Canine breast cancer vaccine and the manufacturing process of such canine breast cancer vaccine.

Abstract

OCR 10KL (02 / 09 / 2568) The canine breast cancer vaccine contains a recombinant protein of the melanoma antigen-B10 gene. And heat shock protein 110 with a size of 63 kilodaltons, used in the manufacturing process of breast cancer vaccines for dogs. It involves synthesizing the plasmid and then increasing its number by introducing the recombinant plasmid PGEX-4T-1-. The synthesized plasmid MAGE-B10-HSP110 was inserted into the Top10 strain of E. coli bacteria and then cultured. Using a bacterial culture medium, the bacteria were inoculated with the E. coli strain BL21 (DE3), and then the bacteria were stimulated. The bacteria are then cultured to produce proteins, after which the cells are harvested by centrifugation and the proteins are extracted. The bacteria were lysed, and proteins were extracted from the cells using lysozyme solution and lipa solution. The water-soluble protein buffers were separated by centrifugation, purified, and the GST site was truncated. Using the enzyme thrombin cleavage, a recombinant protein with a size of 63 kilodaltons was obtained.

Claims

OCR 10KL (02 / 09 / 2568) 1. A breast cancer vaccine for dogs containing a recombinant protein of the melanoma antigen-B10 gene. (Melanoma-associated antigen gene B10; MAGE-B10) and heat shock protein 110. 110 (HSP110) with a magnitude of 63 kilodaltons.

2. Canine breast cancer vaccine, pursuant to claim 1, whereby the CMAGE-B10 gene is selected as the molecule. The goal for the production of such a vaccine.

3. Canine breast cancer vaccine, according to claim 1, where the 5' to 3' terminal region of the recombinant protein between... The melanoma antigen-B10 and heat shock protein genes consist of a sequence of amino acids. TATAGCGTTTCCCAGGGTCCTCAGGGAGCCATATCCACCAGCACTACTGCTGCATCTGTTTCAC ACACAAGATCAAATGAAAGTGCTGACAACCAAGTGGAGGAAAGACCAAGATCCTCCCAGGCTCAGCCCA CCGCTGAGCCGTTCCCCAGAGGCCCGCTAGATGAGAAGGTAGTTAAATTGGTGCATTACCTGCTGTACA AGTATCAAATGAAAGAGCTCATTAGTAAGGCAGGAATGCTGAGAAATGTAATTCAAATGTATAGGAATCA CTTICATGAGATCCTCAAGAGAGCCTCTGAGCACTTGGAGCTGGTTTTTGGCCTTGACTTGAAGGAAGTG GATCCCAACCGGCACATCTATGTCCTTGTGAACAAATTGGAACTAAGTTATGATGCAATGCTGAGTGATG ATGAAGGGGTTCCCAAGACTGGCCTGTTGATGACTATTCTGGGTGTGATCTTCACAAAGGGCAACTGTG CCGCTGAGGAGCAAGTCTGGCAAGTATTGAATGTGATTGGGTTATATGCGGGGATGGAAGGTCGACTCT TCACCATCTCTACAGCGTCTATGGTGGAGAAAATCCCAACTGAGGAGAATGAAGTGTCTTCTGTTGAAGG AGACATGGAGTGTCCAAATCCGAGACCAGCAGAAAACTTGGACACTGATAAAAATATCCAGCAAGACAA CAGTGAAGCTGGAACACAGCCCCAGGTACAAACTGATGGTCAACAAACCTCACAGTCTCCCCCTTCACCT GAACTTACCTCAGAAGAAAACAAAATCCCAGATGCTGACAAAGCAAATGAAAAGAAAGTTGACCAGCCTC CAGAAGCTAAAAAGCCCAAAATAAAGGTGGTGAATGTTGAGCTGCCTATTGAAGCCAACTTGGTCTGGC AGTTAGGAAAAGACCTCCTTAACATGTATATTGAGACAGAGGGTAAGATGATAATGCAGGATAAATTGGAAAAGGAAAGGAACGATGCTAAAAATGCAGTGGAGGAATATGTGTATGAGTTCAGGGACAAGCTGTGTGG ACCATATGAAAAATTTATATCTGAGCAGGATCACCAAAATTTTTTGAGACTGCTTACAGAGACAGAAAAC TGGCTTTATGAAGAAGGAGAGGACCAAGCTAAACAAGCCTATGTGGACAAGTTGGAAGAATTAATGAAA ATTGGCACTCCAGTTAAAGTTCGGTTTCAAGAAGCTGAGGAACGACCAACAAGTGTTTGAAGAATTGGGAC AGAGGCTGCAGCACTATGCCAAGATCGCAGCAGACTTCCGAAATAATGATGAGAAATACAATCATATTGA TGAGTCTGAGATGAAAAAGGTGGAGAAGTCTGTTAATGAAGTGATGGAATGGATGAATAATATCATGAAT GCTCAGGCTAAAAAGAGTCTTGATCAGGATCCAGTTGTACGTGCTCAGGAAATT 4. Method for producing recombinant protein between melanoma antigen-B10 and heat shock protein 110 genes for manufacturing. Canine breast cancer vaccines, under any one of claims 1 through 3, include the following procedures: A. Plasmid synthesis The specific amino acid sequences of the CMAGE-B10 and CHSP110 genes were synthesized and inserted into the plasmid. PGEX-4T-1 is placed at the C-terminus of the GST sequence, in the position between the base sequences of the enzyme 2. Types include EcoRI and Notl, which obtained the recombinant plasmid PGEX-4T-1-MAGE-B10-HSP110. B. Increasing the number of plasmids. The recombinant plasmid PGEX-4T-1-MAGE-B10-HSP110 was inoculated into Escherichia coli (E. coli) bacteria. The Top 10 strains were cultivated using the calcium chloride heat shock transformation method at a temperature of 42 degrees Celsius. After 45 seconds, the bacteria were further cultured in liquid bacterial culture medium (LB broth) and other culture media. Solid bacterial culture (LB agar) at 37°C for 24 hours, respectively, Escherichia bacteria. E. coli (Top 10 strains) containing the hybrid plasmid PGEX-4T-1-MAGE-B10-HSP110 were stored in... Freezing tubes containing liquid bacterial culture medium containing 30% glycerol are stored at... The temperature is -70 degrees Celsius. C. Protein synthesis The recombinant plasmid PGEX-4T-1-MAGE-B10-HSP110 has undergone gene insertion validation. It was then inoculated into Escherichia coli (E. coli) strain BL21 (DE3) using the calcium chloride method. Heat shock transformation was performed using a temperature of 42 degrees Celsius for 45 seconds, and the bacteria were then continued to be cultured. Liquid and solid bacterial culture media at 37 degrees Celsius for a certain period of time. 24 hours in chronological order. Bacterial colonies whose gene insertion during the protein synthesis process has been verified will be... The bacteria were cultured in liquid bacterial culture medium at a temperature of 37 degrees Celsius and a shaking speed of 200. Revolutions per minute to increase the number and achieve a light absorption density between 0.5-0.6, then the bacteria... The cells were stimulated to produce protein and then cultured at 25 degrees Celsius for 24 hours before being harvested. Bacterial cells were precipitated using a centrifuge at 5,000 rpm for 10 minutes. The bacterial cells were then frozen at -20 degrees Celsius before protein extraction. D. Protein extraction The bacteria were lysed, and proteins were extracted from the cells using a lysozyme solution. Incubate in a lipa buffer solution at 4°C for 1 hour. The water-soluble proteins are then separated by centrifugation. Centrifugal force at 12,000 revolutions per minute at 4 degrees Celsius for 30 minutes. e. Purification The extracted protein was purified using affinity chromatography and the GST site was cleaved. Using the enzyme thrombin cleavage, a recombinant protein with a size of 63 kilodaltons was obtained.

5. Method for producing recombinant protein between melanoma antigen-B10 gene and heat shock protein 110 for manufacturing. Canine breast cancer vaccine, under claim 4, where bacteria are cultured on a bacterial culture medium containing... The antibiotic ingredients include ampicillin at a concentration of 100 micrograms per milliliter.

6. Method for producing recombinant protein between melanoma antigen-B10 gene and heat shock protein 110 for manufacturing. Canine breast cancer vaccine, under claim 4, which provides for verification of gene insertion. The process of increasing plasmid quantity involves selecting small, single colonies, extracting the plasmid, and then cutting it using... There are two enzymes: EcoRI and Notl. Where the size of the gene that was cut by the enzyme is equal to the base sequence of MAGE-B10-HSP110 that was cut. The selection is 1,440 bass pairs.

7. Method for producing recombinant protein between melanoma antigen-B10 and heat shock protein 110 for manufacturing. Canine breast cancer vaccine, under claim 4, which provides for verification of gene insertion. The protein synthesis process involves selecting a small, single colony to extract the plasmid, which is then cut using... There are two enzymes: EcoRI and Notl. Where the size of the gene that was cut by the enzyme is equal to the base sequence of MAGE-B10-HSP110 that was cut. The selection is 1,440 bass pairs.

8. Method for producing recombinant protein between melanoma antigen-B10 gene and heat shock protein 110 for manufacturing. The canine breast cancer vaccine, under claim 4, where the bacterial protein synthesis process is stimulated. Protein synthesis was achieved by adding 0.5 mmol of isopropyl beta-D-1-thiogalactopyranozyle solution. Place in liquid bacterial culture medium.

9. Method for producing recombinant protein between melanoma antigen-B10 gene and heat shock protein 110 for manufacturing. Canine breast cancer vaccine, under claim 4, whereby the protein extraction procedure involves the target protein consisting of... The GST sequence, melanoma antigen-B10, and heat shock protein 110 (95 kDa) were examined. The Western blotting method was used, employing monoclonal antibodies specific to the GST sequence, and... Conjugated with horseradish peroxidase enzyme at a concentration of 1:2000.

10. Using a process to produce recombinant proteins between the melanoma antigen-B10 gene and the heat shock protein 110 gene. Any one of claims 4 through 8 for the manufacture of canine breast cancer vaccines, according to claims 1 through 3. Firstly, for the prevention of breast cancer in dogs.

Images