ALD5 or HFD1 or with the four-component DNA fragment that contained the deletion allele of ALD2 and ALD3 together. Transformants were selected for resistance to 0.1 g / L hygromycin and transformant colonies were screened by colony PCR for the correct integration of the four-component DNA fragment using the primer pairs listed in Table 21. Strain GEV03567 was identified by this colony PCR as having ALD2 correctly deleted; strain GEV03568 was identified by this colony PCR as having ALD3 correctly deleted; strain GEV03569 was identified by this colony PCR as having ALD2 and ALD3 together correctly deleted; strain GEV03579 was identified by this colony PCR as having ALD4 correctly deleted; strains GEVO3705, GEVO3706 and GEVO3707 were identified by this colony PCR as having ALD5 correctly deleted; and strainsGEVO3720, GEV03721 and GEV03722 were identified by this colony PCR as having HFD1 correctly deleted.

[0383] Strains containing an isobutanol production pathway and with deletion of ALD2, ALD3 and ALD5 individually or with deletion of ALD2 and ALD3 together were constructed by transformation of strains GEV03567, GEV03568, GEV03569, GEVO3705, GEVO3706 and GEVO3707 with plasmid pGV2247. Transformants were selected for resistance to 0.2 g / L G418 and 0.1 g / L hygromycin and purified by re-streaking onto media containing 0.1 g / L hygromycin and 0.2 g / L G418, generating strains GEV03586, GEV03587, GEV03588, GEVO3590, GEV0359 , GEV03592, GEV03593, GEV03594, GEV03595, GEVO3708, GEVO3709 and GEVO3710. Strains GEV03579, GEVO3720, GEV03721 and GEV03722 were generated from GEV03466 and therefore contained plasmid pGV2247.Table 21. Primers Used to Screen Colonies for Verification of Gene Deletions.Table 22. Genotype of Strains Disclosed in Example 4.pdc1A::[Pcupi:Bs_alsS_coSc:TCYci:PpGKi:LI_kivD2_coEc:PEN02:Sp_HIS5] pdc5A::[LEU2:bla:PTEFi:ScJLV3AN:PTDH3-EcJlvC_coScQ110V]pdc6A [PTEFi:LIJIvD_coSc:PTDH3:EcJlvC_coScP2D1'A1:PEN02:U_adhA:PFBAi:Sc_TRP1] ald3A::Psc_ccwi2- ph {evolved for C2 supplement-independence, glucose tolerance and faster growth}GEV03569 MATa ura3 Ieu2 his3 trpl gpd1A::[TKi_uRA3] gpd2 A::[TKtuRA _short:PFBAi:KI_URA3:TKLURA3 ] pdc1A::[Pcupi:Bs_alsS_coSc:TCYci:PpGKi:LI_kivD2_coEc:PEN02:Sp_HIS5] pdc5A::[LEU2 bla:PTEFi:ScJLV3AN:PTDH3-EcJlvC_coScQ110V]pdc6A: [PTEFi:LIJIvD_coSc:PTDH3:Ec_ilvC_coScP2D1'A 1:PEN02:LI_adhA:PFBAi:Sc_TRP1] ald2A :ald3A::Psc„ccwi2-' ph {evolved for C2 supplement-independence, glucose tolerance and faster growth}GEV03579 MATa ura3 Ieu2 his3 trpl gpd1A::[TKi__uRA3] gpd2 A::[TKi uRA3_shori:PFBAi:KI_URA3:TK uRA3 ] pdc1A::[PCupi:Bs_alsS_coSc:TcYci:PpGKi:LI_kivD2_coEc:PEN02:Sp_HIS5] pdc5A::[LEU2 bla PTEFi:Sc LV3AN-.PTDH3-EcJvC_coScQi m]pdc6A: [PTEFi:LIJIvD_coSc:PTDH3:Ec_ilvC_coScP2D1'A 1:PEN02:LI_adhA:PFBAi:Sc_TRP1] ald4A::Psc_ccwi2:hph {evolved for C2 supplement-independence, glucose tolerance and faster growth}; transformed with pG V2247GEV03586, MATa ura3 Ieu2 his3 trpl gpd1A::[TKi_uRA3] gpd2 A::[T _uRA3 :PFBAi:KI_URA3:T _uRA3 ] GEV03587 and pdc1A::[Pcupi:Bs_alsS_coSc:TcYci:PpGKi:LI_kivD2_coEc:PEN02:Sp_HIS5]GEV03588 pdc5A::[LEU2:bla:PTEFi:ScJLV3AN:PTDH3-EcJlvC_coSco110V]pdc6A :[PTEFi:LUIvD_coSc:PTDH3:EcJlvC_coScP2D1'A1:PEN02:U_adhA:PFBAi:Sc_TRP1] ald2A: ald3A::Psc_ccwi2:hph {evolved for C2 supplement-independence, glucose tolerance and faster growth}; transformed with pGV2247GEVO3590, MATa L ira3 Ieu2 his3 trpl gpd1A::[TKi_uRA3j gpd2 A::[Tn_uRA3^ on:PFBAi:KI_URA3:TKi_uRA3 ] GEV03591 and pddA: [Pcupi:Bs_alsS_coSc:TcYci:PpGKi:LI_kivD2_coEc:PEN02:Sp_HIS5]GEV03592 pdc5A: [LEU2:bla:PTEFi:ScJLV3AN:PTDH3-EcJlvC_coScG110v]pdc6A: [PTEFi:LIJIvD_coSc:PTDH3:EcJlvC_coScP D1'A1:PEN02:LI_adhA:PFBAi:Sc_TRP1] ald2A :psc_ccwi2-'hph {evolved for C2 supplement-independence, glucose tolerance and faster g rowth}; transformed with pGV2247GEV03593, MATa ura3 Ieu2 his3 trpl gpd1::TKi_uRA3 gpd2::TKi_uRA3_shorrPFBAi-KI_URA3-TKLURA3GEV03594 and pdc1::Pcupi-Bs_alsS_coSc-TcYci-PpGKi-LI_kivD2_coEc-PEN02-Sp_HIS5 pdc5: LEU2-bla- GEV03595 PTEF:-SCJLV3AN-PTDH3-ECJIVC_COSCq110vpdc6::PTEF,-LIJIvD_coSc-PTOH3- EcJlvC_coScP D1'A1-PENo2-LI_adhA-PFBAi-Sc_TRP1 ald3A::PSc_ccwi2-hph {evolved for C2 supplement-independence, glucose tolerance and faster growth}; transformed with pGV2247GEVO3705, MATa ura3 Ieu2 his3 trpl gpd1A::[TKi_uRA3] gpd2 A::[TKLuRA3_s ori:PFBAi:KI_URA3:TKi_uRA3 ] GEVO3706 and pdc1A::[Pcupi:Bs_alsS_coSc:TcYci:PpGKi:U_l<ivD2_coEc:PEN02:Sp_HIS5]GEVO3707 pdc5A::[LEU2:bla:PTEFi:ScJLV3AN:PTDH3-EcJlvC_coScQ110V]pdc6A :[PTEFi:UJIvD_coSc:PTDH3:EcJlvC_coScP2D1~A 1:PEN02:LI_adhA:PFBAi:Sc_TRP1] ald5A::Psc_ccwi2-hph {evolved for C2 supplement-independence, glucose tolerance and faster growth}GEVO3708, MATa ura3 Ieu2 his3 trpl gpd1A::[TKi_uRA3] gpd2 A::[TKi_uRA3_short:PFBAi:KI_URA3:TKt_uRA3] GEVO3709 and pdc1A::[Pcupi:Bs_alsS_coSc:TcYci:PpGKi:LI_kivD2_coEc:PEN02:Sp_HIS5]GEVO3710 pdc5A::[LEU2:bla:PTEFi:Sc_ILV3AN:PTDH3-Ec_ilvC_coScQ110V]pdc6-_::[PrEF l / J / vD_coSc; TDH3:Ec_yvC_coScP2Di^^-PEwo2 - / _adM;PFsA1:Sc_rRPii ald5A::Psc_ccwi2:hph {evolved for C2 supplement-independence, glucose tolerance and faster growth}; transformed with pGV2247GEV03711 , MATa ura3 Ieu2 his3 trpl gpd1A::[TKi_uRA3] gpd2 A::[TKi_uRA3_short:PFBAi:KI_URA3:TKLURA3] GEV03712 and pdc1A::[Pcupi:Bs_alsS_coSc:TcYci:PpGKi:LI_kivD2_coEc:PENo2:Sp_HIS5]GEV03713 pdc5A::[LEU2:bla:PTEFi:ScJLV3AN:PTDH3-Ec_HvC_coScQ110V]pdc6A [PTEFi:LIJIvD_coSc:PTDH3:Ec_ilvC_coScP2D1~A1:PEN02:LI_adhA:PFBAi:Sc_TRP1] ald6A::PSc_ccwi2:hph {evolved for C2 supplement-independence, glucose tolerance and faster growth}GEV03714, MATa L ira3 Ieu2 his3 trpl gpd1A::[TKi_uRAs] gpd2 A::[TKi_uRA3_s ort:PFBAi:KI_URA3:TKuRA3 ] GEV03715 and pddA:■[Pcupi:Bs_alsS_coSc:TcYci:PpGKi:LI_kivD2_coEc:PEN02:Sp_HIS5]GEV03716 pdc5A: [LEU2 bla PTEFi:ScJLV3 N:PTDH3-EcJvC_coScQ110V]pdc6A: [PTEFi:LIJIvD_coSc:PTDH3:EcJlvC_coScP D1'A1:PEN02:U_adhA:PFBAi:Sc_TRP1] ald6A:: Psc_ccwi2-'hph {evolved for C2 supplement-independence, glucose tolerance andfaster growth}; transformed with pGV2247GEVO3720, MATa ura3 Ieu2 his3 trpl gpd1A::[TKi_uRA3] gpd2 A::[TKi_uRA3_short:PFBAi:KI_URA3:TKi_uRA3 ] GEV03721 and pdc1A::[PCuPi:Bs_alsS_coSc:TcYci:PpGKi:LI_kivD2_coEc:PEN02:Sp_HIS5]GEV03722 pdc5A::[LEU2:bla:PTEFi:ScJLV3AN:PTDH3-EcJlvC_coScQ110V]coSc:PTDH3:EcJlvC_coScP2D1'A 1:PEN02:LI_adhA:PFBAi:Sc_TRP1]{evolved for C2 supplement-independence, glucose tolerance and faster growth}: transformed with pGV2247Table 23. Plasmids Disclosed in Example 4.

[0384] Shake Flask Fermentations: Fermentations were performed to compare the performance of GEVO3466 to strains containing the ald2A, ald3A, ald2A ald3A, ald4A, ald5A, hfdIA and ald6A deletion mutations. Yeast strains were inoculated fr...

Claims

OCRPP041. Recombinant microorganisms comprising: e) an isobutanol-producing metabolic pathway in which such isobutanol-producing metabolic pathway contains at least one exogenous gene or at least one overexpressed endogenous gene that catalyzes the pyruvate-to-isobutanol conversion step; b) at least one modification that inhibits the expression or activity of an endogenous enzyme with 3-detoreductase activity, in which such modification is selected from the group of genes present. Categorized by: I. Mutations of the intrinsic gene encoding the intrinsic enzyme with 3-keto-reductase activity; and II. Mutations of the regulatory element associated with the intrinsic gene encoding the intrinsic enzyme with 3-keto-reductase activity; where the intrinsic enzyme with 3-keto-reductase activity catalyzes the conversion of acetolactate to 2,3-dihydroxy-2-methylbutanoic acid (DH2MB).

2. Recombinant microorganisms of claim I where the intrinsic enzyme with 3-keto-reductase activity is S.

3. Recombinant microorganisms of claim 1 in which the intrinsic enzyme exhibiting 3-ketoricase activity is selected from SEQIDNO:2, SEQIDNO:4, SEQIDNO:6, SEQIDNO:7, SEQIDNO:8, SEQIDNO:10, SEQIDNO:11, SEQIDNO:12, SEQIDNO:13, SEQIDNO:14, SEQIDNO:15, SEQIDNO:16, SEQIDNO:17, SEQIDNO:18, SEQIDNO:19, SEQIDNO:20, SEQIDNO:21, SEQIDNO:22 and SEQIDNO:

23.

4. Recombinant microorganisms of claim 1 in which the said recombinant microorganisms are selected.

5. A recombinant microorganism of claim 1 where such recombinant microorganism is designed-engineered to reduce or eliminate the activity of pyruvate disarboxytes (PDC).

6. A recombinant microorganism of claim 1 where such recombinant microorganism is a yeast.

7. A recombinant microorganism of claim 6 where such recombinant microorganism is a yeast of Saccharomyces clade. 8.Recombinant microorganisms of claim 6, where such recombinant microorganisms are Saccharomyces ensustricto 9. Recombinant microorganisms of claim 6, where such recombinant microorganisms are Crabtree-negative yeast 10. Recombinant microorganisms of claim 9, where such Crabtree-negative yeast genus is classified into selected genera from a group comprising Saccharompices, Kigveromyces, Pi 11. Recombinant microorganisms of claim 6 in which such recombinant microorganisms are Crabtree-positive yeasts.

12. Recombinant microorganisms of claim 11 in which such Crabtree-positive yeasts are classified into genera selected from a group comprising Saccharompyces, Kligverongces, Zygocchurompces, Debaryomyces, Pichia, Candida, un:Schizosaccharomyces. 13.The recombinant microorganisms of Pledge 12 in which the positive Crabtree species are selected are from a group comprising Saccharomyces cerevisiae, Saccharomyce suvarum, Saccharomyces bayanus, Saccharomyces paradoxus, Saccharomyces castelli, Khuyveromyces thermolerans, Candida glabrata, Zygosaccharomyces bailli, Zygosaccharomyces rouxii, Debaryomyce shansenii, and Pichia. pastorius, and Schizosaccharomyces pombe14. Recombinant microorganisms of claim 6 in which such recombinant microorganisms are post-WGD (wholegenomeduplication) yeasts15. Recombinant microorganisms of claim 14 in which such post-WGD yeasts are classified into genera selected from a group consisting of Sacharomyices or Candida16.The recombinant microorganisms of claim 6, in which case the recombinant microorganisms are pre-WGD (whole genome multiplication) yeasts,17 The recombinant microorganisms of claim 16, in which case the pre-WGD yeasts are classified into selected genera from a group comprising Sacchinzmyces, Khayveromyces, Candida, Pichichia, Deharyomyces, Hansenula, Issatchenkia, Pachysolen, Yarrowia, and Schizosaccharomyces,18. The methods of isobutanol production include: (a) provision of recombinant microorganisms according to claim 1; and b) propagation.

19. Recombinant microorganisms of claim 1 in which such mutations result in alterations of one or more amino acids, insertions of one or more amino acids, loss of one or more amino acids, inhibition, controlled promoter importation, structurally weak promoter importation or a combination thereof;