A primer kit for use in the detection of isoniazid-resistant tuberculosis, and a procedure for detecting such tuberculosis using this primer kit.

Abstract

OCR 25 / 12 / 2566 This invention relates to a set of primers for use in the detection of isoniazid-resistant tuberculosis. The procedure for detecting tuberculosis using the LAMP technique is for use in detecting mutated tuberculosis strains that are resistant to... The primers used are specific to isoniazid resistance genes or mutated strains of the virus. A change in just one nucleotide position allows for various applications in pathogen detection. Isoniazid-resistant tuberculosis with a single mutation was detected using the LampSnip technique. This invention's method for detecting pathogens allows for analysis of results using both real-time loop-mediated (LAMP) technology. Isothermal amplification - single nucleotide polymorphism; real-time LAMP-SNP) (LAMP method) Electrochemical SNP (LAMP) sensor and reading results using genetic material separation methods. The electrical current on the agar plate (LAMP-electrophoresis), which takes only 75 minutes to perform the examination with LAMP, has... The limit of detection (LOD) of the method is 10 to the power of 7 copies of the plasmid. The invention can be used to classify patients with isoniazid-resistant tuberculosis. TB) is removed from patients with tuberculosis susceptible to isoniazid or from patients with wild-type tuberculosis strains. Furthermore, it can be used to create a model of Mycobacterium tuberculosis (MTB). Enabling more specific and sensitive diagnosis of drug-resistant tuberculosis has led to the development of new technologies and testing methods. Easy to use

Claims

OCR 25 / 12 / 2566 1. The primer kit for use in detecting isoniazid-resistant tuberculosis includes: A. Outer Forward Primer (F3): 5'GATGGGCTTGGGCTGGAAGA3' B. Outer Backword Primer (B3): 5'TCAGTGGCCAGCATCGTCG3' C. Inner Forward Snip Loop Primer (FIP): 5'TTGTCCCATTTCGTCGGGGTGTTTTTAAGGACGC GATCATGTCC3' D. Inner Backward Primer (BIP): 5'ACGAGTGGGAGCTGACGAAGTTTTCCGTCCTTGGCGG TGTAT3' J. Sniploo Primer (LPF): 5'CATACGACCTCGATGACAGG3' 2. A method for detecting isoniazid-resistant tuberculosis using a primer kit, as per claim 1, whereby the method... The process is as follows: A. The DNA sample is subjected to a LAMP reaction using a LAMP test solution containing a set of primers. The components, in this case, the primer kit includes: - Outer Forward Primer (F3): 5'GATGGGCTTGGGCTGGAAGA3' - Outer Backword Primer (B3): 5'TCAGTGGCCAGCATCGTCG3' - Inner Forward Snip Loop Primer (FIP): 5'TTGTCCCATTTCGTCGGGGTGTTTITAAGG ACGCGATCATGTCC3' - Inner Backward Primer (BIP): 5'ACGAGTGGGAGCTGACGAAGTTTTCCGTC CTTGGCGGTTAT3' - Sniploope Primer (LPF): 5'CATACGACCTCGATGACAGG3' B. Reading the lamp output obtained from step A and analyzing the results.

3. A procedure for the detection of isoniazid-resistant tuberculosis under claim 2, in which a LAMP test reagent containing... The primer kit is a component that includes: A. Outer Forward Primer, 0.2 micromolar concentration. B. Outer Blackward Primer, 0.2 micromolar concentration. C. Inner Forward Snip Primer, 1.6 micromolar concentration. D. Inner Blackward Primer, 1.6 micromolar concentration. J. SNP Primer, concentration 0.4 micromolar. F. Buffer, concentration 1x. B. Deoxynucleotide triphosphate at a concentration of 1-2 millimolar, with the optimal concentration being 1.

4. Millimolar C. A magnesium sulfate solution with a concentration of 2-8 millimolar, with 4 millimolar being the most suitable. J. Betaine, at a concentration of 0-0.6 molar, with 0.2 molar being the optimal one. The optimal amount of BST DNA polymerase is 4-16 units. That is 8 units.

4. A procedure for the detection of isoniazid-resistant tuberculosis under claim 3, in which a LAMP test reagent containing... The primer kit is a component that includes an additional fluorescent agent at a concentration 1 to 2 times the appropriate level. That is 1 time.

5. A procedure for the detection of isoniazid-resistant tuberculosis under claim 4, where selectable fluorescence is used. From Evagreen, SYBR Green I, SYTO 9, and SYTO ETII. (SYTO 82), YOPRO-1, Pico Green, SYBR Safe - any one of these. One or more combinations 6. A procedure for detecting isoniazid-resistant tuberculosis under claim 2, where the optimal conditions for... The lamp reaction occurs at a temperature of 60-65 degrees Celsius for 45-75 minutes.

7. A procedure for detecting isoniazid-resistant tuberculosis under claim 6, where the optimal conditions are met. For the Lamp reaction, the temperature is 65 degrees Celsius for 75 minutes.

8. A procedure for detecting isoniazid-resistant tuberculosis under claim 2, where the results can be selected from: Real-time LAMP readings, electrochemical readings, and genetic material separation readings. Electrical currents applied to the agar plate, either individually or in combination.

9. A procedure for the detection of isoniazid-resistant tuberculosis under claim 8, whereby the results are read using the method... Electrochemistry is achieved by mixing the lamp product with an electrochemically reactive substance in a ratio of 1 to 10. volume 10. A method for detecting isoniazid-resistant tuberculosis under claim 9, in which an electrochemically responsive substance is used. Choose from: bisBenzimide H 33258, Methylene blue, or Propidium. Propidium iodide or chromomycin, either individually or in combination.

Images