A primer and DNA probe set for the detection of genetic material of paramphistome trematodes, along with a method for detecting this genetic material using the loop-mediated isothermal amplification (LAMP) reaction in conjunction with a DNA biosensor dipstick.

TH28467UActive Publication Date: 2026-07-07SRINAKHARINWIROT UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
TH2203001221
Authority / Receiving Office
TH · TH
Patent Type
Utility models
Current Assignee / Owner
Filing Date
2022-05-18
Publication Date
2026-07-07
Estimated Expiration
2028-05-17

Smart Images

  • Figure 00000005_0000
    Figure 00000005_0000
  • Figure 00000005_0001
    Figure 00000005_0001
Patent Text Reader

Abstract

------09 / 10 / 2568------(OCR) OCR 09WP Primer and DNA probe set for the detection of genetic material of paramphistome trematodes and the method for detecting genetic material of such parasites by applying the LAMP (loop-mediated isothermal amplification) reaction in conjunction with a DNA biosensor dipstick. This allows for convenient and rapid detection of the genetic material of target trematodes, with results available in less than 75 minutes. It demonstrates high specificity, capable of detecting the genetic material of 5 species of paramphistomes: Fischoderius elongatus, Gastrothylax crumenifer, Paramphistomum epiclitum, Carmyerius sp., and Orthocoelium sp., from examination of the gastrointestinal tract or fecal samples.
Need to check novelty before this filing date? Find Prior Art

Claims

------30 / 04 / 2569------(OCR) OCR 10KL1. A primer and DNA probe set for the detection of genetic material of paramphistome trematodes using the loop-mediated isothermal amplification (LAMP) reaction combined with a DNA biosensor dipstick. It consists of 4 primers and 1 probe capable of binding to the internal transcribed spacer 2 (ITS2) nucleotide sequence of 5 paramphistome species: Fischoderius elongatus, Gastrothylax crumenifer, Paramphistomum epiclitum, Carmyerius sp., and Orthocoelium sp.The base sequences are as follows: Primer PAR-F3 (5'-3') AAGTCGTGGCTTGGAATCTGCC; Primer PAR-F3 (5'-3') TRGACRRACAGCAATAGCATCTCAAACC; Primer PAR-FIPB (5'-3') biotin-CGCRGTTGTGTCCGGMGACATTAGGAA-TTTT-GCTGGCGTGATTTCCTCTGTGG; Primer PAR-BIP (5'-3') TTGCTGGTAGCGCAGACGAKGGTGT-TTT-RAGAGCGTGCTWCCATTACAGTTCACTG; Probe PAR-PROBE-FITC (5'-3') FITC-GGTAGAGTCGTGGCT. 2.A primer and DNA probe set for the detection of genetic material of paramphistome trematodes by applying the LAMP (loop-mediated isothermal amplification) reaction in conjunction with a DNA biosensor dipstick, as per Patent 1, where the DNA probe for detecting LAMP products resulting from the amplification of paramphistome genetic material has a unique design: a FITC labeled probe at the 5' millionth tip for the detection of LAMP products, resulting in banding on the DNA biosensor dipstick, with the following base sequence: 5'-FITC-GGTAGAGTCGTGGCT-3' 3.The method for detecting the genetic material of paramphistome trematodes involves applying the LAMP (loop-mediated isothermal amplification) reaction in conjunction with a DNA biosensor dipstick using primers and a DNA probe, as per Patent 1 or 2. This method comprises the following steps: a. Amplification of the sample's genetic material under the LAMP reaction using primers. The optimal conditions for detecting LAMP products are a constant temperature of 60-70°C for 30-60 minutes. b. Detection of LAMP products by applying the DNA probe to the DNA biosensor dipstick. The LAMP products are mixed with the DNA probe, and the entire solution is then mixed with a buffer solution. Then, immerse the DNA biosensor dipstick in the solution and read the result from the appearance of a color band. (4.)Methods for detecting the genetic material of paramphistome trematodes. (paramphistome) by applying the loop-mediated isothermal amplification (LAMP) reaction in conjunction with a DNA biosensor dipstick, as per claim 3, where 12.5 µl (µl) of LAMP reaction contains the following main components: 0.2 µm (µm) each of PAR-F3 and PAR-B3, 1.6 µm (µm) each of PAR-FIPB and PAR-BIP, 1 m (M) of betaine, 1.4 mM / base (mM) of deoxynucleotide triphosphate (dNTPs), 3 mM (mM) of magnesium sulfate (MgSO4), and BST enzyme. 4U of Bst DNA polymerase, 1X LAMP buffer, and 5% water (dH2O).A method for detecting the genetic material of paramphistome trematodes by applying the LAMP (loop-mediated isothermal amplification) reaction in conjunction with a DNA biosensor dipstick, as per patent 3 or 4, for the diagnosis of paramphistome trematodes in the rumen of ruminants, namely cattle and buffalo, from clinical samples, namely feces. ------09 / 10 / 2568------(OCR) OCR 09WP1. A primer and DNA probe set for the detection of genetic material of paramphistome trematodes and a method for detecting the genetic material of such trematodes by applying the loop-mediated isothermal amplification (LAMP) reaction in conjunction with a DNA biosensor dipstick. The set consists of four primers and one probe that can bind to the nucleotide sequences of the internal transcribed spacer 2 (ITS2) region of five paramphistome trematode species: Fischoderius elongatus, Gastrothylax crumenifer, Paramphistomum epiclitum, Carmyerius sp., and Orthocoelium sp.The base sequences are as follows: Primer PAR-F3, base sequence (5'-3')AAGTCGTGGCTTGGAATCTGCC; Primer PAR-B3, base sequence (5'-3')TRGACRRACAGCAATAGCATCTCAAACC; Primer PAR-FIPB, base sequence (5'-3')biotin-CGCRGTTGT GTCCGGMGACATTAGGAA-TTTT-GCTGGCGTGATTTCCTCTGTGG; Primer PAR-BIP, base sequence (5'-3')TTGCTGGTAGCGCAGACGAKGGTGT-TTTT-RAGAGCGTGCTWCCATTACAGTTCACTG; Probe PAR-PROBE-FITC, base sequence (5'-3')FITC-GGTAGAGTCGTGGCT2.A primer and DNA probe set for the detection of paramphistome genetic material by applying the loop-mediated isothermal amplification (LAMP) reaction with a DNA biosensor dipstick, as per Patent 1, where the DNA probe for detecting LAMP products resulting from paramphistome genetic amplification has a unique design: a FITC labeled probe at the 5' end for the detection of LAMP products, resulting in banding on the DNA biosensor dipstick with the following base sequence: 5'-FITC-GGTAGAGTCGTGGCT-3'3.The method for detecting the genetic material of paramphistome trematodes involves applying the loop-mediated isothermal amplification (LAMP) reaction in conjunction with a DNA biosensor dipstick, using primers and a DNA probe as per Patent 1 or 2. This method comprises the following steps: a. Amplification of the sample's genetic material under the LAMP reaction using primers. The optimal conditions for detecting LAMP products are a constant temperature of 60-70°C for 30-60 minutes. b. Detection of LAMP products by applying the DNA probe to the DNA biosensor dipstick. The LAMP products are mixed with the DNA probe, and the entire solution is then mixed with a buffer solution. Then, immerse the DNA biosensor dipstick in the solution and read the result from the appearance of a color band.A method for detecting the genetic material of paramphistome trematodes by applying the loop-mediated isothermal amplification (LAMP) reaction in conjunction with a DNA biosensor dipstick, as per claim 3, where the LAMP reaction... 12.5 microliters (µL) of the solution contains the following main components for the reaction: 0.2 µm (m³) each of primers PAR-F3 and PAR-B3, 1.6 µm (m³) each of PAR-FIPB and PAR-BIP, 1 molar (mM) of betaine, 1.4 millimolar (mM) / base (dNTPs) of deoxynucleotide triphosphate (dNTPs), 3 millimolar (mM) of magnesium sulfate (MgSO4), 4U of Bst DNApolymerase enzyme, 1X of LAMP buffer, and water (dFH2O).A method for detecting the genetic material of paramphistome trematodes by applying the loop-mediated isothermal amplification (LAMP) reaction in conjunction with a DNA biosensor dipstick, as per patent 3 or 4, for the diagnosis of paramphistome trematodes in the rumen of ruminants, namely cattle and buffalo, from clinical samples, namely feces.