A modified plasmid vector produces a green fluorescent protein for reporting the promoter efficiency of Burkholderia spp. in the host cell of the bacterium Pseudomonas putida.

Abstract

Page 1 of 14. Invention details A name that reflects an invention. A modified plasmid vector produces a green fluorescent protein for use in reporting promoter efficiency results. The presence of Burkholderia spp. in the host cell of the bacterium Pseudomonasputida. Five branches of science related to invention. The field of biotechnology involves modified plasmid vectors that produce green fluorescent proteins for... Use the report on the promoter efficiency of Burkholderia spp. in bacterial host cells. Pseudomonasputida(ReporterplasmidsforcharacterizationofBurkholderiaspp. promotersinPseudomonasputida) 10. Background information on the relevant art or science. The bacterium Pseudomonasputida KT2440 (P. putida KT2440) has been developed to be a capable bacterium. The cell receives a recombinant plasmid and has the potential to be a heterologous host cell. (host) for use in studying genes and the creation of biomolecules such as proteins, enzymes, and metabolites. Many types of metabolites are therefore very useful in biotechnology research. 15(D.Regenhardt et al., Pedigree and taxonomic credentials of Pseudomonasputida) Furthermore, strain KT2440,EnvironmentalMicrobiology.4(2002)912–91.) was used. P.putidaKT2440 In the study of the creation of natural products, which are... Secondary metabolites from Gram-negative bacteria that have a chemical structure and... It also exhibits a variety of biological activities (A. Loeschcke et al., Pseudomonasputida— 20aversatilehostfortheproductionofnaturalproducts,ApplMicrobiolBiotechnol.99 (2015)6197–6214.) Bacteria in the class Proteobacteria are the source of substance production. Natural products include many bioactive compounds (Y.Buijs et al., Marine). Proteobacteriaasasourceofnaturalproducts:advancesinmoleculartoolsand (25strategies,Nat.Prod.Rep.36(2019)1333–1350.) From the bacterial genome data in class 2 of 14 pages. These proteobacteria were found to contain a large number of genes or groups of genes that produce secondary metabolites, but... Most are groups of genes whose gene products have not yet been identified (unknown genes), which may result in new types of substances. (K.Alam, et al., Insilicogenomeminingofpotentialnovelbiosyntheticgeneclusters) fordrugdiscoveryfromBurkholderiabacteria,ComputersinBiologyandMedicine.140 5(2022)105046.) Study of genes or groups of genes that produce secondary metabolites from gram-negative bacteria. It can be studied using heterologous expression, which involves the transfer of genes or groups of genes that produce substances. Secondary metabolites are introduced into the host bacterial cell P. putida KT2440 (JJZhang, et al.). Broad-Host-RangeExpressionRevealsNativeandHostRegulatoryElementsThat InfluenceHeterologousAntibioticProductioninGram-NegativeBacteria.MBio8(2017) 10e01291-17.) To enable the genetically modified P. putida KT2440 to produce substances that are products of the gene. Alternatively, these gene groups could be obtained by using P. putida KT2440 as a host cell to produce substances. Based on previous searches, no reports have been found regarding the effectiveness of promoters in metabolites. Genetic mutations of Burkholderia spp. in host bacterial cells Pputida KT2440. Report results 15. This invention therefore focuses on creating a modified plasmid vector containing a gene that produces a green fluorescent protein. (enhanced green fluorescent protein, EGFP) and contains a sequence of nucleotides of... A promoter from the bacterium Burkholderia stagnalis (BCC87598) for use in bacterial host cells. P.putidaKT2440 is used to compare the performance of promoters and select promoters. High efficiency, where selected high-performance promoters can be used for stimulation. 20. Expression of genes or groups of genes that produce secondary metabolites in Burkholderia spp. Other gram-negative bacteria can produce even larger amounts of this substance. The nature and purpose of the invention. This invention aims to develop a modified plasmid vector capable of producing proteins. Green fluorescent indicator for reporting the efficacy of the promoter against B. stagnalis BCC87598. 25 cells in the host bacterial cell P. putida KT2440 were used for screening and comparison. The efficacy of high-efficiency promoters of Burkholderia spp. is analyzed on page 3 of a 14-page report. Cells that can reduce the complex and costly steps involved in examining mRNA levels. Gene analysis results are reported using a method known as real-time polymerase chain reaction (PRCC). reaction, RT-PCR) The modified plasmid vector according to this invention is characterized by the presence of a sequence of components. Five nucleotides of the promoter from the bacterium *B. stagnalis* BCC87598 contain the egfp gene, which is expressed as a protein. It glows green when this invented modified plasmid vector is used in a bacterial host cell. P.putidaKT2440 will produce recombinant cells capable of producing green fluorescent protein (EGFP) under controlled conditions. Control of this promoter makes it possible to measure the fluorescence of the protein. The green glow can be utilized by selected promoters for educational and development purposes. 10. Natural products that are secondary metabolites. From gram-negative bacteria onwards. Brief description of the painting. Figure 1 shows a diagram of the recombinant plasmid for the construction of recombinant bacterial cells P. putida KT2440. pTet-T7-EGFP(a) and pTet-S7-EGFP(b) 15BglII is the base sequence of the recognition region of the restriction enzyme BglII. T7promoter is the base sequence of the T7 promoter. S7promoter is the base sequence of the S7 promoter from the strain Burkholderia sp. Strain LB400. RBS is the base sequence of a ribosome-binding site. XbaI is the base sequence of the recognition region of the restriction enzyme XbaI. 20NdeI is the base sequence of the recognition region of the restriction enzyme NdeI. EGFP is the base sequence of the gene that produces a green fluorescent protein. T7terminator is the base sequence of the T7 terminator. trfA is the base sequence of a gene that produces a protein for initiating self-replication. (replicationinitiationprotein) 25oriV is the base sequence of the DNA replication starting point (Origin of DNA). (Replication) Page 4 of 14. traJ is the base sequence of a gene that synthesizes a protein that recognizes the oriT location. oriT is the base sequence of the starting point for DNA transfer via conjugation. (conjugation) TetR is the base sequence of a gene that produces a tetracycline antibiotic resistance protein. 5TcR is the base sequence of the gene that produces tetracycline efflux protein. Full disclosure of the invention. This invention reveals details of the development of a modified plasmid vector containing the reported gene. Expression of promoter from B. stagnalis BCC87598 in host bacterial cells P. putida. KT2440 enables the recombinant bacterial cell P. putida KT2440 to produce green fluorescent protein from... 10. Expression of the egfp gene regulated by the promoter from B. stagnalis BCC87598 for use. To study and compare the efficiency of promoters and select high-efficiency promoters of pathogens. Burkholderia spp. This plasmid is characterized by the insertion of an embedded nucleotide sequence. The promoter from the B. stagnalis BCC87598 is positioned in front of the egfp gene, which expresses a fluorescent protein. The green color is obtained when the aforementioned plasmid vector is used in the host bacterial cell P. putida KT2440. Fifteen recombinant bacteria produce green fluorescent proteins, and promoter expression can be detected in them. At the cellular level, by measuring the amount of green fluorescent protein using fluorescence coefficients. (Relative EGF Intensity) replaces the RT-PCR method for studying promoter efficiency. This plasmid vector contains a portion that includes a tetracycline resistance gene. The starting point of DNA replication, the starting point of DNA transfer via conjugation, and its location. 20. Ribosome binding to initiate protein translation has specific characteristics: (a) It has a gene that expresses a green fluorescent protein. (b.) There is a promoter isolated from the bacterium Burkholderia stagnalis BCC87598. The process for creating recombinant plasmids and generating strains containing recombinant plasmids involves the following steps: a. Fabrication of recombinant plasmids containing the egfp gene and promoter nucleotide sequence from B. stagnalis. 25BCC87598 is inserted on page 5 of the egfp gene out of 14 pages. This is achieved by increasing the number of nucleotide fragments of the T7 promoter through a chain reaction. Polymerase chain reaction (PCR) using the pET17b plasmid (Invitrogen) The template DNA was used, and the primer pairs T7PupSt_NcoI and T7Tdwst_NcoI, which have the base sequences from the end, were used. 5' to 3' as follows: 5T7PupSt_NcoI:5'-GAACGCCATGGCAGGACCCAACGCTGCC-3' T7Tdwst_NcoI:5'-GAACGCCATGGGGATATAGTTCCTCCTTTCAGC-3' The ends of the nucleotide fragments of the T7 promoter are then truncated using the enzyme NcoI and fused together. The nucleotides obtained were with the plasmid pCAP05 (Addgene,#102920), which was also cleaved with the enzyme NcoI. By ligation to obtain the pTet-T7 plasmid. 10. The nucleotide fragments of the egfp gene were amplified using polymerase chain reaction (PCR). The plasmid pEGFP-hDHFR serves as the template DNA and uses the primers EGFPF_XbaI and EGFPR_KpnISacI. Which has the following base sequence from the 5' end to the 3' end: EGFPF_XbaI:5'-CAGTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATAT GAGCAAGGGCGAGGAGC-3' 15EGFPR_KpnISacI:5'-CCATGGTACCGAGCTCTTACTTGTACAGCTCGTCCATG-3' The nucleotide tips of the egfp gene and the pET17b plasmid vector were then truncated using the enzyme KpnI. And XbaI was purified and the DNA fragments of the egfp gene and the obtained pET17b plasmid were linked by Ligation was performed to obtain a modified plasmid vector named pET17b-EGFP, and then the plasmid was cut. pET17b-EGFP was processed with the enzymes KpnI and XbaI, and the nucleotide fragments of the egfp gene were purified for further analysis. 20 inserts are placed posteriorly on the T7 promoter of the pTet-T7 plasmid, which was cleaved with KpnI and XbaI enzymes. Similarly, ligation was used to obtain the pTet-T7-EGFP plasmid. The pTet-T7-EGFP plasmid was cut with the enzymes BglII and NdeI, and the nucleotide fragments were purified. A size of 8,224 base pairs was then added to the promoter S7 nucleotide fragment by a chain reaction. Polymerase was performed using the pMLS7 plasmid as the DNA template and the primers pS7_F and pS7-EGFP_R. The number 25 has a base sequence from 5' to 3' as follows on page 6 of a 14-page number. pS7_F:5'-CAGGACCCAACGCTGCCCGAGATCTCAGCTAGCCGAATTGCTGG-3' pS7-EGFP_R:5'-AGCTCCTCGCCCTTGCTCATATGGTTTCTTCCTTTAACTTTT CAGTTGG-3' And then the nucleotide fragments of the pTet-T7-EGFP plasmid were amplified using... 5. The plasmid pTet-T7-EGFP was used as a prototype and the primers EGFP-trfA_F and EGFP-trfA_R were used, which have... The base sequence is as follows: EGFP-trfA_F:5'-CATATGAGCAAGGGCGAGGAGCT-3' EGFP-trfA_R:5'-GCGACCACTACACGAAATTCATCTGGGAGAAGTACCGCAAGC-3' The three DNA fragments are then combined using the Gibson assembly technique. 10. By mixing the three nucleotide fragments in a ratio of 1:5:5, respectively, and incubating the nucleotide solution... The temperature was 50 degrees Celsius for 60 minutes to obtain the recombinant plasmid named pTet-S7-EGFP. The plasmid pTet-S7-EGFP was cut using the enzymes BglII and NdeI, and nucleotide fragments were inserted. Promoter from B. stagnalis BCC87598 obtained using the Gibson assembly technique by fragment mixing. The plasmid and promoter nucleotides are mixed in a 1:5 ratio, and the nucleotide solution is incubated at a temperature... Heat at 1550 degrees Celsius for 20 to 60 minutes to obtain recombinant plasmids containing a promoter from the pathogen. B. stagnalis BCC87598 The nucleotide sequence (from the 5' to the 3' end) of the promoter from the bacterium *B. stagnalis* BCC87598. The 26 promoters are detailed as follows: Promoter P705 20CTTCAGTGGGATGGGCAAACTTCCCTCCGGAAAAAGCGGACAGCCGTGTGGCGATCCGGCTTGATC AAGCGATCTGGGGTGGCGGCGCGTCGCGCGCTGGCCGCCGACTTGATTTGGCGCGCGAGGCCCG ATGGCCACGCGCCGCCATACCGTATTCATTAGCGTAAGCGCGTGGTATCCGCGTACGCCGATGAAT AGCCCGCTTCGAAGCGCACGTCCTGAACAGCGTCCGCGGGAAGCGGGTTTTGACGAAGGGTGTAG Page 7 of 14. (TTTGACTGACTCTCATCTGAACCTGAAGGAGAACAACA) Promoter p932 TTCGCTGCACCGCGATACGCGCGATCCCGATTTTATGCAACCCGATTCTTTTCTCAGGTTTGACGGA TATAGCCACTGTCATGAACAATCGGCAACGCTATCGAAAACCCTTTTGTTTCGACGCGACGTCGAT ATAGAGGGTTGCGCAGCGTTGCTTTTAGACTTGCGCAACGCAAAAACACAACCATAATCAATCAAC 5CGGGCCGGAAAAATACGCAAGCT Promoter p1173 CGCACGCTTGACAATTTCTAAAAGTTACGGCAGGCCGGTGTTGCGCATGCGCCACAAACGGATAG GCGATGTTAGGGTGGGGAGGATTTTTTTTCGTGGGAAGGGAACGATATGGCAAAATGCCAACGCA CTGAAAGTTAGACGTGCTCGAAGTCTACACAGAGCGGCGCCGCGTTTTTGTGCCGCACCAATG 10TTATACTTCGAGCAATGTATGACTTGTCACCGTCAACAGGCTCGCAGTAAACCTGCGGTAATCTCA ATTTCGAGAGGAGAAAT > promoter p1957 CGGCAACGTCAATAGAGGGGAGAACGAATGGTGGCGCGGCGCGCCTCCTGCCGAATAGACGAATGG GCTTCGGAAATATTTAGCAAGACGGCCTTCGGCGACGAAGCGATCCACATTCGCGGTAAAAAATC 15GGCCGCGCCGTTCGTCACACCAGTGAAGCCGCCCAGCGCGGCCCCGTGACTTGGCCGAAGCGGCC GGACCCGAAGGACTTCACGCTCA > promoter p2035 AGCACTCACCGCTCAATGAAACACTGTCAAAAGATGCTGATATATCTAAGCGCAATTTTTTGGCAA AAACCAAAACCGTGTTCTATGCTTTGATCACGATTCCTCCGAGCGGCTCACTGGGTTCGACATTTT 20TTTGTCAAGGGCCGCGGACGAGGTTCGGCCTGTGATCTGCTCAATGTCATCAAAGGAAAAGTGGG CGAGAGAATTTAAGCATGCATGCTTTTTGGTCCCTCGATCGAGAGGTAATTAATATCTGCAAGGAG ATGGGGAAAA > promoter p2074 CAAAAAATCCATTTGTTATGGATCGCGTTAAATTTAAAAATAGTCGCTTCGAGTGAGTGAATTTTG 25CACCACCGTCGTGCTCACAGTAGGTTTCAATTCTTTCAGCAAATAAATACCTCATGCCGCCACGCGG 8 pages of 14 pages CGGATCCGGCTGTCCGCTCGCTGCTCGATGCAATATCGTCAAGGATATTTTCGATTTTTAAACT TCGGCTGTCTTCGATCAGGTTGCTCACATTAAATTGTGATGAGGATAATT > promoter p2082 CGCGATCGCTCCATCAACGGTGGATCCGTCAGTGCAATTCAGTCTAAGAAGCAGGCTCCCCGCAT 5GCTTGATTCAGATCAACGGCGCTCACGCCCGGCGGGCGGCGGCGATCCGACACACCCCCGCCGGTC GCACCTGCTTGACCGAGGTCAAGCAAACCGGCATGCGGGCGCCTACATTGTTGGGCGACGGGGAT GCCCCTTTCCACGGAGCAAACGCAA > promoter p2111 TTCGACGAATCGACGAAAAACATCGTCATAACGTCGACAATCCCCGTCGTTCGCATCATTCTTGG 10TCTTGGAACTGATTTTGCGCGTCCCTAAACTGTGTTCATGGCTCGACGCCGTACACAAACACCAACC CATCATCAGGAGATAAGCGC > promoter p2171 CACACCCCATTGAGTAAGCGGCCGAAACGCCGTGTCCATGAATTACAGGGCAGACGTCGGTTTGG CGCAGTGCTCTAATCTCGATACGAGCCGATTCAAGCAGCAAGGCTGGCGGGATCGCCGCGACCGG 15TCCTGATGTATGCGGCGCGACAGCGAATGCGATATGCGCCCGGCACCGGGCCTGCATGGCGGACT GTCGTTGCCCGTCGGAATGAACGCACGGATTCCACGGTGACGTGCATTCGAATCAACGTTTAGCA GACAACGAAGGTTGAGTA > promoter p2571 CATGACAGAGGCACAGCCCCACAGTGCTCGTCTCCCGATTACCACGCGGTTAATTGAGATAACGT 20CACTTTCAGGGCGATTTAAAGCGGGGAAACTACGTATCCGGCGCTCGGAGCGCCTGCGGCCGCG TGCCGCGCCACGGCGAGGGCACATCGCCGCAGTCGCGTCGGAACGGCGCGCTTTTCGACAAGAAC ATGATCACAACGTTCCACCCCCCTGTCAGGTTTACTTGCGCGCGATGTTGGTGCACCGCATGTGCC CGGCGGCCCCCTCCAACATGTGGGACGGCCTCTGAAACCGTTTCCGAAAGCTCAACTAACTCGT TGTTTTGTCGATAAATTGTCGGGATTGTGCAACGCACAAAAAAATGCTTGACATCGGCTTGTTTCTGC 25CCTAAAATAGGTTCCATTGCTGCGTTGCACAAAGCACGCGCATCCGAAGTTCCCCTGCGTAGTGC CCTTTATCCTTGCGATCGACGCGATCGCTTTTCAGGAGCATGACA 9 pages of 14 pages > promoter p3303 TGAGCATCGCCTGAAGACACGGCACGTTCGCGGCGCATGCGTGCACCGCGAGCGCGCCATACGGC ATTCGCGCCGGACGAGCAGTTCACAACAAGGGGCGCGACTCTGCGATGCGCCGGATGGAGCGGGC GTATCGAAGCGGTGTGTGCGGTGACGGGTGCCACGTTGCCGCGCCACATCATCGATCACTTTTCT 5TGTCGGTAAACTATAGGATGACTAAGCGAATTGCAGTAGTGACAGGTGGA >โปรโมเตอร์p3305 GCGTGCACTGATTGCGAATAATCAAAATAAGCGACACGTAAATATTCCCTTTCAGTGTGCACGGCA CGCGGTAAGAAAGTTAAAAATCGTTTCAATACAAGCGATTGTCACGTGTCCCCTTAAAAAATTACC GCCTGACCCGGTTGGCGGGGCATTTGTCGTGTTAGGGTTTCTCCTAGGCATTAATGCCATTGGATT 10GACAATTTATCGTTCTAGAATGGGCGCTCTAAACTTCGCGCATTCAATGAATGGTGTGCGATAAAT AAGAGATCGGGCGAATGGTCCGATTTTCGTCTTCTTTCCATAAACTCTCGCATTGTTACCAGGAGC GTGCAG >โปรโมเตอร์p4464 AAGACAGGTGAATCAGCGCGGATCGACGGTCATTCTTCGGATGTTTGACGCCGACGCCGTCCGTT 15TCCGCCGCGGGCACCTCAATATTTGAGATGAAATTCGGTAAAAATTGCCGAATCTGGCGGGTTTG CGTGATTCTGTTTGTTGTTTCTATGCAACCGTCAAGACGGTGACATGAAGGAATGATGGGATGGAT GTCACCAAAAGAGGTCGTCAAGAAGCCAAAAAAAAGCTTCAAAACAAATACTTATGACCAAGCCC CGATTTCATTATTTCTAGTTCTGGAAAGCTTATTTCTTTTATTGCGAATCGCTCCCCTAGGGTAC ACCCCTAAACTCACGGTTCCCAAACGGGCAACTATCCGGGTGCGGCCAGCAGGACCGATGGCGCT 20TCCGGACGGTTGCAGACCGTTTATGAACAAGGTCGCGAGACCTGCCTCTTTTTAGAAGGGAGCTC CACGAA > promoter p4682 GATACACGCGCGTCTGCAAATCGCTGGAGTTTTTAATTGATTTAAACAATTTCGGCGGTTCACAAA TAATCAATCAAATCATTTCAGCATAACCTGATTATTCTTTCAAATTCCAGTCAATTCACCTTCATA 25AGCCTTGTATTAAATTTCATTGCTATAAGCTGATCGTAAGCAACGTTGCCTCATGTATTTCTTCT CAACCAACCGGAAGATTGCCCA page 10 of 14 pages > promoter p4867 TCGGCCCTCCCGGCCGCGCGGTCCGGGGTGAACGATCGAGACAACCTATTGACGCTTCGCACCCA GGCCATGCCGCAAAGCATGACGACGTGTTTTTGCGCCAGGTCACGATCGGTTTCGCAGCTGGGAA CTCTGACAGCTGCACATCGACCGTCGAACGACTATGGTTTCTGCGCAGGATCGCATTGTCTTCCCT 5GCATCGCTGTTCAATTCATTCAAACCAAAAGGAATCTTTGAACA > promoter p5120 GGGTAAACGATATAGATATATCACCTGATTAATATCAAAGCCGGCCTACCATTCTTCTTGCCACGA TATAACGAGTGGCCTCCATGCTGAAGAAGCGGCAATCAAACCAGTATTTCAGAAACCGATTTTATCC AGATGCAATCTCACCGCGAACGTTCGCGGTGGATTGGCGCTTGCCGCTCAATTAACAACCGGAGA 10TATCATCA > promoter p5236 GGCGTATCGCCGATTGCGATTCGATACGCCGTTCAATTCAAATTTTCAGAATAAAAATATCGAAATA ATGATCGCCCGGATTTGCGGCAAAGTCTAAAAAACTCTTTTAAAAAACAGACACTTCTGCACGAC AGATACCCGAATCGAAATTCACGCGATTCAATCTGCGATTCATCCGGATTCAATTTCTTTTCTGA 15TTTTTCCGACTATGGTTCCAGTCGGCGAAAGCCGATTGTCATGATGCGCGGCGGCAAACAATCGC TGCCGCCATTACACGCGACGACGCGTCGGCCCCCACCGCTGCCGCGGATCCCCCAGCGGGCTCGA TGCGCACACAACCATTCCGACCGAGGGCTCA > promoter p5330 CGGTGAGGCTCGATTAAATCGAAACATTCAATTCGGAAATTGAGTGTTTTTATAATCGCCGGCATG 20CTGTGATTTCTGACAGCTGGAAAACCCTATTTTCCGACCTACGATAAATCAGCCGTTCAATAAACG GCTTCGCCTTGTTTTATTTAGGGATGAATCGTAATTTTTAAAAATTAATTGAGGGCAAAAATC > promoter p5617 GACGCATCACGACAGTTAACAATCTTTCCTGCGGCGCACGAACCGTGCCGATTATCGCGAGAAATA ATTGCAGCGGATGAGCTGCATGGTTTTCATCGTTGCAGGGTGCTATCCATAAATACACTCCGACGC 25CAAATTATTGAAATCGCCAAAAAAATTGTCTATACCCTAGACGAATCGACGTGGCCGGCATCGTG GCAGCACGGCCGCGCGAAAGAGGCGCGAATGACACGGCACGTGCCGCCGTTGCATTCAGCGTGTC 11 of 14 pages GCAGCAATCGAGAGGACTCCGGGGGATGCGGGCGGCCGATGCCGGGCCACCCGCATGAGTCGCA ACCTGGCTCACGCCATGCGCAGCCGCCGGAGCAACGCAGCTTTTTTACGTTCAACGGTCGATTAC CGACCCCGTCACTCGGAGGTTGTC > promoter p5642 5GGCGAGGAAGGATGTCGATGCCGGACGTATCGCGCGCGAAGGTGCGATTTGTGCGTATGTGCTTT CAAGACGACGCAGATCGCCAGGTGGATGGATTCAAATTTCGTGCGAACCGCAATTTAATTTATAA AAATGCACTAATTTAATTCGCGTTGTCTCAAATAAAATATATTCATCCGGTTGTATATCCGGCAATTT TGAATATACTGATTTTGTCTTGCCAACCTGGAGAGGAGTTGAACG > promoter p5662 10CGAGGGTCACAACAATCGCACCGCAGCAATTGCCGACTGCACCAAAAATGGAAATAGTCTCCGAT GTCCTTGATATATATGGATTTTCCACTGCTGTGATGTTTTGGAGACACTTTATTTTTTTGAGCTTTC TTGCGTCTATGGCACTGAGCTATTCTCCAATCCGCAACAAATAACGACGAATCACTTGCGTGGAGA AACTCAACGA > promoter p7121 15CTACCGCGGCGACGAGATCGAACGCGAGCTGTCCGCGTTGCACGAGATGCTCGAGCGCCACGCGC GGGCCGGCCGGGCCGCATCCTGACGCACGCACGACGTACGTTTTTCACGACGACGCATGCGGGCG TCCAGGGTGCCGCCATGCGTGCGCGTCTTCGCCAAGGAGGCTGTCGCG > promoter p7122 CGGCCATGTAACCGCCGCGCTCCCCGTGCTTCTCTGATTTCCGTTTTCAAAACGGAGGGTGTTGT 20TTTGCCTCCCGCCGCGTGGAAATAGCCTTGATGTCGCCCGTTATCGGATTGTCGTGATTCGACCAGT TTGATTGCTGGACACGAAGGAGCATCCC > promoter p7217 GACGCAGGTGCATTTCCGGGCGCGCTCGTGCACAGTTGCGGACGTCCGCGACCATTCGCCCCGC GATGTTCCGGGCGAGCGCGCGGCCGTCGTGCGCCCGTAACACGCAGCACGCAACATGCAACACGC 25CGCAGTCAGGCATTCGCTGTCCCTGTCCACAGACGCTTCGTGCATTCGAACCCTCGACGAAACAG GAGTCTTGCCA Page 12 of 14 pages. Promoter p7456 TGGACCTGTTGCGTGGCAGCCTGTCCGGGCACTACGTGTTCCCCGTGCCGCTGTCCCTGGCGGTG CTGGTCGGTTTCCTGCTGGCGTTCGCGTATTCCGCCGTGCGGGTGTTCGACGGGCGCAGCGGCGA CAACTGACCGGGGAGACCGGCCGCAACAGCGACGCAACCGGCGCCGGCGAACGACGGCGCGAAT 5GGACCCAGGGGCGCGGGCCGGACCGCCGGCGGCGCCCCGCCACGTGACTGACCCGCC Promoter p7459 ATGCTTTCGAAATGAATGAGGCGTTGATTTGCATTGAGTCGATTGATGTTTTCACTGGATATTCGA AGCCCTGTAAAAGCTGGCAGTATGCTGTTTGTTGACATGTGTGAAACTCGCGTGATAGAAGTTCG GCTCGCTGAAGTTAATCCGGATTTTCGTCATTGAAAATCGGCGTCAATTCGGAATGTCGTCCAATG 10AACCCGATGAGAGGTTGAATTGATCCCC Examination of the plasmid according to this invention. This can be achieved by transferring the pTet-T7 or pTet-T7-EGFP plasmid, or a recombinant plasmid. It contains nucleotide components of the promoter from the bacterium *B. stagnalis* (BCC87598) and a protein-synthesizing gene. Green fluorescence was introduced into the bacterial cells of Escherichia coli DH5? (E. coli DH5?) and the strains were selected. 15 genetically modified organisms were treated with recombinant plasmids on LB solid medium containing the antibiotic tetracycline. (tetracycline) at a concentration of 15 micrograms per milliliter, then the plasmid was extracted and examined. Hybrids from genetically modified strains created by restriction enzyme cutting and subsequent validation. Nucleotide sequence using Sanger sequencing. B. Construction of recombinant bacterial cells P. putida KT2440 containing the plasmid according to this invention. 20. This is achieved by transferring the modified plasmid vector according to this invention into the host cell P. putida. KT2440 and selected genetically modified strains that received recombinant plasmids on LB solid medium containing antibiotics. Tetracycline at a concentration of 15 micrograms per milliliter. Monitoring the production of green fluorescent protein in the P. putida KT2440 cell system. This is achieved by culturing P. putida KT2440 containing the recombinant plasmid, with the culture introduced in cell form. 25. A glycerol suspension (5 microliters) stored at -20°C was added to the medium (page 13 of 14). 3 milliliters of liquid LB containing 15 micrograms of tetracycline antibiotic. Add milliliters and incubate at 30 degrees Celsius while shaking at a speed of 200 revolutions per minute for [time]. After 14 to 18 hours, harvest the cells by centrifuging, sedimenting the cells, and aspirating the liquid portion, then dissolve them. Cells were placed in LB liquid medium, and the cell solution was diluted in LB liquid medium containing antibiotics. 5. Tetracycline at a concentration of 15 micrograms per milliliter was used to obtain an absorbance value at a wavelength of 600 nm. The nanometer (OD600) is equal to 0.01, as determined by a microplate reader. Pour 200 microliters of inoculum solution into each 96-well microplate. 3 wells and incubated at 30 degrees Celsius under shaking conditions at a speed of 800 revolutions per minute with a machine. Shake the cell to maintain temperature for 8 hours, then measure the cell turbidity using absorbance. 10 at a wavelength of 600 nanometers and the fluorescence value at the excited light wavelength. Or the stimulation type (excitation) at 485 nanometers and the type resulting from fluorescence (emission) at 528 nanometers. The data was then analyzed using nanometers, by calculating the average values ​​of cell turbidity and fluorescence. Each genetically modified strain undergoes normalization of its fluorescence to spectral value. The turbidity of the cells was averaged, and then the relative intensity of the modified strain was determined. 15 genetic variants to be examined against strains containing the pTet-T7 plasmid. Comparing the efficiency of promoters in recombinant plasmids in P. putida KT2440 by... Considering the fluorescence equivalent value, that is, genetically modified organisms with a fluorescence equivalent value equal to... A value less than 1 means the promoter is ineffective or has no impact, resulting in no creation. A green fluorescent protein in a genetically modified strain with a fluorescence equivalent greater than 1 means that... The expression of 20 promoters enables cells to produce green fluorescent protein, and the efficiency of... The 26 promoters will be compared based on their varying levels of fluorescence. The results of the examination of the expression system report the production of green fluorescent protein in cells. The host, P. putida KT2440, has a modified plasmid vector with a promoter sequence derived from the pathogen. Of the 26 promoters of B. stagnalis BCC87598, some were found to be highly effective. 25. Stimulate the expression of genes that produce green fluorescent protein, resulting in a fluorescence equivalent value greater than 1. The seven promoters are: p7459, p5330, p5642, p5617, p2035, p3303, and p2111. (Page 14 of 14) The best way to invent something. As previously stated in the section on full disclosure of the invention;

Claims

OCR10KL (June 22, 2026) 1. A modified plasmid vector that produces green fluorescent protein for reporting the promoter efficiency of Burkholderia spp. in host cells of the bacterium Pseudomonasputida. It incorporates a tetracycline resistance gene, a DNA replication initiator, a DNA conjugation initiator, and a ribosome binding site to initiate protein translation, with the following unique characteristics: • There is an egfp gene that is expressed as a green fluorescent protein. •

Images