Verient glutamate-cysteine ​​ligase and methods for glutathione production using similar techniques.

Abstract

Invention details;

Description

Glutamate-cysteine ​​ligase mutant and glutathione production method using the same

[0001] The present application relates to a novel glutamate-cysteine ​​ligase variant and a method for producing glutathione using the same.

[0002]

[0003] Glutathione (GSH) is the most common organic sulfur compound found within cells and is a tripeptide composed of three amino acids: glycine, glutamate, and cysteine.

[0004] Glutathione exists in the body in two forms: reduced glutathione (GSH) and oxidized glutathione (GSSG). Reduced glutathione (GSH), which is present in relatively high concentrations under normal conditions, is primarily distributed in the liver and skin cells. It plays a crucial role in antioxidant activity, decomposing and removing reactive oxygen species; detoxifying exogenous compounds such as toxic substances; and whitening, inhibiting melanin production.

[0005] As aging progresses, the amount of glutathione produced gradually decreases, and the decrease in glutathione production, which plays an important role in antioxidant and detoxification functions, promotes the accumulation of active oxygen, which is the main cause of aging, so glutathione supply from outside is necessary (Sipes IG et al, The role of glutathione in the toxicity of xenobiotic compounds: metabolic activation of 1,2-dibromoethane by glutathione, Adv Exp Med Biol. 1986;197:457-67.).

[0006] Glutathione, with its diverse functions, is attracting attention as a material in various fields such as pharmaceuticals, health functional foods, and cosmetics, and is also used in the production of flavoring ingredients and food and feed additives. Glutathione is known to have a significant effect in enhancing the flavor of raw ingredients and maintaining a rich flavor. It can be used alone or in combination with other substances as a kokumi flavor enhancer. Kokumi ingredients are generally known to have a richer flavor than existing umami ingredients such as nucleic acids and MSG, and are known to be produced through the decomposition and maturation of proteins.

[0007] However, despite the increasing demand for glutathione, which can be used in various fields, the enzymatic synthesis process has not yet been commercialized due to the high production cost, and the method of culturing microorganisms and extracting them from the cells has a low yield, so the industrial production of glutathione requires a considerable amount of cost, and thus the market is not very active.

[0008]

[0009] As a result of our efforts to solve the above problems, the inventors discovered a novel glutamate-cysteine ​​ligase mutant and confirmed that introducing the mutant significantly increased the glutathione production capacity of the strain, thereby completing the present application.

[0010]

[0011] The present application provides a glutamate-cysteine ​​ligase variant in which the amino acid corresponding to the 86th position from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0012] The present application provides a polynucleotide encoding the above mutant and a vector comprising the same.

[0013] The present application provides a microorganism that produces glutathione, comprising at least one of the above mutant; a polynucleotide encoding the mutant; and a vector comprising the above polynucleotide.

[0014] The present application provides a method for producing glutathione, which comprises a step of culturing the above microorganism.

[0015]

[0016] The novel glutamate-cysteine ​​ligase variant of the present application significantly increases glutathione production and can thus be usefully utilized for high-production of glutathione. The yeast, dried product, extract, culture, lysate thereof, and the glutathione produced in this manner have antioxidant effects, detoxification effects, and immune-enhancing effects, and can be usefully used in cosmetic compositions, food compositions, feed compositions, pharmaceutical compositions, and the manufacture thereof.

[0017]

[0018] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0019] Furthermore, those skilled in the art will recognize or be able to ascertain, using only routine experimentation, numerous equivalents to the specific embodiments described in this application. Furthermore, such equivalents are intended to be encompassed by this application.

[0020]

[0021] One aspect of the present application provides a glutamate-cysteine ​​ligase variant in which the amino acid corresponding to the 86th position from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0022] The above variant may be a glutamate-cysteine ​​ligase variant comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, wherein the substitution comprises substitution of an amino acid corresponding to the 86th position from the N-terminus of SEQ ID NO: 1 with another amino acid.

[0023] Specifically, the variant may be a protein variant in which amino acid position 86 from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid.

[0024]

[0025] The "glutamate-cysteine ​​ligase (GCL)" of the present application is an enzyme also called "glutamate-cysteine ​​ligase" or "gamma-glutamylcysteine ​​synthetase (GCS)". Glutamate-cysteine ​​ligase is known to catalyze the following reactions:

[0026] L-glutamate + L-cysteine ​​+ ATP ↔ gamma-glutamyl cysteine ​​+ ADP + Pi

[0027] Additionally, the reaction catalyzed by the above glutamate-cysteine ​​ligase is known to be the first step in glutathione synthesis.

[0028] The above glutamate-cysteine ​​ligase may be a protein having an amino acid sequence of sequence number 1, but is not limited thereto.

[0029] In the present application, the amino acid sequence of SEQ ID NO: 1 is an amino acid sequence encoded by the gsh1 gene, and may be referred to as a "GSH1 protein" or a "glutamate-cysteine ​​ligase." The amino acid sequence constituting the glutamate-cysteine ​​ligase of the present application can be obtained from the NCBI's GenBank, a known database. For example, it may be derived from Saccharomyces cerevisiae, but is not limited thereto, and a sequence having the same activity as the amino acid sequence may be included without limitation.

[0030] In addition, although the glutamate-cysteine ​​ligase in the present application is defined as a protein including the amino acid sequence of SEQ ID NO: 1, it does not exclude meaningless sequences before and after the amino acid sequence of SEQ ID NO: 1, mutations that may occur naturally, or silent mutations thereof, and it is obvious to those skilled in the art that if it has the same or corresponding activity as the protein including the amino acid sequence of SEQ ID NO: 1, it corresponds to the glutamate-cysteine ​​ligase of the present application.

[0031] For example, the glutamate-cysteine ​​ligase of the present application may be a protein comprising the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto. In addition, it is obvious that a protein having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, or added is also included within the scope of the protein that is the subject of mutation of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the protein.

[0032] That is, even if the present application describes a "protein or polypeptide having an amino acid sequence described by a specific sequence number" or a "protein or polypeptide comprising an amino acid sequence described by a specific sequence number," it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted or added may also be used in the present application if it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the corresponding sequence number. For example, it is obvious that a "polypeptide comprising the amino acid sequence of SEQ ID NO: 1" can belong to a "polypeptide consisting of the amino acid sequence of SEQ ID NO: 1" if it has the same or corresponding activity.

[0033]

[0034] In this application, the term "variant" refers to a protein in which one or more amino acids differ from the recited sequence by conservative substitution and / or modification, but the functions or properties of the protein are maintained. For the purpose of this application, it may be a variant in which the amino acid corresponding to the 86th position from the N-terminus of SEQ ID NO: 1 among the glutamate-cysteine ​​ligases described above is substituted with an amino acid residue other than cysteine. The variant differs from the identified sequence by several amino acid substitutions, deletions, or additions. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the protein and evaluating the properties of the modified protein. That is, the ability of the variant may be increased compared to the native protein. Additionally, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The term "variant" may include terms such as variant, modification, mutated protein, mutated polypeptide, and variant (in English, modification, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc.), and is not limited thereto as long as the term is used in the meaning of variant. For the purposes of the present application, the variant may be one in which the activity of the mutated protein is increased compared to the natural wild-type or unmodified protein, but is not limited thereto.

[0035] The term "conservative substitution" in this application refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such variants may, for example, have one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues.

[0036] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of a protein that is involved in co-translational or post-translational protein transfer. Furthermore, the polypeptide may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis of the polypeptide.

[0037]

[0038] In the present application, "substitution with another amino acid" is not limited to an amino acid different from the amino acid prior to substitution. In other words, the replacement of cysteine, the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1, with another amino acid can be expressed as "the 86th amino acid is replaced with an amino acid other than cysteine." Meanwhile, when the expression "a specific amino acid is replaced" in the present application is expressed, it is self-evident that the replacement is with an amino acid different from the amino acid prior to substitution, even if it is not specifically indicated that it is replaced with a different amino acid.

[0039]

[0040] The "glutamate-cysteine ​​ligase variant" of the present application may be described as a "(mutant) polypeptide having glutamate-cysteine ​​ligase activity", a "GSH1 variant", and may be capable of increasing glutathione production compared to a protein before mutation, a natural wild-type polypeptide, or an unmodified polypeptide, but is not limited thereto.

[0041] The above variant may be one in which one or more amino acids in the amino acid sequence of SEQ ID NO: 1 are substituted with other amino acids. Specifically, the variant may include a mutation in which the amino acid corresponding to position 86 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid other than cysteine. The other amino acid may be selected from glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, tyrosine, asparagine, glutamate, glutamine, aspartate, lysine, arginine, and histidine.

[0042] In the present application, "a mutant in which the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO. 1 is substituted with a different amino acid" is self-evident and includes a mutant in which the amino acid corresponding to the 86th position of the amino acid sequence of SEQ ID NO. 1 is substituted with a different amino acid, even if the mutant is described at a position other than 86 due to deletion / addition / insertion of an amino acid at the N or C terminus of the amino acid sequence of SEQ ID NO. 1, or in the middle. In addition, although the present application describes a variant in which the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid as an example of a glutamate-cysteine ​​ligase variant, the glutamate-cysteine ​​ligase variant of the present application is not limited to the variant of the amino acid sequence of SEQ ID NO: 1, and it is obvious that a variant in which the "amino acid corresponding to position 86 of the amino acid sequence of SEQ ID NO: 1" is substituted with another amino acid in any amino acid sequence having glutamate-cysteine ​​ligase activity is also included in the scope of the glutamate-cysteine ​​ligase variant of the present application.

[0043] Within any amino acid sequence, “the amino acid corresponding to position 86 of the amino acid sequence of SEQ ID NO: 1” can be identified through various sequence alignment methods known in the art.

[0044]

[0045] A glutamate-cysteine ​​ligase variant in which the amino acid corresponding to the 86th position from the N-terminus of the amino acid sequence of SEQ ID NO: 1 of the present application is substituted with another amino acid may be a protein comprising the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity therewith, and in which the amino acid corresponding to the 86th position of SEQ ID NO: 1 is substituted with another amino acid.

[0046] A glutamate-cysteine ​​ligase variant in which the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1 of the present application is substituted with an amino acid other than cysteine ​​may comprise any one of the amino acid sequences of SEQ ID NOs: 3 to 21. Specifically, it may consist essentially of any one of the amino acid sequences of SEQ ID NOs: 3 to 21, and more specifically, it may consist of any one of the amino acid sequences of SEQ ID NOs: 3 to 21, but is not limited thereto.

[0047] In addition, the variant may include an amino acid sequence of any one of SEQ ID NOs: 3 to 21, or an amino acid sequence in which amino acid position 86 is fixed (i.e., the amino acid corresponding to position 86 of SEQ ID NOs: 3 to 21 in the amino acid sequence of the variant is identical to the amino acid at position 86 of SEQ ID NOs: 3 to 21) and has 80% or more homology or identity therewith, but is not limited thereto.

[0048] Specifically, the variant of the present application may include a polypeptide having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with any one of the amino acid sequences of SEQ ID NOs: 3 to 21. In addition, it is obvious that a protein having an amino acid sequence in which part of the sequence is deleted, modified, substituted, or added, other than position 86, is also included in the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the variant.

[0049]

[0050] In this application, the terms "homology" or "identity" refer to the degree of relationship between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.

[0051] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its full length. Hybridization is also contemplated for polynucleotides that contain degenerate codons in place of codons in the polynucleotide.

[0052] Whether any two polynucleotide or polypeptide sequences are homologous, similar, or identical can be determined using known computer algorithms such as the "FASTA" program with default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be used. (including the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, BLAST from the National Center for Biotechnology Information database, or ClustalW can be used to determine homology, similarity, or identity.

[0053] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using the GAP computer program, as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program defines the total number of symbols in the shorter of the two sequences as the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0054] Additionally, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the defined appropriate hybridization conditions are within the scope of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrooket al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubelet al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0055]

[0056] Another aspect of the present application may provide a polynucleotide encoding the variant.

[0057] In this application, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, and may be a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the protein variant.

[0058] The polynucleotide encoding the protein variant of the present application may include, without limitation, a polynucleotide sequence encoding a glutamate-cysteine ​​ligase variant that increases glutathione production capacity.

[0059] The gene encoding the glutamate-cysteine ​​ligase of the present application may be the gsh1 gene. The gene may be derived from yeast. Specifically, it may be derived from the genus Saccharomyces, more specifically from Saccharomyces cerevisiae. Specifically, it may be a gene encoding the amino acid sequence of SEQ ID NO: 1, and more specifically, it may be a sequence including the base sequence of SEQ ID NO: 2, but is not limited thereto.

[0060] The polynucleotide encoding the protein variant of the present application may have various modifications in the coding region within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of the codons preferred by the organism to which the polypeptide is to be expressed. Specifically, the polynucleotide sequence encoding the protein variant in which the amino acid corresponding to position 86 in the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid may be included without limitation. For example, the polynucleotide of the present application may be a polynucleotide sequence encoding the protein variant of the present application, specifically, a protein comprising the amino acid sequence of any one of SEQ ID NOs: 3 to 21, or a polypeptide having homology or identity therewith, but is not limited thereto. The homology or identity is as described above.

[0061] In addition, a probe that can be prepared from a known genetic sequence, for example, a sequence that hybridizes under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence and encodes a protein variant in which the amino acid corresponding to position 86 in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, may be included without limitation.

[0062] The above "stringent conditions" refer to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (e.g., J. Sambrooket al., supra). For example, conditions in which genes with high homology, 80% or more, specifically 90% or more, more specifically 95% or more, even more specifically 97% or more, and particularly specifically 99% or more, hybridize, and genes with lower homology do not hybridize, or conditions in which washing is performed once, specifically twice or three times, at a salt concentration and temperature corresponding to the washing conditions of conventional Southern hybridization, 60°C, 1X SSC, 0.1% SDS, specifically 60°C, 0.1X SSC, 0.1% SDS, more specifically 68°C, 0.1X SSC, 0.1% SDS. However, it is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.

[0063] Hybridization requires that two polynucleotides have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the present application may also encompass isolated polynucleotide fragments that are complementary in their entirety, as well as substantially similar polynucleotide sequences.

[0064] Specifically, polynucleotides having homology can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C and can be appropriately adjusted by those skilled in the art depending on the purpose.

[0065] The appropriate stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art.

[0066]

[0067] Another aspect of the present application may provide a vector comprising a polynucleotide encoding the protein variant.

[0068] The term "vector" as used herein refers to a DNA construct containing a base sequence of a polynucleotide encoding a target protein operably linked to suitable regulatory sequences so as to enable expression of the target protein in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector can replicate or function independently of the host genome, or can be integrated into the genome itself.

[0069] The vector used in the present application is not particularly limited, and any vector known in the art can be used. The yeast expression vector can be both an integrative yeast plasmid (YIp) and an extrachromosomal plasmid vector. The extrachromosomal plasmid vector can include an episomal yeast plasmid (YEp), a replicative yeast plasmid (YRp), and a yeast centromer plasmid (YCp). In addition, artificial yeast chromosomes (YACs) can also be used as the vector in the present application. As specific examples, available vectors include pESCHIS, pESC-LEU, pESC-TRP, pESC-URA, Gateway pYES-DEST52, pAO815, pGAPZ A, pGAPZ B, pGAPZ C, pGAPα A, pGAPα B, pGAPα C, pPIC3.5K, pPIC6 A, pPIC6 B, pPIC6 C, pPIC6α A, pPIC6α B, pPIC6α C, pPIC9K, pYC2 / CT, pYD1 Yeast Display Vector, pYES2, pYES2 / CT, pYES2 / NT A, pYES2 / NT B, pYES2 / NT C, pYES2 / CT, pYES2.1, pYES-DEST52, pTEF1 / Zeo, pFLD1, PichiaPinkTM, p427-TEF, p417-CYC, pGAL-MF, p427-TEF, p417-CYC, PTEF-MF, pBY011, pSGP47, pSGP46, pSGP36, pSGP40, ZM552, pAG303GAL-ccdB, pAG414GAL-ccdB, pAS404, pBridge, pGAD-GH, pGAD T7, pGBK T7, pHIS-2, pOBD2, pRS408, pRS410, pRS418, pRS420, pRS428, yeast micron A form, pRS403, pRS404, pRS405, pRS406, pYJ403, Including but not limited to pYJ404, pYJ405 and pYJ406.

[0070] For example, a polynucleotide encoding a target protein within a chromosome can be replaced with a mutated polynucleotide using a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, such as, but not limited to, homologous recombination. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface protein, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby allowing the selection of transformed cells.

[0071] The term "transformation" in this application may refer to introducing a vector containing a polynucleotide encoding a glutamate-cysteine ​​ligase variant into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed in the host cell. In addition, the polynucleotide may include DNA and RNA encoding the glutamate-cysteine ​​ligase variant. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all the elements necessary for its own expression. The above expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are operably linked to the polynucleotide. The expression cassette may be in the form of a self-replicating expression vector. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0072] In addition, the term "operably linked" as used herein means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target polypeptide of the present application. The method for transforming the vector of the present application includes any method for introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique known in the art depending on the host cell. Examples thereof include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0073]

[0074] The present application can provide a microorganism that produces glutathione, comprising at least one of the mutant; a polynucleotide encoding the mutant; and a vector comprising the polynucleotide.

[0075] The above microorganism may be a microorganism expressing the above mutant, or a microorganism into which the above mutant has been introduced.

[0076] In the present application, the term "microorganism comprising a mutant", "microorganism into which a mutant has been introduced", or "microorganism expressing a mutant" may refer to a microorganism that naturally has weak glutathione production ability or a microorganism in which glutathione production ability has been conferred on a parent strain that does not have glutathione production ability. Specifically, the microorganism is a microorganism that expresses a glutamate-cysteine ​​ligase mutant that includes one or more amino acid mutations in the amino acid sequence of SEQ ID NO: 1, wherein the amino acid mutation may include a mutation in which the amino acid corresponding to the 86th position from the N-terminus is substituted with another amino acid. In addition, the microorganism may be a microorganism that expresses a glutamate-cysteine ​​ligase mutant in which the amino acid corresponding to the 86th position in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. For example, the microorganism may be, but is not limited to, a Saccharomyces cerevisiae strain deposited under accession number KCCM12659.

[0077] The glutamate-cysteine ​​ligase and its variants are as described above.

[0078] In this application, the term "protein to be / is expressed" refers to a state in which a target protein is introduced into a microorganism or modified to be expressed within the microorganism. If the target protein is a protein present within the microorganism, this may refer to a state in which its activity is enhanced compared to its endogenous state or before modification. For the purposes of this application, the "target protein" may be the glutamate-cysteine ​​ligase variant described above.

[0079] Specifically, "introduction of a protein" may refer to the display of activity of a specific protein that a microorganism did not originally possess, or enhanced activity compared to the inherent activity or activity of the protein before modification. For example, a polynucleotide encoding a specific protein may be introduced into the chromosome of a microorganism, or a vector containing a polynucleotide encoding a specific protein may be introduced into a microorganism and its activity may be exhibited. In addition, "enhancement of activity" may refer to the enhanced activity of a specific protein of a microorganism compared to the inherent activity or activity before modification. "Intrinsic activity" may refer to the activity of a specific protein that the parent strain originally possessed before the change in traits, when the traits of a microorganism change due to genetic mutation caused by natural or artificial factors.

[0080] Specifically, the activity enhancement of the present application may be any one or more selected from the group consisting of increasing the intracellular copy number of a gene encoding the protein variant, introducing a mutation into an expression control sequence of a gene encoding the protein variant, replacing an expression control sequence of a gene encoding the protein variant with a sequence having strong activity, replacing a gene encoding a native protein on a chromosome with a gene encoding the protein variant, additionally introducing a mutation into a gene encoding the protein so that the activity of the protein variant is enhanced, and introducing a protein variant into a microorganism, but is not limited thereto.

[0081] The increase in the copy number of the gene as described above is not particularly limited thereto, but may be performed in a form operably linked to a vector, or by insertion into a chromosome within a host cell. Specifically, a vector capable of replicating and functioning independently of a host, to which a polynucleotide encoding the protein of the present application is operably linked, may be introduced into a host cell. Alternatively, a vector capable of inserting the polynucleotide into a chromosome within a host cell, to which the polynucleotide is operably linked, may be introduced into the chromosome of the host cell. The insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, homologous recombination.

[0082] Next, modifying the expression control sequence to increase the expression of the polynucleotide may be performed by, but is not particularly limited to, inducing a sequence mutation in the nucleic acid sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control sequence, or by replacing the nucleic acid sequence with a nucleic acid sequence having stronger activity. The expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence regulating the termination of transcription and translation, etc.

[0083] A strong promoter may be linked upstream of the above polynucleotide expression unit instead of the original promoter, but is not limited thereto. For example, when the host cell is yeast, available promoters include, but are not limited to, the TEF1 promoter, the TEF2 promoter, the GAL10 promoter, the GAL1 promoter, the ADH1 promoter, the ADH2 promoter, the PHO5 promoter, the GAL1-10 promoter, the TDH3 promoter (GPD promoter), the TDH2 promoter, the TDH1 promoter, the PGK1 promoter, the PYK2 promoter, the ENO1 promoter, the ENO2 promoter, and the TPI1 promoter. In addition, modification of a polynucleotide sequence on a chromosome may be performed, but is not particularly limited thereto, by inducing mutations in the expression regulatory sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof of the nucleic acid sequence to further enhance the activity of the polynucleotide sequence, or by replacing it with a polynucleotide sequence that has been improved to have stronger activity.

[0084] Such introduction and enhancement of protein activity may be, but is not limited to, an increase in the activity or concentration of the corresponding protein, typically by at least 1%, 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, or up to 1000% or 2000%, relative to the activity or concentration of the protein in a wild-type or unmodified microbial strain.

[0085] The term "unmodified microorganism" in this application does not exclude a strain containing a mutation that may occur naturally in a microorganism, and may be a natural strain itself, a microorganism that does not contain a variant of the protein, or a microorganism that has not been transformed with a vector containing a polynucleotide encoding a variant of the protein.

[0086] In the present application, the microorganism comprising the polynucleotide comprising or encoding the glutamate-cysteine ​​ligase variant may be, for example, a recombinant microorganism produced by transformation with a vector comprising the polynucleotide, but is not limited thereto. The recombinant microorganism may be a yeast, for example, a microorganism of the genus Saccharomyces, and specifically, Saccharomyces cerevisiae, but is not limited thereto.

[0087]

[0088] "Glutathione" in this application is used interchangeably with "glutathione" and "GSH", and refers to a tripeptide composed of three amino acids: glutamate, cysteine, and glycine. Glutathione can be used as a raw material for pharmaceuticals, health functional foods, flavoring materials, foods, feed additives, cosmetics, etc., but is not limited thereto.

[0089] In this application, the term "microorganism producing glutathione" includes all microorganisms that have undergone genetic modification, either naturally or artificially, and may be microorganisms in which a specific mechanism has been weakened or strengthened due to causes such as the insertion of an external gene or the strengthening or inactivation of an endogenous gene, and may be microorganisms in which genetic mutations for the production of the desired glutathione have occurred or the activity has been strengthened. For the purpose of this application, the microorganism producing glutathione may refer to a microorganism capable of producing an excess of the desired glutathione compared to a wild-type or unmodified microorganism, including glutamate-cysteine ​​ligase. The term "microorganism producing glutathione" may be used interchangeably with terms such as "glutathione-producing microorganism," "microorganism having glutathione-producing ability," "glutathione-producing strain," and "strain having glutathione-producing ability."

[0090] The above glutathione-producing microorganism may be a recombinant microorganism. The recombinant microorganism is as described above.

[0091] The above glutathione-producing microorganism is not particularly limited in type as long as it is capable of producing glutathione, but may be a microorganism of the genus Saccharomyces, and specifically, may be Saccharomyces cerevisiae, but is not limited thereto.

[0092] The parent strain of the glutathione-producing microorganism containing the above mutant is not particularly limited, as long as it is capable of producing glutathione. The microorganism may further include mutations such as strengthening the biosynthetic pathway to increase glutathione production, releasing feedback inhibition, or inactivating genes that weaken the degradation pathway or biosynthetic pathway. Such mutations do not exclude natural ones. However, they are not limited thereto.

[0093]

[0094] Another aspect of the present application provides a method for producing glutathione, comprising culturing the microorganism. The microorganism and glutathione are as described above. Glutathione can be accumulated within the cell through strain cultivation.

[0095]

[0096] The medium and other culture conditions used for culturing the strain of the present application can be any medium used for culturing microorganisms of the genus Saccharomyces without any particular limitation. Specifically, the strain of the present application can be cultured in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and / or vitamin, etc., under aerobic or anaerobic conditions while controlling temperature, pH, etc.

[0097] In the present application, the carbon source may include, but is not limited to, carbohydrates such as glucose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamate, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar), and other appropriate amounts of carbon sources may be used without limitation. These carbon sources may be used alone or in combination of two or more.

[0098] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0099] The above-mentioned personnel may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc.

[0100] In addition, the medium may contain amino acids, vitamins, and / or appropriate precursors. Specifically, L-amino acids may be added to the culture medium of the strain. Specifically, glycine, glutamate, and / or cysteine ​​may be added, and L-amino acids such as lysine may be further added if necessary, but are not necessarily limited thereto.

[0101]

[0102] The above medium or precursor may be added to the culture in batch or continuous manner, but is not limited thereto.

[0103] In the present application, during the cultivation of the strain, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the culture in an appropriate manner to adjust the pH of the culture. In addition, during the cultivation, an antifoaming agent such as fatty acid polyglycol ester can be used to suppress bubble formation. Furthermore, to maintain the aerobic state of the culture, oxygen or an oxygen-containing gas can be injected into the culture, or to maintain anaerobic and microaerobic states, no gas can be injected, or nitrogen, hydrogen, or carbon dioxide gas can be injected.

[0104] The temperature of the culture may be between 25°C and 40°C, more specifically between 28°C and 37°C, but is not limited thereto. The culture period may continue until the desired amount of useful substance is produced, and is specifically between 1 hour and 100 hours, but is not limited thereto.

[0105]

[0106] The above glutathione manufacturing method may further include an additional process after the culturing step. The additional process may be appropriately selected depending on the glutathione's intended use.

[0107] Specifically, the glutathione production method may include a step of recovering glutathione from one or more materials selected from the strain, its dried product, extract, culture, and crushed product after the culturing step.

[0108] The above method may additionally include a step of lysing the strain prior to or concurrently with the recovery step. Lysis of the strain may be performed using methods commonly used in the technical field to which the present application pertains, such as a lysis buffer solution, a sonicator, heat treatment, and a French press. In addition, the lysis step may include, but is not limited to, an enzymatic reaction such as a cell wall-degrading enzyme, a nuclease, a nucleic acid transferase, or a protease.

[0109] For the purpose of the present application, the above glutathione manufacturing method can be used to manufacture dry yeast, yeast extract, yeast extract mix powder, and pure glutathione containing a high content of glutathione, but is not limited thereto, and can be manufactured appropriately depending on the intended product.

[0110] In this application, the term "dry yeast" may be used interchangeably with terms such as "strain dried product." The dry yeast may be produced by drying yeast cells that have accumulated glutathione, and may be specifically included in feed compositions, food compositions, etc., but is not limited thereto.

[0111] In this application, the term "yeast extract" may be used interchangeably with terms such as "strain extract." The strain extract may refer to the remaining material after separating the cell wall from the cells of the strain. Specifically, it may refer to the remaining component obtained by lysing the cells, excluding the cell wall. The strain extract includes glutathione, and other components may include, but are not limited to, one or more of proteins, carbohydrates, nucleic acids, and fibers.

[0112] The above recovery step can recover the target substance, glutathione, using a suitable method known in the art.

[0113] The above recovery step may include a purification process. The purification process may separate and purify only glutathione from the strain. Through the purification process, pure glutathione can be produced.

[0114] If necessary, the glutathione production method may further include a step of mixing a material selected from the strain obtained after the culturing step, its dried product, extract, culture, lysate, and glutathione recovered therefrom with an excipient. Through the mixing step, a yeast extract mix powder may be produced.

[0115] The above excipients can be appropriately selected and used depending on the intended use or form, and for example, can be selected from starch, glucose, cellulose, lactose, glycogen, D-mannitol, sorbitol, lactitol, maltodextrin, calcium carbonate, synthetic aluminum silicate, calcium monobasic phosphate, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, dextrin, sodium alginate, methylcellulose, colloidal silica gel, hydroxypropyl starch, hydroxypropyl methylcellulose, propylene glycol, casein, calcium lactate, Primogel, and gum arabic, and specifically, can be one or more ingredients selected from starch, glucose, cellulose, lactose, dextrin, glycogen, D-mannitol, and maltodextrin, but are not limited thereto.

[0116] The above excipients may include, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents, for example.

[0117]

[0118] Another aspect of the present application provides a use of the glutamate-cysteine ​​ligase variant for glutathione production. Another aspect of the present application provides a use of the microorganism for glutathione production. The glutamate-cysteine ​​ligase variant and the microorganism are as described above.

[0119]

[0120] Hereinafter, this application will be described in more detail through examples and experimental examples. However, these examples and experimental examples are intended to exemplify this application and the scope of this application is not limited to these examples and experimental examples.

[0121]

[0122] Example 1: Selection of glutathione-producing strains and confirmation of glutathione production capacity.

[0123] Strains were obtained from yeast containing various strains, improved, and strains with glutathione production ability were selected.

[0124] Specifically, grain samples such as rice, barley, mung beans, and oats were collected from 20 regions including Yongin, Icheon, Pyeongtaek, and Hwaseong in Gyeonggi Province, South Korea, ground, kneaded, wrapped in cloth, pressed firmly to shape, wrapped in straw, fermented for 10 days, and then slowly dried to produce nuruk.

[0125] To isolate various strains from the manufactured nuruk, the following experiment was performed. 45 ml of saline water was added to 5 g of nuruk and ground in a mixer. To isolate the pure yeast strain, serial dilution was performed and spread on YPD agar (yeast extract 10 g / L, bacto peptone 20 g / L, glucose 20 g / L, based on 1 liter of distilled water) and cultured at 30°C for 48 hours. Then, yeast colonies were streaked on YPD agar through colony morphology and microscopic examination. 25 ml of YPD broth was dispensed into a 250 ml Erlenmeyer flask, and the pure isolated strain was inoculated. The strain was screened by shaking (30°C, 200 rpm) for 48 hours to confirm glutathione production.

[0126] To improve the strains initially isolated, random mutations were induced in the isolated strains. Specifically, among the yeast isolated from the above-mentioned nuruk, a strain confirmed to produce glutathione was isolated and named the CJ-37 strain. The CJ-37 strain was cultured on solid media, then inoculated into broth to obtain a culture solution, and the cells were irradiated with UV light using a UV lamp. Afterwards, the UV-irradiated culture solution was spread on a plate medium, and only the mutant strains that formed colonies were isolated and obtained, and their glutathione production was confirmed.

[0127] As a result, the strain showing the best glutathione production among the mutant strains was selected as a glutathione-producing strain and named CJ-5 strain. It was deposited with the Korean Culture Center of Microorganisms (KCCM), an international depository under the Budapest Treaty, on July 31, 2019, and assigned the deposit number KCCM12568P.

[0128]

[0129] Example 2: Additional improvement experiments to increase glutathione production.

[0130] To further improve the glutathione production capacity of the CJ-5 strain, mutations were induced as follows.

[0131] The CJ-5 strain was cultured on solid medium, then inoculated into broth to obtain a culture solution, and the cells were irradiated with UV using a UV lamp. Afterwards, the UV-irradiated culture solution was spread on a plate medium, and only the mutant strains that formed colonies were isolated and obtained. The strain with the greatest improvement in glutathione production was isolated and named strain CC02-2490, and deposited with the Korean Culture Center of Microorganisms (KCCM), an international depository under the Budapest Treaty, on January 17, 2020, and assigned the accession number KCCM12659P. As a result of analyzing the base sequence of the glutathione biosynthetic gene gsh1 in relation to the increased glutathione production ability of the strain, it was confirmed that cysteine, the 86th amino acid of the GSH1 protein encoded by the gsh1 gene, was substituted with arginine.

[0132]

[0133] Example 3: GSH1 C86 residue mutation experiment

[0134] From the results of Example 2 above, it was determined that position 86 of the GSH1 protein would be important for glutathione production, and mutant strains of Saccharomyces cerevisiae CEN.PK2-1D and Saccharomyces cerevisiae CJ-5 strains were produced to express mutant proteins in which the 86th cysteine ​​amino acid of the GSH1 protein was substituted with a different amino acid, and it was attempted to confirm whether glutathione production increased.

[0135] To construct a strain in which cysteine ​​at position 86 of the GSH1 protein of Saccharomyces cerevisiae was substituted with arginine, the pWAL100 and pWBR100 plasmids were used with reference to the paper by Lee TH, et al. (J. Microbiol. Biotechnol. (2006), 16(6), 979-982). Specifically, PCR was performed as follows using the genomic DNA of the CJ-5 strain as a template. By performing PCR using primers of SEQ ID NO: 22 and SEQ ID NO: 23, a partial sequence of the GSH1 N-terminal including the N-terminal BamHI flanking sequence, the start codon of the GSH1 ORF, and the C86R mutant coding sequence was secured, and by using primers of SEQ ID NO: 24 and SEQ ID NO: 25, a partial sequence of the GSH1 C-terminal including the C-terminal XhoI flanking sequence, the GSH1 ORF stop codon, and the C86R mutant coding sequence was secured. Afterwards, using these two sequences as templates and performing overlap PCR using SEQ ID NO: 22 and SEQ ID NO: 25, a GSH1 ORF fragment including the coding sequence of the GSH1 mutant protein in which the 86th cysteine ​​is substituted with arginine, the N-terminal BamHI, and the C-terminal XhoI restriction enzyme sequences were secured. The above ORF fragment was cloned into the pWAL100 vector treated with the same enzymes after BamHI and XhoI treatment, thereby producing the pWAL100-GSH1(C86R) vector.

[0136] In addition, PCR was performed using the genomic DNA of the CJ-5 strain as a template and primers of SEQ ID NO: 26 and SEQ ID NO: 27 to secure 500 bp after the GSH1 ORF stop codon, including the N-terminal SpeI and C-terminal NcoI restriction enzyme sequences, and treated with SpeI and NcoI restriction enzymes. Afterwards, the vector was cloned into pWBR100 treated with the same restriction enzymes to produce the pWBR100-GSH1 vector.

[0137] Finally, to produce a DNA fragment to be introduced into yeast, a PCR product containing an arginine mutation coding sequence and a part of KlURA3 was obtained using the primers of SEQ ID NO: 22 and SEQ ID NO: 28 using the previously produced pWAL100-GSH1 (C86R) vector as a template, and a PCR product containing a part of KlURA3 and 500 bp after the GSH1 stop codon was obtained using the primers of SEQ ID NO: 29 and SEQ ID NO: 27 using the pWBR100-GSH1 vector as a template. Then, each PCR product was transformed into S. cerevisiae CEN.PK2-1D and S. cerevisiae CJ-5 at the same molar ratio. PCR was performed at 95℃ for 5 minutes of heat denaturation, 53℃ for 1 minute of binding, and 72℃ for 1 minute per 1 kb of polymerization. Yeast transformation was performed using the lithium acetate method modified from Geitz's paper (Nucleic Acid Research, 20(6), 1425). Specifically, yeast cells with an OD of 0.7 to 1.2 were washed twice with lithium acetate / TE buffer, and the PCR products and single-stranded DNA (Sigma D-7656) were mixed together. The cells were incubated in lithium acetate / TE / 40% PEG buffer at 30℃ for 30 minutes and at 42℃ for 15 minutes. The cells were then cultured on SC (2% glucose) agar plates without uracil until colonies were visible to obtain a strain into which the GSH1 C86R mutant coding sequence and the KlURA3 gene were introduced. Afterwards, to remove KlURA3, each strain was cultured overnight in 2 ml of YPD, diluted 1 / 100, and spread on SC (2% glucose) agar plates containing 0.1% 5-FOA to obtain S. cerevisiae CEN.PK2-1D GSH1 C86R mutant strain with the uracil marker removed and S.A cerevisiae CJ-5 GSH1 C86R mutant strain was constructed. A strain capable of expressing a GSH1 mutant protein substituted with 18 amino acids other than arginine was constructed in the same manner, except that a primer pair was used in which the arginine coding sequence at position 86 in the primer sequences of SEQ ID NOs. 23 and 24 was substituted with a sequence encoding a different amino acid.

[0138]

[0139] Primer 5'→3' sequence F_BamHI_GSH1 (SEQ ID NO: 22) GGTAGGATCCATGGGACTCTTAGCTTTGGGCACR_GSH1_C86R (SEQ ID NO: 23) TTAGCCTCCCTAAGGGACGAATCCTF_GSH1_C86R (SEQ ID NO: 24) CGTCCCTTAGGGAGGCTAACGATGTR_XhoI_GSH1 (SEQ ID NO: 25) ATGACTCGAGTTAACATTTGCTTTCTATTGAAGGCF_SpeI_GSH1_DW (SEQ ID NO: 26) TAGAACTAGTACTCCTTTTATTTCGGTTGTGAAR_NcoI_GSH1_DW (SEQ ID NO: 27) GCTGCCATGGGAATAGTGTGAACCGATAACTGTGTR_AL killer (SEQ ID NO: 28) GAGCAATGAACCCAATAACGAAATCTTF_BR killer (SEQ ID NO: 29)CTTGACGTTCGTTCGACTGATGAG

[0140]

[0141] The results of measuring the concentration of glutathione (GSH) produced by culturing each strain produced above for 26 hours are shown in Tables 2 and 3.

[0142]

[0143]

[0144]

[0145] Experimental results showed that replacing cysteine ​​at position 86 of the GSH1 protein with another amino acid increased glutathione production by up to 27% compared to the case where the wild-type GSH1 protein was included.

[0146] This shows that a GSH1 mutant in which cysteine ​​at position 86 of the GSH1 protein is replaced with another amino acid significantly increases glutathione production capacity.

[0147]

[0148] Example 4: Determining the Effect of Different Cys Residues on Glutathione Production

[0149] As a comparative example, the glutathione production ability was confirmed by introducing mutations into other Cys residues of the GSH1 protein, and the results are shown in Table 4.

[0150]

[0151]

[0152]

[0153]

[0154] The experimental results showed that cysteine ​​residues other than cysteine ​​86 did not have an effect of increasing glutathione production, and instead showed a tendency to decrease glutathione production.

[0155] This demonstrates that not all cysteine ​​residues within a protein exhibit increased glutathione production. Furthermore, it confirms that the novel GSH1 variant developed in this application exhibits increased glutathione production.

[0156] Yeast that produces glutathione in high quantities, its dried product, extract, culture, crushed product and produced glutathione have antioxidant effects, detoxification effects and immunity-enhancing effects and can be usefully used in cosmetic compositions, food compositions, feed compositions, pharmaceutical compositions and their manufacture.

[0157]

[0158] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

[0159]

[0160]

Claims

OCR1.Veriant glutamate-cysteine ​​ligase in which the amino acid corresponding to position 86 from the N end of the amino acid sequence SEQIDNO:1 is replaced by a different amino acid.2.Veriant glutamate-cysteine ​​ligase according to claim 1, in which the amino acid corresponding to position 86 is replaced by glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, tyrosine, asparagine, glutamate, glutamine, aspartate, lysine, arginine, or histidine.3.Veriant glutamate-cysteine ​​ligase Cysteine ​​ligase pursuant to claim 1, where the variant has an identical origin sequence equal to or greater than 80% and less than 100% of the amino acid sequence of SEQIDNOS:

14. Glutamate-cysteine ​​ligase pursuant to claim 1, where the variant consists of one sequence of amino acids selected from SEQIDNOS:3 to 215. Polynucleotide encoding the glutamate-cysteine ​​ligase pursuant to any one of claims 1 to 46. Vector composed of polynucleotides pursuant to claim 57.Glutathione-producing microorganisms comprising at least one of: variant glutamate-cysteine ​​ligase under any of claims 1 through 4; polynucleotide encoding the variant; and vectors comprising the polynucleotide.

8. Microorganisms under claim 7, where the microorganism is of the genus Saccharomyces.

9. Microorganisms under claim 7, where the microorganism is Saccharomyces cerevisiae.

10. Microorganisms under claim 7, where the microorganism is of the genus Saccharomyces. Patent No. 7, in which the microorganism is the strain Saccharomyces cerevisiae deposited with access number KCCM12659P11. The method of glutathione production, which involves the cultivation of the microorganism containing at least one of the following: variant glutamate-cysteine ​​ligase according to one of the claims 1 to 4; polynucleotide encoding the variant; and a vector containing the polynucleotide, in a culture medium.12.The method under claim 11, which includes the recovery of glutathione from at least one selected cultured microbial product, dried microbial product, microbial extract, microbial culture, and microbial lysate;