A modified plasmid vector containing the reported genes and promoter of Burkholderia spp. for use in the bacterial host cell Escherichia coli BL21(DE3).

Abstract

Page 1 of 14. Invention details A name that reflects an invention. A modified plasmid vector containing the reported genes and promoter of Burkholderia spp. for... Used in host cells of the bacterium EscherichiacoliBL21(DE3). Five branches of science related to invention. The field of biotechnology, specifically regarding modified plasmid vectors containing genes, has reported results and... Promoter of Burkholderia spp. for use in host cells of the bacterium Escherichiacoli. BL21(DE3)(ReporterplasmidsforcharacterizationofBurkholderiaspp.promotersin Escherichiacoli) 10. Background information on the relevant art or science. Burkholderia spp. are bacteria in the class Proteobacteria. The potential to form various secondary metabolites (S. Kunakom, ASEust?quio,2019,BurkholderiaasaSourceofNaturalProducts,J.Nat.Prod.822018– 2037.andHSElshafie,I.Camele,2021,AnOverviewofMetabolicActivity,Beneficial 15andPathogenicAspectsofBurkholderiaSpp.,Metabolites.11,321.)Based on genome data of Burkholderia spp. has been shown to have a number of gene clusters associated with expression. of numerous secondary metabolites (Alam et al., 2022, Insilicogenomemining of potentialnovelbiosyntheticgeneclustersfordrugdiscoveryfromBurkholderiabacteria, Comput.Biol.Med140,105046) which includes both groups of genes involved in the creation of new substances and groups of genes... 20. Regarding the expression of bioactive compounds, however, the data on compound discovery... Secondary metabolites from Burkholderia spp. are also less numerous than those from the aforementioned gene pools because... These are genes that are either unexpressed or minimally expressed (cryptic genes), making them undetectable and therefore... The use of high-efficiency promoters to stimulate the expression of genes or groups of genes responsible for producing substances. Secondary metabolites can be used to increase substance production; however, studies and findings are shown on page 2 of 14. There is a scarcity of high-efficiency promoters for gene activation in Burkholderia spp., leading to... It is necessary to find more high-efficiency promoters from strains within this group. Genetic engineering technology is currently being used to study substances. The genetics of microorganisms are studied by applying groups of genes capable of producing reporting substances for tracking purposes. 5. Expression of the gene of interest or measurement of the expression level of the studied gene by Escherichia coli. BL21(DE3)(E.coliBL21(DE3)) is considered a type of host cell that has been developed for expression. The gene of interest is designed to produce the desired protein or enzyme under the control of the T7 promoter. (Studier et al., 1986, Use of bacteriophage T7 RNA polymerase to direct selective (high-level expression of clonedgenes, J.Mol.Biol.189,113–130.) In addition, E. coli 10BL21(DE3) is also a host cell with better potential for producing secondary metabolites. Other E. coli strains (Zhang et al., 2017, Broad-Host-Range Expression Reveals Native) andHostRegulatoryElementsThatInfluenceHeterologousAntibioticProductionin Gram-Negative Bacteria, mBio8:e01291-17.) Therefore, E. coli BL21(DE3) was chosen as the cell. The hosts for protein production testing reported results under the control of different promoters. Fifteen examples of genes reported to have been used in E. coli include enzyme-producing genes such as the lacZ gene. For the production of the enzyme beta-galactosidase (Aviv and Gal-Mor, 2018), LacZReporterSystemasaTooltoStudyVirulenceGeneRegulationinBacterial Pathogens.InHost-PathogenInteractions:MethodsandProtocols,Methodsmol.biol. 1734) gusA gene for the production of beta-glucoronidase enzyme (Myronovskyi) 20 et al., 2011,?-GlucuronidaseasaSensitiveandVersatileReporterinActinomycetes., (Appl.Environ.Microbiol.77,5370–83) The phoA gene is responsible for the production of the alkaline phosphatase enzyme. (alkalinephosphatase)(Gibson and Caparon,2002,AlkalinePhosphataseReporter TransposonforIdentificationofGenesEncodingSecretedProteinsinGram-Positive Microorganisms.,Appl.Environ.Microbiol.68,928–932) cat gene for enzyme production. 25-chloramphenicolacetyltransferase (Gorman and...) Moffat and Howard, 1982, RecombinantGenomesWhichExpressChloramphenicol Acetyltransferase in Mammalian Cells.,Mol.Cell.Biol.2,1044–1051) enzyme-producing gene, page 3 of 14. Luciferase (Brasier and Ron, 1992, Luciferase Reporter Gene Assayin) MammalianCells.,MethodsEnzymol.,216,386-397) also have genes that can be expressed as Other reported proteins include groups of fluorescent proteins such as the gfp gene for the production of green fluorescent protein. (Soboleski, Oaks, and Halford, 2005, Green Fluorescent Protein Isa Quantitative) 5ReporterofGeneExpressioninIndividualEukaryoticCells.,FASEBJ.19,440-442)generfp For the production of red fluorescent protein (Rodrigues et al., 2001, Red Fluorescent Protein). (DsRed)asaReporterinSaccharomycesCerevisiae.,J.Bact.,183,3791-3794), etc. The properties of a protein or substance should be quantitatively measurable using simple procedures. It should be low-cost, have good sensitivity, and be non-toxic to cells. 10. Can be used to display gene expression results, reporting results with a linear relationship. (correlation) can be obtained, and due to these distinctive characteristics, reporting genes are often used for verification. The processes of transcription and translation of genes of interest or use. To test and compare the effectiveness of promoters by inserting a reporting gene at the end. Whether the promoter is in a plasmid vector or in the genome sequence, the study focuses on the expression of the gene of interest. 15. Different strains of microorganisms require promoters isolated from that strain to maintain control. The interpretation and decoding of genes studied using the recombinant cell system has led to the development of plasmid vectors. The nucleotide sequence of the promoter is specific to the study of genes of interest for different strains. Based on previous searches, there have been no reports of the development of plasmids containing genes with reported results for practical use. For testing the efficacy of promoters from Burkholderia spp. in a host cell system. 20 E. coli bacteria This invention focuses on the design and construction of a modified plasmid vector containing a reported gene and... Nucleotide components of the promoter from Burkholderia stagnalis BCC87598. (B. stagnalis BCC87598) for use in the host bacterial cell E. coli BL21(DE3) for comparison. The expression efficiency of promoters at the cellular level and the selection of high-performance promoters. 25. B. stagnalis (BCC87598) - Page 4 of 14. The nature and purpose of the invention. This invention involves developing a modified plasmid vector with an inserted nucleotide sequence. The protomer is from Burkholderia stagnalis BCC87598 and has a reported gene system which is a plasmid. The carrier according to this invention is characterized by the presence of a nucleotide sequence of the egfp gene. 5. Expressed as enhanced green fluorescent protein (EGFP) and the HPPD gene. This is expressed as an enzyme for the production of brown pigment (4-Hydroxyphenylpyruvatedioxygenase, HPPD) and contains the nucleotide sequence of 26 promoters from B. stagnalis BCC. 87598 in the host bacterial cell E. coli BL21(DE3). With the aim of using it to compare the performance of promoters and to select them. 10 Highly effective promoters of Burkholderia spp. when these plasmid vectors are used in cells. E. coli BL21(DE3) bacteria yielded recombinant bacterial cells from which the expression of Highly effective cellular promoter expression can be used to screen and compare expression levels. The promoters of Burkholderia spp. and Gram-negative bacteria can be removed with a simple and easy procedure. The cost is lower than analysis using real-time polymerase chain reaction (PRCC). (15chainreaction) Brief description of the painting. Figure 1 shows an image of a modified plasmid vector involved in its creation and performance testing. A modified plasmid vector based on this invention is intended for use in the bacterial host cell E. coli BL21(DE3). BglII is the base sequence of the recognition region of restriction enzymes. 20T7promoter is the base sequence of the T7 promoter. RNARbs are the base sequences of ribosome-binding sites. NdeI is the base sequence of the recognition region of the restriction enzyme NdeI. EGFP is the base sequence of the gene that produces a green fluorescent protein. T7terminator is the base sequence of the T7 terminator. 25AmpRpromotor is the promoter base sequence of the ampicillin resistance gene. AmpR is the base sequence of the ampicillin resistance gene (page 5 of 14). Ori is the base sequence of the DNA replication start position (Origin of DNA). (replication) Rop is the base sequence of the gene that produces the ROP (Repressor of Primer) protein. MutatedHPPDfromA-F0070 is the base sequence of the gene that produces the HPPD enzyme. 5. Full disclosure of the invention. This invention reveals details of a modified plasmid vector containing the reported gene and... Promoter of Burkholderia spp. for use in host cells of the bacterium Escherichiacoli. BL21(DE3) can be used for screening and comparing high-performance promoters. The promoter efficiency of B. stagnalis BCC87598 as analyzed at the cellular level. 10E.coli obtained a plasmid based on this invention which is characterized by the insertion of a nucleotide sequence of... A total of 26 promoters from B. stagnalis BCC87598 were placed in front of the reported gene. Two types are the egfp gene, which expresses an enhanced green fluorescent protein. protein, EGFP) and the hppd gene which is expressed as an enzyme for the production of brown pigment (4- Hydroxyphenylpyruvated oxygenase (HPPD) in the host bacterial cell E. coli BL21(DE3), which 15. When the aforementioned plasmid vector was used in E. coli BL21(DE3) bacterial cells, recombinant bacterial cells were obtained. The expression of promoters at the cellular level can be checked by detecting green fluorescent protein. (EGFP) using the relative EGF intensity and measuring pigment production. Sugar produced by the enzyme HPPD is measured by its absorption at a wavelength of 400 nanometers. Replacing the study of promoter efficacy with the RT-PCR method. 20. This modified plasmid vector contains a component that includes the T7 terminator promoter. T7 ampicillin resistance gene promoter of the ampicillin resistance gene, initiation point. DNA replication of genes creates the protein Rop and ribosome binding sites to initiate translation. Proteins have the following characteristics: • There are genes that express as green fluorescent proteins or genes that express enzymes for... 25. Produces brown pigment. • There is a promoter isolated from B. stagnalis on page 6 of 14. The strain of B. stagnalis used is B. stagnalis BCC87598. The gene expressing the enzyme that produces this brown pigment has a modified nucleotide sequence from the end. 5' to 3' at the cleavage site of the enzyme BglII from AGATCT to AAATCT. Bacterial host cells E. coli BL21(DE3) containing a plasmid vector component with the reported gene. 5 results for comparing the promoter efficiency of Burkholderia spp. The process for fabricating the plasmid described in this invention involves the following steps: a. Creation of plasmid vectors containing the reported gene by modifying the pET17b plasmid vector to include the egfp gene. Insert it at the end of the nucleotide promoter sequence T7. This is achieved by amplifying the nucleotide fragments of the egfp gene through polymerase chain reaction. 10 (polymerase chain reaction, PCR) using the pEGFP-hDHFR plasmid as the DNA template and using... The primer has the following base sequence from the 5' to the 3' end: Forwardprimer EGFPF_XbaI 5'-GCAGTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATG AGCAAGGGCGAGGAGC-3' 15ReverseprimerEGFPR_KpnISacI(Reverseprimer) 5'-CCATGGTACCGAGCTCTTACTTGTACAGCCTGTCCATG-3' The nucleotide tips of the egfp gene and the pET17b plasmid vector were then truncated using the enzyme KpnI. And XbaI was purified and the DNA fragments of the egfp gene and the obtained pET17b plasmid were linked by Ligation was used to create a modified plasmid vector named pET17b-EGFP. 20b. Fabrication of a plasmid vector containing the reported gene by modifying the pET17b plasmid vector to include the hppd gene. Insert it at the end of the nucleotide promoter sequence T7. This is achieved by amplifying the nucleotide fragments of the hppd gene using polymerase chain reaction (PCR). Using the genomic DNA of Streptomycess p.A-F0070 as a template DNA and using primers. HPPD1_FxbaI and HPPD1_RkpnI, with base sequences from the 5' to the 3' end as follows (page 7 of 14): Forwardprimer HPPD1_FxbaI 5'-GCAGTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGACTGAGAT CCTGAATCCC-3' Reverse primer HPPD1_RkpnI (Reverseprimer) 55'-CCATGGTACCTCAGAGGTTTTCCGCGCTTC-3' The ends of the nucleotide fragments of the hppd gene and the pET17b carrier DNA were then truncated using the enzyme KpnI. And XbaI was purified and the nucleotide fragments of the hppd gene and the obtained pET17b plasmid were linked by Ligation was performed to obtain a modified plasmid vector named pET17b-HPPD. Next, the nucleotide sequence in the hppd gene at the BglII enzyme cutoff site was modified. 10. Convert AGATCT to AAATCT using the following method: cut the pET17b-HPPD plasmid with the enzyme BglII. Then, a 3,305 base pair nucleotide fragment was purified and subsequently amplified to a 1,138 base pair fragment. The bases were determined by polymerase chain reaction using the pET17b-HPPD plasmid as the DNA template and used... The mutatedHPPD_F and mutatedHPPD_R primers have the following base sequences from the 5' to the 3' end: Forwardprimer mutatedHPPD_F (Forwardprimer) 155'-GGACCCAACGCTGCCCGA-3' Reverse primer mutatedHPPD_R (Reverseprimer) 5'-GGACCGGCTTGGTGAAGATTTGG-3' The two nucleotide fragments are then joined together using the Gibson assembly technique. (Assembly) by mixing 3,305 and 1,138 base pair nucleotide fragments in a 1:5 ratio and incubating. 20 nucleotide solutions were steeped at 50°C for 20 to 60 minutes to obtain plasmid vectors. Modified and named pET17b-HPPDmut. C. Fabrication of a modified plasmid containing a promoter from Burkholderia stagnalis BCC87598. The gene page reports the results for egfp and hppd. This is achieved by increasing the number of nucleotide fragments of the promoter from the bacterium *B. stagnalis* (BCC). 2587598 Total of 26 promoters identified by polymerase chain reaction using genomic DNA. Page 8 of 14. The template DNA from B. stagnalis BCC87598 was then cut, and the plasmid pET17b-EGFP was added. The pET17b-HPPDmut plasmid was inoculated with the enzymes BglII and NdeI, and a promoter nucleotide fragment was inserted. The gene page was inserted into a plasmid prepared using the Gibson assembly technique to obtain the plasmid. A modified vector containing all 26 promoters from the Burkholderia stagnalis BCC87598 strain. The 5 nucleotide sequences (from the 5' to the 3' end) of the promoter from the bacterium Burkholderia stagnalis BCC. 87598, a total of 26 promoters, have the following details: Promoter P705 CTTCAGTGGGATGGGCAAACTTCCCTCCGGAAAAAGCGGACAGCCGTGTGGCGATCCGCTTGATC AAGCGATCTGGGGTGGCGGCGCGTCGCGCGCTGGCCGCCGACTTGATTTGGCGCGCGAGGCCCG 10ATGGCCACGCGCGCCATACCGTATTCATTAGCGTAAGCGCGTGGTATCCGCGTACGCCGATGAAT AGCCCGCTTCGAAGCGCACGTCCTGAACAGCGTCCGCGGGAAGCGGTTTTGACGAAGGGTGTAG TTTGAACTGACTCTCATCTGAACCTGAAGGAGAACAACA > promoter p932 TTCGCTGCACCGCGATACGGCGCATCCGATTTTATGCAACCCGATTCTTTTCTCAGGTTGACGGA 15TATAGCCACTGTCATGAACAATCGGCAACGCTATCGAAACCCTTTTGTTTCGACGCGACGTCGAT ATAGAGGGTTGCGCAGCGTTGCTTTTAGACTTGCGCAACGCAAAACACAACCATAATCAATCAAC CGGGCCGGAAAAATACGCAAGCT > promoter p1173 CGCACGCTTGACAATTTCTAAAAGTTACGGCAGGCCGGTGTTGCGCATGCGCCACAAACGGATAG 20GCGATGTTAGGGTGGGGAGGATTTTTTTTCGTGGGAAGGGAACGATATGGCAAAATGCCAACGCA CTGAAAGTTAGACGTGCTCGAAGTCTACACAGAGCGGCGCCGCGTTTTTGTGCCGCACCAATG TTATACTTCGAGCAATGTATGACTTGTCACCGTCAACAGGCTCGCAGTAAACCTGCGGTAATCTCA ATTTCGAGAGGAGAAAT > promoter p1957 25CGGCAACGTCAATAGAGGGAGAACGAATGGTGGCGCGGCGCGCCTCCTGCCGAATAGACGAATGG GCTTCGGAAATATTTAGCAAGACGGCCTTCGGCGACGAAGCGATCCACATTCGCGGTAAAAAATCหน้า9ของจำนวน14หน้า GGCCGCGCCGTTCGTCACACCAGTGAAGCCGCCCAGCGCGGCCCCGTGACTTGGCCGAAGCGGCC GGACCCGAAGGACTTCACGCTCA >โปรโมเตอร์p2035 AGCACTCACCGCTCAATGAAACACTGTCAAAAGATGCTGATATATCTAAGCGCAATTTTTTGGCAA 5AAACCAAAACCGTGTTCTATGCTTTGATCACGATTCCTCCGAGCGGCTCACTGGGTTCGACATTTT TTTGTCAAGGGCGCGCGACGAGGTTCGGCCTGTGATCTGCTCAATGTCATCAAAGGAAAAGTGGG CGAGAGAATTTAAGCATGCATGCTTTTTGGTCCCTCGATCGAGAGGTAATTAATATCTGCAAGGAG ATGGGGAAA >โปรโมเตอร์p2074 10CAAAAAATCCATTTGTTATGGATCGCGTTAAATTTAAAAATAGTCGCTTCGAGTGAGTGAATTTTG CACCACCGTCGTGCTACAGTAGGTTTCAATTCTTTCAGCAAATAAATACCTCATGCCGCCACGCGG CGGATCCGGCTGTGTCCGCTCGCTGCTCGATGCAATATCGTCAAGGATATTTTCGATTTTTAAACT TCGGCTGTCTTCGATCAGGTTGCTCACATTAAATTGTGATGAGGATAATT >โปรโมเตอร์p2082 15CGCGATCGCTCCATCAACGGTGGATCCGTCAGTGCAATTCAGTCTAAGAAGCAGGCTCCCCGCAT GCTTGATTCAGATCAACGGCGCTCACGCCCGGCGGGCGGCGGCGATCCGACACACCCCCGCCGGTC GCACCTGCTTGACCGAGGTCAAGCAAACCGGCATGCGGGCGCCTACATTGTTGGGCGACGGGGAT GCCCCTTTCCACGGAGCAAACGCAA > promoter p2111 20TTCGACGAATCGACGAAAAACATCGTCATAACGTCGACAATCCCCGTCGTTCGCATCATTCTTGG TCTTGGAACTGATTTTGCGCGTCCCTAAACTGTGTTCATGGCTCGACGCCGTACACAAACACCAACC CATCATCAGGAGATAAGCGC > promoter p2171 CACACCCCATTGAGTAAGCGGCCGAAACGCCGTGTCCATGAATTACAGGGCAGACGTCGGTTTGG 25CGCAGTGCTCTAATCTCGATACGAGCCGATTCAAGCAGCAAGGCTGGCGGGATCGCCGCGACCGG TCCTGATGTATGCGGCGCGACAGCGAATGCGATATGCGCCCGGCACCGGGCCTGCATGGCGGACT 10 pages GTCGTTGCCCGTCGGAATGAACGCACGGATTCCACGGTGACGTGCATTCGAATCAACGTTTAGCA GACAACGAAGGTTGAGTA > promoter p2571 CATGACAGAGGCACAGCCCCACAGTGCTCGTCTCCCGATTACCACGCGGTTAATTGAGATAACGT 5CACTTTCAGGGCGATTTAAAGCGGGGAAACTACGTATCCGGCGCTCGGAGCGCCTGCGGCCGCG TGCCGCGCCACGGCGAGGGCACATCGCCGCAGTCGCGTCGGAACGGCGCGCTTTTCGACAAGAAC ATGATCACAACGTTCCACCCCCCTGTCAGGTTTACTTGCGCGCGATGTTGGTGCACCGCATGTGCC CGGCGGCCCCCTCCAACATGTGGGACGGCCTCTGAAACCGTTTCCGAAAGCTCAACTAACTCGT TGTTTTGTCGATAAATTGTCGGGATTGTGCAACGCACAAAAAAATGCTTGACATCGGCTTGTTTCTGC 10CCTAAAATAGGTTCCATTGCTGCGTTGCACAAAGCACGCGCATCCGAAGTTCCCCTGCGTAGTGC CCTTTATCCTTGCGATCGACGCGATCGCTTTCAGGAGCATGACA > promoter p3303 TGAGCATCGCCTGAAGACACGGCACGTTCGCGGCGCATGCGTGCACCGCGAGCGCGCCATACGGC ATTCGCGCCGGACGAGCAGTTCACAACAAGGGGCGGCACTCTGCGATGCGCCGGATGGAGCGGGC 15GTATCGAAGCGGTGTGTGCGGTGACGGGTGCCACGTTGCCGCGCCACATCATCGATCACTTTTCT TGTCGGTAAACTATAGGATGACTAAGCGAATTGCAGTAGTGACAGGTGGA > promoter p3305 GCGTGCACTGATTGCGAATAATCAAAATAAGCGACACGTAAATATTCCCTTCAGTGTGCACGGCA CGCGGTAAGAAAGTTAAAAATCGTTTCAATACAAGCGATTGTCACGTGTCCCCTTAAAAAATTACC 20GCCTGACCCGGTTGGCGGGGCATTTGTCGTGTTAGGGTTTCTCCTAGGCATTAATGCCATTGGATT GACAATTTATCGTTCTAGAATGGGCGCTCTAAACTTCGCGCATTCAATGAATGGTGTGCGATAAAT AAGAGATCGGGCGAATGGTCCGATTTTCGTCTTCTTTCCATAAACTCTCGCATTGTTACCAGGAGC GTGCAG >โปรโมเตอร์p4464 25AAGACAGGTGAATCAGCGCGGATCGACGGTCATTCTTCGGATGTTTGACGCCGACGCCGTCCGTT TCCGCCGCGGGCACCTCAATATTTGAGATGAAATTCGGTAAAAATTGCCGAATCTGGCGGGTTTG CGTGATTCTGTTTGTTGTTTCTATGCAACCGTCAAGACGGTGACATGAAGGAATGATGGGATGGATหน้า11ของจำนวน14หน้า GTCACCAAAAAGAGGTCGTCAAGAAGCCAAAAAAAAGCTTCAAAACAAATACTTATGACCAAGCCC CGATTTCATTATTTCTAGTTCTGGAAAAGCTTATTTCTTTATTTGCGAATCGCTCCCCTAGGGTAC ACCCCTAAACTCACGGTTCCCAAACGGGCAACTATCCGGGTGCGGCCAGCAGGACCGATGGCGCT TCCGGACGGTTGCAGACCGTTTATGAACAAGGTCGCGAGACCTGCCTCTTTTTAGAAGGGAGCTC 5CACGAA >โปรโมเตอร์p4682 GATACACGCGCGTCTGCAAATCGCTGGAGTTTTTAATTGATTTAAACAATTTCGGCGGTTCACAAA TAATCAATCAAATCATTTCAGCATAACCTGATTATTCTTTCAAATTCCAGTCAATTCACCTTCATA AGCCTTGTATTAAATTTCATTGCTATAAGCTGATCGTAAGCAACGTTGCCTCATGTATTTCTTCT 10CAACCAACCGGAAGATTGCCCA > promoter p4867 TCGGCCCTCCCGGCCGCGCGGTCCGGGGTGAACGATCGAGACAACCTATTGACGCTTCGCACCCA GGCCATGCCGCAAAGCATGACGACGTGTTTTTGCGCCAGGTCACGATCGGTTTCGCAGCTGGGAA CTCTGACAGCTGCACATCGACCGTCGAACGACTATGGTTTCTGCGCAGGATCGCATTGTCTTCCCT 15GCATCGCTGTTCAATTCATTCAAACCAAAAGGAATCTTTGAACA > promoter p5120 GGGTAAACGATATAGATATATCACCTGATTAATATCAAAGCCGGCCTACCATTCTTCTTGCCACGA TATAACGAGTGGCCTCCATGCTGAAGAAGCGGCAATCAAACCAGTATTTCAGAAACCGATTTTATCC AGATGCAATCTCACCGCGAACGTTCGCGGTGGATTGGCGCTTGCCGCTCAATTAACAACCGGAGA 20TATCATCA > promoter p5236 GGCGTATCGCCGATTGCGATTCGATACGCCGTTCAATTCAAATTTTCAGAATAAAAATATCGAAATA ATGATCGCCCGGATTTGCGGCAAAGTCTAAAAAACTCTTTTAAAAAACAGACACTTCTGCACGAC AGATACCCGAATCGAAATTCACGCGATTCAATCTGCGATTCATCCGGATTCAATTTCTTTTCTGA 25TTTTTCCGACTATGGTTCCAGTCGGCGAAAGCCGATTGTCATGATGCGCGGCGGCAAACAATCGC TGCCGCCATTACACGCGACGACGCGTCGGCCCCCACCGCTGCCGCGGATCCCCCAGCGGGCTCGA TGCGCACACAACCATTCCGACCGAGGGCTCA 12 pages of 14 pages > promoter p5330 CGGTGAGGCTCGATTAAATCGAAACATTCAATTCGGAAATTGAGTGTTTTTATAATCGCCGGCATG CTGTGATTTCTGACAGCTGGAAAACCCTATTTTCCGACCTACGATAAATCAGCCGTTCAATAAACG GCTTCGCCTTGTTTTATTTAGGGATGAATCGTAATTTTTAAAAATTAATTGAGGGCAAAAATC 5> promoter p5617 GACGCATCACGACAGTTAACAATCTTTCCTGCGGCGCACGAACCGTGCCGATTATCGCGAGAAATA ATTGCAGCGGATGAGCTGCATGGTTTTCATCGTTGCAGGGTGCTATCCATAAATACACTCCGACGC CAAATTATTTGAAATCGCCAAAAAAATTGTCTATACCCTAGACGAATCGACGTGGCCGGCATCGTG GCAGCACGGCCGCGCGAAAGAGGGCGCGAATGACACGGCACGTGCCGCCGTTGCATTCAGCGTGTC 10GCAGCAATCGAGAGGACTCCGGGGGATGCGGGCGGCCGATGCCGGGCCACCCGCATGAGTCGCA ACCTGGCTCACGCCATGCGCAGCCGCCGGAGCAACGCAGCTTTTTTACGTTCAACGGTCGATTAC CGACCCCGTCACTCGGAGGTTGTC > promoter p5642 GGCGAGGAAGGATGTCGATGCCGGACGTATCGCGCGCGAAGGTGCGATTTGTGCGTATGTGCTTT 15CAAGACGACGCAGATCGCCAGGTGGATGGATTCAAAATTTCGTGCGAACCGCAATTTAATTTATAA AAATGCACTAATTTAATTCGCGTTGTCTCAAATAAAATATATTCATCCGGTTGTATATCCGGCAATTT TGAATATACTGATTTTGTCTTGCCAACCTGGAGAGGAGTTGAACG > promoter p5662 CGAGGGTCACAACAATCGCACCGCAGCAATTGCCGACTGCACCAAAAATGGAAATAGTCTCCGAT 20GTCCTTGATATATATGGATTTTCCACTGCTGTGATGTTTTGGAGACACTTTATTTTTTTGAGCTTTC TTGCGTCTATGGCACTGAGCTATTCTCCAATCCGCAACAAATAACGACGAATCACTTGCGTGGAGA AACTCAACGA > promoter p7121 CTACCGCGGCGACGAGATCGAACGCGAGCTGTCCGCGTTGCACGAGATGCTCGAGCGCCACGCGC 25GGGCCGGCCGGGCCGCATCCTGACGCACGCACGACGTACGTTTTTCACGACGACGCATGCGGGCG TCCAGGGTGCCGCCATGCGTGCGCGTTCTCGCCAAGGAGGCTGTCGCG 13 of 14 pages > promoter p7122 CGGCCATGTAACCGCCGCGCTCCCCGTGCTTCTCTGATTTCCGTTTTCAAAACGGAGGGTGTTGT TTTGCCTCCGCCGCGTGGAAATAGCCTTGATGTCGCCCGTTATCGGATTGTCGTGATTCGACCAGT TTGATTGCTGGACACGAAGGAGCATCCC 5> promoter p7217 GACGCAGGTGCATTTCCGGGCGCGCTCGTGCACAGTTGCGGACGTCCGCGACCATTCGCCCCGC GATGTTCCGGGCGAGCGCGCGGCCGTCGTGCGCCCGTAACACGCAGCACGCAACATGCAACACGC CGCAGTCAGGCATTCGCTGTCCCTGTCCACAGACGCTTCGTGCATTCGAACCCTCGACGAAACAG GAGTCTTGCCA 10> promoter p7456 TGGACCTGTTGCGTGGCAGCCTGTCCGGGCACTACGTGTTCCCCGTGCCGCTGTCCCTGGCGGTG CTGGTCGGTTTCCTGCTGGCGTTCGCGTATTCCGCCGTGCGGGTGTTCGACGGGCGCAGCGGCGA CAACTGACCGGGAGACCGGCCGCAACAGCGACGCAACCGGCGCCGGCGAACGACGGCGCGAAT GGACCCAGGGGCGCGGGGCGGACCGCCGGCGGCCCCCCGCACGTGACTGACCCGCC 15> promoter p7459 ATGCTTTCGAAATGAATGAGGCGTTGATTTGCATTGAGTCGATTGATGTTTTCACTGGATATTCGA AGCCCTGTAAAAGCTGGCAGTATGCTGTTTGTTGACATGTGTGAAACTCGCGTGATAGAAGTTCG GCTCGCTGAAGTTAATCCGGATTTTCGTCATTGAAAATCGGCGTCAATTCGGAATGTCGTCCAATG AACCCGATGAGAGGTTGAATTGATCCCC 20. Then, construct an E.coli BL21(DE3) strain containing a modified plasmid vector with a promoter from the bacteria. B. stagnalis BCC87598 and the reported egfp or hppd genes were transferred via the pET17b plasmid. The pET17b-EGFP plasmid, the pET17b-HPPDmut plasmid, and modified plasmids containing a promoter from the pathogen. The B. stagnalis BCC87598 gene is inserted at the page of the gene that reports egfp or hppd into E. coli cells. BL21(DE3) was then used to select genetically modified strains that had received plasmids on LB solid medium. 25 samples of ampicillin at a concentration of 100 micrograms per milliliter were administered, and then the grown bacteria were selected. Culture the bacteria in LB liquid medium containing ampicillin at a concentration of 100 micrograms per milliliter (as shown on page 14 of 14). The temperature is 37 degrees Celsius under shaking conditions at a speed of 200 revolutions per minute for 14 to 18 hours. To preserve the microorganisms in the form of a cell suspension in a 25 percent glycerol solution. At a temperature of minus 80 degrees Celsius. Examination of the plasmid according to this invention. 5. The plasmid according to this invention can be verified by transferring a plasmid vector. The modified strains were introduced into E. coli DH5 cells, and the genetically modified strains receiving the plasmid were selected. A modified vector on Luria-Bertani (LB) solid medium containing the antibiotic ampicillin. A concentration of 100 micrograms per milliliter was used to extract the modified plasmid vector DNA, which was then cut. The restriction enzymes are then used, and the nucleotide sequence is verified using the Sanger sequencing method. 10 (Sanger sequencing) This plasmid invention is being used to test the effectiveness of a microbial promoter. B. stagnalis BCC87598 This is done by measuring the expression of genes, and reporting results for both types: genes that produce fluorescent proteins. Green and HPPD enzyme genes are involved in the production of brown pigment in the host cell E. coli BL21(DE3). 15. There are 26 different promoter-modified plasmid vectors, with the promoter having... High efficiency will result in high expression of the egfp or hppd genes and cause E. coli to produce [the desired substance / product]. High concentrations of green fluorescent protein or brown pigment, respectively, were detected by testing the number of promoters. Of these 26 promoters, 5 showed high efficiency in stimulating gene expression. Green fluorescent proteins p7459, p5642, p1173, p5617, and p2035 were generated, and the organism has 14 promoters. Twenty genes that demonstrated high efficiency in stimulating the expression of genes producing enzymes that create brown pigment include: p2074,p7459,p5120,p5330,p2571,p5642,p1173,p4682,p705,p5617,p3305,p2035, p932 and p2111 The best way to invent something. As previously stated in the section on full disclosure of the invention;