A set of primers and DNA probes for detecting the genetic material of the roundworm Angiostrongylus cantonensis using the LAMP (loop-mediated isothermal amplification) technique, along with a DNA biosensor dipstick.

Abstract

------10 / 03 / 2026------(OCR) OCR 09WP A primer and DNA probe kit for detecting the genetic material of the roundworm Angiostrongylus contonensis using the LAMP (loop-mediated isothermal amplification) technique, along with a DNA biosensor dipstick. The summary is as follows: 1. It can be used as a simple, convenient, and fast test kit, providing results in under 2 hours. It can be used for point-of-care monitoring. 2. It has specificity towards the target being investigated. 3. Used for detecting the genetic material of the roundworm species A. contonensis. ------------

Claims

------10 / 03 / 2026------(OCR) OCR 09WP 1. The primer and DNA probe set for detecting the genetic material of the roundworm Angiostrongylus cantonensis using the LAMP (loop-mediated isothermal amplification) technique, and the DNA biosensor dipstick, consists of four primers capable of binding to the genetic material of the roundworm A. cantonensis, as follows: Primer F3AcLH2, base sequence (5'-3') GGCTATATTATATTGAAGCTGAAGT Primer B3AcLH2, base sequence (5'-3') GTCTGCTTAGTAGTTGACTTC Primer FIPACLH2 (5'-3' base sequence) biotin-CGATTAGCGGCAATGTTCCATTTTTGTTCTCAATGGCCAAGTG Primer BIPAcLH2 (base sequence (5'-3')) GGAGGCTGCGTATGTGAGAGGTTTTGTTAGAAATTTCCATACTATC 2. A primer and DNA probe set for the detection of the genetic material of the roundworm A. cantonensis using the LAMP (loop-mediated isothermal amplification) technique and a DNA biosensor dipstick as per claim 1, where the optimal conditions for detecting the LAMP product are characterized as follows: the LAMP reaction is performed at a constant temperature of 62 °C for 60 minutes, followed by incubation at 80 °C for 10 minutes to stop the reaction, and then the LAMP product is detected using the DNA biosensor dipstick.

3. A set of primers and DNA probes for the detection of the genetic material of the roundworm A. cantonensis using the LAMP (loop-mediated isothermal amplification) technique and a DNA biosensor dipstick as per Patent 1, whereby the DNA probe for the detection of roundworm A. cantonensis has a unique design, namely a FITC labeled probe at the 5' end for the detection of the LAMP product on the DNA biosensor dipstick with the following base sequence: 5' -FITC-CTACTAGGAGCCCAGGATC-3' 4. A primer and DNA probe kit for the detection of genetic material of the roundworm A. cantonensis using the LAMP (loop-mediated isothermal amplification) technique and a DNA biosensor dipstick, as per claim 1, consisting of the following main components for the reaction: 0.2 micromolar each of F3AC LCH2 and B3AC LCH2 primers; 1.6 micromolar each of FIPAC LCH2 and BIPAC LCH primers; 4 units of BST polymerase enzyme; 1x dilution buffer solution for the enzyme; and deoxynucleotide triphosphate (dNTPs). The mixture contained 1.4 millimolar (mM) of magnesium sulfate (MgSO4), 4 millimolar (mM) of betaine, 1 molar (M) of betaine, and water (dH2O). ------------

Images