A primer and probe kit specific to Actinobacillus pleuropneumoniae serovar 5; a method for detecting A. pleuropneumoniae serovar 5 using this primer and probe kit; and a planar flow assay kit for detecting A. pleuropneumoniae serovar 5 containing the components of this primer and probe kit.

Abstract

OCR 09WP 26 / 11 / 2568 Primers and probes specific to serovar 5 of Actinobacillus pleuropneumoniae (APP, APP) and the application of primers and probes specific to the APP's serovar 5 in the method. Detection of A. pleuropneumoniae serovar 5 and a planar flow assay kit for bacterial detection. For example, the APP Serovar 5 detection kit is specific to A. pleuropneumoniae serovar 5. Only A. pleuropneumoniae serovar 5 is detected, and it has high sensitivity, meaning it contains only one copy of the original DNA. That's all it takes to detect it. The test can be done quickly, with a reaction time of only 20 minutes. Expensive equipment is required for the reaction to be performed, and the results cannot be easily read with the naked eye.

Claims

OCR 09WP 26 / 11 / 2568 1. A set of primers and probes specific to Actinobacillus pleuropneumonice serovar 5. A sequence of bases, at least one of which can be selected. ก. gaattattatctttagtagccacaagacccga B. caacaatgagagaattettttaactcagataggcg C. (DIG)-caacaatgagagaattettttaactcagataggcg D. TCG AAG TGA ATT ATT GCA AAA CAT GGC TGC TGC TTG GTA TTG GGT TGA TTT C Mon. TCG AAG TGA ATT ATT GCA AAA CAT GGC TGC (dT-FAM) G (THF) (dT-BHQ) TG GTA TTG GGT TGA TTT C (Biotin)-TCG AAG TGA ATT ATT GCA AAA CAT GGC TGC TG (THF) TTG GTA TTG GGT TGA TTT C-(3'-block) 2. Method for detecting Actinobacillus pleuropneumoniae serovar 5 using a set of primers and probes. Specific to A. pleuropneumoniae serovar 5, the procedure is as follows: A. Amplifying DNA from the DNA sample to be tested. B. Product availability analysis. The primer and probe set specific to A. pleuropneumoniae serovar 5 has the following sequence: Bass, with at least one of the following options selected. • gaattattatctttagtagccacaagacccga • caacaatgagagaattettttaactcagataggcg • (DIG)-caacaatgagagaattgttttaactcagataggcs • TCG AAG TGA ATT ATT GCA AAA CAT GGC TGC TGC TTG GTA TTG GGT TGA TTT C • TCG AAG TGA ATT ATT GCA AAA CAT GGC TGC (dT-FAM) G (THF) (dT-BHQ) TG GTA TTG GGT TGA TTT C • (Biotin)-TCG AAG TGA ATT ATT GCA AAA CAT GGC TGC TG (THF) TTG GTA TTG GGT TGA TTT C-(3'-block) 3. Method for detecting Actinobacillus pleuropneumoniae serovar 5 using a set of primers and probes. It is specific to A. pleuropneumoniae serovar 5 according to claim 2, where amplification... DNA can be selectively processed using the polymerase chain reaction (PCR) technique. Which type of recombinase polymerase amplification reaction? One thing 4. Method for detecting Actinobacillus pleuropneumoniae serovar 5 using a set of primers and probes. It is specific to A. pleuropneumoniae serovar 5 according to claim 2, where the analysis of the presence The presence of a product relies on techniques such as electrophoresis to measure fluorescence. (Fluorescence) Changes in pH (acid-base), electrical signal measurement, measurement. Which of the following is applicable: potential difference, Raman signal measurement, or lateral flow strip technique? One thing 5. A planar flow assay kit for the detection of Actinobacillus pleuropneumoniae serovar 5. A set of primers and probes specific to A. pleuropneumoniae serovar 5 is a component. The test kit includes: a) The RPAA reactor component, which consists of a protein mixture including recombinase. Single strand binding protein (SSB) and DNA. DNA polymerase and a set of primers and probes specific to the pathogen are used. A. pleuropneumoniae serovar 5 is used to perform DNA replication specifically with the bacteria. A. pleuropneumoniae has only 5 serovars. b) The lateral flow strip, which displays colored bands when DNA is present. Specific to A. pleuropneumoniae serovar 5. Specifically, a set of primers and probes specific to A. pleuropneumonice serovar 5 are available. A sequence of bases, at least one of which can be selected. • gaattattatctttagtagccacaagacccga • caacaatgagagaattgttttaactcagataggcg • (DIG)-caacaatgagagaattettttaactcagataggcg • TCG AAG TGA ATT ATT GCA AAA CAT GGC TGC TGC TTG GTA TTG GGT TGA TTT C • TCG AAG TGA ATT ATT GCA AAA CAT GGC TGC (dT-FAM) G (THF) (dT-BHQ) TG GTA TTG GGT TGA TTT C • (Biotin)-TCG AAG TGA ATT ATT GCA AAA CAT GGC TGC TG (THF) TTG GTA TTG GGT TGA TTT C-(3'-block)

Images