Mutants of the glutamate dehydrogenase gene promoter and their applications.

Abstract

Invention details;

Description

Mutants of glutamate dehydrogenase gene promoter and their applications Technical field:

[0001] The present disclosure belongs to the field of biotechnology, and particularly relates to mutants of a glutamate dehydrogenase gene promoter and applications thereof. Background technology:

[0002] Amino acids, including glutamic acid, lysine, and proline, are essential building blocks of protein for animal nutrition and are widely used in industries such as medicine, healthcare, food, animal feed, and cosmetics. They are primarily produced using microbial fermentation. Currently, the main production strains include microorganisms from the genera Enterobacter and Corynebacterium. Due to the physiological advantages of Corynebacterium, Corynebacterium has become the most important production strain in industry. With the continuous development of biotechnology, reports on metabolic engineering of Corynebacterium to increase its amino acid production are increasing. These modifications include enhancing the expression of enzymes involved in amino acid synthesis pathways and reducing the expression of enzymes involved in competitive pathways.

[0003] Glutamate dehydrogenase (encoded by the gdh gene) catalyzes α-ketoglutarate to produce glutamate and is a key enzyme in glutamate biosynthesis. Glutamate is also a precursor or important metabolite for the synthesis of proline, lysine, etc. It has been reported in the literature that enhancing the expression of key enzymes (e.g., glutamate dehydrogenase) in the synthesis pathway of the target product can increase the production of glutamate, lysine, proline, arginine, etc. in the strain. [1-4] . Those skilled in the art are aware that there are many ways to enhance enzyme expression, such as increasing the copy number, replacing a strong promoter, and so on. Since increasing the copy number will increase the burden on the strain to a certain extent, which may lead to genomic instability of the strain, and the promoter does not have the above defects in regulating gene expression, therefore, in order to improve the production efficiency of amino acids in Corynebacterium, the art needs to develop a rich promoter element to moderately enhance the expression of target genes such as gdh, thereby improving the production efficiency of amino acids and their derivatives in the strain.

[0004] References:

[0005] [1]WO0053726A1

[0006] [2]JP61268185A

[0007] [3]CN1262640C

[0008] [4]Keleshyan, SK et al., Influence of Glutamate Dehydrogenase Activity on L-Proline Synthesis, APPLIED BIOCHEMISTRY AND MICROBIOLOGY, 2017, 53(5):518-523).

[0009] Summary of the invention:

[0010] In a first aspect, the present disclosure provides mutants of the glutamate dehydrogenase gene promoter, wherein mutant (i) has a mutated nucleotide at one or more positions corresponding to positions 479-482 of the nucleotide sequence shown in SEQ ID NO: 30, and has a mutated nucleotide at one or more positions corresponding to positions 499-501 of the nucleotide sequence shown in SEQ ID NO: 30.

[0011] The term "mutant" in the present disclosure refers to a polynucleotide comprising an alteration (i.e., a substitution, insertion, and / or deletion) at one or more (e.g., several) positions relative to a "wild type" or "compared" polynucleotide or polypeptide, wherein a substitution refers to replacing the nucleotide occupying a position with a different nucleotide. A deletion refers to the removal of a nucleotide occupying a position. An insertion refers to the addition of a nucleotide adjacent to and immediately following the nucleotide occupying the position.

[0012] Specifically, the mutant of the Corynebacterium glutamicum glutamate dehydrogenase gene promoter has mutated nucleotides at one, two, three or four positions corresponding to positions 479-482 of the nucleotide sequence shown in SEQ ID NO: 30, and has mutated nucleotides at one, two or three positions corresponding to positions 499-501 of the nucleotide sequence shown in SEQ ID NO: 30. Furthermore, the mutant of the Corynebacterium glutamicum glutamate dehydrogenase gene promoter has enhanced promoter activity compared to the Corynebacterium glutamicum glutamate dehydrogenase gene promoter.

[0013] In some embodiments, the mutant comprises a substituted nucleotide. Substitution is a mutation caused by replacing a base in a nucleotide with another different base, also known as a base substitution mutation or a point mutation.

[0014] In some embodiments, mutant (ii) comprises the reverse complement of the nucleotide sequence shown in (i).

[0015] In some embodiments, mutant (iii) comprises the reverse complement of a sequence that hybridizes to the nucleotide sequence shown in (i) or (ii) under high stringency hybridization conditions or very high stringency hybridization conditions.

[0016] In some embodiments, mutant (iv) comprises a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence shown in (i) or (ii). Specifically, a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity compared to the nucleotide sequence shown in (i) or (ii).

[0017] Furthermore, the mutant shown in any one of (i)-(iv) is not aattctttgtggtcatatctgtgcgacactgccataattgaacgtg at the nucleotide sequence at positions 469-514 corresponding to the sequence shown in SEQ ID NO: 30; and, compared with the glutamate dehydrogenase gene promoter of the sequence shown in SEQ ID NO: 30, the mutant shown in any one of (i)-(iv) has enhanced promoter activity.

[0018] In some embodiments, according to the mutant of the glutamate dehydrogenase gene promoter described in the present disclosure, its nucleotide sequence is mutated at positions 479-482 corresponding to SEQ ID NO: 30 and mutated at positions 499-501 corresponding to SEQ ID NO: 30.

[0019] Further, a mutation at positions 479-482 corresponding to SEQ ID NO: 30 refers to a mutation at one or more bases at positions 479, 480, 481, or 482 corresponding to SEQ ID NO: 30, and a mutation at positions 499-501 corresponding to SEQ ID NO: 30 refers to a mutation at one or more bases at positions 499, 500, 501 corresponding to SEQ ID NO: 30.

[0020] In some embodiments, the mutant of the glutamate dehydrogenase gene promoter according to the present disclosure has an enhanced promoter activity of 2-47 times or more compared to the glutamate dehydrogenase gene promoter of the sequence shown in SEQ ID NO: 30.

[0021] In some embodiments, according to the mutant of the glutamate dehydrogenase gene promoter described in the present disclosure, the nucleotide sequence of the promoter core region is one of the following sequences:

[0022]

[0023] In some embodiments, the nucleotide sequence of the mutant of the glutamate dehydrogenase gene promoter according to the present disclosure is as shown in any one of SEQ ID NOs: 1-29.

[0024] The mutant glutamate dehydrogenase gene promoter is a nucleotide molecule with promoter activity. The term "promoter" refers to a nucleic acid molecule typically located upstream of the target gene's coding sequence, providing a recognition site for RNA polymerase and located 5' upstream of the mRNA transcription start site. It is an untranslated nucleic acid sequence that RNA polymerase binds to and initiates transcription of the target gene.

[0025] The "promoter core region" refers to a nucleic acid sequence located on a promoter in prokaryotes, which is a core sequence region that exerts promoter function, mainly including the -35 region, the -10 region, the region between the -35 region and the -10 region, and the transcription start site. The -35 region is the recognition site for RNA polymerase, and the -10 region is the binding site for RNA polymerase. The mutant of the promoter disclosed herein is an improved promoter of the gdh gene of Corynebacterium glutamicum, which has higher promoter activity than the wild-type promoter, such as an increase of at least 2.3 times, preferably 3.3 times, 5 times, or 8 times, more preferably 10 times, 11 times, 12 times, 13 times, or 14 times, and most preferably 40 times or 45 times.

[0026] Promoter nucleic acid molecules of the present invention can be separated or prepared using standard molecular biology techniques. For example, suitable primer sequences can be used to separate promoter nucleic acid molecules of the present invention by PCR. In addition, automatic DNA synthesizers can also be used to prepare promoter nucleic acid molecules of the present invention by standard synthesis techniques.

[0027] In a second aspect, the present disclosure provides an expression cassette and a recombinant vector comprising the mutant of the glutamate dehydrogenase gene promoter.

[0028] The “expression cassette” has the meaning generally understood by those skilled in the art, ie, an element containing a promoter, a target gene and capable of expressing the target gene.

[0029] The term "vector" refers to a DNA construct comprising a DNA sequence operably linked to appropriate control sequences to express a gene of interest in a suitable host. The vector used in the present disclosure is not particularly limited and may be any vector known in the art, as long as it is capable of replicating in the host. Specifically, the vector includes, but is not limited to, plasmids and bacteriophages, such as the pEC-XK99E plasmid used in the specific examples of the present disclosure. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases, integrate into the genome itself.

[0030] In a third aspect, the present disclosure provides a recombinant host cell containing the mutant, expression cassette or recombinant vector of the glutamate dehydrogenase gene promoter.

[0031] Recombinant host cells are specifically achieved by transformation. "Transformation" as used herein has the meaning generally understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. The transformation method includes any method for introducing nucleic acid into a cell, including but not limited to electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0032] The “host cell” described in the present disclosure has the meaning generally understood by those of ordinary skill in the art, that is, a cell into which the nucleic acid with promoter activity of the present disclosure can be introduced, which is called a recombinant host cell after the introduction. In other words, the present disclosure can utilize any host cell, as long as the nucleic acid with promoter activity of the present disclosure is contained in the cell and is operably connected to a certain gene to mediate the transcription of the gene. The host cell of the present disclosure can be a prokaryotic cell or a eukaryotic cell. In some embodiments, the host cell in the present disclosure can be any type of strain with the ability to produce the target product, including wild-type strains and recombinant strains. Exemplarily, the host cell is derived from a microorganism suitable for fermentation to produce target products such as amino acids and organic acids, such as Enterobacter, Corynebacterium, Brevibacterium, Arthrobacter, Microbacterium, etc.

[0033] In some preferred embodiments, the host cell is an enterobacterium or a corynebacterium, more preferably Corynebacterium glutamicum, including but not limited to Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and derivative strains of the L-amino acids produced by the above-mentioned strains.

[0034] In a specific embodiment of the present disclosure, the host cell is Corynebacterium glutamicum, which is further modified by introducing a G149K mutation coding sequence into the glutamate kinase ProB encoding gene in the bacteria to relieve the feedback inhibition of proline. In some more specific embodiments, in the strain that relieves the feedback inhibition of proline, the glutamate kinase proB is further overexpressed using the pyc promoter. G149K The expression cassettes for glutamate-5-semialdehyde dehydrogenase proA and pyrrole-5-carboxylate dehydrogenase proC are integrated into the proline dehydrogenase / pyrrole-5-carboxylate dehydrogenase putA gene to obtain a proline-producing strain. Preferably, the pyc promoter is an enhanced mutant promoter thereof. More preferably, the core region sequence is shown in SEQ ID NO: 68. More preferably, the sequence of the pyc promoter is shown in SEQ ID NO: 69. This allows for more efficient proline production.

[0035] In other embodiments, the host cell may also be other types of amino acid-producing strains. "Amino acid-producing strains" as used herein refer to bacteria that can produce and accumulate amino acids when cultured in a culture medium, or that can secrete amino acids into the culture medium, that is, that can produce free amino acids extracellularly. For example, these may be naturally occurring amino acid-producing strains or engineered amino acid-producing strains obtained through genetic modification.

[0036] In some embodiments, the host cell of producing Methionin can be a bacterial strain expressing the aspartokinase that releases feedback inhibition on the basis of Corynebacterium glutamicum ATCC 13032. In addition, the host cell of producing Methionin can also be a derivative strain with Methionin production capacity.

[0037] In some embodiments, the lysine-producing host cell may further comprise one or more genes selected from, but not limited to, the following, which are attenuated or have reduced expression:

[0038] a. adhE gene encoding alcohol dehydrogenase;

[0039] b. ackA gene encoding acetate kinase;

[0040] c. pta gene encoding phosphate acetyltransferase;

[0041] d. ldhA gene encoding lactate dehydrogenase;

[0042] e. focA gene encoding formate transporter;

[0043] f. pflB gene encoding pyruvate formate lyase;

[0044] g. poxB gene encoding pyruvate oxidase;

[0045] h. thrA gene encoding the bifunctional aspartate kinase I / homoserine dehydrogenase I enzyme;

[0046] i. thrB gene encoding homoserine kinase;

[0047] j. ldcC gene encoding lysine decarboxylase; and

[0048] h. cadA gene encoding lysine decarboxylase.

[0049] In some embodiments, the lysine-producing host cell may further include, but is not limited to, one or more genes selected from the following genes that are enhanced or overexpressed:

[0050] a. dapA gene encoding dihydrodipyridine synthase that relieves lysine feedback inhibition;

[0051] b. dapB gene encoding dihydrodipicolinate reductase;

[0052] c. ddh gene encoding diaminopimelate dehydrogenase;

[0053] d. dapD encoding tetrahydropicolinate succinylase and dapE encoding succinyldiaminopimelate deacylase;

[0054] e. asd gene encoding aspartate semialdehyde dehydrogenase;

[0055] f. ppc gene encoding phosphoenolpyruvate carboxylase;

[0056] g. pntAB gene encoding nicotinamide adenine dinucleotide transhydrogenase;

[0057] i. lysE gene encoding the lysine transport protein.

[0058] Exemplarily, the host cell is a host cell for producing threonine. In some embodiments, the host cell for producing threonine is a bacterial strain expressing the aspartokinase LysC that releases feedback inhibition on the basis of Corynebacterium glutamicum ATCC 13032. In other embodiments, the host cell for producing threonine can also be a bacterial strain of other types with threonine production capacity.

[0059] In some embodiments, one or more genes selected from the following are enhanced or overexpressed in the threonine-producing host cell:

[0060] a. thrABC genes encoding the threonine operon;

[0061] b. hom gene encoding homoserine dehydrogenase that relieves feedback inhibition;

[0062] c. gap gene encoding glyceraldehyde-3-phosphate dehydrogenase;

[0063] d. pyc gene encoding pyruvate carboxylase;

[0064] e. mqo gene encoding malate:quinone oxidoreductase;

[0065] f. tkt gene encoding transketolase;

[0066] g. gnd gene encoding 6-phosphogluconate dehydrogenase;

[0067] h. thrE gene encoding threonine export;

[0068] i. eno gene encoding enolase.

[0069] Exemplarily, the host cell is an isoleucine-producing host cell. In some embodiments, the isoleucine-producing host cell is a strain that produces L-isoleucine by replacing the amino acid at position 323 of the L-threonine dehydratase ilvA gene with alanine. In other embodiments, the isoleucine-producing host cell may also be other strains capable of producing isoleucine.

[0070] Exemplarily, the host cell is a host cell for producing O-acetyl homoserine. In some embodiments, the host cell for producing O-acetyl homoserine is a bacterial strain that produces O-acetyl homoserine by inactivating O-acetyl homoserine (thiol)-lyase. In other embodiments, the host cell for producing O-acetyl homoserine can also be a bacterial strain of other types with O-acetyl homoserine production capacity.

[0071] Exemplarily, the host cell is a methionine-producing host cell. In some embodiments, the methionine-producing host cell is a strain that produces methionine by inactivating transcriptional regulators of methionine and cysteine. In other embodiments, the methionine-producing host cell can also be other strains with methionine production capacity.

[0072] In the present disclosure, the host cells can be cultured according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0073] In a fourth aspect, the present disclosure provides a use of the mutant of the glutamate dehydrogenase gene promoter according to the first aspect, the expression cassette or expression vector according to the second aspect, and the recombinant host cell according to the third aspect in at least one of the following (a)-(c):

[0074] (a) enhancing the transcription level of a gene, or preparing a reagent or kit for enhancing the transcription level of a gene;

[0075] (b) preparing a protein, or preparing a reagent or kit for preparing a protein;

[0076] (c) producing a target product, or preparing a reagent or kit for producing a target product.

[0077] In some embodiments, the protein is a protein associated with the synthesis of a target product, a protein associated with membrane transport, or a gene expression regulatory protein.

[0078] In some embodiments, the target product can be selected from at least one of amino acids and their derivatives, and can also be selected from other types of compounds that can be obtained through biosynthesis in the art.

[0079] Illustratively, the amino acids and their derivatives include, but are not limited to, one or a combination of two or more of the following: proline, hydroxyproline, lysine, glutamic acid, arginine, ornithine, glutamine, threonine, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, methionine, aspartic acid, asparagine, histidine, phenylalanine, tyrosine, tryptophan, 5-aminolevulinic acid, or a derivative of any of the foregoing amino acids.

[0080] In a fifth aspect, the present disclosure provides a method for enhancing the expression of a target gene, the method comprising operably linking the mutant of the glutamate dehydrogenase gene promoter to the target gene.

[0081] The term "operably linked" in this disclosure refers to the functional connection between the mutant of the glutamate dehydrogenase gene promoter disclosed herein and the coding gene to initiate and mediate transcription of the gene, indicating that the mutant of the glutamate dehydrogenase gene promoter disclosed herein and the coding gene are operably linked to control the transcriptional activity of the operon gene. The operably linked method can be any method described by those skilled in the art. The method of enhancing target gene expression described in this disclosure utilizes the mutant of the glutamate dehydrogenase gene promoter disclosed herein and is implemented using methods commonly used by those skilled in the art.

[0082] Exemplarily, the encoding gene includes, but is not limited to, a gene encoding a protein related to the synthesis of the target product, a gene encoding a protein related to membrane transport, or a gene encoding a gene expression regulatory protein.

[0083] In some embodiments, mutants of the glutamate dehydrogenase gene promoter are used to express genes related to amino acid synthesis. Exemplarily, mutants of the glutamate dehydrogenase gene promoter can be used to express other genes in Corynebacterium or Enterobacterium, including but not limited to genes related to amino acid synthesis, such as glutamate dehydrogenase Gdh, aspartate kinase LysC, threonine operon ThrABC, aspartate semialdehyde dehydrogenase Asd, aspartate ammonia lyase AspB, homoserine dehydrogenase Hom, homoserine O-acetyltransferase MetX, dihydrodipicolinate synthase DapA, dihydropicolinate reductase DapB, meso- Diaminopimelate dehydrogenase Ddh, glutamate kinase ProB, glutamate-5-semialdehyde dehydrogenase ProA, pyrrole-5-carboxylate dehydrogenase ProC, proline dehydrogenase / pyrrole-5-carboxylate dehydrogenase PutA, glutamyl t-RNA reductase hemA, pyruvate carboxylase Pyc, phosphoenolpyruvate carboxylase Ppc, amino acid transport protein, ptsG system-related protein, pyruvate dehydrogenase AceE, glyceraldehyde-3-phosphate dehydrogenase GapN, lysine decarboxylase CadA or LdcC, etc.

[0084] In one embodiment, the encoding gene is a glutamate dehydrogenase gene, which can catalyze α-ketoglutarate to produce glutamate and is a key enzyme in glutamate biosynthesis. At the same time, since glutamate is a precursor for the synthesis of proline, lysine, etc., a large number of literature reports have shown that enhancing the expression of glutamate dehydrogenase can increase the production of glutamate, proline, lysine, etc. in the strain. [1-4] The series of strong promoter elements disclosed herein can be used to moderately regulate the expression of target genes and achieve efficient production of target products.

[0085] Furthermore, in a sixth aspect, the present disclosure provides a method for preparing a protein, wherein the method comprises the step of expressing the protein using the expression cassette or expression vector described in the second aspect, or the recombinant host cell described in the third aspect; optionally, the protein is a protein related to the synthesis of a target product, a protein related to membrane transport, or a gene expression regulatory protein;

[0086] Optionally, the method further comprises the step of isolating or purifying the protein.

[0087] Furthermore, in a seventh aspect, the present disclosure provides a method for producing a target product, comprising culturing a host cell containing a mutant of the glutamate dehydrogenase gene promoter described in the first aspect operably linked to a gene related to the synthesis of the target product, and collecting the produced target product.

[0088] In some embodiments, the target product is an amino acid, and the method for producing the amino acid comprises culturing a host cell containing a mutant of the glutamate dehydrogenase gene promoter operably linked to a gene encoding glutamate dehydrogenase, and collecting the produced amino acids. The amino acids include proline, lysine, glutamic acid, hydroxyproline, arginine, ornithine, and glutamine. More preferably, the genes associated with amino acid production include, but are not limited to, gdh gene, lysC gene, thrABC gene, asd gene, aspB gene, hom gene, metX gene, dapA gene, dapB gene, ddh gene, proB gene, proA gene, proC gene, putA gene, hemA gene, pyc gene, ppc gene, lysE gene, ptsG gene, ptsI gene, aceE gene, gapN gene, and the like. By the method disclosed herein, the production of amino acids, particularly proline, lysine, glutamic acid, hydroxyproline, arginine, ornithine, glutamine, threonine, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, methionine, aspartic acid, asparagine, histidine, phenylalanine, tyrosine, tryptophan, 5-aminolevulinic acid, or derivatives of any of the above amino acids, of the strain can be increased.

[0089] The amino acid production method disclosed herein utilizes the mutant glutamate dehydrogenase gene promoter disclosed herein and employs methods commonly used by those skilled in the art, and also includes a step of recovering the amino acids from cells or culture medium. Methods for recovering amino acids from cells or culture medium are well known in the art and include, but are not limited to, filtration, anion exchange chromatography, crystallization, and HPLC.

[0090] Beneficial effects of the present disclosure: The nucleic acid molecule with enhanced promoter activity provided by the present disclosure exhibits higher promoter activity than the wild type, and can be used to enhance the expression of target genes. For example, when operably linked to the gdh gene, etc., it can enhance the expression intensity of proteins related to the synthesis of target products, such as glutamate dehydrogenase, thereby improving the production efficiency of amino acids and organic acids in the recombinant strain, and has high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] Figure 1: Plasmid map of the pEC-XK99E-Pgdh-rfp plasmid.

[0092] Figure 2: Fluorescence screening plate for gdh promoter mutants. DETAILED DESCRIPTION

[0093] Definition of terms

[0094] When used in conjunction with the term "comprising" in the claims and / or the specification, the word "a" or "an" can mean "one", but can also mean "one or more", "at least one" and "one or more than one".

[0095] As used in the claims and description, the words "comprising," "having," "including," or "containing" are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0096] Throughout this application, the term "about" indicates that a value includes the standard deviation of error for the device or method being employed to determine the value.

[0097] Although the disclosure supports a definition of the term "or" as only alternatives as well as "and / or," the term "or" in the claims means "and / or" unless explicitly stated as only alternatives or as mutually exclusive between alternatives.

[0098] When used in the claims or description, a selected / optional / preferred "numerical range" includes both the numerical endpoints at both ends of the range and all natural numbers covered between the numerical endpoints relative to the aforementioned numerical endpoints.

[0099] As used in the present disclosure, the terms "nucleic acid molecule" and "polynucleotide" refer to polymers composed of nucleotides. Nucleic acid molecules and polynucleotides can be in the form of separate fragments or can be a component of a larger nucleotide sequence structure, which is derived from a nucleotide sequence separated at least once in quantity or concentration, and can be identified, manipulated, and recovered by standard molecular biology methods (e.g., using cloning vectors) and sequences and their component nucleotide sequences. When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C), wherein "U" replaces "T". In other words, "polynucleotide" refers to a nucleotide polymer removed from other nucleotides (separate fragments or entire fragments), or can be a component or ingredient of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences.

[0100] As used in this disclosure, the terms "target gene" and "gene of interest" can be used interchangeably.

[0101] As used herein, the term "wild-type" refers to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism, can be isolated from a source in nature, and has not been intentionally modified by humans in the laboratory is naturally occurring. As used herein, "naturally occurring" and "wild-type" are synonyms.

[0102] As used in the present disclosure, the terms "sequence identity" and "percentage identity" refer to the percentage of identical (i.e., identical) nucleotides or amino acids between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides can be determined by the following method: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions containing the same nucleotide or amino acid residue in the aligned polynucleotides or polypeptides is scored, and compared with the number of positions containing different nucleotides or amino acid residues in the aligned polynucleotides or polypeptides. A polynucleotide can differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or missing nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or two polynucleotides). A polypeptide can differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or missing amino acids (i.e., amino acid insertions or amino acid deletions in one or two polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotides or polypeptides. For example, percent identity can be calculated by dividing the number of positions containing the identical nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

[0103] In some embodiments, two or more sequences or subsequences have a "sequence identity" or "percent identity" of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% nucleotides when compared and aligned for maximum correspondence using a sequence comparison algorithm or as measured by visual inspection. In certain embodiments, the sequences are substantially identical over the entire length of either or both compared biopolymers (e.g., polynucleotides).

[0104] As used in this disclosure, the term "complementary" refers to hybridization or base pairing between nucleotides or between nucleotides, such as between the two strands of a double-stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single-stranded nucleotide being sequenced or amplified.

[0105] As used herein, the term "high stringency conditions" refers to prehybridization and hybridization for probes of at least 100 nucleotides in length, following standard Southern blotting procedures, at 42° C. for 12 to 24 hours in 5X SSPE (saline sodium phosphate EDTA), 0.3% SDS, 200 micrograms / ml sheared and denatured salmon sperm DNA, and 50% formamide. Finally, the support material is washed three times for 15 minutes each at 65° C. using 2X SSC, 0.2% SDS.

[0106] As used herein, the term "very high stringency conditions" refers to prehybridization and hybridization for probes of at least 100 nucleotides in length, following standard Southern blotting procedures, at 42° C. for 12 to 24 hours in 5X SSPE (saline sodium phosphate EDTA), 0.3% SDS, 200 micrograms / ml sheared and denatured salmon sperm DNA, and 50% formamide. The carrier material is finally washed three times for 15 minutes each at 70° C. using 2X SSC, 0.2% SDS.

[0107] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used to implement or test this disclosure, the methods and materials provided herein are preferred.

[0108] The present disclosure will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present disclosure and are not used to limit the scope of the present disclosure. The experimental techniques and experimental methods used in the examples are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples for which specific conditions are not specified are generally carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0109] Example 1. Construction of a plasmid characterizing the strength of the gdh gene promoter of Corynebacterium glutamicum

[0110] In order to characterize the strength of the gdh gene promoter of Corynebacterium glutamicum, the present invention first constructs a characterization vector. Based on the pEC-XK99E plasmid backbone, the gdh gene promoter expresses the 60 amino acids at the N-terminus of the gdh gene, a connecting peptide, and a red fluorescent protein gene. Based on the published genome sequence of Corynebacterium glutamicum ATCC13032 and the gdh gene annotation information, primers gdh-F / R were designed. Using the ATCC13032 genome as a template, a DNA fragment of the gdh gene promoter and the N-terminal 180bp was obtained by PCR amplification. The pEC-XK99E-rfp reported in the literature was used as the primer. [5]Using the plasmid as a template, pEC-F / R primers were used to amplify DNA fragments containing the pEC-XK99E plasmid backbone, linker peptide, and red fluorescent protein gene. These two fragments were cloned and ligated using a Novozymes One-Step Recombination Kit to generate the pEC-XK99E-Pgdh-rfp characterization vector, the plasmid map of which is shown in Figure 1. The primer sequences used are listed in Table 1.

[0111] Table 1

[0112]

[0113]

[0114] Example 2. Screening and Strength Characterization of Corynebacterium glutamicum gdh Gene Promoter Mutants

[0115] (1) Construction of a Corynebacterium glutamicum gdh gene promoter mutant library

[0116] The present disclosure mutates the core region "AATTCTTTGTGGTCATATCTGTGCGACACTGCCATAATTGAACGTG" of the gdh gene promoter of Corynebacterium glutamicum, wherein the underlined portions are the main sequences of the -35 region and -10 region of the promoter, respectively. The present disclosure mutates "AATTCTTTGTNNNNATATCTGTGCGACACTNNNATAATTGAACGTG" at the corresponding positions of the above core region, and uses gdh-M1 / M2 and gdh-M3 / M4 primers to amplify two fragments of the plasmid, respectively. The two fragments are cloned and connected using a one-step recombination kit from Novozymes, and all clones obtained are collected and plasmids are extracted to obtain a gdh gene promoter mutant library. The above library and the wild-type control pEC-XK99E-Pgdh-rfp obtained in Example 1 were transformed into Corynebacterium glutamicum ATCC13032, coated on TSB plates, and fluorescent photographs of the plates with hundreds of clones were taken by a fluorescent imaging system. Mutants with increased expression intensity were preliminarily screened based on the fluorescence brightness of the clones. The TSB plate medium composition (g / L) is as follows: glucose, 5g / L; yeast extract, 5g / L; soy peptone, 9g / L; urea, 3g / L; succinic acid, 0.5g / L; K₂HPO₄·3H₂O, 1g / L; MgSO₄·7H₂O, 0.1g / L; biotin, 0.01mg / L; thiamine, 0.1mg / L; MOPS, 20g / L; agar powder, 15g / L. A preliminary screening of over 10,000 clones was performed, yielding approximately 40 mutants with enhanced fluorescence intensity (the screening plate is shown in Figure 2). The primer sequences used are shown in Table 2.

[0117] Table 2

[0118]

[0119] (2) Strength characterization of the Corynebacterium glutamicum gdh gene promoter mutant library

[0120] All mutants with enhanced fluorescence intensity observed on the above plates were cultured in 96-well plates to characterize promoter strength. TSB liquid medium composition (g / L): glucose, 5 g / L; yeast extract, 5 g / L; soy peptone, 9 g / L; urea, 3 g / L; succinic acid, 0.5 g / L; K2HPO4·3H2O, 1 g / L; MgSO4·7H2O, 0.1 g / L; biotin, 0.01 mg / L; thiamine, 0.1 mg / L; MOPS, 20 g / L. Strains obtained from the plates were inoculated using toothpicks into each well of a 96-well plate containing 200 μl of TSB liquid medium. Each strain was cultured in triplicate at 30°C on a plate shaker at 800 rpm for 24 h. Fluorescence intensity was then measured, and strains with increased fluorescence intensity compared to the wild-type control were sequenced. The results are shown in Table 3. Some of the promoter mutants have the same sequence. Finally, the present invention successfully obtained 29 different promoter mutants with improved expression intensity compared with the wild-type promoter, with the improvement fold ranging from 2.3 to 46.4 times. gdh -1 to P gdh -29, which can provide abundant elements for modifying the expression of genes such as gdh.

[0121] Table 3

[0122]

[0123] Example 3. Application of Corynebacterium glutamicum gdh gene promoter mutants in proline production

[0124] (1) Evaluation of the construction of the basic strain SLCgP2 for proline production

[0125] According to literature reports, the introduction of the G149K mutation in glutamate kinase ProB can relieve the feedback inhibition of proline. Introducing this mutation into the genome of Corynebacterium glutamicum ATCC13032 strain can produce proline. In the present invention, the G149K mutation is introduced into the Corynebacterium glutamicum ATCC13032 strain, and the codon is mutated from GGT to AAG to obtain the SLCgP1 strain.

[0126] The present disclosure further applies P pyc -20 promoter (the nucleotide sequence of its core region is CGGGCCTTGATTGTAAGATAAGACATTTAGTATAATTAG, as shown in SEQ ID NO: 68, and the nucleotide sequence of the promoter is shown in SEQ ID NO: 69) to overexpress glutamate kinase proB that relieves feedback inhibitionG149K The expression cassettes of glutamate-5-semialdehyde dehydrogenase proA and pyrrole-5-carboxylate dehydrogenase proC were integrated into the proline dehydrogenase / pyrrole-5-carboxylate dehydrogenase putA gene to obtain a proline-producing strain named SLCgP2.

[0127] The SLCgP2 strain was constructed as follows: 1) First, the P pyc -20 promoter expresses proB G149K , proA and proC expression cassette. pyc The plasmid containing the -20 promoter was used as a template and pyc-a / b as primers to amplify P pyc -20 promoter fragment; using the genome of SLCgP1 strain as template, proB was amplified using proB-1 / 2, proA-1 / 2 and proC-1 / 2 as primers. G149K , proA and proC fragments; at the same time, the backbone of pEC-XK99E was amplified with pEC-1 / 2 primers. The above five fragments were cloned and connected using the Novozymes one-step recombination kit to obtain pEC-proB G149K 2) Construct a recombinant vector to insert the above expression cassette into the chromosome on the putA gene. pyc -20 strain genome was used as template, putA-1 / 2 and putA-3 / 4 primers were used to amplify the upstream and downstream homology arms inserted into the putA gene; pEC-proB G149K The proAproC plasmid was used as a template and the expression cassette fragment was amplified using ABC-F / R primers; at the same time, the pK18-1 / 2 primers were used to amplify the backbone of pK18mobsacB. The above PCR fragments were cloned and connected using the Novozymes One-Step Recombination Kit to obtain pK18-proB G149K proAproC recombinant vector. 3) pK18-proB G149K The SLCgP1 strain was transformed with the proAproC recombinant vector and plated onto LBHIS solid medium containing 5 g / L glucose and 25 μg / mL kanamycin. The cells were cultured at 30°C to obtain the first recombinant transformants. Correct primary recombinant transformants were inoculated into LB medium containing 5 g / L glucose and cultured overnight. Then, 1% of the cells were transferred to LB medium containing 100 g / L sucrose. After culturing overnight at 30°C, the cells were plated onto LB solid medium plates supplemented with 100 g / L sucrose for screening. PCR with universal-specific primers and sequencing confirmed the correct mutants, resulting in the SLCgP2 strain. The primer sequences used are shown in Table 4.

[0128] Table 4

[0129]

[0130]

[0131] (2) Construction of recombinant vector of gdh gene promoter mutant of Corynebacterium glutamicum

[0132] According to the reported genome sequence of Corynebacterium glutamicum ATCC13032, the upstream homology arms were amplified using gdh-UF / gdh-UR primers, and the P gdh -1, P gdh -7, P gdh -16, P gdh -23, P gdh -26 and P gdh -29 promoter mutant downstream homology arm; at the same time, the pK18-1 / 2 primer was used to amplify the pK18mobsacB backbone. After the above PCR fragments were recovered, they were cloned and connected using the Novozymes one-step recombination kit to obtain the promoter mutant recombinant vector pK18-P gdh -1, pK18-P gdh -7, pK18-P gdh -16、pK18-P gdh -23, pK18-P gdh -26 and pK18-P gdh The primer sequences used above are shown in Table 5.

[0133] Table 5

[0134]

[0135] (3) Construction of gdh gene promoter mutants of proline-producing bacteria of Corynebacterium glutamicum

[0136] The recombinant vector pK18-P gdh -1, pK18-P gdh -7, pK18-P gdh -16、pK18-P gdh -23, pK18-P gdh -26 and pK18-P gdh-29 were transformed into the proline-producing strain SLCgP2 of Corynebacterium glutamicum, and the plates were spread onto LBHIS solid medium containing 5 g / L glucose and 25 μg / mL kanamycin. The transformants were cultured at 30°C to obtain the first recombinant transformants. The correct first recombinant transformants were inoculated into LB medium containing 5 g / L glucose, cultured overnight, and then 1% transferred to LB medium containing 100 g / L sucrose. After culturing overnight at 30°C, the plates were spread onto LB solid medium plates supplemented with 100 g / L sucrose for screening. The correct mutants were confirmed by PCR and sequencing, and the gdh promoter-mutated strains SLCgP3, SLCgP4, SLCgP5, SLCgP6, SLCgP7, and SLCgP8 were obtained.

[0137] (4) Evaluation of the proline production capacity of gdh gene promoter mutants of proline-producing bacteria Corynebacterium glutamicum

[0138] In order to test the effect of gdh promoter mutation in Corynebacterium glutamicum on proline production, fermentation tests were carried out on SLCgP2, SLCgP3, SLCgP4, SLCgP5, SLCgP6, SLCgP7 and SLCgP8, respectively. The fermentation medium components were: glucose, 72 g / L; yeast powder, 1 g / L; soy peptone, 1 g / L; NaCl, 1 g / L; ammonium sulfate, 1 g / L; urea, 10 g / L; K2HPO4·3H2O, 1 g / L; MgSO4·7H2O, 0.45 g / L; FeSO4·7H2O, 0.05 g / L; biotin, 0.4 mg / L; vitamin B1, 0.1 mg / L; MOPS, 40 g / L; initial pH 7.2. First, the strains were inoculated into TSB liquid medium and cultured for 8 hours. The culture was then used as seed inoculation in 24-well plates containing 800 μl of fermentation medium per well. The inoculum size was 12 μl. The plates were incubated at 30°C for 18 hours on a shaker at 800 rpm. Each strain was replicated in triplicate. Proline production was measured after fermentation. The results, shown in Table 6, show that proline production increased in all strains after the gdh promoter mutation.

[0139] Table 6

[0140] Proline production of strains (g / L) SLCgP2 5.48±0.23 SLCgP3 6.11±0.19 SLCgP4 7.07±1.05 SLCgP5 7.50±0.43 SLCgP6 7.74±0.62 SLCgP7 7.85±0.17 SLCgP8 7.28±0.62

[0141] The above results indicate that mutants that enhance the expression strength of the gdh gene promoter can be applied to the production of target products that rely on the reaction from α-ketoglutarate to glutamate, such as proline, lysine, glutamate, hydroxyproline, arginine, ornithine, glutamine, and other amino acids that use glutamate as a product or important synthetic precursor. Asakura Y et al. reported that using gdh promoter mutants to enhance Gdh activity can increase glutamate production. [6] Xu, J et al reported that tac-M Replacing the promoter of the gdh gene with the promoter enhances Gdh activity and can increase lysine production. [7] Hydroxyproline is produced by a one-step hydroxylation of proline as a precursor. The modification disclosed herein for improving proline synthesis can also be used for hydroxyproline production.

[0142] References:

[0143] [5] Wang Yingchun et al. Screening of endogenous efficient constitutive promoters of Corynebacterium glutamicum based on time series transcriptome[J]. Chinese Journal of Biotechnology, 2018, 34(11): 1760-1771.

[0144] [6]Asakura Y, Kimura E, Usuda Y, et al. Altered metabolic flux due to deletion of odhA causes L-glutamate overproduction in Corynebacterium glutamicum[J].Appl Environ Microbiol, 2007,73(4):1308-1319.

[0145] [7]Xu,J.,Wu,Z.,Gao,S.et al.Rational modification of tricarboxylic acid cycle for improving L-lysine production in Corynebacterium glutamicum.Microb Cell Fact 17,105(2018).

[0146] All technical features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by another feature having the same, equivalent, or similar function. Therefore, unless otherwise specified, each feature disclosed is merely an example of a series of equivalent or similar features.

[0147] In addition, from the above description, those skilled in the art can easily understand the key features of the present disclosure from this disclosure. Without departing from the spirit and scope of the present disclosure, many modifications can be made to the invention to adapt to various different purposes and conditions of use. Therefore, such modifications are also intended to fall within the scope of the appended claims.

Images