The Selected Aspir Incident

TR202316185BActive Publication Date: 2026-06-22COMMONWEALTH SCI & IND RES ORG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
TR202316185
Authority / Receiving Office
TR · TR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-05-31
Publication Date
2026-06-22
Estimated Expiration
2041-05-31

Smart Images

  • Figure 00000100_0000
    Figure 00000100_0000
  • Figure 00000100_0001
    Figure 00000100_0001
  • Figure 00000101_0000
    Figure 00000101_0000
Patent Text Reader

Abstract

The present invention relates to select transgenic safflower events that produce high levels of oleic acid.
Need to check novelty before this filing date? Find Prior Art

Description

1 28780 TAR FNAME THE SELECTIVE ASP R INCIDENT BULU UN AREA The current finding is select transgenic aspirin that produces high levels of oleic acid. It is related to the events. BACKGROUND OF BULU 10 Vegetable oils are an important source of dietary fat for humans and are essential for development. It represents approximately 25% of calorie intake in these countries (Broun et al., 1999). World production of vegetable oils is at least approximately 110 million tons per year, and of this... 86% is used for human consumption. Almost all of this oil is soy. oilseeds such as beans, canola, safflower, sunflower, cottonseed and peanuts 15 obtained from plants or plantation trees such as palm, olive and coconut (Gunstone, 2001; Oil World Annual, 2004). Food oils affect individual fats. Scientific studies on the effects of acid compounds on various aspects of human health. Increased understanding and public awareness have made functionality necessary for various food applications. 20 These modifications affect the metabolic pathways for plant fatty acid synthesis and... This requires information about the genes that encode enzymes for these pathways (Liu et al., 2002; Thelen and Ohlrogge, 2002). The nutritional effects of various solid and liquid fats, especially solid and liquid fats Even among the most common are cardiovascular diseases, cancer, and various inflammatory conditions. 25 Its effect is given great importance. High levels of cholesterol in the diet and Saturated fatty acids are thought to increase the risk of heart disease, and this situation, Consumption of saturated animal fats, which are rich in cholesterol, can increase cholesterol levels. a diet that does not contain plant-based foods and aims to reduce satiety in favor of plant-based foods. This has led to recommendations (Liu et al., 2002). 30 2 Dietary intake of cholesterol found in animal or other foods increases total blood cholesterol levels. It can significantly increase cholesterol levels, as well as solid and liquid fats. The fatty acids it contains have significant effects on blood serum cholesterol levels. It has also been found that it is possible. Dietary fatty acids cause undesirable low levels in the blood. low-density lipoprotein (LDL) and desirable high-density lipoprotein (HDL) 5 Its effect on cholesterol forms is particularly interesting. In general, saturated or acids, especially myristic acid, which is the main saturated substance found in plant oils. (14:0) and palmitic acid (16:0) increase serum LDL-cholesterol levels and As a result, it has the undesirable characteristic of increasing the risk of cardiovascular disease. (Zock et al., 1994; Hu et al., 1997). However, in plant oils 10 stearic acid (18:0), which is the other main saturated acid found, reduces LDL-cholesterol. It has been shown that it did not raise cholesterol and could actually lower total cholesterol (Bonanome). (Grundy, 1988; Dougherty et al., 1995). Therefore, stearic acid is generally... It is considered to be at least neutral in terms of cardiovascular disease risk (Tholstrup) and others, 1994). On the other hand, unsaturated oleic acid (18:1) and other unsaturated 15 These acids have a beneficial property such as lowering LDL-cholesterol (Roche and Gibney, (2000), therefore they reduce the risk of cardiovascular disease. High oleic acid content, and also, but not limited to, generally or lubricants in the form of acid esters, biofuels, or raw materials for alcohols substances, plasticizers, waxes, metal stearates, emulsifiers, personal care 20 products, soaps and detergents, surfactants, pharmaceuticals, metal processing additives, raw materials for fabric softeners, inks, clear soaps, PVC stabilizer, intermediate for alkyd resins and many other types of sub-oleochemical derivatives. It has many industrial uses, such as being a raw material. Oil producers and food manufacturers have traditionally used unsaturated fats in oils. to reduce the level of acids, thus improving oxidative stability in frying applications. to increase and also to provide solid fats for use in margarine and solid fats They relied on hydrogenation for this. Hydrogenation breaks down carbon-carbon double bonds. by converting them into carbon-carbon monounits, thereby reducing the degree of unsaturation of fats. It is a chemical process. Complete hydrogenation produces a fully saturated oil. With this 30 Together, the partial hydrogenation process removes both saturated and monounsaturated fatty acids. 3 This leads to an increase in the levels of unsaturated fatty acids. Partial hydrogenation. Some of the monounsaturated substances formed during this process are naturally occurring substances. It exists in the trans isomer form rather than isomers (elaid acid, which is the trans isomer of oleic acid). (like acid) (Sebedio et al., 1994; Fernandez San Juan, 1995). Now, cis-unsaturated Trans-fatty acids, compared to fatty acids, increase serum LDL cholesterol levels by 5 in elevation (Mensink and Katan, 1990; Noakes and Clifton, 1998) and serum HDL It was as effective as palmitic acid in lowering cholesterol (Zock and Katan, 1992). It is known and therefore contributes to an increased risk of cardiovascular disease. They are found (Ascherio and Willett, 1997). Nutritional adverse effects of trans fatty acids. As a result of increased awareness of the issue, hydrogenation is now used in the food industry. By avoiding the use of oils, we can achieve both high nutritional value and hydrogenation. Solid and liquid fats, especially liquid fats, that can provide functionality without the need for additional substances. In these cases, those rich in oleic acid or a solid or semi-solid oil In cases where a preference is given, those rich in stearic acid should be preferred. There is a growing trend in science towards this. 15 Other lipids and oils with high oleic acid content and their reliable Resources are needed. BRIEF DESCRIPTION OF BULU Current developers believe that commercially viable oils containing high levels of oleic acid are suitable for 20 years. It has identified select safflower varieties that can be used for production. In one respect, the existing finding provides a safflower plant cell containing the following: (a) A polynucleotide containing a nucleotide sequence provided as SEC NO: 13 and a polynucleotide containing a nucleotide sequence given as SEC NO: 14, (b) A polynucleotide containing a nucleotide sequence provided as SEC D NO:21 25 and a polynucleotide containing a nucleotide sequence given as SEC NO:22, (c) a T-DNA molecule, where the T-DNA molecule is a part of the cell. It is inserted into a region of the chromosome, this region being designated as SEC D NO:11. It has a nucleotide sequence, 4 (d) a T-DNA molecule, where the T-DNA molecule is a part of the cell. It is inserted into a region of the chromosome, this region being designated as SEC D NO:18. has a nucleotide sequence or (e) any combination of these. An arrangement includes safflower plant cells (a) and (c), e.g. in GOR73226 5 In this case, both (a) and (c) apply. In an arrangement, safflower plant cell (b) and (d) is included, for example in the case of GOR73240 both (b) and (d) are valid. A The arrangement includes safflower plant cells (a) to (d), e.g., both T- of safflower cells To include the DNA, the safflower strain GOR73226 is crossed with the strain GOR73240. In a preferred arrangement, the cell has either (a) or (b), but both have 10. It is also possessed by (a) or (b), heterozygous or preferential in the safflower genome. It may be present in the homozygous state. In homozygous arrangements in the aspirin cell, T- Depending on the DNA insertion, either as adjacent sequences or as SEK D NO: 11 (in case (a)) there is none or SEK D NO: 18 (in case (b)) there is none. Alternatively, a 15 is available in another direction, containing one or more of the following: safflower plant cells: (a) A polynucleotide containing a nucleotide sequence given as SEC NO:7, (b) A nucleotide supplied as nucleotides 296 to 8640 of SEC NO:7 a polynucleotide containing the sequence, (c) A polynucleotide containing a nucleotide sequence provided as SEC D NO:33, 20 (d) A polynucleotide containing a nucleotide sequence provided as SEC D NO:34, or (e) Full length of nucleotides 296 to 8640 of SEC NO:7 and at least 95% A polynucleotide that has the same properties as the i-e. In a preferred arrangement, all (a), (b) and (e) apply. A 25 Regulations (a), (b), (c) and (e) are applicable, for example in GOR73226. In regulation (a), (b), (d) and (e) are applicable in example GOR73240. In a preferred arrangement, the cell, It has a single T-DNA insertion. In an arrangement, polynucleotide(s) and / or T-DNA(s) are inserted into the cell's genome, preferably, it integrates stably into the cell's nuclear genome. 30 in one arrangement safflower plant cell or a part of the plant containing polynucleotide(s) and / or It is homozygous for T-DNA(s). Alternatively, safflower cell, plant or herb. part, for example in the case of F1 seed, in terms of polynucleotide(s) and / or T-DNA(s). It is heterozygous. Another existing finding is that of the GOR73226 or GOR73240 safflower strain. It releases its cell. 5 In one study, oleic acid was the total amount of acid found in a safflower plant cell. It constitutes at least 90% by weight of the acids. In one arrangement, oleic acid is a component of the finding. Safflower oil constitutes 90% to 95% by weight of the total fatty acids in the plant cell. In the regulation, oleic acid is among the total fatty acids in a safflower plant cell. It constitutes 91% to 93% by weight. In one arrangement, oleic acid is found in an aspirin 10 It constitutes 91.5% to 92.5% by weight of the total fatty acids in plant cells. In a particular arrangement, at least 95% by weight of the lipid in a plant cell belonging to this group, It is triacylglycerol (TAG). In one study, palmitic acid was found to be the total fat in a safflower plant cell. It constitutes less than 2.7% by weight of the acids. In one arrangement, palmitic acid is 15% of the discovered substance. It constitutes 2.5% to 2.7% by weight of the total fatty acids in a safflower plant cell. In one arrangement, linoleic acid was found in the total amount of linoleic acid in a safflower plant cell. It constitutes less than 1.7% by weight of the acids. In one arrangement, linoleic acid is found in the mixture. It constitutes 1.2% to 1.6% by weight of the total fatty acids in a safflower plant cell. In one arrangement, α-linolenic acid was found in a total of 20 safflower plant cells. It constitutes less than 0.2% by weight of fatty acids. In one arrangement, α-linolenic acid (ALA) is the total fatty acid content of 0.1% by weight in a safflower plant cell. It constitutes a small percentage, or approximately 0.1%. A safflower plant found in a regulation. The total fatty acids in the cell do not contain α-linolenic acid and / or α-linolenic acid is not detected. It cannot be done. 25 A safflower plant cell, found in an arrangement, contains hygromycin. It contains a phosphotransferase polypeptide and a polynucleotide that encodes the polypeptide, e.g., in A hygromycin phosphotransferase containing an amino acid sequence provided in SEK D NO:8. polypeptide. In one arrangement, it was found that the cell was a safflower seed cell, belonging to a safflower 30. safflower, which does not contain plant cells, polynucleotide(s) and / or T-DNA(s), and comes in warm snow. 6 reduced CtFAD2-2 protein activity and reduced CtFATB-3 compared to the cell. It possesses protein activity. CtFAD2-2 is involved in the regulation of safflower seed cells. level of protein activity, preferably polynucleotide(s) and / or T-DNA(s) Snow that does not contain warm snow reduces the concentration of safflower cells by 90% to 99%, preferably. It decreases between 95% and 99% or between 96% and 99%. In one arrangement, CtFATB-3 5 The level of protein activity, including polynucleotide(s) and / or T-DNA(s). Snowfall decreases by 50% to 95% depending on the mild incoming safflower cell, preferably 60% to 95%. It decreases between 75% and 95%. A safflower plant found in a regulation. the cell, some CtFATB-3 protein activity and some CtFATB-3 protein It has activity. A safflower cell, which is a cell other than the germ cell, has a 10 In the regulation of CtFAD2-2 and CtFATB-3 protein activities, polynucleotide(s) and / or significantly less than the safflower cells that arrived in the snow and / or did not contain T-DNA(s). It does not decrease. This phenotype is driven by the polynucleotide, for example in GOR73226 and GOR73240. The promoter is related to the seed-specific characteristic. In an arrangement, the seed cell The safflower cell on the outside still produces the Hph polypeptide. 15 In one arrangement, a safflower plant cell containing the ol allele of the CtFAD2-1 gene was found. or contains one ol1 allele or both alleles of the CtFAD2-1 gene. A preferred one In this arrangement, either the ol allele or the ol1 allele of the CtFAD2-1 gene is found in a homozygous state. In a preferred arrangement, an allele is a single allele. A safflower plant cell, found in an arrangement, is a developing 20 It is a germ cell in a seed or in a mature seed. It belongs to an arrangement. a safflower plant cell, in the seed of a safflower plant grown in the field or harvested It is found in a germinated seed. In another direction, an aspirate containing a cell that includes the following is present. sow the seeds: 25 (a) A polynucleotide containing a nucleotide sequence provided as SEC NO: 13 and a polynucleotide containing a nucleotide sequence given as SEC NO: 14, (b) A polynucleotide containing a nucleotide sequence provided as SEC NO:21 and a polynucleotide containing a nucleotide sequence given as SEC NO:22, 7 (c) a T-DNA molecule, where the T-DNA molecule is a part of the cell. It is inserted into a region of the chromosome, this region being designated as SEC D NO:11. It has a nucleotide sequence, (d) a T-DNA molecule, where the T-DNA molecule is a part of the cell. It is inserted into a region of the chromosome, which is represented as SEC NO:18. has a nucleotide sequence or (e) any combination of these. Alternatively, a situation may arise that includes one or more of the following: A safflower seed containing cells provides: (a) A polynucleotide containing a nucleotide sequence given as SEC NO:7, 10 (b) A nucleotide supplied as nucleotides 296 to 8640 of SEC NO:7 a polynucleotide containing the sequence, (c) A polynucleotide containing a nucleotide sequence provided as SEC D NO:33, (d) A polynucleotide containing a nucleotide sequence provided as SEC D NO:34, or 15 (e) Full length of nucleotides 296 to 8640 of SEC NO:7 and at least 95% A polynucleotide that has the same properties as the i-e. Another existing finding is that of the GOR73226 or GOR73240 safflower strain. It releases its seeds. In another direction, a safflower seed containing a cell of the existing substance 20 sa lar. The above summarizes a seed of a plant, a cell of a plant. It can possess any of these properties. For example, in a formulation, oleic acid is found in... at least 90% by weight of the total fatty acids in safflower seeds, preferably It contains 90% to 95%. 25 Another finding is that at least 95% of the seeds in the existing discovery belong to the discovery. It became a collection of safflower seeds. Alternatively, a safflower plant containing a cell of a substance found in another direction, or It contains a portion of this. In an arrangement, the plant or a portion of it includes flours: (a) A polynucleotide containing a nucleotide sequence given as SEC NO: 13 30 and a polynucleotide containing a nucleotide sequence given as SEC NO: 14, 8 (b) A polynucleotide containing a nucleotide sequence provided as SEC NO:21 and a polynucleotide containing a nucleotide sequence given as SEC NO:22, (c) a T-DNA molecule, where the T-DNA molecule is a part of the cell. It is inserted into a region of the chromosome, this region being designated as SEC D NO:11. It has a nucleotide sequence of 5 (d) a T-DNA molecule, where the T-DNA molecule is a part of the cell. It is inserted into a region of the chromosome, this region being designated as SEC D NO:18. has a nucleotide sequence or (e) any combination of these. Alternatively, a 10 is available in another direction, containing one or more of the following: It provides a safflower plant containing cells, or a part of it: (a) A polynucleotide containing a nucleotide sequence given as SEC NO:7, (b) A nucleotide supplied as nucleotides 296 to 8640 of SEC NO:7 a polynucleotide containing the sequence, (c) A polynucleotide containing a nucleotide sequence provided as SEC D NO:33, 15 (d) A polynucleotide containing a nucleotide sequence provided as SEC D NO:34, or (e) Full length of nucleotides 296 to 8640 of SEC NO:7 and at least 95% A polynucleotide that has the same properties as the i-e. Another available variety is safflower strain GOR73226 or GOR73240 or 20. He sells some of them. Alternatively, a safflower plant containing a cell of a substance found in another direction, or It releases a portion of this. The above summarizes a plant of Bulu, a cell of Bulu. It can have any of these properties. For example, in one formulation, oleic acid is found in 25 the total fatty acids by weight in a part of the safflower plant, for example, in its seeds It contains at least 90%, preferably 90% to 95%. In an arrangement, the plant contains the cells of the organism. In an arrangement, the plant part It is a seed. In a given arrangement, the plant contains a seed belonging to the species or can produce one. Current bulu owners report that bulu flour plants consistently produce high levels of 30 They found that they produced seeds containing oleic acid. In one experiment, the oleic acid in the seed was examined. 9 The acid level remains consistent across multiple generations, such as nine generations. In a regulation The oleic acid level in the seed varies over multiple generations, for example, over nine generations. at least 90%, between 90% and 95%, between 91% and 93% by weight of total fatty acids It is between 91.5% and 92.5%. In a regulation, the total acid the predominantly oleic acid level in the content, over multiple generations, for example nine generations 5 Throughout, it will change by less than 5%, less than 4%, less than 2%, or less than 1%. The current inventors also have the right to breed plants derived from the invention under the same conditions. the resulting safflower does not contain polynucleotide(s) and T-DNA(s) a plant seed whose content is not significantly reduced when compared to its oil content Depending on the seed content, or preferably non-transgenic seed content, either 10 They also found that increased seed production resulted in a different effect. In one arrangement, the content was transgenic. a difference of 1-4% in absolute terms compared to non-existent seed, e.g., from 31% to at least 32% or It is increased to 35%. The seed content of a plant found in a regulation, for more than one generation. It is consistent throughout, for example, nine generations. In an arrangement, either the content is weighted at least 33% or at least 34%, preferably 33% to 37% or 34% to 37% by weight 15 It is among them. In an arrangement, the content can be passed down through multiple generations, for example, nine It changes by less than 5%, less than 4%, less than 2%, or less than 1% across generations. In a regulation, a safflower plant or part thereof belonging to the invention, belonging to the invention It is produced by growing seeds. In an arrangement, polynucleotide(s) and / or T-DNA(s) are separated by at least nine generations. stable throughout the plant's genome or a part of it (like a seed) It is integrated. In an arrangement, one or more or all of the following characteristics must be present: equivalent that does not contain polynucleotide(s) and / or T-DNA(s) grown under conditions It is the same as with an incoming plant: seedling viability, plant height, time to flowering, 25 harvest lodging, seed crude protein content, seed crude fat content, seed ash content and Seed carbohydrate content. In one arrangement, safflower plant or parts thereof, polynucleotide(s) and / or T- It contains a transgene outside of the DNA(s). In addition, pollen from a certain plant is also provided. 30 Additionally, an egg from a plant called Bulu is also provided. At the same time, a tissue culture of renewable cells is also provided; The cells here are the cells of the tissue. In an arrangement, the tissue consists of leaves, pollen, embryos, roots, root tips, capsules, flowers, ovaries, and stems They are selected from the group. Alternatively, you can find a safflower plant or produce seeds from it. A method provides; the method includes the following: (a) a second seed of the first safflower plant found to obtain new safflower seeds crossbreeding with safflower plant; and (b) producing a new safflower plant under plant growth conditions the cultivation of the seed and, depending on the request, 10 (c) Harvesting seeds from the new generation safflower plant. In one arrangement, the second safflower plant provides the agricultural nutrients that are lacking in the first safflower plant. It possesses at least one desirable characteristic from this perspective. Examples of suitable agricultural characteristics. among these, but not limited to, herbicide resistance, insect resistance, bacterial resistance. disease resistance, fungal disease resistance, viral disease resistance, female infertility or male 15 Infertility is involved. In a regulation, an agricultural trait is given by a transgene. In an arrangement, the method may also be repeated one or more times in steps (a) and (b). It involves repetition. The seed harvested in an operation is first-generation (Fl) hybrid safflower seed. In one arrangement, the second safflower plant is a safflower plant. 20 In one arrangement, the second safflower plant does not produce safflower seeds. In a single method, the following also applies: (d) One or more generations of plants in step (b) are the same as the second safflower plant. with plants of the genotype, at least 75%, at least 80% or more of the second safflower plant genotype must be present. backcrossing enough to produce a plant that has at least 90% of the original. 25 Also, a safflower plant or a part of it produced by a method that is not readily available. partial. Another existing finding is related to the identification of a safflower plant. The method involves extracting DNA from a plant and processing it into one or more of the cells described herein. This involves analyzing for excess polynucleotide(s) and / or T-DNA molecule(s). 30 present in a relevant direction; of a plant, a part of a plant, preferably a seed; this 11 DNA obtained from a plant, plant part, or seed, as defined here. or more polynucleotide(s) and / or T-DNA molecule(s) analyzed whether it is a plant, plant part or seed, as determined by means of identification. It includes a method for determining. In an arrangement, safflower seeds are a the collection, whether a seed belonging to this collection is present or not 5 It is tested to determine this. In an arrangement, polynucleotide(s) and / or T-DNA molecule(s), restriction fragment length u polymorphism analysis, amplification fragment length u from polymorphism analysis, nucleic acid sequencing and / or nucleic acid amplification This is detected using a technique selected from the group. 10 In an arrangement, the methods include the following: i) a DNA sample from a safflower plant or a part of it such as seeds or cells. taking, ii) for example, a polynucleotide and / or T-DNA as defined herein, or its derivatives. a pair of primers capable of amplifying a portion of it and 15 for nucleic acid amplification mixing with reactants, iii) carrying out an amplification reaction and iv) Analysis of the product from step iii) for an amplification product. In one arrangement, DNA may or may not include a seed of the organism. It's from a seed collection. 20 In one arrangement, the amplification product is a polynucleotide and / or T-DNA. It encompasses the integration area. In a preferred arrangement, the amplification product, SECTION D NO: Contains any of 14, 15, 21 or 22. In one regulation TTGGATACCGAGGGGAATTTATGGAAC (SEK D NO: 35) and CAATCACAATAAGTCGTTGC (SECTION NO: 36) primer pair or 25 of these one or both of them, for example, shorter or longer, and the same DNA A variant that hybridizes to the region, a nucleotide provided as SEC NO: 13. A polynucleotide with the sequence and a 562 bp amplicon were produced i GOR73226 as in his lineage, he has a nucleotide sequence provided as SEC NO: 14. It is used to detect a polynucleotide containing another polynucleotide. 30 12 In one regulation TTGGATACCGAGGGGAATTTATGGAAC (SEK D NO: 37) and TGATAACGATCTTGCGCAAC (SECTION NO: 38) primer pair or any of these one or both of them, for example, shorter or longer, and the same DNA A variant that hybridizes to the region, a nucleotide provided as SEC NO: 21. A polynucleotide with the sequence and a 199 bp amplicon were produced i GOR73240 5 as in his lineage, he has a nucleotide sequence provided as SEC NO: 22. It is used to detect a polynucleotide containing another polynucleotide. In one regulation AAAAGCCTGAACTCACCGC (SEC D NO: 39) and TCGTCCATCACAGTTTGCC (SECTION NO: 40) primer pair or one of them or both, for example, shorter or longer, and both targeting the same region of DNA. A hybridizing variant was produced, an amplicon of 689 bp, i GOR73226 and To identify a gene encoding the Hph polypeptide, as in the GOR73240 lineages. It is used. In an arrangement, the methods include the following: i) DNA sample from a safflower plant or a part of it such as seeds or cells 15 taking, ii) for example, a polynucleotide and / or T-DNA as defined herein or its derivatives a probe capable of hybridizing to a portion of it and reagents for polynucleotide hybridization wife scratching, iii) carrying out a hybridization reaction and 20 iv) Analysis of the product from step iii) for the probe. In one arrangement, DNA may or may not include a seed of the organism. It is from a seed collection. In one arrangement, the probe targets the integration region of a polynucleotide and / or T-DNA. It hybridizes to a region encompassing, but the polynucleotide and / or T-DNA present in the DNA is 25 However, it does not produce a detectable signal. Another existing discovery is a method for producing safflower seeds. These methods include: a) a population of a plant belonging to Bulu a, preferably consisting of at least 1000 plants as part of it being grown in a field and 30 b) harvesting the seeds. 13 In one arrangement, cultivation is carried out in an open field. Another approach involves obtaining the seed of the existing discovery and producing safflower oil. It provides a safflower oil production method that involves processing the seeds to obtain it. Another aspect of the existing discovery; the cell belonging to the discovery, the seed belonging to the discovery, belonging to the discovery safflower plant or one or more of its methods of obtaining flour from it, or these 5 oils that can be obtained by. Another aspect of the existing discovery; the cell belonging to the discovery, the seed belonging to the discovery, belonging to the discovery safflower plant, obtained by means of a method of discovery or from one or more of the following: a combination containing more than one and one or more acceptable carriers, preferably provides a food or feed ingredient. 10 Another existing invention, related to the production of an industrial product. the cell, the seed of the invention, the safflower plant of the invention, or the oil of the invention, the invention one or more of the products produced by a method of identification or discovery It enables its use. Another existing finding is a 15 aimed at producing a feedstuff / nutrient. The method provides; the method, the cell related to the invention, the seed related to the invention, the safflower related to the invention. oil produced from the plant, its composition, or by a method of extracting it. It involves mixing one or more of these with at least one other food ingredient. (related) The existing findings in this direction provide a method for producing a feedstuff / nutrient; The method involves heating, for example, the fat or compound of a food product to 20%. It is produced in its presence or by a method of discovery, or it involves frying. Another aspect of the existing discovery; the cell belonging to the discovery, the seed belonging to the discovery, the discovery the safflower plant, the oil of the invention, the composition of the invention or a method of the invention a feed that involves reacting one or more of the produced oils The substance / food, cosmetic or chemical provides. 25 Another finding is that the extract is derived from safflower seeds. It provides seed meal. Seed meal is, for example, the seed of an organism, from the seed. If crushed to release a large portion of its fat, the resulting substance may contain residual fat. or seed meal, further treated with a solvent to extract the oil. It may be so, and therefore may be devoid of seed oil. However, there are still 30 in the seed. It contains DNA that includes polynucleotide(s) and / or T-DNAs. 14 Another existing solution is aimed at producing an industrial product. The process includes the following steps: i) the cell related to the invention, the seed related to the invention, the safflower plant related to the invention, the invention or one or more of the components of the invention or the oil produced by the method related to the invention. obtaining a few, 5 ii) depending on the request, the cell belonging to the discovery in step i), the seed belonging to the discovery, one or more of the safflower plant, oil or components of this discovery the physical processing of the excess, iii) the cell belonging to the discovery, the seed belonging to the discovery, the safflower plant belonging to the discovery, belonging to the discovery or the physically processed product of component or step ii) of the invention or discovery, at least 10 at least a portion of it is broken down into lipids by heat, chemical or enzymatic means or any of these. transforming it into an industrial product through the application of a combination and iv) recovery of industrial products, thus obtaining the industrial product. Another existing discovery provides a method for producing biofuels; 15 The method includes the following flours: i) the cell related to the invention, the seed related to the invention, the safflower plant related to the invention, the invention oil, one or more of which are produced by a component of the invention or by a method related to the invention. The excess can be used to produce alkyl esters, optionally in the presence of a catalyst. reacting with alcohol, and 20 ii) Depending on the request, blending of alkyl esters with petroleum-based fuels. In one arrangement, alkyl esters are methyl esters. Another existing finding is a polynucleotide as defined here. and / or a kit containing primers and / or probes for the detection of T-DNA For example, the kit may contain two or more primers as defined in Table 1. Kit 25 also, for example, carrying out a DNA amplification reaction and / or probe It may also include instructions for use and / or reagents for hybridization and detection. Any arrangements here are necessary unless otherwise specifically stated. Once the changes have been made, this will also apply to any other regulations. will be accepted. 30 The scope of the current findings is limited to what is described here and is for sampling purposes only. It is not limited to specific regulations aimed at. Functionally, all products, Even the methods and procedures described herein are clearly within the scope of this study. Throughout this specification, unless otherwise specifically stated or the context dictates otherwise... unless required, to a single step, even to a single item, group of steps or item 5 The reference to the group of markers, these steps, item markers, step groups or one or more of the groups of bullet points It will be addressed in a comprehensive manner. Find this further through the following non-restrictive examples and in the appendix. This will be explained with reference to the figures. 10 BRIEF DESCRIPTION OF THE ATTACHED FILES Figure 1: Schematic outline of the T-DNA region of the transformation vector pCW732. The properties include flours: RB = Right Border; LB = Left Border; Flax linini = flax linine promoter (2033bc); CtFATB = Karthamus tinctorius L palmitoyl-ACP thioesterase sequence 15 (412bp); CtFAD2.2 = Karthamus tinctorius L. 12 desaturase sequence (756bp); int1 = PDK intron sequence (768bp); int2 = Catalase 1 intron sequence (196bp); ocs3' = octopine synthase transcription terminator / polyA region (708bp); nos3' = nopaline synthase transcription terminator / polyA (277bp); p35S = 35S promoter (343bp); hph = intron containing hygromycin phosphotransferase gene (1216bp). 20 Figure 2: EMA of PCR-based genome interception analysis of GOR73226 and GOR73240. Figure 3: Ematic genetic analysis of T-DNA from pCW732 inserted into the aspirin genome. map; Pacben and Kpn restriction zones in Southern blot hybridization analysis and 25 It shows the locations of the fragments. In the adjacent genomic DNA, Pacben and The location of kpn I regions is dependent on the T-DNA insertion site, and each independent It is unique for the transgenic lineage. The probe's location is shown. To scale. It is not scratched. 16 Figure 4: Southern blot of aspirin transformed with T-DNA from pCW732 vector. Hybridization analysis. DNA obtained from independent transgenic safflower strains, It was digested with either kpnben or pac, and the protein of the hygromycin phosphotransferase gene was analyzed. Probed with a radio-labeled DNA fragment from the coding region. From left to right. The components found in the sequenced strands include: DNA digested by the KpnI enzyme, a non-transgenic 5 S-317 as a negative control; pCW732-40 (GOR73240); pCW732-48 (Event 48); pCW732-22 (Event 22); pCW732-21 (Event 21); pCW732-21 (Event 21, repeated); pCW732-26 (GOR73226); pCW732-30 (Event 30); pCW732-34 (Event 34); pCW732-33 (Event 33). The order of DNA samples in Pac digestion is the same, going to the right in the strips. This was repeated. Fragment sizes were estimated from in silico digestion. 10 Figure 5: Sequence characterization of the T-DNA insertion of GOR73226. PCR-based genome. Sequential connections identified from execution analysis (E26_RB Connection and E26_LB Connection) The amplicons are the pCW732 vector (pCW732_LB and pCW732_RB) and the draft aspirin. Aligned to the sequences of the genomic sequence database (Bower16_13860-7_8). 15 Figure 6: Sequence characterization of the T-DNA insertion of GOR73240. PCR-based genome. Sequential connections identified from execution analysis (E40_RB Connection and E40_LB Connection) The amplicons are the pCW732 vector (pCW732_LB and pCW732_RB) and the draft aspirin. Aligned to the sequences of the genomic sequence database (gx_s317 Scaff097804). 20 Figure 7: Aspirated T-DNA from pCW732 to produce transgenic event GOR73226. Schematic structure. Schematic map, 1000 bp upstream of the insertion zone and the flow of AA, one the location of the deletion and the elements of the remaining T-DNA sequences after the insertion It indicates its location. E26TF and E26GR, preparation for PCR specific to GOR73226 25 These are priming zones. Figure 8: Schematic structure of T-DNA insertion to GOR73240 in the CBI1582 safflower strain. Schematic map, showing the flow of the insertion zone 1000 bp upstream and 960 AA downstream, duplications, the location of a deletion and the elements of the remaining T-DNA sequences after the insertion 30 It indicates its location. E40GF and E40GR are being prepared for genome execution analysis. 17 These are the priming regions. Where there is a 35 bp duplication, there is also a 34 base deletion. Please note that E40_TF and E40_GR2 were found for PCR specific to GOR73240. These are priming areas. Figure 9: Cross between GOR40 and a linoleic growing strain, linoleic and 5 The negative correlation between oleic acid and linoleic acid percentage is shown in Example 4. There is a negative correlation between acids. Figure 10: Aa of CtFAD2.2 and CtFATB in GOR73226 and GOR73240 plants. regulation. On average, three 10 for each event and non-transgenic safflower control plants. Biological replicates and three technical replicates were also evaluated. Plants GOR73226 and GOR73240. CtFAD2.2 and CtFATB-3 when compared to non-transgenic safflower plants The genes have significantly reduced (P<0.05) transcript abundance levels. Average relative mRNA expression levels for the same letter are not significantly different. (P>0.05). 15 Figure 11: Comparison of parental lineage for GOR73226 and GOR73240 safflower. Vitality score. For each region, plots are shown with an indication of emergence and settlement. A vitality score is given; here, 0 points means there is no vitality at all, and 9 points means the most vitality. It represents a plot. The bars represent the average viability score ± standard error. 20 Figure 12: Comparison of parental lineage for GOR73226 and GOR73240 safflower. The height of the plant. For each region, the height of 10 plants in each plot was measured and The average has been calculated. The bars represent the average height ± standard error in each region. It equals 25. Figure 13: Disease incidence for GOR73226 and GOR73240 in aspirin and parental lineage. Scores. For each region, the incidence of disease in 10 leaves in each plot. It was evaluated; here, a score of 0 represents a high incidence of the disease, and 9 The score represents the healthiest leaves. The average disease score for the sticks in each region is 30. ± represents the standard error. 18 Figure 14: Insect damage scores for GOR73226 and GOR73240 safflower and their parent lineage. For each region, the rate of insect damage observed in 10 leaves in each plot. It was evaluated; here, a score of 0 represents a high level of insect damage. Meanwhile, the 9 points represent the least damaged leaves. The bars are in each region. The mean disease score represents ± standard error. 5 Figure 15: Comparison of parental lineage for GOR73226 and GOR73240 safflower. Yield. For each region, the yield of each plot was also evaluated and converted to T / ha. The bars represent the average yield ± standard error in each region. DZL STES NN KEY SECTION NO:1 - Amino acid sequence of safflower FAD2-2 polypeptide (CtFAD2-2, Eri im No. KC257448). SEK D NO:2 - Corresponding mRNA encoding the safflower FAD2-2 polypeptide (CtFAD2-2). The nucleotide sequence of the incoming cDNA does not contain a PolyA tail. Translation start 15 The codon is located at nucleotides 81-83, and the translation stop codon is 1230-1232. It is located in the nucleotides, the protein-coding region corresponds to nucleotides 81-1229. SEK D NO:3 - Amino acid sequence of safflower FATB-3 polypeptide (CtFATB-3, Eri im No. KU059745). SEK D NO:4 - Corresponding to mRNA encoding the Aspir FATB-3 gene (CtFATB-3) 20 The nucleotide sequence of cDNA does not contain a PolyA tail. Translation start codon 237- The initial transposition codon is at nucleotides 239, and the translation stop codon is at nucleotides 1320-1322. The protein coding region corresponds to nucleotides 237-1319; in FATB-3 hpRNA. 373-784 nucleotides were used. SEK D NO:5 - cDNA 25 for the safflower FAD2-2 gene used in the genetic structure of pCW732 The nucleotide sequence of the region corresponds to nucleotides 426-1181 of SEC NO:2. SEK D NO:6 - cDNA for the safflower FATB-3 gene used in the pCW732 genetic structure. The nucleotide sequence of this region corresponds to nucleotides 485-784 of SEC NO:4. SEK D NO:7 - Nucleotide of the region of the pCW732 genetic structure encompassing T-DNA sequence. Nucleotides 6-168, Sa boundary region, T-DNA Sa boundary begins at nucleotide 128; 30 Nucleotides 296-2328 are the conline promoter; nucleotides 2396-2807 are the antisense promoter. 19 CtFATB-3 region in orientation; nucleotides 2816-3573, in sense orientation The CtFAD2-2 region; nucleotides 3643-4410, intron Flaveria in sense orientation. trinerva PDK gene; nucleotides 4445-4634, intron with reverse orientation from the Cat-1 gene; Nucleotides 4697-5454 are the region of the CtFAD2-2 gene with antisense orientation; 5463- Nucleotides 5874 are located in the sense orientation region of the CtFATB-3 gene; 5918-6625 5 nucleotides, ocs3' transcription terminator / polyA region; nucleotides 6673-7124, CaMV 35S promoter; nucleotides 7125-8340, a Cat-1 at nucleotides 7464-7653. Hph coding region containing the intron; nucleotides 8366-8640, nos3' transcription. Terminator / polyadenylation site; nucleotides 8817-9266, T-DNA left border region, The left border ends at nucleotide 9222. 10 SEK D NO:8 - Amino acid sequence of hygromycin phosphotransferase polypeptide (Hph). SEK D NO:9 - Nucleotide of the Sa boundary sequence added to GOR73226 (pCW732_RB) series (see figure 5). SEC D NO: 10 - GOR73226 nucleotide of the right-hand boundary junction sequence (E26_RB_junction) The sequence; nucleotides 1-81 correspond to aspirin neighboring genomic DNA, 82-122 15 These nucleotides correspond to the Sa boundary sequence of T-DNA (see Figure 5). SEK D NO:11 - GOR73226's T-DNA was added to an Aspir scaffold sequence. The nucleotide sequence (gx_S317_Scaff_m9987) is converted to create GOR73226. During the process, nucleotides 77-231 were deleted (see Figure 5). SEC D NO: 12 - GOR73226 Nucleotide 20 of the left border junction sequence (E26_LB_junction) The sequence; nucleotides 1-104 correspond to the left border sequence of T-DNA, 105-145 The nucleotides correspond to the genomic DNA of aspirin (see Figure 5). SEK D NO:13 - Nucleotide sequence of the left border sequence added to GOR73226 (E26_LB) (See Figure 5). SEK D NO: 14 - GOR73226 Nucleotide sequence of a portion of the right-hand boundary junction sequence; 25 Nucleotides 1-20 correspond to the neighboring aspirin genomic DNA, while nucleotides 21-40 correspond to the same genomic DNA. The T-DNA sequence added at the border receives a warming response. SEK D NO: 15 - GOR73226 Nucleotide sequence of a portion of the left border junction sequence; Nucleotides 1-20 correspond to the T-DNA sequence inserted at the left border, 21-40 The nucleotides correspond to the genomic DNA of the neighboring aspir. 30 The nucleotide sequence of the Sa boundary sequence added to SEK D NO:16 - GOR73240 (in Figure 6) pCW732_RB). SEC D NO: 17 - GOR73240 nucleotide of the right-hand boundary junction sequence (E40_RB_junction) The sequence; nucleotides 1-170 correspond to neighboring genomic DNA, nucleotides 171-209 The Sa boundary sequence added to GOR73240 receives a warming effect (see Figure 6). 5 SEK D NO:18 - GOR73240's T-DNA was added to an Aspir scaffold sequence. Nucleotide sequence (gx_S317_Scaff097804); 136-170 during transformation process. Nucleotides have been duplicated and nucleotides 171-204 have been deleted at the left border linkage. (See Figure 6). SEC D NO: 19 - GOR73240 Nucleotide 10 of the left border junction sequence (E40_LB_junction) The sequence; nucleotides 1-44 correspond to the left border sequence, nucleotides 45-79 corresponds to a 35 bp aspirin genomic sequence copied during the transformation process. Income, 80-175 nucleotides correspond to safflower genomic DNA. Transformation During the procedure, a 34 bp genomic sequence was deleted (see Figure 6). SEK D NO:20 - Nucleotide 15 of the left border of the T-DNA (pCW732_LB) in GOR73240. series (see figure 6). SEC NO: 21 - GOR73240 Nucleotide sequence of a portion of the right-hand boundary junction sequence; Nucleotides 1-20 correspond to the neighboring aspirin genomic DNA, while nucleotides 21-40 correspond to the same genomic DNA. The T-DNA sequence added at the border receives a warming response. SEC NO: 22 - GOR73240 Nucleotide sequence of a portion of the left border junction sequence; 20 Nucleotides 1-20 correspond to the T-DNA sequence inserted at the left border, 21-40 The nucleotides correspond to the genomic DNA of the neighboring aspir. SEC ID NO: 23 to 32 and 35 to 40 – Oligonucleotide primers. SEK D NO:33 - T-DNA including aspir genomic sequences An additional nucleotide sequence was added to GOR73226. Nucleotides 1-996 are located in the upper 25 of T-DNA. The aspir genomic sequence in the sequence; nucleotides 1002-1042 Sa boundary sequence integrated; 1170- Nucleotides 3202 are the conlinenin promoter; nucleotides 3270-3681 are the antisense promoter. CtFATB-3 region in orientation; nucleotides 3690-4445, in sense orientation. The CtFAD2-2 region; nucleotides 4517-5284, intron Flaveria in sense orientation. trinerva PDK gene; nucleotides 5319-5514, intron with reverse orientation from Cat-1 gene; 30 Nucleotides 5573-6329 are the region of the CtFAD2-2 gene in antisense orientation; 6337- 21 Nucleotides 6748 are located in the sense orientation region of the CtFATB-3 gene; 6792-7499. nucleotides, ocs3' transcription terminator / polyA region; nucleotides 7645-7987, CaMV 35S promoter; nucleotides 7999-9214, a Cat-1 at nucleotides 8338-8527. Hph coding region containing the intron; nucleotides 9239-9515, nos3' transcription. Terminator / polyadenylation site; nucleotides 9691-9851, T-DNA left border region; 5 Nucleotides 9852-10056 are involved in the addition of an extra backbone; nucleotides 10057-11060 are involved in T-DNA. asa genomic sequence in the aa stream. SEK D NO:34 - T-DNA including aspir genomic sequences The nucleotide sequence i was added to GOR73240. Nucleotides 1-1059 are upstream of T-DNA. The Aspirin genomic sequence in the sequence; nucleotides 1060-1098 Sa boundary sequence integrated; 1226-10 Nucleotides 3258 are the choline promoter; nucleotides 3326-3737 are the antisense promoter. CtFATB-3 region in orientation; nucleotides 3746-4501, in sense orientation The CtFAD2-2 region; nucleotides 4573-5340, intron Flaveria in sense orientation. trinerva PDK gene; nucleotides 5375-5570, intron with reverse orientation from Cat-1 gene; Nucleotides 5629-6385 are the region of the CtFAD2-2 gene in antisense orientation; 6393-15 Nucleotides 6804 are located in the sense orientation region of the CtFATB-3 gene; 6848-7555. nucleotides, ocs3' transcription terminator / polyA region; nucleotides 7701-8043, CaMV 35S promoter; nucleotides 8055-9270, a Cat-1 at nucleotide 8394-8583. Hph coding region containing the intron; nucleotides 9295-9571, nos3' transcription. Terminator / polyadenylation site; nucleotides 9750-9762, T-DNA left border region; 20 Nucleotides 9763-10726 are the aspir genomic sequence in the amino acid stream of T-DNA. DETAILED EXPLANATION OF BULU General Techniques and Definitions Unless otherwise specifically defined, all technical and scientific principles used herein are 25 terms in technology (e.g., cell culture, molecular genetics, plant breeding, or acid) (chemistry, gene silencing, protein chemistry and biochemistry) have ordinary specialization which will seem mild in comparison to the commonly known meaning. Unless otherwise specified, the recombinant protein used in the current formulation is cell-specific. culture and immunological techniques, technically expert, well-known standard 30 These are procedures. Such techniques are discussed throughout the literature, including J. Perbal's work on Molecular Cloning. 22 A Practical Guide, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Handbook, Cold Spring Harbor Laboratory Press (1989), TA Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), DM Glover and BD Hames (editors), DNA Cloning: A Practical Approach Approach, Volumes 1-4, IRL Press (1995 and 1996) and FM Ausubel et al. (editors), 5 Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley- Interscience (1988, including all updates to date), by Ed Harlow and David Lane (editors) Antibodies: A Laboratory Handbook, Cold Spring Harbor Laboratory, (1988) and JE Coligan et al. (editors) Current Protocols in Immunology, John Wiley This is described in sources such as & Sons (including all updates to date) and 10 It has been explained. The term "and / or" means, for example, "X and / or Y", "X and Y" or "X or Y". will be understood in the following way and will encompass both meanings or one of them. It will be accepted. The term "approximately" as used herein, unless otherwise specified, refers to the defined 15 de erin + / - 10%, more preferably + / - 5%, more preferably + / - 4%, more preferably + / - 3%, more preferably + / - 2%, more preferably + / - 1.5%, more This preferably means + / - 1%, or even more preferably + / - 0.5%. Throughout the specification, the word "contain" is used, as well as "contains" or "containing". Variations refer to the inclusion of a specified element, integer, or step. 20 while doing so, another element, integer or step, or element, integer or step That doesn't mean the group was excluded. The term "aspir" used here, with the suffix -ı, refers to the species Karthamus tinctorius. It refers to its members. A "lineage" is a group of 25 individuals who share the same definition but show little general diversity. It is a group of plants. "Border" also refers to a group of individuals that have very few traits among themselves. Genetically diverse or largely identical, showing no genetic diversity. It refers to a homogeneous group of plants that carry the same genetic material. "Variety" or "Cultivated plant" and "lineage" can be used interchangeably, but generally the former two The term refers to a lineage suitable for commercial production. For example, "genetically derived from parental lines". The phrase "genetically derived" was used with the addition of "ı", meaning "genetically derived". 23 The characteristic in question is wholly or partly an aspect of the genetic structure of the plant in question. It means determined by. Used here with the suffix -ı to refer to a "privileged lineage" with the same transformative DNA. through transformation or with plants obtained by such transformation a group of lineages obtained through hybridization; 5 of the transgene structure(s) its expression and stability, optimal agronomic for the plant in which it is found. based on compatibility with the characteristics and the realization of the desired phenotypic trait. It is a lineage chosen as such. Therefore, the criteria for selecting a distinguished event are among the following: It is a small one and, advantageously, all of them: (a) the presence of the transgene affects the agricultural performance or commercial value of the plant. not making excessive compromises on other desirable qualities, such as those related to it; (b) the event is stably inherited and suitable for identification purposes. with a well-defined molecular configuration, the tools can be developed characterization; (c) the relevant genes in the transgene cassette, both heterozygous (or hemizygous) 15 And in the homozygous state, the plants carrying the disease are suitable for normal agricultural use. commercially acceptable under various environmental conditions to which it is likely to be exposed exhibiting a correct, appropriate and stable spatial and temporal phenotypic expression at the level. Foreign DNA also allows for the introduction of desired commercial genetic histories into the plant genome. It can also be associated with a position that gives. 20 Used herein with the attached document, GOR73226, SEC D NO:13. A polynucleotide containing a nucleotide sequence, a nucleotide provided as SEC NO:14. a safflower plant strain containing a polynucleotide sequence and a T-DNA molecule It states that the T-DNA molecule is inserted into a region of one of the plant's chromosomes, where The region has a nucleotide sequence designated as SEC NO:11. This lineage, 25 Submitted on __________________, at __________________ address _____________________ Access is possible through the Budapest Treaty No. 1. Applicant (Commonwealth Scientific and Industrial Research Organisation, Clunies Ross St, Acton ACT 2601, Australia) and its commercial partners (Go Resources, 15 Sutherland Street, Brunswick VIC 3056, Australia), the seeds of this lineage are such that 30 24 If it cannot be provided through a trustee, the same conditions apply according to the Budapest Agreement. It guarantees that it is available in a safekeeping facility located underneath. Used herein with the addition of GOR73240, SEC D NO:21. A polynucleotide containing a nucleotide sequence, a nucleotide provided as SEC NO:22. a safflower plant strain containing a polynucleotide sequence and a T-DNA molecule containing the sequence 5 It states that the T-DNA molecule is inserted into a region of one of the plant's chromosomes, where The region has a nucleotide sequence designated as SEC NO:18. This lineage, Submitted on __________________, at __________________ address _____________________ Access is possible through the Budapest Treaty No. 1. Applicant (Commonwealth Scientific and Industrial Research Organisation, 10 Clunies Ross St, Acton ACT 2601, Australia) and its commercial partners (Go Resources, 15 Sutherland Street, Brunswick VIC 3056, Australia), the seeds of this lineage are such that If it cannot be provided through a trustee, the same conditions apply according to the Budapest Agreement. It guarantees that it is available in a safekeeping facility located underneath. The terms "seed" and "grain" are used here in a related manner. These are terms and have the most common meanings. "Grain" can refer to harvested grain or still a plant. It refers to mature grain, such as the grain that is still on the tree but ready for harvest, however Depending on the context, it can also refer to grain after moisture absorption or germination. Mature Grains typically have a moisture content of less than 10-12% by weight, for example, 6-10%. It contains the following words: "seed," "the seed that grows," as well as "grain," which is mature grain. It contains, but does not cover, the grain after moisture absorption or germination. It was used here. The suffix "gelin en seed" typically refers to the seed that reproduces after fertilization or anthesis of the plant. It refers to a seed found in their structures before it matures, but also It can also refer to seeds isolated from a plant before they mature. Seed Development in plants is generally divided into early, middle, and late stages. 25 "Plant part" includes plant cells, plant organs, plant protoplasts, plants plant cell tissue cultures, plant cultures, plant clusters and which can be reproduced in plants or embryos, pollens, ovules, seeds, pods, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, cotyledons, hypocotyls, 30 types of media such as radicles, single cells, gametes, cell cultures, tissue cultures, and the like. Plant parts contain intact plant cells. A cotyledon is a type of seed leaf; A cotyledon is a small leaf found on the surface of a plant embryo. A cotyledon provides nutrients to the seed. It contains storage tissues. The embryo is a small part found inside a mature seed. It is a plant. "Plant cells" also includes non-renewable plant cells. "New generation" includes the offspring and derivatives of a plant or plants. It means all generations and includes the first, second, third and subsequent generations; and its own 5 through self-pollination or hybridization with plants of the same or different genotypes It can be produced and modified using a range of suitable genetic engineering techniques. Culture, in general, refers to plants that have been deliberately modified and selected by humans. "TO" indicates the first generation of the converted plant material, "Tl" refers to the TO plants. It indicates the seed produced on it; if it's a Tl seed, then it's a T2 seed, etc., then the next Tx generation is 10. It provides plants that produce. "Backcrossing" is when a breeder repeatedly crosses a hybrid offspring with the parental lineage. For example, in the first generation hybrid Fl, one of the parental genotypes of the Fl hybrid Crossing is a process. The term "snow that comes warmly" refers to a cell, plant, or part of a plant that is 15 (seed) having the same or similar genetic background as, but not as described here like this, it is not modified (for example, a cell or a plant or a part of it, here) (as defined, it lacks a polynucleotide and / or T-DNA) of a cell or It refers to a plant or a part of it (like a seed). A cell that comes into contact with warm snow. or a plant or part thereof (seed), for example, to compare the following: a 20 It can be used as a control: a modified cell, plant or as described here. CtFAD2-2 protein activity and / or CtFATB-3 compared to a portion of this (seed) protein activity. A person skilled in the technique would find a suitable method for such a comparison. "The snow that comes warm easily" can easily pick up the cell, plant, or part of it (seed). can determine. 25 The terms "FAD2-2" and "CtFAD2-2" and their usage herein are included with the suffix "ı". Variations, an aspirin FAD2 with amino acid sequence SEK D NO:1. a polypeptide, for example, a sequence of nucleotides provided as SEC NO:2 It refers to a polypeptide encoded by a gene. As used here, a FAD2-2 gene thus... It is a gene that codes for a polypeptide or a mutant allele of it. These terms also refer to 30 the sequences provided are either naturally occurring or artificially induced or produced. 26 It also includes variants. In one regulation, it is found as FAD2-2, SEK D NO:1. an amino acid that is at least 95% identical to the sequence provided, preferably at least 99% identical. It contains a sequence of CtFAD2-2 genes, which are mutated, meaning they have altered activity, such as reduced activity. polypeptides encoding desaturase-active polypeptides or functional polypeptides (bo (alleles) includes non-coding alleles. Such alleles can occur naturally or 5 It can be induced through artificial mutagenesis. A CtFAD2-2 is found in safflower cells. gene activity is preferentially mediated by RNAi interference, i.e., by the endogenous CtFAD2-2 gene. a genetic material that codes for an inhibitory RNA molecule without altering itself This is reduced by the addition of the structure. More preferably, the expression of the CtFAD2-2 gene is reduced in the seed. using a specific promoter, preferably on the developing seed of the safflower plant 10 In cells, the expression of the CtFAD2-2 gene is minimal in tissues outside the seed cell. It is reduced either by a certain degree or without any reduction. The terms "FATB-3" and "CtFATB-3" and their usage herein are included with the suffix "ı". Variations, an aspirin FATB with the amino acid sequence SEC D NO:3. a polypeptide, for example, a sequence of nucleotides provided as SEC NO:4, is 15 It refers to a polypeptide encoded by a FATB-3 gene. As used here, a FATB-3 gene thus... It is a gene that codes for a polypeptide or a mutant allele of it. These terms are also used to describe... the sequences provided are either naturally occurring or artificially induced or produced. It also includes variants. A regulation found in FATB-3, SEC D NO:3. an amino acid that is at least 95% identical to the sequence provided, preferably at least 99% identical. It contains a sequence of CtFATB-3 genes, which are mutated, meaning they have altered activity, such as reduced activity. polypeptides encoding or functionally possessing palmitoyl-ACP thioesterase activity. It includes alleles that do not code for polypeptides (bo alleles). Such alleles are naturally occurring. It can occur naturally or be induced through artificial mutagenesis. Bulu un aspir The activity of a CtFATB-3 gene in cells is preferentially inhibited via RNAi interference, i.e., 25 without altering the endogenous CtFATB-3 gene on its own, an inhibitory RNA molecule This is reduced by adding a genetic construct that codes for it. More preferably, the CtFATB-3 gene. expression is preferably done using a seed-specific promoter from the safflower plant. In the cells of the developing seed, the CtFATB-3 gene is present in the tissues outside the seed. expression is reduced by minimal reduction or not at all. 30 27 As explained here, the OL locus corresponds to the CtFAD2-1 gene. olol Oleic acid content of seed oil in (homozygous) genotypes grown in greenhouses For plants, it is generally 71-75% (Knowles, 1989). Knowles (1968) identified the ol allele in a safflower. It was included in the breeding program and in 1966 it was the first high oleic (HO) safflower in the United States. It launched the "UC-1"; this was followed by the development of "Oleic LEED" varieties and 5 The Saffola series, including the Saffola 317 (S-317), S-517 and S-518, has been launched. High When oleic (olol) genotypes were grown in the field at different temperatures, the oleic acid level... It has become relatively stable (Bartholomew, 1971). Also, Knowles (1972) at the same locus A different allele, "ol1", has been identified; this accounts for 35% to 50% of cases in the homozygous state. It produced oleic acid. Compared to the olol genotype, the ol1ol1 genotype showed a strong response to temperature. This has been demonstrated (Knowles, 1972). As determined here, reduced levels in safflower seeds The allele of the mutation that provides FAD2-1 activity (and general FAD2 activity) is the framework. Mutant FAD2-1 containing a slip mutation (due to the deletion of a single nucleotide) It is a gene. The abbreviation "T-DNA" is used here, for example, in Agrobacterium tumefaciens15 T-DNA of the Ti plasmid or an Agrobacterium rhizogenes Ri plasmid or These are man-made variants that function as T-DNA, and an aspirate of T-DNA. after being transferred to the cell and integrated into the nuclear genome, derived from there It refers to molecules. Therefore, T-DNA includes both right and left border sequences. It may contain a complete T-DNA or, for example, the right and / or left T-DNA boundary 20 through the integration process, including the loss of sequences, one or more of the molecule's components This can be derived from the loss of sequences at both ends. The T-DNA samples found are related to this. It inserts a polynucleotide anywhere between the left and right border sequences (if any). T- Factors necessary for the transfer of DNA, such as viral genes, into a plant cell. The coding sequences can be added to T-DNA or are already present on the same replicon as the T-DNA. may be or preferably trans on a compatible copy in Agrobacterium kona. It is found as such. These types of "binary vector systems" are well known in technology. Here, the term "same" is used with the suffix - for example, with the safflower plant, which is related to the discovery. related to "same" seedling viability, plant height, flowering time, harvest settling, seed crude protein content, seed crude fat content, seed ash content, or seed 30 polynucleotide(s) and / or T-DNA(s) that do not contain carbohydrates, 28 For the corresponding plant grown under the same conditions, the p value is greater than 0.05 (> 0.05) This indicates that there is no statistically significant difference, such as a high value. Used here with the suffix "ı" to mean "extracted oil" or "extracted oil". The term "lipid" refers to a fat containing at least 60% (w / w) and derived from a transgenic organism or a component thereof. It corresponds to a fat component extracted from that part. 5 As used here, the term "purified" refers to the lipid or fat content of the discovery. When used in conjunction with other substances, it typically extracts lipids or fats, lipid / fat even subjected to one or more processing steps aimed at increasing its purity It means it was held. For example, a purification stage consists of the following: It may include one or more or all of the group: extracted or in 10 removal of gum, removal of odor, removal of color, drying and / or separation into fractions. However, the term "purified" is used here in the form in which it is used. found in a way that will increase the oleic acid content as a percentage of the total fatty acid content a transesterification process that alters the lipid or fatty acid composition of a lipid or fatty acid or does not involve any other process. In other words, purified lipid or fat oil 15 Even the acid content is essentially the same as that of the unpurified lipid or other substances. Extracted lipid or fatty acid content, for example, oleic, linoleic, and palmitic acid. The compound is derived from the lipid or fatty acid composition of the plant seed from which it is obtained. Essentially the same. In this context, "essentially the same" means + / - 1% or preferably + / - 0.5%. income. For example, if a plant seed contains 92% oleic acid, the extract will be 20%. It contains between 91-93% oleic acid. As used herein, the term "seed oil" refers to an oil containing at least 60% (w / w) lipids. obtained from the seed of the plant, or from the seed if the seed is still present. It is obtained as a compound that corresponds to a warming. That is, the seed oil or the discovered compound. Seed oil obtained using this method is called "extracted seed oil" or similar. 25 Unless referred to by specific terms, such as in the seed or cotyledons or embryo, this is a part of it. It contains the seed oil present in that part; in this case, from the seed in question It is extracted oil. Seed oil is preferably extracted seed oil. Seed Oil is typically a liquid at room temperature. Preferably, the total fat in seed oil. Fatty acid (TFA) content is >90% oleic acid (C18:1).∆9). Fatty acids typically contain, for example, 30 TAG, DAG, acyl-CoA, or phospholipid are in an esterified form. Otherwise... 29 Unless otherwise specified, the acids may be free or esterified. It can be in a form that is preferably >95% or >98% esterified by weight. The oil in the seed must contain at least 90% fatty acids, preferably more. at least 91%, preferably at least 92%, preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more 5 more preferably at least 97%, more preferably at least 98%, more preferably at least 99% can be found as TAGs. A seed oil found in a regulation, in the seed or nucleic acids are found together with one or more other lipids in the crude extract. largely separated from acids, polypeptides, or other contaminant molecules. "Purified" or "purified" is a type of seed. Largely purified seed 10 the oil contains at least 60% of other related components in the seed or extract, more Ideally, at least 75% and even more preferably at least 90% of the population should be free. Bulu seed oil also contains, but is not limited to, cholesterol, kalinasterol / 24- methylene cholesterol, campesterol / 24-methylcholestanol campestanol / 24-methylcholestanol, ∆5-stigmasterol, ergost-7-en-3β-ol, eburicol, β-sitosterol / 24-ethylcholesterol, ∆5-15 such as avenasterol / isofucosterol, ∆7-stigmasterol / stigmast-7-en-3β-ol and ∆7-avenasterol Seed oil may also contain molecules that are not acidic. Seed oil, in any known technical sense... It can be extracted from the seed using this method. This typically involves hexane, diethyl ether, petroleum ether, with non-polar solvents such as chloroform / methanol or butanol mixtures It involves extraction and usually the seeds are crushed for the first time or passed through a cylinder 20 It is related to passing through. The lipids related to starch in the grain are saturated with water via butanol. Extractable. Technique for removing polysaccharides and / or phospholipids. Seed oil can be de-gum removed or contaminants eliminated using known methods. to remove or by other means to improve purity, stability or color It can be processed. TAGs and other esters in seed oil can be processed by acid or alkali treatment or 25 They can be hydrolyzed by lipases to release free fatty acids, or Seed oil, as is known in technology, can be hydrogenated, chemically or enzymatically. It can be processed. However, when the seed oil is processed in such a way that it no longer contains TAG, As stated here, it is no longer considered seed oil. Purified and / or extracted lipids or free and ester compounds 30 sterol (e.g., sitosterol, campesterol, stigmasterol, brassicasterol, ∆5-avenasterol, concentrations of sitostanol, campestanol and cholesterol, Phillips et al. (2002) and / or as described in Sample 17 of WO 2013 / 159149. Herbal Sterols in fatty acids include free alcohols and fatty acid esters (esterified sterols). It exists in the form of glycosides and acylized glycosides of sterols. Harvested or extracted seed oils preferably around 100 to around 5 Contains 1000 mg total sterols / 100 g. For use as food or animal feed. sterols are primarily in free or esterified forms, rather than glycosylated forms. It is preferable for them to be available in the forms. In the available seed oils, oils The sterols it contains are preferably at least 50% in the form of esterified sterols. Find safflower seed oil, preferably approximately 150 to approximately 400 mg total (10 mg). sterol / 100g typically contains approximately 300mg total sterol / 100g seed oil and is the main The sterol is sitosterol. As used here, the term "fatty acid" refers to saturated or unsaturated fatty acids, at least 8%. It means a carboxylic acid that has a long aliphatic tail of the length of a carbon atom. It comes from fatty acids, typically at least 12 carbon atoms long, with a carbon-carbon bond of 15. It has a chain. Most naturally occurring fatty acids have an even number of carbon atoms. It has this because its biosynthesis involves acetate, which has two carbon atoms. Or acids. In its free state (esterified) or bonded to TAG, DAG, MAG, acyl-CoA (thio-ester) or It can also be in an esterified form, such as a covalently bonded form. An esterified form. When covalently bonded in this form, the fatty acid is referred to here as an "acyl" group. 20 Fatty acid, phosphatidylcholine (PC), phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, It can be esterified with a phospholipid such as phosphatidylinositol or diphosphatidylglycerol. Saturated fatty acids have no double bonds or other functional groups along the chain. It does not contain. The term "saturated" means that all carbons (except the carboxylic acid [-COOH] group) It refers to hydrogen because it contains as much hydrogen as possible. That is, 25 The omega ( ) end contains 3 hydrogens (CH3-) and each carbon in the chain contains 2 hydrogens (-CH2-) It contains unsaturated fatty acids, which are similar in form to saturated fatty acids, but the chain... There are one or more alkene functional groups along the chain, and each alkene is located in the chain. the single bond "-CH2-CH2-" part becomes the double bond "-CH=CH-" part (i.e., a double bond to another carbon). (a carbon) is replaced with another. The next 30 in the chain attached to either side of the double bond The two carbon atoms exist in either a cis or trans configuration. 31 "Triacylglyceride" or "TAG" is glycerol esterified with three fatty acids. It is a glyceride. In the Kennedy pathway of TAG synthesis, DAG is synthesized as described above. is formed and then a third acyl group, DGAT, activates the activity of glycerol. It is esterified in its backbone. PDAT is among the alternative pathways for TAG formation. The pathway is catalyzed by the enzyme and the MGAT pathway (PCT / AU2011 / 000794). 5 As used here, the term "by weight" refers to the weight of a substance (e.g., oleic acid). acid, palmitic acid or linoleic acid) weight; substance in the composition or a component It is expressed as a percentage of the weight of the component containing it. For example, a specific compound like oleic acid. fatty acid weight, lipid or seed oil or total fatty acid of the seed It can be determined as a percentage of the weight of the content. 10 The term "biofuel," as used here with the suffix "ı," typically refers to automobiles, used to power machines such as trucks or petrol-powered engines and any whose energy is obtained from biological carbon fixation instead of fossil fuels It refers to the type of fuel. Biofuels are fuels obtained from biomass conversion. It also includes solid biomass, liquid fuels, and biogas. Examples of biofuels: 15 among them bioalcohols, biodiesel, synthetic diesel, vegetable oil, bioethers, biogas, synthesis gas, solid biofuels, algae-derived fuel, biohydrogen, biomethanol, 2,5- Dimethylfuran (DMF), biodimethyl ether (bioDME), Fischer-Tropsch diesel, biohydrogen These include diesel, mixed alcohols, and wood-burning diesel. As used here, the term "industrial product" refers primarily to carbon and 20 It refers to a hydrocarbon product composed of hydrogen, for example, methyl and / or fatty acids. Alkanes such as ethyl esters or methane are typically liquids at ambient temperatures. Mixtures of long-chain alkanes, a biofuel, carbon monoxide and / or hydrogen or a bioalcohol such as ethanol, propanol or butanol, or biochar. "Industrial The term "product" includes intermediate products that can be transformed into other industrial products. 25 The aim is; for example, synthesis gas itself is also an industrial product. can be used to synthesize a hydrocarbon product, also known as It is considered an industrial product. The term "industrial" is used here in the sense of "industrial". The term "product" includes both the pure forms of the compounds listed above and, more generally, their various forms. It contains a mixture of two and three elements; for example, a hydrocarbon product, technically good 30 As understood, it can include various carbon chain lengths. 32 Polynucleotides The terms "polynucleotide" and "nucleic acid" are used interchangeably. These are... a polymeric form of nucleotides of any length (deoxyribonucleotides) (or ribonucleotides) snow comes warm. A polynucleotide genomic, described here, cDNA can be of semi-synthetic or synthetic origin, double-stranded or single-stranded, and 5 due to its origin or manipulation: (1) a polynucleotide that is related to the origin It is not related to all or part of it, (2) the polynucleotide to which it is attached in nature is attached to a different polynucleotide or (3) does not occur in nature. The preferred discovery polynucleotides that can be replicated in plant cells and silence RNA molecules It codes for double-stranded DNA molecules. 10 As used here, the term "gen" will be considered in the broadest sense, and a constitutive gene's transcription region and the protein-coding region that undergoes translation. including the region and extending for a distance of at least approximately 2 kb at both ends, both 5' and The coding region at the 3' ends of the gene is located bit by bit and It contains deoxyribonucleotide sequences that include the sequences involved in its expression. These 15 In this context, a gene is a gene, and promoters or enhancers are naturally associated with a particular gene. control signals such as termination and / or polyadenylation signals or heterologous signals It contains control signals; in this case, the gene is referred to as a "chimeric gene". Protein Sequences located in the 5' region of the coding region and present on mRNA are called 5' sequences. These are called untranslated sequences. The 3' or amino acid sequence of the protein coding region... sequences located in the blood and present on the mRNA are 3' untranslated. These are called sequences. The term "gene" refers to both the cDNA and genomic forms of a gene. It includes the genomic form or clone of a gene, "introns", "intervening regions" or It can be interrupted by non-encoding sequences called "insertion sequences". It contains the coding region. ntrons are the 25 constituent parts of a gene that are transcribed into nuclear RNA (nRNA). They are components. They may include regulatory elements such as neutrons and enhancers. It is removed from the nuclear or primary transcript or "extracted by end-splicing"; this Therefore, mRNA transcripts do not contain introns. mRNA is formed into new forms during translation. The function of determining the sequence or order of amino acids in a polypeptide. sees. The term "gene" here refers to all or part of the proteins belonging to the discovery described. 30 33 a synthetic or fusion molecule that encodes any of the above It contains a complementary nucleotide sequence. An "allele" is a genetic variant within a cell, a single plant, or a population. It refers to a specific form of a sequence (like a gene); the specific form is another form of the same gene. When compared with other forms, at least one sequence and often more than one 5 in the gene sequence The variant varies in the region. This variant differs between different alleles. The sequences in these regions are called "variances," "polymorphisms," or "mutations." A "transgene" is a gene that is introduced into the genome through a transformation process. It is a gene. A transgene is produced through regeneration from a modified plant cell. initially in a transformed plant or by self-pollination or in the first 10 in new generation plants produced by crossbreeding with a germicidal parent or from seeds, etc. It can be found in the sections. The term "genetically modified" and its variations, a the insertion of a gene into a cell through transformation or transduction, mutating a gene in a cell and altering a gene in a cell or as described above The regulation of the new generation of any cell modified as described is 15 It involves genetic modification or modulation. The term "genomic region" as used here, with the suffix "ı", refers to a transgene within the genome. or a group of transgenes (also referred to here as a cluster) into a cell or of it It was added to the precursor and shared genetically in the new generation of cells after meiosis. "transferred" indicates a location. 20 A polynucleotide (or T-DNA) described here is an artificial recombinant. a nucleic acid molecule that has been created or modified by various methods It is either a "recombinant polynucleotide" or an "exogenous polynucleotide". Recombinant Polynucleotide can be present in a cell in varying amounts or in its natural state. Compared to other sources, it can be expressed at a much lower rate (e.g., in mRNA form). Exogenous 25 a polynucleotide, a polynucleotide that is added to a cell that does not naturally contain a polynucleotide It is a polynucleotide. Typically, it is exogenous and serves as a template for mRNA transcription. A DNA molecule is used, and this is then transformed into a molecule found inside the cell. It is translated into a continuous sequence of amino acid residues that codes for a polypeptide. Another In this regulation, a portion of the exogenous polynucleotide is endogenous to the cell and its expression is 30 They are modified with recombinant media, for example, the polynucleotide of the transformed cell. 34 to enable the expression of the polypeptide encoded by endogenous An exogenous control sequence is added to the upstream of a polynucleotide. For example, an exogenous A polynucleotide can express an antisense RNA into an endogenous polynucleotide. Bulu is a recombinant polynucleotide, found in a cell-based or undissociated polynucleotides from other components of the cell-free expression system and 5 then the cell in question is purified by separating it from at least some of its other components. It includes polynucleotides produced in cell-based or cell-free systems. Polynucleotide, in nature It can be an end extension of existing nucleotides or form a single polynucleotide. two from different sources (naturally occurring and / or synthetic) combined to form a mixture. It may contain two or more nucleotide sequences. Typically, such chimeric 10 Polynucleotides, transcription of the open reading frame in a cell. at least one open read functionally linked to a suitable promoter for guidance It includes the frame. Regarding the identified polynucleotides, higher than those given above. If the percentage figures are to encompass the preferred arrangements, then 15 will be done. Therefore, where applicable, minimum percentage identity figures. in this regard, the polynucleotide should contain at least 50%, preferably at least the relevant candidate SEC NO. 60%, preferably more than 65%, preferably more than 70%, preferably more than 70% at least 75%, preferably at least 80%, preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more than 20 more preferably at least 93% more preferably at least 94% more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 25% at least 99.7%, preferably at least 99.8%, and even more preferably at least 99.9% identical It is preferable for it to contain a polynucleotide sequence. A useful polynucleotide for the current discovery, under strict conditions, can be found here. It can selectively hybridize to a defined polynucleotide. It was used here. The strict conditions are as follows: (1) during hybridization, a 30 such as formamide at 42°C denaturing agent, e.g. 50% (v / v) formamide with 0.1% (w / v) sterile serum albumin, 35 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5, 750 Use 75 mM NaCl, 75 mM sodium citrate; or (2) 0.2 x SSC and 0.1% SDS at 42°C 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt solution, sonicated salmon sperm It uses DNA (50 g / ml), 0.1% SDS and 10% dextran sulfate and / or (3) 5 for washing. Low ionic strength and high temperature are used, e.g. 0.015 M NaCl / 0.0015 at 50°C M sodium citrate / 0.1% SDS. RNA Silencing RNA interference (RNAi), as defined here, affects CtFAD2-2 protein activity. and / or the production of a specific protein, such as CtFATB-3 protein activity. It is particularly useful for inhibition. This technology uses mRNA that is essentially identical to the mRNA of the gene in question, or a portion of it. the presence of dsRNA molecules containing a sequence and a complementary sequence It relies on. Appropriately, dsRNA, a recombinant vector, or a single 15 in the host cell. can be generated from a promoter; where the sense and anti-sense sequences are represented by a sequence, preferably. It is covalently combined with an unrelated sequence; this results in the sense and incoming transcript being affected. antisense sequences connect to a loop structure formed by a splicing sequence within the dsRNA molecule. This allows hybridization to form a new RNA molecule, but it does not hybridize to the target RNA or its derivatives. It can form a series of loop structures identical to its complement. Typically, dsRNA, 20 arranged as a discontinuous palindrome, sense in an inverted repetition structure. It is encoded by a double-stranded DNA structure that has antisense sequences, where Repeated sequences are copied in the dsRNA molecule to produce hybridization sequences. and the interrupt sequence are used to create a loop in the dsRNA molecule. is copied. The design and production of suitable dsRNA molecules are carried out with particular reference considerations. 25 When acquired, this is within the capacity of a person skilled in the technique, see Waterhouse et al. (1998), Smith et al. (2000), WO 99 / 32619, WO 99 / 53050, WO 99 / 49029 and WO 01 / 34815. In one example, at least partially double-stranded RNA that has homology. the product(s) preferably target a region of a target RNA to be inactivated 30 A DNA insertion is made that directs the synthesis of at least 19 complementary consecutive nucleotides. This 36 Therefore, when DNA is transcribed into RNA, it forms the double-stranded RNA region. It contains both sense and antisense sequences that can be hybridized. The sense sequence is arranged in a certain order. and antisense sequences, a spacer containing an intron that is cut off when transcribed into RNA. It is separated by a region. This arrangement results in higher gene silencing efficiency. It has been shown that the result is... The double-stranded RNA region is formed from one or two DNA regions. It may contain one or two RNA molecules being transcribed. The presence of a double-stranded molecule, that destroys both double-stranded RNA and the homologous RNA transcript of the target gene, an endogenous molecule that effectively reduces or eliminates the activity of a target gene It is thought to have triggered a response from the system. In hybridization, the length of each of the sense and antisense sequences is 10 times the length of the target mRNA. A gene transcript must contain at least 19 nucleotides, some of which are mild. A full-length sequence with all snow and warm temperatures can be used. Sense and antisense sequences. The degree of identity with the targeted transcript should be at least 85%, at least 90%, or at least 95%. It must be 100%. The RNA molecule can, of course, perform the function of stabilizing the molecule. It may contain unrelated sequences. The RNA molecule is processed by an RNA polymerase II or RNA polymerase III. 15 It can be expressed under the control of the promoter. Examples of the latter include tRNA. or snRNA promoters are involved. Recombinant Cells Bulu also finds one or more polynucleotides or T-DNAs as defined herein in 20 or a recombinant safflower cell containing a combination of these. The term "recombinant cell" is used interchangeably with the term "transgenic cell" here. It is used. A cell in recombinant cell culture, a cell in vitro, or a It could be a cell in the safflower plant or a part of it, like a seed. Transformation of Plants Transgenic plants, in general, Slater et al., Plant Biotechnology - Genetic Manipulation of Plants, Oxford University Press (2003) and Christou and Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004) It can be produced using known techniques in the field, such as those described. 30 37 Used here with the suffix -ı, "stably transform", "stably "Transformed" terms and their variations, polynucleotide cell This refers to their integration into the genome, so that during cell division without the need for positive selection for their existence, the new generation They are transferred to cells. Stable transformants or their offspring have chromosomal 5 Techniques such as Southern blots or in situ genomic DNA hybridization on DNA It can be selected and / or identified by any known method. Agrobacterium-mediated transfer is a common method for inserting genes into plant cells. It is a viable system because DNA can be used for transient expression or in plant cells. stable integration of DNA in the genome requires plant 10 It can be administered to cells in organs or explants in tissue cultures. Agrobacterium-mediated plant integration vectors deliver DNA into plant cells. Its use for insertion is well known in the technique (see example, US 5177010, US 5104310, US 5004863 or US 5159135). The DNA region to be transferred is bounded by its boundary sequences. It is identified and the intervening DNA (T-DNA) is usually added to the plant genome. Also T-15 DNA integration is a relatively delicate process that results in several rearrangements. It is a process. Agrobacterium-mediated transformation is effective in these plant varieties, gene It is the preferred method due to its ease and clearly defined nature of transfer. Preferential Agrobacterium transformation vectors, as described (Klee et al., Plant DNA Infectious Agents, Hohn and Schell, eds., Springer-Verlag, New York, pp. 179-20 203 (1985)) with E. coli in the annex that will allow appropriate manipulations. Agrobacterium has the ability to replicate. Possible acceleration methods include, for example, microprojectiles. Bombardment and similar processes are involved. Transformative nucleic acid molecules in the plant. An example of a method for delivering to cells is microprojectile 25 It is a bombardment. This method was developed by Yang and others for Particle Gene Transfer. Bombardment Technology, Oxford Press, Oxford, England (1994) It has been studied. It can be coated with nucleic acids and delivered to cells by a repulsive force. non-biological particles (microprojectiles). Such methods are well-developed in the field. It is known that in another arrangement, plastids can be transformed in a stable manner. 30 Among the methods described for plastid transformation in higher plants, the following can be selected. 38 DNA containing a marker is delivered via a particle gun, and the DNA is homologous. This involves targeting the plastid genome via recombination (US 5,451,513, US 5,545,818, US 5,877,402, US 5,932479 and WO 99 / 05265). ). Transformation of plant protoplasts, calcium phosphate precipitation, polyethylene. glycol treatment, electroporation, and methods based on combinations of these treatments 5 This can be achieved using these systems. The application of these systems to different plant species is discussed. The subject is related to the reproduction of plant water from protoplasts. Grains... Explanatory methods for regeneration from protoplasts have been described (Fujimura (and others, 1985; Toriyama et al., 1986; Abdullah et al., 1986). Other cell transformation methods can also be used, and these include 10 These include, but are not limited to, the transfer of DNA directly to pollen, thereby transferring DNA to a cell. through direct injection into the plant's reproductive organs or by DNA direct injection of immature embryo cells into the embryos and subsequent drying The process involves adding DNA to plants through the rehydration of embryos. From single plant protoplast transformants or various transformed 15 The regeneration, development, and cultivation of plants from explants is a well-established technique. It is known (Weissbach et al., Methods for Plant Molecular Biology, Academic Press, San Diego, California, (1988). This regeneration and growth process Typically, the selection of transformed cells involves these individualized cells, throughout the normal stages of embryonic development up to the rooted plantlet stage 20 It includes the steps of culturing. Transgenic embryos and seeds are similarly processed. They are reproduced. The resulting transgenic rooted shoots are then placed in suitable soil, such as... It is sown in a plant growing medium. The development or regeneration of plants containing foreign, exogenous genes is a technique. It is well known. Preferably, reproducing plants, homozygous transgenic plants 25 It pollinates itself to produce pollen. Otherwise, it is obtained from plants that are reproduced. The pollen obtained is used in the cultivation of plants from seeds of agriculturally important lineages. They are crossbred. Conversely, pollens obtained from plants of these important lineages, It is used to pollinate reproducing plants. It contains a specific polynucleotide. The current discovery is a transgenic plant, developed by experts in the field using well-known methods. 30 They are grown using [methods]. 39 To confirm the presence of transgenes in transgenic cells and plants, a polymerase chain reaction using advanced, known methods by experts in the field (PCR) amplification or Southern blot analysis can be performed. Transgenic After the plants are obtained, plant tissues or parts with the desired phenotype are selected. They can be grown in a way that allows for production. Plant tissue or plant parts can be harvested. 5 and / or seeds can be collected. The seeds are separated into tissues or parts with the desired characteristics. It can serve as a resource for growing additional plants. A transgenic plant or other created using Agrobacterium Transformation methods typically target a single transgenic locus on a chromosome. It includes. Such transgenic plants are hemizygous with respect to the added gene(s) 10 They can be named. The more preferred option is being homozygous for the added gene(s). It is a transgenic plant, meaning that each chromosome of a chromosome pair has the same chromosome. It is a transgenic plant containing two additional genes, one of which is at the locus. It is a homozygous plant. A transgenic plant is a plant produced by the self-fertilization of a hemizygous transgenic plant. Germinating a portion of the seed and analyzing the resulting plants for the relevant gene. 15 It can be obtained through this process. Also, two that contain two independently segregated exogenous genes or loci. different transgenic plants to produce offspring containing both sets of genes or loci It should also be understood that they can be crossed (mated). The appropriate F1 generation... taking it for oneself, being homozygous for both exogenous genes and loci 20 It can produce plants. By crossbreeding back to a parent plant, a non-transgenic plant can be obtained. Crossbreeding is designed in a similar way to plant propagation. Different characteristics and For descriptions of other commonly used cultivation methods for the products, see... See: Fehr, Breeding Methods for Cultivated Plant Development, Wilcox J. ed., American Society of Agronomy, Madison Wis. (1987). 25 For particularly useful methods for aspirin transformation, see: Belide and di . (2011). Token-Assisted Selection Token-assisted selection is a repetitive 30-point selection in a classic parenting program. When performing backcrossing with the parent, it is good to select the necessary heterozygous plants. 40 It is a known method. The plant population in each generation of backcrossing is normally heterozygous for the relevant gene present in a backcrossing population at a 1:1 ratio. This will be the case, and the molecular marker can be used to distinguish between the two alleles of the gene. For example, in DNA is extracted from young shoots and subjected to introgression to determine the desired result. By testing with a specific marker for the trait, energy and resources are used to produce fewer plants. 5 While focusing on this, early selection of plants is carried out for further backcrossing. To further accelerate the backcrossing program, from immature seeds The resulting embryo (25 days after anesthesia) is allowed to reach full maturity of the seed. Instead, they can be cut and grown in nutrient media under sterile conditions. "Embryo DNA extraction from three leaves, called "rescue," and the desired 10 This process, used in conjunction with genotype analysis, then traces the recurring trait back to the parent. The desired variety to be hybridized can be grown in a greenhouse or field until maturity. It allows for the rapid selection of plants that possess the specified characteristics. Any molecular device known in the technique that can detect a polynucleotide. Biological techniques can be used in existing methods. Such methods include 15 among these, but not limited to, nucleic acid amplification, nucleic acid sequencing, nucleic acid hybridization with appropriately labeled probes, single-stranded Conformational analysis (SSCA), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis (HET), chemical cleavage analysis (CCM), catalytic nucleic acid This involves the division or the use of a combination thereof (see example in 20). Lemieux, 2000; Langridge et al., 2001). "Polymerase chain reaction" ("PCR"); "upstream" and an "upstream" a "primer pair" or "primer set" consisting of primers and DNA polymerase and typical as a polymerization catalyst, such as a thermally stable polymerase enzyme PCR is a reaction in which copies of a target polynucleotide are made using a specific method. The methods are known in the field of technology and for example in "PCR" (Ed. MJ McPherson and SG). Moller (2000) describes the plant in his document (BIOS Scientific Publishers Ltd, Oxford). cDNA obtained from reverse transcription of mRNA isolated from cells PCR can be performed on it. However, genomic DNA isolated from a plant... It will generally be easier to perform PCR tests on it. 30 41 The primer is a sequence-specific hybrid that can hybridize to the target sequence during PCR. It is an extendable oligonucleotide sequence. Amplicons or PCR products or PCR fragments or amplification products, target sequence primers and newly synthesized These are extension products containing multiple copies. Multiplex PCR systems use multiple It involves multiple sets of primers resulting in the simultaneous production of the amplicon. The primers are 5 It can perfectly match the target sequence or have restrictions on specific target sequences. leading to the insertion of enzymes or catalytic nucleic acid recognition / cleavage sites Primers can contain internally incompatible bases that can open amplicons. may include additional sequences to facilitate capture or detection and / or It may contain modified or labeled nucleotides. Repeated heat of DNA 10 denaturation cycles, fusion of primers to complementary sequences (annealing), and Extension of annealed primers with polymerase, exponential extension of the target sequence This results in amplification. The terms target or target sequence or template refer to amplified. The resulting nucleic acid sequences are warm to the cold. Methods for directly sequencing nucleotide sequences, developed by 15 experts in the field. which is well known and cited as an example in Ausubel et al. (above) and Sambrook et al. (Above) references can be found. Sequencing, e.g. dideoxy sequencing, chemical by sequencing or any suitable method thereof This can be implemented. Direct sequencing is the process of finding the base pairs of a given sequence. It has the advantage of being able to identify variation. 20 Detection systems based on hybridization include, but are not limited to, the following: TaqMan analysis and molecular signal analysis (US 5,925,517) are included. TaqMan analysis (US 5,962,233), an allele with a donor dye at one end and a recipient dye at the other. It uses ASO probes, so that the dye pair undergoes fluorescence resonance energy transfer. It interacts via (FRET). 25 In one arrangement, the method described in Example 3 was used on aspirin with the ol mutation. in selection and breeding programs for the identification and selection of plants is used. For example, the method involves obtaining primers from the plant using the primers summarized in Table 1. performing an amplification reaction on the obtained genomic DNA Includes 30 42 Production of Lipids and / or Fats with High Oleic Acid Content Techniques routinely applied in the field utilize the currently available plants, especially: Extraction, processing, purification and extraction of lipids produced by seeds It can be used for analysis. Such techniques have been described throughout the literature as follows: It is defined and explained in the following sources: Fereidoon Shahidi, Food Analytics 5 Current Protocols in Chemistry, John Wiley & Sons, Inc. (2001) D1.1.1-D1.1.11 and Perez-Vich et al. (1998). Seed ore production Typically, plant seeds are cooked and pressed to produce raw seed oil. and / or extracted; then the gum is removed, refined, a is added and The odor is removed. Generally, techniques for crushing seeds are known. For example... safflower seeds are sprayed with water to increase their moisture content, for example, to 8.5%. A smooth cylinder that can be tempered and has an adjustable range of 0.23 to 0.27 mm. It can be crushed into flakes using [method]. Depending on the type of seed, add water before crushing: 15 This may not be possible. Applying heat inactivates the enzymes, increasing the number of cells. It facilitates breakdown, binds lipid droplets together, and separates protein particles. These particles all facilitate the extraction process. In one process, a large portion of the seed oil is passed through a screw press. are released. The cakes coming out of the screw press are then passed through a heat-monitored column 20 It can be extracted using a solvent, e.g., hexane. Alternatively, by pressing. The crude seed oil produced by this process is separated from the seed oil during the pressing process. A sedimentation basin with a slotted wire mesh drain to remove expressed solids. It can be passed through the tank. After the hexane is removed, pressing and The solid residue obtained from the extraction is 25, which is generally used as animal feed. It is seed meal. Purified seed oil, removal of remaining fine solid particles. It can be passed through a plate and frame filter. If desired, the extraction process can be completed. Recovered seed oil is blended together with purified seed oil. A raw seed oil can be produced. After the solvent is removed from the crude seed oil, it is pressed and extracted. 30 The extracted parts are combined and, for example, in degumming, caustic refining, purification and 43 It undergoes normal lipid processing procedures such as deodorization. The product pathway Depending on the nature of the feed, some or all steps may be skipped; feed quality may vary. While limited treatment may be needed for some applications, more extensive treatment is required for oleochemical applications. A purification step is needed. Gum removal Degumming is an early step in the refining of oils and its primary purpose is, Phospholipids, which can be found in approximately 1-2% of the total extracted lipid. Most of it is removed. Crude oil is typically treated with phosphoric acid at 70-80°C. Adding approximately 2% water to the phospholipids, along with trace metals and pigments, reduces their volume by 10%. This results in the separation of most of it. The removed insoluble material is mainly... It is a mixture of phospholipids and triacylglycerols, also known as lecithin. It is known that degumming involves converting non-hydrated phosphatides into a hydratable form. To convert and extract the small metals present, concentrate the raw seed oil. This can be achieved by adding phosphoric acid. Gum is extracted from seeds by centrifugation. 15 or separates from it. Alkali refining Alkali refining is one of the refining processes used to refine crude oil. It is one of them and is sometimes referred to as neutralization. It usually follows degumming and is 20 It comes before the increase. After gum removal, the seed oil contains all the fatty acids and To titrate phosphoric acid, a sufficient amount of alkaline solution is added, and this The soaps formed in this way can be removed through processing. A suitable alkaline solution is used. Ingredients include sodium hydroxide, potassium hydroxide, sodium carbonate, and lithium. These include hydroxide, calcium hydroxide, calcium carbonate, and ammonium hydroxide. These 25 The process is typically carried out at room temperature and the free fatty acid fraction The soap is removed by extraction via centrifugation or with a solvent that dissolves the soap. It is removed through this route and neutralized, or washed away with water. Excess in the substance can be removed if necessary. It can be neutralized with a suitable acid such as alkali, hydrochloric acid, or sulfuric acid. 44 A increase A increase occurs in the presence of soil with increasing moisture content (0.2-2.0%) and in the absence of oxygen. heated to 90-120°C for 10-30 minutes by operating with nitrogen or steam or in a vacuum It is a refining process. This step in the oil processing removes unwanted pigments (carotenoids, It is designed to remove chlorophyll, decodupol, etc., and the process also has 5 oxidation products, trace metals, sulfur compounds, and trace amounts of soap. It drives away. Odor removal Odor removal involves removing liquid and solid fats at high temperatures (200–260°C) and low temperatures. This is the process of processing at a pressure of (0.1–1 mm Hg). This is typically about 0.1 mm Hg per seed oil. This is done by steaming at a rate of ml / minute / 100 ml of seed oil. Approximately 30 minutes. After the steaming process, the seed oil is allowed to cool under vacuum. The seeds are typically transferred to a glass container and stored under refrigeration before... It is washed with argon. This process improves the color of the seed oil and removes the remaining free fatty acids. volatile substances including monoacylglycerols and their oxidation products or eliminates most of the smelly compounds. Preparation for winter Preparation of oils involves the crystallization of liquid and solid oils at sub-ambient temperatures. Sometimes, commercial liquid oils are used to separate solid (stearin) and liquid (olein) fractions. It is a process used in production. Initially, it was used to produce a product that did not contain solids. It was applied to cottonseed oil. Generally, the saturated fatty acid content of oils... It is used to reduce. Transesterification Transesterification is the process of converting fatty acids from TAGs into free fatty acids. or by releasing acid esters, usually as ethyl esters of acid, It is a process that removes fatty acids both within and between TAGs. A fractionation process. When combined with the transesterification process, the fatty acid composition of lipids is 30 It can be used to modify (Marangoni et al., 1995). Transesterification, 45 It can use either chemical or enzymatic means; the latter, on the TAG, or lipases that may be site-specific for certain fatty acids or that prefer some fatty acids over others It uses (sn-1 / 3 or sn-2 specific). One or the LC-PUFA concentration. to increase it, either acid fractionation, for example cryocrystallization, urea complex formation using molecular distillation, supercritical liquid extraction and 5 with any of the known methods in the technique, such as silver ion complex formation It can be obtained. Complex formation with urea, or saturated and monounsaturated fatty acids. It is preferred because of its simplicity and effectiveness in reducing the levels of acids. This is the method (Gamez et al., 2003). Initially, the TAGs of fat were generally fatty acids. in the form of esters, they are formed by hydrolysis or lipases into their constituent fatty acids. It breaks down and these free acids or acid esters then form a complex. For its formation, urea is mixed with an ethanolic solution. Saturated and monounsaturated or Acids readily complex with urea and crystallize upon cooling, and further It can then be filtered away. The fraction mixed with the non-urea complex is thus separated. Enriched with LC-PUFA. 15 Hydrogenation The hydrogenation of fatty acids typically involves the use of hydrogen in the presence of a catalyst. It involves treatment. Non-catalytic hydrogenation only at very high temperatures. It is true. 20 Hydrogenation is commonly used in the processing of vegetable oils. Hydrogenation converts unsaturated or saturated acids into saturated or trans acids, and in some cases, trans acids. Hydrogenation transforms liquid vegetable oils into liquids like those found in margarine. This results in the conversion of fats into solid or semi-solid forms. The degree of saturation of the fat... This change causes some important physical properties, such as the melting range, to change. 25 Therefore, liquid oils become semi-solid. Solid or semi-solid oils are preferred for cooking. This is because, when mixed with flour, it adds a more desirable texture to the finished product. Partially hydrogenated vegetable oils are more nutritious than animal-derived oils. because it was cheap, because it was available in a wide variety of consistencies, and because of other desirable qualities. It has acquired properties such as increased oxidative stability / longer shelf life, 30 These are the dominant fats used as solid fats in most commercially baked goods. 46 In a particular arrangement, the lipid / fat in question is unhydrogenated. A lipid or fat... An indication that it is not hydrogenated is the absence of any trans fatty acids in its TAG. It is the absence of it. Areas of Use for Oils 5 Seed oil produced using the methods described here, preferably safflower seed oil. Lipids / fats like these have various uses. In some regulations, lipids are used in food. They are used as oils. In other arrangements, lipids are refined and used as lubricants. It is used as or for other industrial uses such as the synthesis of plastics. It can be used in the production of cosmetics, soap, fabric softener, electrical insulation, or detergents. 10 For the production of agricultural chemicals such as surfactants or emulsifiers. It can be used. In some formulations, lipids are refined to produce biodiesel. This substance can be used advantageously in paints or varnishes because... The absence of linolenic acid means that its color will not fade easily. An industrial product manufactured using a method involving the production of oil; fatty acid 15 esters, preferably such as acid methyl esters and / or acid ethyl esters. hydrocarbon product; an alkane such as methane, ethane, or a longer-chain alkane; more a mixture of long-chain alkanes; an alkene; a biofuel; carbon monoxide and / or hydrogen gas; a bioalcohol such as ethanol, propanol, or butanol; biochar or carbon It could be a combination of carbon monoxide, hydrogen, and biochar. The industrial product is 20. alkanes or a mixture of alkanes and alkenes, preferably predominantly (>50%) C4–C8 alkanes or predominantly C6–C10 alkanes or predominantly C6–C8 a mixture of any of these components, such as a mixture of alkanes It is possible. The industrial product is not carbon dioxide or water, but these molecules. It can be produced in combination with an industrial product. The industrial product is atmospheric 25 a gas at pressure / room temperature, or preferably a liquid or a solid such as biochar The process may produce carbon monoxide, hydrogen gas, alkanes, and other substances that can then be separated. Even a gas like biochar has a width, even a liquid has a width, and even a solid has a width. It can produce a combination. In one arrangement, the hydrocarbon product is predominantly either... They are methyl esters. In an alternative arrangement, the hydrocarbon product is either methyl 30 acid. It is a product other than esters. 47 Heat is generated in the process by pyrolysis, combustion, gasification, or enzymatic digestion (anaerobic). It can be applied in conjunction with processes such as digestion, composting, and fermentation. Lower... gasification at high temperatures, for example between approximately 700°C and approximately 1000°C. It is true. Gasification at higher temperatures, for example approximately 1200°C to approximately It occurs between 1600°C. Low-temperature pyrolysis (slower pyrolysis) takes approximately 5 While pyrolysis occurs at 400°C, higher temperature pyrolysis is approximately 500°C. Mesophilic digestion occurs at temperatures between approximately 20°C and approximately 40°C. Thermophilic digestion occurs between approximately 50°C and approximately 65°C. Chemical methods include, but are not limited to, catalytic methods. decomposition, anaerobic digestion, fermentation, composting, and transesterification 10 It is a chemical agent in a configuration, a catalyst that can be applied together with heat. or uses a catalyst mixture. In the process, a homogeneous catalyst or a heterogeneous catalyst can be used. and / or an enzymatic catalyst may be used. In an arrangement, the catalyst acts as a transition metal catalyst, a molecular sieve type catalyst, an activated alumina The catalyst, or sodium carbonate as a catalyst, is among the catalysts. Sulfuric acid is also used as a catalyst. acid catalysts such as acid or potassium or sodium hydroxide or other hydroxides Alkaline catalysts are found, such as those mentioned. The chemical agent targets the fatty acids in the lipid. It may involve transesterification; in this process, a homogeneous catalyst is used with a heterogeneous one. A catalyst and / or an enzymatic catalyst may be used. The conversion involves applying heat and It may involve pyrolysis that can be applied by chemical means and a transition metal 20 as a catalyst. catalyst, a molecular sieve type catalyst, an activated alumina catalyst and / or sodium carbonate can be used. Enzymatic methods include, but are not limited to, examples such as: microorganisms through anaerobic digestion, fermentation, or composting Digestion occurs either by the digestive system or through recombinant enzymatic proteins. 25 Feedstuffs / Nutrients This lipid / fat contains a very high oleic acid content and low levels of linoleic acid. saturated fatty acids (<3.2%) and palmitic acid, and essentially zero levels of linolenic acid. Due to its acid content, it has advantages in food applications. This is either a high 30 Oxidative stability reduces spoilage, making it suitable for use in foods like, for example, french fries. 48 This makes it ideal for food applications where heating is required, such as frying. It brings about the length of time an oil can be held at 110°C, for example 20 or 25. a high number of hours, preferably more than 30 hours or more than 50 hours, measured in hours It has an OSI (oxidative stability index). The health effects of saturated fatty acids... Due to its association with harmful effects, saturated fatty acids are not found in other plant-based foods. According to some, low levels of fats offer health benefits. Fats also... It has virtually zero trans fatty acid content; this is desirable in some markets. This is because trans fatty acids also have negative effects on heart health. It has also been associated with elevated LDL cholesterol. Furthermore, polyunsaturated fatty acids... Because fatty acids are at very low levels, reducing PUFA levels is necessary. It does not require hydrogenation; such hydrogenation produces trans fatty acids. They also help to reduce the incidence or severity of obesity and diabetes. This is advantageous, especially because they contain only naturally occurring fatty acids. They are also preferred for food applications (Scarth and Tang, 2006). In line with the current objectives, "feedstuffs-nutrients" provide the body with 15 Ingested for: human or animal consumption (enteral and / or parenteral consumption) (including) any food or preparation that: (1) nourishes tissues or serves to create or provide energy and / or (2) adequate nutritional status or serves to maintain, repair, or support metabolic function. Found The foods contain nutritious ingredients for infants and / or young children. 20 Find food substances / nutrients, for example, a cell of the organism, a part of the organism the plant, the plant part of the plant, the seed of the plant, an extract of the plant, belonging to the plant It contains the product of a method or a compound together with suitable carrier(s). "Carrier" The term encompasses any component, whether or not it has nutritional value. It is used in its broadest sense. As any expert in the field will appreciate, the carrier, feed 25 will not have a harmful effect on an organism consuming the substance / nutrient suitable for use in a feedstuff / nutrient (or sufficiently low in quantity) (must be used in the required concentration) The available feed material / nutrient can be obtained using the methods, cells or as described herein. It contains a lipid produced directly or indirectly using organisms. Composition 30 It can be in solid or liquid form. In addition, even if it is desired for a particular use. 49 It may contain edible macronutrients, vitamins and / or minerals in sufficient quantities. or the amounts of other components, whether the composition is normal in individuals or metabolically individuals with special needs, such as those suffering from disorders and the like. This will vary depending on the intended use. Foods contain fat if the fat is mixed with one or more other ingredients. by mixing or making a food additive such as salad dressing or mayonnaise It can be produced by mixing it with one or more other ingredients. Food or food products. The additive may contain 1%-10% or more by weight of oil. Oil is the optimal composition. to provide it with other vegetable oils or to provide semi-solid oil with solid oils or It can be blended with date oil. Foods or food additives produced from oil 10 among them salad dressing, mayonnaise, margarine, bread, cakes, biscuits (cookies), croissants, baked goods, crepes or pancake mixes, custards, Frozen desserts and non-dairy foods are included. Examples of suitable carriers that are nutrient-rich include, but are not limited to, these. Except for edible oils, it contains macronutrients such as carbohydrates and proteins. 15 It receives. Examples of such edible oils include, but are not limited to, these: coconut oil, borage oil, mushroom oil, blackcurrant oil, soybean oil and Mono- and diglycerides are included. Examples of these types of carbohydrates include: These include, but are not limited to, glucose, edible lactose, and hydrolyzed starch. In addition, Examples of proteins that can be used in the nutritional composition of food include 20 including but not limited to, soy proteins, electrodialyzed whey, electrodialyzed or untreated milk, whey, or hydrolyzates of these proteins are used. He takes it. Regarding vitamins and minerals, the available feed ingredient / nutrient... even their components include calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, 25 Iron, copper, zinc, selenium, iodine, and vitamins A, E, D, C, and B complex. These can be supplemented. Vitamins and minerals of this type can also be added. The components used in current feed formulations / nutrients are semi-finished. It may be purified or of purified origin. Semi-purified or purified, It means a material prepared by purifying a natural material.30 50 An existing feed ingredient / nutrient compound to be added to the diet. It can be added to food even when not needed. For example; margarine, modified butter, cheese, milk, yogurt, chocolate, sugar, snacks, salad dressings, cooking ingredients oils, edible oils, meats, fish, including but not limited to It can be added to any type of food and beverage. 5 In addition, lipids produced in accordance with the existing findings or the genes in question Host cells that are modified to contain and express a substance, in an animal human tissue or milk or even acid imine or egg or even acid imine or more desirable for animal consumption or animal health and welfare They can also be used as animal feed supplements, in order to improve the quality of the feed. There are 10 such products. Examples of animals include sheep, cattle, horses, poultry, dogs, and cats. Pets and similar items are included. Additionally, these feed materials / nutrients are intended for human or animal consumption. to increase fatty acid levels in fish in aquaculture Available. 15 The preferred feedstuffs / nutrients found are those of humans or other animals. Plants, seeds, and leaves that can be used directly as food or feed, These are other plant parts such as fruits and stems. For example, animals raised in the field. These types of plants can be consumed either by direct grazing or through controlled feeding. They can also be fed in moderate amounts. 20 Even signs The current discovery also includes one or more discoveries generated using the discovery's methods. This includes lipid or lipid-containing ingredient labels, especially pharmaceutical ingredient labels. A pharmaceutical compound; phosphate-buffered saline, water, ethanol, polyols, vegetable oil 25 or, a standard, good emulsion such as a wetting agent or water / oil emulsion. a known, non-toxic, pharmaceutically acceptable carrier, adjuvant or The compound may contain one or more lipids in combination with the vehicle. The compound may be a solid or It can be in liquid form. For example, a tablet, capsule, indigestible liquid, powder, or topical solution. It can be in the form of an ointment or cream. Suitable for dispersions, e.g. 30 in this case, by maintaining the required particle size and surfactants 51 It can be preserved by using isotonic solutions such as sugars, sodium chloride, and the like. It may be desirable to include other substances as well. Even alongside such inert diluents... also wetting agents, emulsifying and suspending agents, sweeteners substances, flavoring agents and perfumery agents, as well as auxiliary substances may include. 5 Suspensions contain ethoxylated isostearyl alcohols in addition to the active ingredients. polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum suspension agents such as metahydroxide, bentonite, agar-agar and tragacanth gum or these It may contain mixtures of substances. Solid dosage forms such as tablets and capsules are well-known techniques in the field. 10 It can be prepared using. For example, lipids produced in accordance with the existing findings; acacia, Binders such as corn starch or gelatin, potato starch or alginic acid decomposing agents and a lubricant such as stearic acid or magnesium stearate used in combination with other substances such as lactose, sucrose and corn starch They can be formed into tablets using traditional tablet bases. Capsules contain 15 of these excipients. by being enclosed in a gelatin capsule along with antioxidants and related lipid(s) It can be prepared. Lipids produced according to the available findings for intravenous administration, or their derivatives. Derivatives can be incorporated into commercial formulations. A typical dosage of a particular fatty acid is one to five times a day (20g per 100g per day). The amount taken is between 0.1 mg and 20 g, and preferably approximately 10 mg to approximately 1, 2, 5 or varies between 10 g per day (taken in one or more doses). In terms of technique... As is known, a minimum of approximately 300 mg / day of fatty acids is desirable. However, discretion... It will be determined that any amount of fatty acid will be beneficial to the subject. Among the possible routes of administration of the currently available pharmaceutical compounds are 25. Examples include enteral and parenteral administration. For example, a liquid preparation... This can be applied in this way. In addition, a homogeneous mixture can be completely submerged in water. Physiologically acceptable diluents and preservatives under sterile conditions, a spray or inhaler mixed with buffers or propellants It can be created. 30 52 The dosage of the compound to be administered in the trial will be determined by a person who is an expert in the field. These factors can be determined and considered in the experiment, including weight, age, general health status, medical history, and immune status. It depends on various factors such as etc. In addition, the components of the currently available product can also be used for cosmetic purposes. The ingredients are added to pre-existing cosmetic ingredients in a way that will create a mixture. An added or produced fatty acid, depending on the source, is the sole "active" ingredient in a cosmetic formula. It can even be used as a single unit. EXAMPLES Example 1. General Materials and Methods 10 Plant Materials and Growing Conditions Here, a non-transgenic aspirin (Carthamus) is indicated as CBI1582. The lineage of tinctorius is a heterogeneous mixture of some breeding materials obtained from Mexico. They were obtained by selecting from the population. Approximately 20 seeds from each breeding population. They were sown, and the resulting plants were grown in quarantine facilities for one season. 15 The seeds of the plants were preserved and either damaged or analyzed for acid profile or content determination. It was evaluated even without being given. High oleic acid, producing at least 80% oleic acid in seed oil. An acidic strain was selected. The new generation of plants from this strain are still morphologically heterogeneous. It appears that further selections are made by passing two more generations from a single seed lineage. It was done. A fourth-generation line that is phenotypically stable was identified as CBI1582. It was captured and used in subsequent genetic transformation experiments. The CBI1582 strain; Available from CSIRO, Canberra, Australia. Safflower genotypes such as CBI1582, S-317, and transformants of CBI1582, A perlite and sandy loam under a 16-hour (25°C) / 8-hour (22°C) day / night cycle. The seeds were grown from a seed in a greenhouse inside a potting mix. The plants also have the following characteristics: 25 As announced, Victoria, New South Wales, Queensland and Western Australia, It was also grown in fields in various parts of Australia. DNA and RNA, including leaves, roots, cotyledons, and hypocotyls. Plant tissues for extraction should be collected 10 days after germination, unless otherwise specified. Harvested from safflower seedlings. Flowering spikes were obtained on the first day of flowering. 30 and developing embryos 7 (early), 15 (mid) and 20 (late) days after flowering (DPA). 53 The samples were harvested at three developmental stages. The samples were immediately cooled in liquid nitrogen and DNA and RNA were stored at -80°C until extraction was performed. Lipid Analysis Rapid or complete isolation of lipid samples from single seeds for acid analysis 5 Safflower seeds are harvested when the plant is mature and then stored at 37°C for 3 days. It was dried by storage and, if not analyzed immediately, was kept at room temperature afterwards. Individual seeds or seeds in clusters were crushed between small filter papers and Seed oil samples that were absorbed by the papers and excreted were analyzed using GC as described below. The acid content was analyzed using various methods. 10 Total lipid isolation from semi-cotyledons after germination For example, screening of next-generation seeds obtained from transgenic plants. For this purpose, safflower seeds were placed in a petri dish on a wet filter paper for 1 day. germinated throughout. Lipid analysis was performed on all mature seeds as described above. 15 A cotyledon was carefully removed from each seed that sprouted. Each seedling's back... The rest were transferred to the soil and the resulting plants were grown until they matured, then The seeds were harvested to preserve the transgenic lineage. Extraction from seeds using a Soxilet apparatus 20 Safflower seeds harvested for quantitative extraction of seed oil are left overnight. It was dried in an oven at 105°C throughout and then Puck was used for 1 minute. It was ground at the mill. The ground seed material (~250 grams) was weighed beforehand. It was gathered in a thimble and weighed before being removed. A layer of cotton was placed on top of the flour. After the wool is added, it is either processed in a Soxilet Extraction apparatus with a solvent (Petrol 25 The spirit (40-60°C) was initially extracted at 70-80°C. The mixture was then added every 15-20 minutes. The solvent is siphoned into the extraction flask every minute, subjecting it to reflux overnight. It was held. The solution, the extract, the solvent was rotated under vacuum. It was recovered by evaporation using an evaporator. The weight of the extracted oil is... Measured or its content determined. Determining the fatty acid composition of the extracted oil 30 Small samples were diluted in chloroform and analyzed by gas chromatography. 54 Fractionation of Lipids If required, TAG fractions are applied to pre-coated silica gel plates (Silica using a two-phase thin-layer chromatography (TLC) system on gel 60 (Merck). It was separated from its lipid components. The equivalent value of 10 mg dry weight of plant tissue. An extracted lipid sample is used to remove non-polar waxes in the first 5 In the first phase, it was subjected to chromatography with hexane / diethyl ether (98 / 2 v / v) and then in the second phase. Chromatography was performed using hexane / diethyl ether / acetic acid (70 / 30 / 1 v / v) in the phase. He was caught. If necessary, extracted from leaves with a dry weight of 5 mg. Polar lipids in lipid samples were identified in the first direction using two-dimensional TLC (Silica gel 60, Merck) at a rate of 10°. chloroform / methanol / water (65 / 25 / 4 h / h / h) and in the second direction polarization using chloroform / methanol / NH4OH / ethylpropylamine (130 / 70 / 10 / 1 h / h / h / h) It was separated from non-lipid components. Lipid points and appropriate standards run on the same TLC plates, iodine The samples were briefly exposed to vapor, visualized, collected in vials, and packaged as shown below (15). It was transmethylated to produce FAME for GC analysis. Preparation of fatty acid methyl esters (FAME) and gas chromatography (GC) analysis. For fatty acid composition analysis by GC, the sample was prepared as described above. Extracted lipid samples were transferred to a glass tube and 2 20 in methanol (Supelco) Transmethylation was performed in 1 mL of 1 M HCl at 80°C for 3 hours. At room temperature... After cooling, 1.3 mL of 0.9% NaCl and 800 µL of hexane were added to each tube, and FAMEs were extracted into the hexane phase. Either acid or imine was determined. FAMEs, changing the temperature increase program back to the starting temperature of 150°C, 1 held for 25 minutes, at 3°C / minute plus 210°C, and then at 50°C / minute Except for being heated to 240°C and finally held for 2 minutes, essentially Zhou with a 30 m BPX70 column as described by et al. (2011) equipped with an Agilent Technologies 7890A gas chromatograph (Palo Alto, Separated by gas chromatography (GC) using Agilent (California, USA). Peak values Technologies ChemStation software (Rev B.03.01 (317), Palo Alto, California, USA) 30 Determined using the following ratios: 18:1, 18:0, 20:0 and 22:0 used for calibration. 55 The original Nu-Chek GLC contains equal ratios of 31 different fatty acid methyl esters. Peak responses were similar for either standard-411 (Nu-Chek Prep Inc, MN, USA) or acid. The percentage of each fatty acid in the samples, and the individual and total peak areas for the fatty acids. Calculations were made based on this. Analysis of the sterol content of the samples. Approximately 10 mg of oil samples and C24:0 monoyl added as an internal standard. The aliquot is placed in a glass tube with a Teflon-coated screw cap containing 4 mL of 5% in 80 MeOH. The reaction was performed using KOH and heating at 80°C for 2 hours. After the mixture was cooled, 2 mL of Milli-Q water was added and the sterols were mixed, shaken and 10 It was extracted by vortexing into 2 mL of hexane:dichloromethane (4:1 v / v). The mixture... It was centrifuged and the sterol extract was removed, then washed with 2 mL of Milli-Q water. Afterwards... After shaking and centrifugation, the sterol extract was obtained. The extract was then placed in a nitrogen gas chamber. The mixture was vaporized using the flux, and the sterols were extracted using 200 mL of BSTFA and at 80°C for 2 days. It was heated and then silylated for 15 hours. For GC / GC-MS analysis of sterols, sterol-OTMSi derivatives were heated in a heat block at 40°C. It was dried under a stream of nitrogen gas and then analyzed by GC / GC-MS. It was immediately re-dissolved in chloroform or hexane. Sterol-OTMS derivatives, Supelco Equity™-1 welded silica capillary column (15 m x 0.1 mm inner diameter, 0.1 (m film thickness), a FID, a split / non-split injector and an Agilent 20 An Agilent Technologies 7683B Series automated sampling device and injector. Gas chromatography using Technologies 6890A GC (Palo Alto, California, USA). (GC) analysis was performed. Helium was the carrier gas. Samples were placed in an oven at a temperature of 120°C. It was injected in undivided mode. After injection, the oven temperature was 10°C min–1. The temperature was increased to 270°C and finally to 300°C with 5°C min–1. Peak values, Agilent 25 Measurements were taken using Technologies ChemStation software (Palo Alto, California, USA). GC results are subject to an error of ±5% even within individual fields. GC-mass spectrometric (GC-MS) analyses were performed on a Finnigan Thermoquest GCQ. GC-MS and a Finnigan Thermo Electron Corporation GC-MS on It was realized; both systems are column-mounted injectors and Thermoquest Xcalibur 30. Each GC is equipped with the software (Austin, Texas, USA). 56 A capillary column of similar polarity was attached. Individual components were analyzed using mass spectral data. using and retention time data obtained for original and laboratory standards. It was defined by comparing it with what was obtained. A complete simultaneous analysis was performed with the sample group. Procedural blind analysis was performed. Example 2. Production and selection of GOR73226 and GOR73240 safflower varieties. Safflower plants of genotype CBI1582 have a total fatty acid content of 90% to 95%. among them seeds containing oleic acid and a genetic structure to produce seed oil. It was reversed. To do this, amino acid regulation was initiated via RNA interference (RNAi). Two genes were selected; FAD2-2 and FATB-3 safflower genes. 10 The FAD2-2 gene converts monounsaturated oleic acid into a polyunsaturated fatty acid. Acid contains a fatty acid 12-desaturase enzyme that converts linoleic acid into linoleic acid. It was one of eleven FAD2-like genes found (Cao et al., 2013). FAD2-2 The amino acid sequence of the polypeptide is given here as SEC NO:1 and FAD2-2 The nucleotide sequence of the cDNA corresponding to the mRNA transcript from the gene, SEK D NO:2 15 It is provided as such. The FATB-3 gene releases palmitic acid during fatty acid synthesis in plastids. an acyl-ACP that hydrolyzes a thioester bond in palmityl-ACP to release it. FATB-3 is one of three FATB-like genes in safflower that encode the thioesterase enzyme. The amino acid sequence of the polypeptide is given here as SEC D NO:3 and FATB-3 20 The nucleotide sequence of the cDNA corresponding to the mRNA transcript from the gene is SEC D NO:4 It is provided as such. The 756-nucleotide region of FAD2-2 cDNA and the 412-nucleotide region of FATB-3 cDNA The nucleotide region was selected to form the RNAi structure. These target regions... The nucleotide sequences here are represented as SEC NO:5 and SEC NO:6 respectively. These DNA fragments containing these sequences are found in safflower cells. When copied, a double-stranded RNA molecule corresponds to the selected target gene sequences. A hairpin RNA that produces an inverted repeat structure with a (dsRNA) region It was used to create. The inverted repeat region is from a flax conline gene. (US 7,642,346) from a seed-specific promoter and 30 from an octopine synthase gene (ocs3') is under the control of an incoming transcription terminator / polyadenylation site. 57 was placed. The target sequences (sense and antisense) in the reversed repetition, one of which is conline. According to its promoter, a gene from the Flaveria trinerva PDK gene is in sense orientation. being an intron and other introns in antisense orientation derived from a catalase-1 gene It is separated by two sequences of introns. The reversed version is Helliwell and Waterhouse. It was created using the vector system defined by (2005). 5 A DNA fragment containing a reversed repeat forms the pCW732 vector. a plant binary expression vector for pORE-CBIb (Coutu et al., 2007) The vector's T-DNA was added, along with hygromycin phosphotransferase (Hph, SEC NO:8). It contained a selectable marker gene that encoded, so that during the conversion process It allowed selection for tolerance to hygromycin in tissue culture. The hph gene, 35S promoter 10 It was expressed with. Figure 1 shows the schematic genetic map of the T-DNA region of pCW732. This shows that the T-DNA in pCW732 contains a reversed repeat sequence. The nucleotide sequence is given here as SEC NO:7. The sequence is SEC NO:7. This is stated in the explanation. PCW732 genetic structure, a grafting method in which regenerated shoots were saved 15 using the Agrobacterium-mediated method, the CBI1582 safflower strain was analyzed. It was used to transform cut cotyledons and hypocotyls from plants (Belide et al., 2011). Ten independent, validated studies growing on unconverted rootstocks. Turned shoots (hereinafter referred to as T0 plants) pCW732 It was reproduced using the vector and grown to maturity. T-DNA T020 Integration into safflower sprouts, as described by Belide et al. (2011) T- Confirmed by PCR using primers specific to the DNA vector. From mature plants. Seeds (T1 seeds) were collected and analyzed for increased oleic acid in the seed oil. At least six of the transformants were found to have a lower total fatty acid content than the seed oil. a quantity of seeds containing between 90% and 95% oleic acid by weight, and also 25 It yielded segregans with the same oleic acid content as CBI1582 and some intermediate phenotypes. Other transformants such as pCW722-82 did not produce seeds containing at least 90% oleic acid. Instead, the oleic acid content was approximately 80%. Over eight new generations, various methods are used to select the two best lineages from the Transformers. The following criteria were used; these were GOR73226 and GOR73240 30 as optimal transgenic strains. This resulted in the selection of new generation plants from their lineages. The most important criterion was the parent. 58 When compared with CBI1582, its fatty acid composition, i.e., >90% by weight, was found. In addition to oleic acid levels, reduced palmitic acid levels (<4.0%) and large The linoleic acid (LA) level was significantly reduced (<3.75%). Other criteria used were: field trials, seed content, having single T-DNA insertions, agricultural performance and other features as explained in the examples below 5 The key is the stability of the acidic property over generations. To achieve this, a single T- Transgenic that is homozygous for DNA insertion and has a high oleic acid content. T2 seeds were selected from the plants and multiplied to produce T3 seeds. These were analyzed without causing further damage, and the process was repeated. T4 seeds, OGTR In 2014, under regulatory approval, 10 near Kununurra in Western Australia The crops were sown in the field and T4 plants were evaluated in terms of agricultural performance. T5 The seeds were planted near Narrabri, NSW in 2015, and the resulting plants This process was evaluated. This process continued with multi-region field trials up to the T9 generation, followed by the next generation. It was repeated through generations. Example 3. Molecular characterization of transgenic strains. Determination of T-DNA copy number The number of T-DNA insertions into the safflower genome for each transformed lineage and In order to analyze the insertion points, including GOR73226 and GOR73240 Ten T4 generation plants from each of the crossbred strains were grown in a greenhouse and 20 DNA was extracted from the combined plant material. The extracted DNA... Restriction enzymes are purified in cesium chloride gradients, in this case separately. Kpnben and PacBen were used to make it digestible. Belide et al. (2011) Southern blot hybridization analysis was performed following the protocol. In each case, 1 mg DNA is soaked overnight with Kpnben or PacI (NEB, USA) for 25 minutes, according to the supplier's instructions. digested. Each of KpnI and PacI is inside the T-DNA fragment, but hygromycin The phosphotransferase performs digestion in a region outside the gene region (Figure 3). The digested DNA, along with the control DNA, was electrophoresised on an agarose gel. It was subjected to and blotted on a membrane using standard methods. A radio-labeled For probe preparation, PCR primers were used to target all 30% of the Hph gene from pCW732. It was used for amplification of the coding region. This amplicon is a contaminant. 59 To create a clean template for the probe, free from the vector backbone array. It was used as a template for the next round of PCR. The probe was randomly primed. Using integration, the radio was tagged and, as previously described, 32P-NTP. They radiolabeled ribonucleotides (Belide et al., 2011). Gel electrophoresis and a Following membrane blotting, 5 targets for the hygromycin phosphotransferase gene were found. The radio-labeled probe hybridized to the membrane under tight conditions, and the membrane was tightly fitted. It was washed under the conditions. A photograph of the Southern blot is shown in Figure 4. Pacben and KpnI Transformants GOR73226 (732-26) and GOR73240 (732-40) for each of the enzymes Only one hybridization band was observed for this, whereas of the other 10 transgenics analyzed. Some of the plants gave two, three or up to six hybridization bands. GOR73226 and Each of the GOR73240 plants has only one T-DNA insertion into the genome. It was concluded that this was the case. In contrast, independent transgenic strains 21, 33 and 48, this Consistent with the insertion of multiple T-DNAs into each of the transformants. It produced a band. The probe was obtained from 15 unrotated safflower plants as a negative control. hybridization with the obtained DNA. Insertion sites and neighboring sequences for T-DNAs at GOR73226 and GOR73240. The insertion site for each of the GOR73226 and GOR72640 transgenic strains. To identify and isolate linkage sequences, T-DNA 20 in the safflower genome was analyzed. Genomic DNA was used to map the precise location of the insertion sites. T- To clone and identify adjacent sequences outside the left and right DNA boundaries. A Universal GenomeWalker™ 2.0 kit (Clontech) along with the supplier's protocol. was used (Figure 2). In the protocol, plant genomic DNA was processed with a restriction enzyme. digestion and subsequent adapter ligation and PCR-based 25 for cloning the coherent sequences. Amplification was used. For each primer / adapter pair, the oligonucleotide primer was T- The DNA was inserted just inside the Left Border or Right Border sequence, so that the T- Sequences adjacent to DNA are called aspirated genomic sequences, adjacent to T-DNA splice sites. was amplified. DNA for left border cloning was digested with DraI. Right border DNA for cloning was digested with EkoRV. 30 60 Amplicons derived from genome execution analysis were cloned, and these were... Nucleotide sequences were determined using standard techniques. T- from pCW732 Since the nucleotide sequence of DNA is known, the linking sequence and therefore the neighboring sequences can be determined. It was easily identified. GOR73226 DNA and for the region adjacent to the Left Border. Using a primer / adapter pair, only one amplicon of approximately 1000 bp in length can be generated. cloned and sequenced (Figure 5). Primer / adapter regions for the Sa border region. The analysis used produced only one amplicon, approximately 1400 bp in length. Sol And the safflower sequences surrounding the Sa Border were identified from the sequences of the connecting trailers. With approximately 200,000 fragments / contig, it comprises about 80% of the safflower genome. When aligned with the wild-type safflower draft genome sequence (Bowers et al., 2016), 10 For GOR73226, the sequences adjacent to the left and right borders are the only DNA contigs in the draft genome. with e le ti. The T-DNA in GOR73226 is provided as SEC D NO: 11 in this contige. It has been concluded that the sequence was added to a region of contiguous land. GOR73226 The combination of sequencing its amplicons and aligning them to the VAH-i type safflower genome, During the insertion of T-DNA, 155 base pairs of genomic DNA are involved in the splicing region. It was deleted, but it was found. Furthermore, the analysis revealed that the entire Left Border sequence was added to the genome. However, it revealed that only 41 bp of the 162 bp Sa Boundary sequence had been added. This Species rearrangements are often observed during the integration of a T-DNA. Nucleotide linking fragments for GOR73226, containing the right and left boundary sequences. The sequences are provided as SEK D NO:10 and SEK D NO:12 respectively. GOR73226 to 20 The nucleotide sequences of the integrated Sa and Sol borders are SEC D NO:9 and SEC D, respectively. It is provided as NO:13. GOR73226 The nucleotide sequence of a portion of the right-hand boundary link, Sequence Number D:14 and for the GOR73226 Left border connection, Sequence Number D:15 These sequences are similar to GOR73226 in that they have insertions elsewhere in the genome. It easily distinguishes them from transgenic lineages. Approximately 1.25 in the upstream and downstream directions of T-DNA. nucleotide containing T-DNA splice, which includes the kb-sized genomic sequence of the aspirin. The series is provided as SEK D NO:33. Based on this analysis, a map of the addition of pCW732 to GOR73226. was created (Figure 7). Similarly, 30 obtained from genome interrogation analysis for GOR73240. Amplicons were cloned and their nucleotide sequences were obtained from T4 and T7 generation plants. 61 It was determined using DNA. The linking sequences in the safflower genome and therefore... The neighboring sequences were easily identified. For the GOR73240 DNA and the region adjacent to the Left Border. Using a primer / adapter pair, only one amplicon of approximately 1000 bp in length can be generated. cloned and sequenced (Figure 5). Primer / adapter regions for the Sa border region. The analysis used produced only one amplicon, approximately 6000 bp in length. Sol 5 And the safflower sequences surrounding the Sa Border were identified from the sequences of the connecting trailers. When aligned with the wild-type aspirin draft genome sequence, the Left and Right sides for GOR73240 were identified. The sequences surrounding the boundaries are interconnected with a single DNA sequence in the blueprint genome. GOR73226 As was the case for, the T-DNA in GOR73240 corresponds to the sequence provided as SEC D NO: 18. It has been concluded that the possessor has been added to a region of contig. GOR73240 10 The combination of sequencing its amplicons and aligning them to the VAH-i type safflower genome, During T-DNA insertion, the insertion of T-DNA occurs within 34 genomic regions. The analysis found that it produced a 35 bp deletion and a 35 bp duplication (Figure 6). Furthermore, the analysis... This revealed that both the Left Border (13 bp) and Right Border (39 bp) sequences were cut. Nucleotide 15 of the linking fragments for GOR73240, which includes the right and left boundary sequences. The sequences are listed as SEK D NO:17 and SEK D NO:19, respectively. To GOR73240 The nucleotide sequences of the integrated Sa and Sol boundary sequences are SEC D NO:16 and respectively. It is provided as SEK D NO:20. GOR73240 Part of the border connection. The nucleotide sequence is given as SEK D NO:21 and GOR73240 for the left border linkage. It is provided as NO:22. These sequences include GOR73240 with insertions elsewhere in the genome. It easily distinguishes it from other transgenic lineages. The upward and downward directions of the T-DNA... This involves inserting a T-DNA sequence containing approximately 1 kb of the neighboring aspir genomic sequence. The nucleotide sequence is provided as SEC NO:34. Based on this analysis, a map of the addition of pCW732 to GOR73240. was created (Figure 8). 25 Results of PCR-based genome sequencing Overall, these results indicate that both GOR73226 and GOR73240 are present in the genome. a single copy of T-DNA without any partial or complete T-DNA component It was concluded that the addition included Left Border and Right Border sequence analyses, T7 generation 30 When DNA from plants was used, the same results were obtained as with T4 generation plants. 62 It was found that GOR73226 and GOR73240 have stable heritability in the safflower nuclear genome. It was concluded that it had additions. Absence of vector backbone sequences in GOR73226 and GOR73240 Five pairs of PCR primers (Table 1), bacterial origin regions of replication and 5 T-DNA, including the bacterial antibiotic selection marker encoding NptII. It was designed along the regions of the pCW732 transformation vector in the outside. Isolated from T6 generation plants grown in the field under regulatory approval. DNA was used in PCR reactions with primer pairs using standard techniques. PCR reaction products were subjected to electrophoresis on 1% agarose gels. 10 Non-transgenic safflower was used as a negative control for DNA obtained from S-317. was used and obtained from the binary vector pCW732, diluted to the appropriate concentration and Plasmid DNA inserted into control DNA was used as a positive control. GOR73226 And amplicon of the expected size was not detected in GOR73240 DNA. In addition All control reactions detected the presence or absence of target fragments as expected. 15 It showed that during the transformation process, plants GOR73226 and GOR73240... The conclusion was that no vector backbone sequence was integrated into their genomes. It has been reached. Table 1. PCR primers for identifying the T-DNA vector backbone sequence. Primary Sequence (5' to 3') SEC D NO P1FW GTCGGCAAATCGTCAGACTT 23 P1RV GTGGAGTCAGGCTTGATCGT 24 P2FW TGTTCCCGGATCGAAGTAAG 25 P2RV ACATCCTTGGCGTCTCAACT 26 P3FW AATGTTCGAATGCCCTTCTC 27 P3RV AGGGCGACCTCTTTTTGG 28 P4FW GACAAGTGGTATGACATTGC 29 P4RV CTAAAACAATTCATCCAG 30 P5FW AGATCCTCTTCCGCTTCCTC 31 P5RV TACCGGGTTGGACTCAAGAC 32 63 Example 4. Evaluation of the GOR73226 and GOR73240 or compound phenotype. Fatty acid analysis of F2 Next Generation obtained from transgenic plants and hybrids. Transgenic safflower seeds, T2 and later generations, and various F2 seed populations obtained from hybrids were analyzed in terms of acid composition. This was done. To do this, safflower seeds were used, making it easy to remove the seed coat. 5 To achieve this, it was soaked overnight at room temperature onto a wet filter paper. From each impregnated seed, the tip of a cotyledon approximately 5 mm long was cut and removed, or conversion of acids to methyl esters (FAME) and measurement by GC By means of or even acid, a sample was taken for analysis. To preserve the seed, each The remaining part of one seed was sown in soil in pots, and the resulting plants were grown in a greenhouse for 10 days. She was raised until she was a mother. FAME is, primarily as described by Zhou et al. (2013), It was prepared with minor modifications as shown below. Methylation: 800 µL 1N methanolic-HCl Extended to 4 hours using (Supelco, Bellefonte, USA). FID and GC analysis also described. It was implemented as planned (Zhou et al., 2013), but the phased program was 15 It was changed to an initial temperature of 150°C and held at this temperature for 1 minute. Then the temperature was increased to 180°C at a rate of 10°C / minute, and to 240°C at a rate of 50°C / minute. It was heated and held for 4 minutes. For calibration, GLC standard 411 (Nuchek, Elysain, (USA) was used. Fatty acid analyses are also submitted to the National Association of Testing Authorities (NATA) 20 NSW Primary Industries Testing Laboratory, a registered commercial testing laboratory. technical procedures approved by, in accordance with industry standards and This was accomplished using various methods. T7 was obtained from 5 independent field trials conducted in 2016. Acid compound analysis of GOR73226 and GOR73240 seeds of generation 25 The results are presented in Table 2. Values ​​are ± standard error. Same letter combination There is no significant difference between the means (>0.01). GOR73226 and GOR73240 consistently contains between 90% and 95% oleic acid, less than 4% palmitic acid, and less than 2.75% It was observed that seed oil containing less linoleic acid was produced. Conversely, CBI1582 parent The strains contained approximately 76% oleic acid and approximately 15% linoleic acid. 30 strains None of them contained α-linolenic acid (ALA). It was assumed that the standard errors were very low. 64 Therefore, even the acid mark, from the T2 generation of seeds to at least the T7 generation. It was quite stable. Essentially the same results were obtained from geographically different environments. This was also observed in other field trials. These data indicate that the seeds contain 91-93% oleic acid. To achieve this, RNAi is used to activate the genes CtFAD2-2 and CtFATB-3. This demonstrates the stability of the regulation. 5 Table 2. Fatty acid profile of GOR73226 and GOR73240 seed oils by parent lineage. Comparison with CBI1582. Fatty acid(s) GOR73226 GOR73240 CBI1582 Palmitic acid C16:0 3.46±0.13a 3.53±0.24a 6.27±0.12b Palmitoleic C16:1 0.07±0.04a 0.12±0.07a 0.03±0.01a Stearic acid C18:0 1.33±0.12a 1.64±0.12ab 1.76±0.09a Oleic acid C18:1 9 92.50±0.28a 91.82±0.49a 75.91±0.59b Linoleic acid C18:2 9.12 2.52±0.22a 2.65±0.28a 15.73±0.58b Linolenic acid C18:3 9,12,15 0.0a 0.0a 0.0a Aracidic acid C2O: 0.14±0.03a 0.20±0.04a 0.23±0.03a Crossing GOR73226 with high oleic type non-transgenic safflower 10 A separate GOR73226 plant of the T4 generation has high (approximately 75%) oleic acid content. next to a non-transgenic plant of the S-317 genotype in a greenhouse They were grown. During flowering, two plants were hand-crossed and self-propagated. To prevent pollination, all unused flower clusters were removed. This procedure... 6 F1 seeds were produced. The F1 seeds were planted and the resulting F1 plants matured in 15 days. They were grown. The F1 plants were allowed to self-pollinate, resulting in 119 F2 plants. A seed population was formed. Each of the 119 seeds was analyzed in terms of its fatty acid profile. The samples were analyzed. Levels of oleic acid were over 90% by weight and palmitic acid was below 4%. The number of F2 seeds containing high oleic acid levels was also evaluated. A separation ratio of 3:1 was sought for the characteristic. Of the 119 F2 seeds produced by hybridization, 20 37 seeds had palmitic acid levels above 4%. Of these, 36 had oleic acid. The level was below 90%. These seeds were separators that lacked T-DNA. It was thought that the chi-square goodness-of-fit tests were based on an estimated 3:1 separation ratio. 65 It showed that there was no significant deviation. (palmitic acid greater than 4% X2[1,N=119] = 2.36, P=0.153, P<0.01; oleic acid levels less than 90% X2[1,N=119] = 1.75, P=0.224, (P<0.01). Based on this analysis, the insertion of T-DNA into GOR73226 is a dominant factor. The genetic locus was stably inherited in accordance with Mendelian inheritance. And they split at a 3:1 ratio. 5 Crossing of GOR73240 with high oleic type non-transgenic safflower Similarly, a separate plant of the T4 generation GOR73240 has high oleic acid content. next to a non-transgenic plant of the Montola 2003 variety with genotype It was grown in a greenhouse. Two plants were hand-crossed and 10 to prevent self-pollination. All unused flower clusters were discarded. F1 seeds were sown and F1 plants were grown. They were grown to maturity and a population of 59 F2 seeds was produced. Of the 59 seeds... Each of them was analyzed in terms of its acid profile. Of the 59 F2 seeds, 14 were palmitic. Acid levels were above 4% and oleic acid levels were 90% or less; this indicates It represents separate groups lacking T-DNA. Chi-square goodness-of-fit tests predict 15 The study showed no significant deviation from the 3:1 separation ratio (palmitic acid less than 4%). large X2[1,N=59] = 0.05, P=0.822, P<0.01; oleic acid levels less than 90% X2[1,N=59] = 0.277, P= 0.599, P<0.01). Based on this analysis, T-DNA's The addition to GOR73226 indicates that a dominant genetic locus is consistent with Mendelian inheritance. It was stably inherited and separated in a 3:1 ratio. 20 Crossing of GOR73240 with non-transgenic high linoleic type safflower Additionally, a separate plant of the T4 generation GOR73240 has high linoleic acid content (>70%). It was grown in a greenhouse alongside a non-transgenic plant with its phenotype, and The plants were crossbred. F1 seeds were sown, and the resulting F1 plants produced 126 F2 seeds, 25 of which were derived from the F1 seeds. They were grown to maturity by self-pollination to produce a population. Each of the 126 seeds was analyzed for its acid profile. Over 90% had oleic acid. number of F2 seeds with acid levels and linoleic acid above 70% The number of seeds with these levels was also evaluated according to a 3:1 separation ratio. Linoleic As expected from the cross between the oleic type and the high oleic type, linoleic acid levels were 30 It showed a negative correlation with oleic acid (Figure 9). Of 126 F2 seeds, 27 were... 66 The oleic acid level was over 90%. These plants contained functional T-DNA. That is, it had super-high oleic acid levels. Chi-square goodness-of-fit tests, predictive data. The results showed no significant deviation from the 3:1 split ratio (greater than 90%). Oleic acid X2[1,N=126] = 0.68, P=0.4096, p<0.01). 24 seeds out of 126 F2 seeds Linoleic acid levels were above 70%. These seeds did not contain T-DNA and had high 5% acid content. It resembled the parental lineage with linoleic acid. Chi-square goodness-of-fit tests predicted... It showed no significant deviation from the 3:1 separation ratio (linoleic greater than 70%). acid X2[1,N=126] = 2.08, P=0.1492, p<0.01). Based on this analysis, T-DNA's The addition to GOR73226 indicates that a dominant genetic locus is consistent with Mendelian inheritance. It was stably inherited and separated in a 3:1 ratio. 10 Example 5. Lipid analysis at facilities GOR73226 and GOR73240. Profile of membrane-associated lipid species at different plant growth stages. removal Total lipids were measured in 15 two-week-old safflower plants of different varieties or strains. extracted from freeze-dried cotyledons, hypocotyls, roots and true leaves The varieties and strains were: GOR73226 and GOR73240 (SHO), high oleic. Non-transgenic strains S-317 (HO1) and Lesaf496 (HO2), EMS mutagenesis (ems / S901) developed with high oleic non-transgenic aspirin that reduces yield. The variety was (US 5,912,416) and the wild type, low oleic acid safflower variety was Centennial (LO). Every 20 Freeze-dried leaf tissue from plants of the same species or lineage, at a rate of 20 per second. metallic for 3 minutes using a Reicht tissue disruptor (Qiagen) at a certain frequency It was powdered in a microcentrifuge tube containing a ball. Chloroform:methanol (2:1, (h / h) was added and tissue disintegrator was used before the addition of 0.1 M KCl in a 1:3 (h / h) ratio. The mixture was stirred with the powder for another 3 minutes. The sample was then centrifuged for another 3 minutes before being mixed again. The mixture was stirred (at 14,000 g for 5 minutes), then the lower lipid phase was collected. The remaining aqueous phase The cell debris was washed once with chloroform, centrifuged, and the substrate removed. and combined with the previous extract. The lipid phase solvent was then treated with a stream of nitrogen gas. It was completely steamed using and the extracted lipid was 20 mg extracted. The lipid base was resuspended using 1 ml of chloroform. 30 67 Lipiomic analysis via LC-MS Lipid extracts were diluted in 1:100 mL butanol:methanol (1:1, v / v) and Liquid chromatography-mass spectrometry based on previously described methods. Analyzed using (LC-MS) (Reynolds et al., 2015). Briefly, Jet Stream Agilent 1290 series LC and 6490 triple quadrupole LC-MS were used with ionization. 5 Phosphatidylcholine (PC) and lysophosphatidylcholine (LPC) species are treated with 20 mM ammonium acetate. An Agilent 120 HILIC with a gradient from 95% acetonitrile to 75% acetonitrile. The PC and LPC hydrogen addition products were separated on the column (2.1 x 100 mm, 2.7 µm). In positive ionization mode, with the characteristic 184 m / z phosphatidyl Ba group ion. Monogalactosdiacylglycerol (MGDG), digalactosdiacylglycerol (DGDG), 10 were measured. Ammonium addition products of diacylglycerol (DAG) and TAG lipid species, singly or Acids were analyzed by neutral loss from C16 to C20. Multiple reaction monitoring (MRM) The lists are based on the following main fatty acids: 16:0, 16:3, 18:0, 18:1, 18:2, 18:3, A 28 V impact energy was used. Lipids were injected into an Agilent Poroshell column (50 mm). 15 using a binary gradient with a flow rate of 0.2 mL / min (x 2.1 mm, 2.7 µm). They were separated chromatographically. The mobile phases were: A. H2O:acetonitrile:isopropanol (5:45:50, v / v)10 mM ammonium formate; B. H2O:acetonitrile: 10 mM ammonium formate in isopropanol (5:20:75, v / v). Individual MRM TAG refers to the ammoniacal precursor ion and the product ion resulting from neutral loss. The results were determined based on the Agilent Mass Hunter Quantitative software. It was integrated using [method name] and transferred to R for statistical and graphical analysis. LC-MS method with high oleic and low oleic safflower varieties When compared, the seed and non-seed cells in GOR73226 and GOR73240 plants It provided a comprehensive analysis of lipids in tissues using plants LO, HO1, and HO2. When compared, diacylglycerol (DAG) was found in the roots and true leaves, 25 such as digalactosildiacylglyerkol (DGDG) and monogalactosildiacylglyerkol (MGDG) The predominant lipid types are highly polyunsaturated fatty acids, each unique to these plant tissues. Even in terms of displaying the mark, it was the same in GOR73226 and GOR73240. In contrast... ems / S901 plants have a distinct monounsaturated content compared to polyunsaturated fatty acids. It included a plus. These results were obtained using 30 in the production of GOR73226 and GOR73240. The RNAi transgene, encoded by the T-DNA of pCW732, is found in extra-seminal tissues. 68 it had no effect and the resulting seed, such as the cotyledons and hypocotyls, and It showed that it was limited to developmentally derived organs. Example 6. RNA analysis of FAD2 and FATB genes in transgenic plants. In plants GOR73226 and GOR73240, the amino acids of the CtFATB and CtFAD2.2 genes are 5. regulation GOR73226 is used to analyze RNA expression in transgenic plants. GOR73240 and non-transgenic control plants in a greenhouse until flowering. They were grown. Flowers were manually pruned to regulate the timing of seed development. The embryos were dusted, and 15 days after dusting, total RNA was measured from the developing embryos at 10°C. A sample was taken. Total RNA was extracted from developing safflower seeds. Gene For RT-PCR analysis of expression, precipitated RNA was extracted using chloroform. Apart from the repetition and overnight precipitation of RNA at -20°C, the supplier's Small RNAs were extracted using Plant RNAeasy columns (Qiagen) according to the instructions. It was further purified to remove contaminant DNA. RQ1 15 to remove contaminant DNA. DNAse (Promega) was used. cDNA synthesis was performed using an oligo dT according to the manufacturer's protocol. Superscript III reverse transcriptase (Life Technologies, Invitrogen) with primer (Invitrogen) This was accomplished using three separate cDNA synthesis reactions for each RNA sample. Real-time quantitative (qRT)-PCR was performed as described. (Allen et al., 2007). Data analysis, Least Significant Difference (LSD) test (p<0.05) 20 SPSS was used, taking into account the significance of the differences between the tested means. This was done using statistics (version 23). By using these methods to prepare RNA samples, non-transgenic The high oleic safflower variety was found in plants GOR73226 and GOR73240 according to S-317. To measure the abundance of RNA expressed from the CtFAD2-2 and CtFATB-3 genes, 25 Quantitative PCR was used. Expression levels of CtFATB-3 and CtFAD2-2 were measured using safflower S-. Compared to 317, it decreased significantly in GOR73226 and GOR73240 (p<0.05) (Figure 10). For CtFATB-3, GOR73226 and GOR73240 differ from each other and from S- It was significantly different from 317 (P<0.01). Significantly different for CtFAD2-2 expression. They were different provinces (P>0.05) and both were significantly reduced compared to S-317. 30 69 Small RNA Analysis Total RNA isolated from plants, Illumina TruSeq small RNA Sample Preparation Kit and Illumina-based 100 bpm single-read technologies (John Curtin Medical) The data was subjected to deep sequencing using the Research School, Canberra, Australia. The sRNA sequence database was generated using adapter 5 with Trimmimatic (Bolger et al. 2015). It was trimmed from arrays and processed using ShortStack (Axtell 2013) with CtFAD2.2 and CtFATB. By realigning back to template sequences, a single mismatch was allowed. Minimum unique Locations with a reading coverage of 5 were reported. Extracted from GOR73226 and GOR73240, typically 21-24 nt in size. Populations of small RNA molecules within the range were sequenced, and the draft safflower genome 10 was created. They were mapped according to their sequence. The only places where these small RNA populations were mapped are, These were the transcribed regions of the CtFAD2-2 and CtFATB-3 genes. Specifically, the small ones. The RNA alignment regions are mostly in the hairpin RNA gene at pCW732. It was limited to the gene regions used in its design (SEK ID NO: 5 and 6). Aspir A more detailed examination of the gene, of small RNAs aligned anywhere in the genome, 15 Here, within an open reading framework (ORF), there are over 10 hits. It did not find any significant hits as identified. Lipidomic and RNA analyses revealed that the developing safflower plants... In their seeds, the amino acids of the CtFAD2-2 and CtFATB-3 genes were specifically regulated and This includes 20 derived from hairpin RNA mapped to the CtFATB-3 and CtFAD2-2 genes. It has been concluded that this is mediated by small RNA molecules. This gene This was consistent with the RNAi-mediated reduction mechanism in expression. Outside the seed There was no amino acid regulation in the genes of the plant tissues. Example 7. Hph gene expression in plants GOR73226 and GOR73240 25 To test Hph gene expression in transgenic plants, the T8 generation was used. from GOR73240 and GOR73226 plants grown in the field and non-transgenic Seeds obtained from parent strain CBI1582 were sown in pots with soil at a diameter of 2 cm. The actual leaf samples were harvested after 3 weeks of growth. Belide and Western blot 30 on protein extracts as described by others (2011) The analysis was carried out. Briefly, the leaf material was powdered in liquid nitrogen. 300 70 Approximately 5 mg of powder was added to µL of standard Laemmli Tampon, and incubated at 95°C for 5 minutes. It was heated, cooled to room temperature, and centrifuged at 10,000 rpm for 5 minutes. Each 20 µL of supernatant with a 4-12% polyacrylamide gradient (Life Technologies) The proteins were applied to a denaturing SDS gel. The proteins were then standardized for sizing. 5 using a BenchMark protein ladder for 40 minutes at 200 mA electrophoresis was performed. The proteins obtained from the gels were transferred to a prepared PVDF membrane. Blotted onto and upregulated to Hph protein in a primary mouse monoclonal antibody (HYHmb; mybioSource.com product MBS857772; 1:2000 dilution) and secondary Probing was performed using an antibody (anti-mouse HRP; 1:5000). Positive against Hph. Controls (plants F11576 and F11772) were included in all membranes. F11772, 10 It was an F1 hybrid plant between GOR73240 and non-transgenic safflower, and all alleles were present. It was expected to be hemizygous. F11576 contains approximately 5 copies of T-DNA, pCW732 (Event 33) is another safflower plant that has been modified. Western blot analysis of GOR73226 and GOR73240 showed a correlation with Hph protein. The resulting sample revealed a single polypeptide band of approximately 40 kD that binds the antibody. 15 There is no evidence of multiple protein products in non-transgenic safflower CBI1582. There was no Hph protein detected. Protein expression profiles were mainly The same was true for plants GOR73226 and GOR73240. HPH protein binds to the 4-hydroxyl group of the antibiotic Hygromycin B. It deactivates it by catalyzing its phosphorylation. This is the human clinical 20 It is highly specific for a limited number of antibiotics that are not used in applications, and It has no effect on aminocyclitol or aminoglycoside antibiotics. Animal Studies show that the protein has no acute toxicity, and database analysis reveals no known toxicity. It shows no similarity to proteins or allergens. Proteins in plants It is not glycosylated and the protein is rapidly broken down in gastric fluid. 25 Example 8 - Summary Agricultural Assessment of GOR73226 and GOR73240 Field trials For phenotypic and agronomic evaluation and molecular characterization purposes. and to collect seed and plant tissue samples for analysis, field 30 Experiments were conducted (Table 3). Plants GOR73226, GOR73240 and their parent lineage 71 CBI1582 and conventional non-rotating safflower plants, Gene Technology Regulator Various cultivation in Australia under a license issued by its office. They were raised in these regions. The agricultural practices and pest control measures used were location-specific and This was typical for all aspects of safflower cultivation, including soil preparation, fertilizer application, 5 It included irrigation and pesticide application. Field trials were randomized full-block. (RCB) design is established. Trials at each facility are for testing, control and reference. It included the following varieties. In 2015, GOR73226 and GOR73240 seeds were from the T4 generation. In 2016, it was from the T5 generation. Each block (copy) represents one parcel of each treatment. It contained. The experimental unit was a plot. All plots in each block were 10 plots in a random order of operations. They were independently randomized to receive four replicates in each region. There were. In each copy, each safflower seed was planted in randomly arranged plots. Although some of the experiments were conducted in the same state, they were not in the same place. It has not been planted. Due to crop rotation practices, the plots are in different fields or The farm was located in different parts of the area. The environment, field history, soil type, and pest presence were all factors. Field conditions, such as drainage, can vary from year to year. Evaluation Methods The characteristics of GOR73226 and GOR73240 (Table 4) are with parent lineage CBI1582. The data were compared. Data analysis was performed using the Least Significant Difference (LSD) test (p<0.01). SPSS statistics are used, taking into account the significance of the differences between the obtained averages. This was done using (version 23). Levene was used to verify the homogeneity of variances. The test (p>0.05) was performed, and the data were normalized and variances calculated as needed. Data transformation was performed to obtain homogeneity. Summary of Rearing Conditions Field trials were conducted in New South Wales and Victoria over two growing seasons. This was realized. Growing conditions in each state and each year have changed significantly. It was different. A summary of growing season conditions, Australian Agriculture and Resources. Crop 30 of 2015 and 2016 published by the Bureau of Economics and Sciences Their reports are summarized as follows: 72 The crop growing season in Victoria was chaotic in 2015. In Victoria The safflower regions found had a poor start with below-average rainfall and the main Seasonal conditions were unfavorable in the planting regions. Especially in August, winter conditions prevailed. Water levels are significantly below average and soil moisture levels are below average. It was quite low. It was enough for the crops to continue developing, but 5 Yield expectations have decreased. In Victoria, this is especially true in September and October. It was below average, and unusually high for early October. Daytime temperatures also had an impact. To what extent the yield potential of individual crops... It was negatively affected, affecting the crop's development stage and the crop's growth in the spring. It depended on regional differences in the situation. Adverse weather conditions also affected the crop. This negatively impacted its quality. Overall, safflower regions in Victoria were under stress. Table 3. Field trial areas used for agricultural evaluation. Attempt Region Number Location Tria design October Date Blooming Date* Harvest Date DIR131 Region 1 (KA15-838) West Wimmera (Canvas), Victoria 0.233 hectare; RCB, 4 copy 10.07.2015 30.10.2015 12.01.2016 DIR131 Region 2 (KA15-837) Horsham (Kalkee), Victoria 0.233 hectare; RCB, 4 copy 10.07.2015 30.10.2015 12.01.2016 DIR131 Region 3 (KA15-834) Narrabri (Bellata), NSW 0.35 hectares; RCB, 4 copy 21.07.2015 30.10.2015 02.01.2016 DIR131 Region 4 (KA15-833) Narrabri, NSW 0.37 hectares; RCB, 4 copy 21.07.2015 03.11.2015 08.12.2015 DIR131 Horsham 0.10ha; 28.06.2016 14.12.2016 14.02.2017 73 Region 8 (KA16- 0947) (Kalkee), Victoria RCB, 4 copy DIR131 Region 9 (KA16- 0948) West Wimmera (Canvas), Victoria 0.10 hectares; RCB, 4 copy 28.06.2016 10.12.2016 16.02.2017 DIR131 Region 10 (KA16- 0937) Narrabri (Bellata), NSW 0.25 hectares; RCB, 4 copy 04.07.2016 08.11.2016 21.12.2016 DIR131 Region 12 (KA16- 0936) Narrabri, NSW 0.75 hectares; RCB, 4 copy 28.07.2016 22.11.2016 05.01.2017 DIR131 Region 13 (KA16-0938 Narrabri (Wee Wa), NSW 0.40 hectares; RCB, 4 copy 29.07.2016 14.11.2016 04.01.2017 * Flowering date is the date of the first flower, in accordance with DIR131 reporting purposes. expresses Table 4. Agricultural characteristics were also evaluated. Evaluation Type Scale Method Viability 0% = No viability, 9% = Most viable plot The height was measured in cm, and the average was taken from the height of 10 plants. Number of days until 50% flowering Disease incidence was assessed in 0-9 to 10 leaves, and the number of diseased leaves was recorded. counted Insect stylets were evaluated in terms of insect damage to 0-9-10 leaves, and counted Lodging 0-9 The crop was evaluated in terms of lodging; where 9=crop. 74 no lying down and 0=completely flat Crop shedding was evaluated in terms of 0-9 crop shedding; where 9=crop. no crop loss and 0=100% crop loss and seeds falling to the ground Yield T / ha Yield is measured with a small field combine harvester and is in T / ha It has been estimated based on this principle. This snowfall was mild, with NSW regions experiencing average to above-average temperatures in 2015. It took a while. Seasonal conditions in September and October in the planting areas of NSW. Overall, it was warmer and drier than average. Towards the end of October and in November... Heavy rains for much of the month reduce the moisture content of the topsoil to 5%. They improved their levels. Overall, conditions in NSW were more favorable than in Victoria. In 2016, seasonal conditions in Victoria's main farming regions, Spring was quite favorable for crop development. Spring rains were above average. It was above average, which increased soil moisture levels and temperatures were above average. It was below. Seasonal conditions were very favorable from spring to harvest. However, the water level was 10 The precipitation and lodging (of fallen crops) negatively affected crops in some regions. Many planting areas in NSW have above-average yields, compared to most areas of the state. After a previous winter, September 2016 saw above-average rainfall. Winter and early Spring rains increased soil moisture levels, leading to record-high rainfall in many regions. This resulted in high yields. However, in some regions, particularly in the central and southern 15 Above-average rainfall in NSW has caused flooding and submerged crops. This caused it to remain unchanged. Seasonal conditions in November and December were not suitable; Below-average rainfall and above-average temperatures in the upper layer By depleting soil moisture, it led to a hot end for safflower trials. Evaluation of seedling viability. Seedling viability, rapid and uniform seedling emergence, and crop formation. It is a characteristic that determines the potential. The characteristic refers to the initial growth and It identifies the ultimate yield potential. Each replicate trial in each trial area. 75 The plot was evaluated in terms of seedling viability approximately 40 days after planting (planting 11). In 2015, seedling viability among the trial areas, seasonal There were significant differences to reflect the differences in the data (F[3,48]=20,17; P<0.01). However, GOR73226, GOR73240 and parent lineage CBI1582 (F[2,48]=1.33; 5 There was no significant difference between the safflower strain and the experimental area (F[6,48]=0.57; P=0.28). There was no significant interaction effect between them (P=0.75). Similarly, in 2016, among the trial areas, there was also a seasonal pattern. significant differences in vitality, reflecting the differences within them as well. there were (F[4,52]=10.54; P<0.01). As in 2015, there were 10 strains among the strains tested. (F[2,52]=1.44; P=0.25) or between lineages and trial regions (F[8,52]=1.38; P=0.25) No significant difference was observed in the interaction effect. Results from 9 different trial areas for the years 2015 and 2016, GOR73226 and Seedling viability of GOR73240 safflower strains was significantly higher than that of the CBI1582 parental strain. This shows that it is no different. 15 Evaluation of plant height Each experimental plot in each experimental area was planted approximately 120 days prior to planting. then evaluated in terms of plant height (Figure 12). Experimental areas in 2015. between them, in terms of plant height, reflecting seasonal variations. There were significant differences in plant height among safflower strains (F[3,48]=198.78; P<0.01). There was also a significant difference in terms of (F[2,48]=9.93; P<0.01); GOR73226 was different from GOR73240 and Parental control was consistently shorter than in CBI1582. Trial sites with aspirin. There was no significant interaction between their ancestors (F[6,48]=1.21; p=0.33). Similar observations were made in 2016, regions (F[4,52]=91.72; p<0.01) and safflower 25 Significant differences were recorded between the lineages (F[2,52]=9.82; P<0.01), however, safflower There is no interaction between the height of their lineage and region (F[8,52]=1.91; p=0.10). GOR73240 was not different from the parental lineage of CBI1582, but GOR73226 was both. It was slightly shorter than GOR73240, as well as from the parental lineage in Bellata and Kalkee. Results from 9 different trial areas for the years 2015 and 2016, GOR73226 and 30 The plant height of the GOR73240 safflower strain was significantly higher than that of the CBI1582 parental strain. 76 It wasn't different, but in some contexts GOR73226 was slightly shorter than the other two. This shows that it happened. Flowering time The flowering time of safflower depends largely on the variety and planting time. 5 GOR73226 and GOR73240 have the same flowering time as the parent lineage CBI1582. To investigate whether it has it or not, up to 50% flowering in an individual plot. The elapsed time (number of days) was also taken into consideration. In 2015, two areas in New South Wales were also assessed (Area 3: Narrabri and Zone 4: Bellata). Both trial zones were opened on the same day (July 21, 2010). Despite being planted in 2015, there was a significant difference between the experimental areas. (F[1,24]=30.74; p<0.01); Time to flowering in Bellata (110 days), Narrabri It was on average 4 days longer than the region (106 days). Also between the regions Diversity also had an important effect (F[2,24]=6.25; P<0.01), but no significant interaction. There was no effect (F[2,24]=1.53; P=0.25). On average GOR73226 (106.5±0.65 days), 15 It bloomed slightly earlier than its parental offspring (109.75±0.65 days). GOR73240 (108±0.65 days), significantly different from GOR73226 or parental control. de ildi. In 2016, three areas in New South Wales were reclassified (Area 12: Narrabri, Zone 10: Bellata and Zone 13: Wee Waa). As seen in 2015, flowering 20 The trial area had a significant effect on the time (F[2,28]=1182.72; P<0.01). This, This can be partly attributed to differences in planting dates between regions. In Bellata The region was earlier compared to Narrabri and Wee Waa (125±0.31 days and 116±0.31 days). It was planted and had the longest flowering period (137±0.25 days). There is no significant difference between the varieties in all regions in this regard (F[2,28]=0.25; 25 (P=0.78) or any interaction between varieties and experimental areas (F[2,28]=0.50; P=0.61) was not present. In 2015, two areas in Victoria were also assessed (Area 1: Kaniva and Zone 2: Kalkee). Both experimental zones were planted on the same day (July 10, 2015). However, there was a significant difference between the experimental regions (F[1,24]=9.99; 30 p<0.01); Time to flowering in Kalkee (138 days), compared to Kaniva region (135 77 (day) was on average 3 days longer. Also, between regions (F[2,24]=4.80;= 0.02) or Variation had no significant effect on the interaction effect (F[2,24]=1.68; P=0.22). On average, GOR73226 (135±0.75 days) is descended from the parental line (138±0.75 days) and It bloomed slightly earlier than GOR73240 (137±0.75 days). In 2016, between the trial sites in Victoria (F[2,24]=1.42; P=0.25) or 5 There was no significant difference between the types (F[2,24]=3.32; P=0.06). For parental control Flowering period is 172±0.2 days for GOR73226 and 173±0.2 days for GOR73240. It was 172 ± 0.2 days. In summary, the two-year and multi-regional evaluation is based on GOR73226 and GOR73240 differs significantly from the CBI1582 parent line in terms of flowering time, by 10 years. It showed that it was no different. Assessment of disease incidence Each replicate plot in each experimental area was planted approximately 120 days prior to planting. It was then evaluated in terms of disease incidence (Figure 13). Trial 15 in 2015 seasonal differences in disease incidence between regions There were significant differences to reflect this (F[3,48]=12.49; P<0.01). However, GOR73226, There was a significant difference between GOR73240 and parental lineage CBI1582 (F[2,48]=0.108; p=0.90). there was no significant difference between the safflower strain and the experimental area (F[6,48]=0.85; p=0.54). There was no effect. 20 The same observations were recorded in 2016 as well, among the trial areas. Significant differences were observed in terms of disease incidence (F[4,52]=23.97; p<0.01) and There was no significant difference between GOR73226, GOR73240 and parental lineage CBI1582. (F[2,52]=0.15; p=0.87) and there was no significant interaction between the safflower strain and the experimental area. there was no effect (F[8,52]=1.85; p=0.11). 25 In summary, the results from 9 different trial regions for the years 2015 and 2016 are as follows: Disease incidence of GOR73226 and GOR73240 SHO safflower strains CBI1582 It showed that it did not differ significantly from its parental lineage. 78 Assessment of insect damage. Each replicate plot in each experimental area was planted approximately 120 days prior to planting. They were then evaluated in terms of insect damage (Figure 14). The trial areas were examined in 2015. between them in terms of insect damage, reflecting seasonal variations. There were significant differences (F[3,48]=16.03; p<0.01). However, GOR73226, GOR73240 or 5 There was no significant difference between parental lineage CBI1582 (F[2,48]=1.05; p=0.36) and aspirin There was no significant interaction between the lineage and the experimental region (F[6,48]=1.05; p=0.41). It wasn't there. The same observations were recorded in 2016, and insects were also found among the experimental areas. Significant differences were observed in terms of damage (F[4,52]=52.33; p<0.01) and GOR73226, 10 There was no significant difference between GOR73240 and parental lineage CBI1582 (F[2,52]=3.60; (p=0.04) and there was no significant interaction between safflower strain and the experimental area. (F[8,52]=2.67; p=0.03). In summary, the results from 9 different trial regions for the years 2015 and 2016 are as follows: In transgenic safflower strains, the incidence of insect damage is significantly higher than in the parental strain. It showed that it was no different. Evaluation of harvest lodging. Each replicate plot in each experimental area was approximately 165 days after planting. It was then evaluated in terms of harvest lodging and capsule shedding. In 2015, 20 There was no significant difference in terms of lying down between the trial areas (F[3,48]=2.64; p=0.06). Similarly, GOR73226, GOR73240 and parent lineage (F[2,48]=0.81; p=0.84) There was no significant difference between the safflower strain and the experimental area (F[6,48]=0.81; p=0.98) There was no significant interaction between them. In 2016, between the trial areas There were significant differences in terms of sleeping (F[4,52]=32.13; p<0.01), however 25 GOR73226, GOR73240 or parent lineage CBI1582 (F[2,52]=0.30; p=0.74) There was no significant difference between the safflower strain and the experimental area (F[8,52]=0.33; p=0.92). There was no significant interaction effect. In all locations and years, in safflower plots. No crust shedding was observed. 79 Efficiency evaluation In 2015, yield differences were observed among the trial areas in terms of seasonal and geographical factors. There were significant differences to reflect the differences in the data (F[3,48]=1.84; (p<0.01) (Figure 15). However, GOR73226, GOR73240 or parental lineage CBI1582 (F[2,48]=4.10; p=0.25) there was no significant difference between the safflower strain and experimental area 5 There was no significant interaction effect between (F[6,48]=2.93; p=0.02). Similarly In 2016, differences were observed between the trial areas, as well as in seasonal variations. There were significant differences in terms of efficiency, which was reflected in the results (F[4,52]=25.38; p<0.01). There was no significant difference between the tested safflower strains (F[2,52]=4.66; p=0.02), however There was no significant interaction effect between strains and experimental regions (F[8,52]=7.96; p=0.01) 10 There were. In NSW, GOR73226 and GOR73240 had higher yields than parental control. She gave it, but the situation was the opposite in Victoria. In general, grain yield of transgenic safflower strains is significantly higher than that of the parental strain. The results were not significantly different; in 2015 and 2016, transgenes were studied in 9 different experimental regions. Yield differences are related to seasonal variability and geographical location rather than the presence of the plant itself. 15 This was observed. This is because the seeds were tested in multiple trials in the field, as explained below. along with the stability of the fatty acid composition, other transgenic strains created. This was a very important criterion for selecting GOR73226 and GOR73240 instead. Results 20 Agronomic analysis of transgenic safflower strains GOR73226 and GOR73240 the evaluation of these phenotypes revealed parental control in all of them. It showed that they were not significantly different from their ancestors. Genetic modification No adverse effects were observed. Example 9. Compound evaluation of GOR73226 and GOR73240 safflower seeds. Selection of Control and Reference Types Safflower seed is the primary test for compound analysis of GOR73226 and GOR73240. It was chosen as an ingredient because seed meal or fractions of it are derived from seeds. It was accepted that even the seed's symbol represented these derived materials. 30 in the field. The composition of the plant tissue obtained from cultivated GOR73226 and GOR73240 is also 80 These were examined. The most suitable comparison for these was the CBI1582 parental lineage. Safe use of traditional non-rotating safflower varieties for food and feed. It has a history and has also been used as a reference type. Hemeloic type and linoleic type safflower varieties were included. These varieties are used as bird feed and vegetable oil. It is widely used in markets. Traditionally, unprocessed safflower has 5 common ingredients. To provide a comprehensive overview, the following reference types have been included: Sironaria and Centennial (linoleic acid types), S-317, Montola 2003 and S901 (oleic acid types). Various safflower seed products can be used as animal feed: seeds, oil extraction, which is mostly used as a protein source in animal feed byproduct (safflower meal) and husks (Oelke et al., 1992). 10 for oil production. The safflower seeds used were cold-pressed, expeller-pressed, or solvent-treated. It may be extracted. By-products include safflower meal and early-stage plant tissue. It can be used in animal feed. Therefore, it comes from an expeller press and in the field. GOR73226 and GOR73240 seed meal obtained from cultivated plant tissue Feed quality was also evaluated. 15 Seed and plant tissue samples were collected from some of the field paths described in Example 8. The seeds were obtained from plants inoculated into an RCB design. Geographically, the seeds were analyzed for analysis. At least two geographically distant areas were selected; Kalkee and New South in Victoria. The samples were brought together at Bellata in Wales to provide a composite sample for analysis. Seeds obtained from the Bellata trial were also brought in as seed meal for feed testing. It was crushed for the purpose of production. Samples for testing were taken in a field in 2014. It was obtained from seeds produced in the trial. It was obtained from four independent events. Samples were analyzed and parental CBI1582 control and conventional non-conversion were performed. It was compared with safflower varieties. The study was conducted in Kununurra, Western Australia. Plant samples were also obtained from 38-day-old plants in block plantings. 25 In each field trial area, seeds were collected from separate plots and kept separate. For the purposes of compositional analysis, copies of each strain and transgenic lineage, They were brought together to form a composite sample. Composite seed samples were ground before analysis. This was done for testing. 30 by following the protocols provided by each of the laboratories 81 This was implemented. All methods, technical procedures, and practices conforming to industry standards were followed. These tests were carried out by commercial testing laboratories using various methods. A summary of the analytes tested can be found in Table 5. These analytes include aspirin. They have been selected taking into account the essential nutrients. Data analysis was performed using the Least Significant Difference (LSD) test (p<0.01). SPSS statistics (version 23), taking into account the significance of differences between means. This was done using Levene's Test to verify the homogeneity of variances. (p>0.05) normalization of the data and homogeneity of variances were performed as needed. To obtain this, perform a LOG (base 10) transformation on the proportional data. It was made a reality. 10 Safflower seed analysis Even the symbols GOR73226 and GOR73240 have parental lineage CBI1582 and traditional When compared with unprocessed safflower, it remained at normal levels for safflower. To verify this, a nutritional analysis was performed on safflower seeds. Compositional 15 The analyses determined the following concentrations: Obtained from GOR73226, GOR73240, CBI1582 and several traditional safflower varieties. A summary of the approximate chemical composition of the collected seeds is presented in Table 6. Moisture content 20 Moisture content is an important factor related to the storage quality of seeds and is tested. Significant differences (p<0.05) were observed among the types of moisture detected. The content varied between 4.6% and 6.8% (w / w). Compared to other varieties tested... When compared, CBI1582 had the highest average moisture content (6.2±0.27%). This has happened, however, with GOR73226 and GOR73240 or other high oleic acid varieties 25 When compared, there was no significant difference (p>0.01). The exception was CBI1582. In terms of moisture content, linoleic safflower was significantly different from Sironaria. was (p<0.01). GOR73226 (5.8±0.17%) and GOR73240 (5.6±0.10%) were the tested aspirins. None of the types were significantly different (p>0.01) and the mean values ​​were 30 It was within the ranges reported in the literature. 82 The observed average differences are related to differences in maturity at harvest time. They may be related, but all varieties meet industry standards in terms of moisture content. It was included. The safflower seeds, blended for safe and long-term storage, had moisture content. It is recommended that the rate does not exceed 8%. Table 5. Safflower seed component analytes were also evaluated. 5 Approximately those analyzed (6) Crude Protein Oven Humidity Or Carbohydrates Ash Energy Vitamins (11) Niacin B3 Thiamine B1 Vitamin A Folate Vitamin B6 Riboflavin B2 Vitamin D2 Folic Acid Vitamin C Pantothenate B5 Vitamin B12 Minerals (9) Copper Iron Sodium Magnesium Manganese Zinc Potassium Phosphorus Calcium Total Amino Acids (16) Alanine Arginine Aspartic acid + Asparagine Lisin Glutamic acid + Glutamine Glycine Histidine zoleucine Leucine Methionine Phenylalanine Proline Cool Threonine Tyrosine Valine Fatty Acid Profile (20) Myristic acid C14:0 Heptadecanoic acid C17:0 Oleic acid C18:1 Interidic acid C2O:0 Erucic acid C22:1 My multiple satiety Trans or Palmitic acid C16:0 Heptadekenoic acid C17:1 Linoleic acid C18:2 Eicosenoic acid C2O:1 Lignoceric acid C24:0 I'm not satisfied with just one thing. Or inside Palmitoleic acid C16:1 Stearic acid C18:0 Linoleic acid C18:3 Behenic acid C22:0 Tetracocenoic acid C24:1 He's full. Sugar Profile (1) Total Free Sugars Anti-Nutrients (2) Tannins Cyanide 83 T ab lo 6 . A sp ir t oh u m u n u n y white la I k a n al trace i K ar white te ri st two * G HE R 73 22 6 G HE R 73 24 0 C B I1 58 2 S -3 17 M on to la 03 S ir on ar ia T ol er an s ar al ı ı* * L it er at ü r ar al ı ı N em 5. 8± 0. 17 ab 5. 6± 0. 1a b 6. 2± 0. 27 a 5. 5± 0a b 5. 85 ± 0. 18 ab 5. 1± 0. 18 b 2. 42 -8 .5 0 5. 5- 7. 4 H am p ro te in .1 ± 2. 55 a 21 .8 ± 1. 1a 21 .5 ± 4. 2a 16 .2 ± 0. 0a 19 .5 ± 9. 7a 18 .5 ± 4. 45 a 0- 39 .1 14 .7 -3 7. 2 T op la m l ip it 34 6. ± 1. 3a b 34 7. ± 1. 4a b 31 2. ± 1. 2a b 5. ± 1. 2a 37 7. ± 1. 5b 37 7. ± 1. 52 b 1. 0- 60 0 13 7. -2 9. 0 K ar bo nh id ra tl ar 35 8. 5± 3. 6a 34 2. ± 2. 8a 37 7. ± 4. 7a 45 1. ± 1. 6a 34 3. ± 8. 8a 36 7. ± 5. 0a 3. 60 -6 6. 7 22 5. -4 8. 9 K ül 3. 1± 0. 3a 3. 19 ± 0. 3a 2. 9± 0. 2a 2. 7± 0. 3a 3. 3± 0. 28 a 2. 2± 0. 24 a 0. 50 -6 .6 3. 4- 4. 2 E ne rj i (k al or i / 0g ) 53 5. 2± 5. 1a b 53 6. 3± 4. 2a b 51 7. 5± 4. 2a b 51 9. 8± 4. 9a b 55 4. 3± 6. 2b c 55 9. 9± 6. 2b c 28 3- 69 6 49 0- 50 7 * A ks i be li rt the m ed i i sü re what k ur u a ır lı k no zı nd a (g / 1 00 g) f and kl and k ul is The is they k he when pl I m ı tı r. D its on and r or Yes is m a± s Yes nd and t ha Yes dı r. A the ı ha rf it hand hi p or breed old m al and a burn know nd a I old m bed b is f and k do kt ur . ** T the on I s and al ık old rı % 95 g üv is and p op ül and do nd and to never it rl on in % 99 'u we to what in what k to that ld to he sa pl moment m I ti r. N e.g. horse if d to er le r si fi r be ar white du ze lt province di . 84 Safflower seed analysis Even the symbols GOR73226 and GOR73240 have parental lineage CBI1582 and traditional When compared with unprocessed safflower, it remained at normal levels for safflower. To verify this, a nutritional analysis was performed on safflower seeds. Compositional The evaluations determined the following concentrations: 5 Obtained from GOR73226, GOR73240, CBI1582 and several traditional safflower varieties. A summary of the approximate chemical composition of the collected seeds is presented in Table 6. Moisture content Moisture content is an important factor related to the storage quality of the seed, and test 10 Significant differences (p<0.05) were observed among the types of moisture detected. The content varied between 4.6% and 6.8% (w / w). Compared to other varieties tested... When compared, CBI1582 had the highest average moisture content (6.2±0.27%). This has happened, however, with GOR73226 and GOR73240 or other high oleic acid varieties. When compared, there was no significant difference (p>0.01). The exception was CBI1582's 15 In terms of moisture content, linoleic safflower was significantly different from Sironaria. was (p<0.01). GOR73226 (5.8±0.17%) and GOR73240 (5.6±0.10%) were the tested aspirins. None of the types were significantly different (p>0.01) and the mean values It was within the ranges reported in the literature. 20 The observed average differences are related to differences in maturity at harvest time. They may be related, but all varieties meet industry standards in terms of moisture content. It was included. The safflower seeds, blended for safe and long-term storage, had moisture content. It is recommended that the rate does not exceed 8%. Crude protein In all the varieties tested, the protein content varied between 16-21%. There was no significant difference in crude protein content (p>0.01), and all results were within the literature range. Analysis showed that crude protein levels in GOR73226 and GOR73240 were similar to those of conventional proteins tested. It has been shown that it does not differ significantly from safflower strains. 30 85 Raw or The raw materials or contents of GOR73226 and GOR73240 are checked against CBI1582 or several other standards. It was not significantly different from commercial safflower varieties (p>0.01). High oleic acid S-317 This was significantly different from Montola 2003 and Sironaria (p>0.01). The crude oil levels in GOR73226 and GOR73240 were compared with the conventional safflower 5 tested. This showed that they were not significantly different from their ancestors. Ash Analysis regarding ash content was tested with GOR73226 and GOR73240. The study showed no significant difference between traditional safflower strains (p>0.01). 10 Carbohydrates Total carbohydrate levels were determined using fresh weight data and the following: The difference was calculated using the equation: % carbohydrate = %100 - % protein % or % Moisture % ash). Carbohydrate content tested with GOR73226 and GOR73240: 15 No significant difference was observed between traditional safflower strains (p>0.01). Energy Calories were calculated using the following equation: Calories (Kcal / 100 g) = (4 × % protein) (9 × % fat) (4 × % carbohydrates). Energy of GOR73226 and GOR73240 is 20 Potential control, CBI1582 or several commercial safflower varieties differ significantly. There were some differences among the tested traditional safflower strains (p>0.01). It was observed. The analysis showed that the caloric potential of GOR73226 and GOR73240 was tested. It showed that it resembled traditional safflower varieties. Summary of the approximate analysis Approximate analysis on seeds obtained from GOR73226 and GOR73240. This was done and compared with parental control and traditional aspirin. The analysis showed that both The parental lineages of both GOR73226 and GOR73240 were obtained from CBI1582 and tested. It showed that it did not differ significantly from traditional safflower strains. 30 86 Mineral composition of safflower seeds A number of minerals are essential plant nutrients. Some are needed in larger quantities. Some are macronutrients, and others are needed only in trace amounts (micronutrients). Both macro and microscopic features were observed in seed samples taken from GOR73226 and GOR73240. The nutrients were analyzed and compared with CBI1582 and commercial safflower varieties. 5 were tested. Among the 9 minerals, GOR73226 and GOR73240 are important from parental control CBI1582. The difference was not significant (p>0.01) and was similar to the traditional safflower strains tested. The mineral content of GOR73226 and GOR73240 was within the literature range for safflower. Vitamin analysis of safflower seeds: 10 Vitamin analysis was only performed on composite samples from the Kalkee trial area. The vitamin levels in GOR73226 and GOR73240 were checked by parental supervision (CBI1582). And it was comparable to the traditional safflower strains tested. Together, vitamin B6 levels in all safflower samples in this study, compared to other fatty acids... Compared to what has been reported in the literature for seeds, it was quite high. Also 15 When compared with other safflower varieties, the Vitamin B5 level in GOR73226 is higher. It was lower than traditional safflower; this is compared to the levels observed in canola seeds. It was more similar. Vitamin B6 acts as a cofactor for many enzymes. Specifically, B6 Pyridoxal 5'-phosphate, the active form of the vitamin, is primarily composed of amino acid compounds. It plays many roles as a versatile cofactor for enzymes involved in its metabolism. It has. Data shows that aspirin is a good source of Vitamin B6. Amino acid analysis of safflower seeds A total of 16 amino acids were examined. The tested traditional safflower strains... No significant difference (p>0.01) between GOR73226 and GOR73240 25 No observations were made. Analysis revealed that GOR73226 and GOR73240 are amino acid compounds of the parent amino acid group. The control showed that it was not significantly different from CBI1582 and conventional safflower. Fatty acid profile obtained from safflower seeds. GOR73226 and GOR73240 aspirin genes are found at super high levels (30) in seeds. It has been modified to accumulate oleic acid. Obtained from field-grown safflower. 87 Homozygous seeds were analyzed in terms of either acid profiles or acid composition. (Table 7). Analysis of GOR73226 and GOR73240 seeds revealed oleic acid, linoleic acid, and CBI1582 parental strain and traditional safflower tested except for palmitic acid levels. It was shown that they were comparable to their ancestors (Table 7). In this analysis, GOR73226 and GOR73240 exhibited approximately 92% oleic acid, with linoleic acid levels of 1.2% and 1.6%. and palmitic acid levels were 2.6% and 2.5%, respectively. GOR73226 and GOR73240 Low levels of linoleic and palmitic acids in seed samples reflect homozygosity. The acid of the seeds obtained collectively from GOR73226 and GOR73240 The analysis investigated the effectiveness of amino acid regulation by the CtFAD2.2 and CtFATB genes. Its unique reputation was established. 10 Analysis of free sugars in safflower seeds When compared to the tested traditional safflower strains, GOR73226 and There was no significant difference in free eker levels between GOR73240 (p>0.01). Analysis of anti-nutrients in safflower seeds Tannins Tannins are polyphenols that can bind to and precipitate proteins (Butler's Theory). (Rogler 1992; Chung et al., 1998). Tannins in livestock diets contribute to weight gain. It can reduce intake, apparent digestibility, and feed utilization efficiency. This 20 Anti-nutritional effects generally refer to the digestion of dietary proteins by tannins. This has been attributed to its inhibition. Other effects associated with tannins in the diet are systemic and It requires the inhibitory material to be absorbed into the body from the digestive system (Chung and others, 1998). The tannin levels in the tested safflower varied between 0.08% and 0.41%. 25 GOR73226 and GOR73240 are significantly different from CBI1582 and the tested traditional strains. The levels in GOR73226 and GOR73240 were not different (p>0.01). yields were lower than those from seeds, e.g. canola –1.5%, Canadian Canola Council (2015); Rapeseed–0.5%, Heuzé et al. (2017a); soybean–0.85%, Heuzé et al. (2017b); sunflower meal–1.4%, Heuzé et al. (2016). 30 88 Hydrogen Cyanide Prussic acid, also known as hydrogen cyanide or HCN, is both beneficial and... It is a dangerous chemical. Although this substance occurs naturally in some plants... It can also be synthesized by various chemical processes. 110 to 135 ppm in 0.5 to 1 hour or It has been reported that it can later become fatal or life-threatening. Most animals 5 The acute lethal dose of hydrogen cyanide (HCN) of this type is approximately 2 mg / kg, and 200 ppm Plant materials containing cyanogenic glycosides are considered hazardous. (Cope, 2017). Plant materials containing 200-500 ppm HCN on a dry weight basis. It should be acknowledged that it is potentially toxic to livestock (Williams, 2012). In all safflower varieties examined, HCN was found in amounts less than 2.5 ppm (mg / kg). It was found that GOR73226 and GOR73240 were tested in conventional safflower. that they did not differ significantly from their ancestors and that there was no potential for cyanide contamination between the varieties. Its production is very low and it is considered not toxic to either humans or animals. It showed that it wasn't done. Table 7. Parental control compared with CBI1582 and GOR73226. GOR73240's oil acid profile Oil acid* GOR73226 GOR73240 CBI1582 S- 317 Montola Sironaria Myristic acid C14:0 0.03 0.03 0.09 0.07 0.08 0.11 Palmitic acid C16:0 2.6 2.5 5.8 5.5 5.3 7.4 Palmitoleic acid C16:1 0.2 0.1 0.2 0.2 0.1 0.1 Heptadecanoic acid C17:0 <0.1 <0.1 <0.1 <0.1 <0.1 <0.1 Heptadekenoic acid C17:1 <0.1 <0.1 0.1 0.1 <0.1 <0.1 Stearic acid C18:0 2.5 2.0 2.2 2.9 2.0 2.4 89 Oleic acid C18:1 92.0 92.3 75.2 67.8 74.8 11.8 Linoleic acid C18:2 1.2 1.6 14.7 21.9 16.1 76.3 Linoleic acid C18:3 0.1 0.1 0.1 0.1 0.1 0.1 Ara idic acid C20:0 0.5 0.4 0.5 0.5 0.4 0.3 Eicosenoic acid C20:1 0.3 0.3 0.3 0.3 0.3 0.2 Behenic acid C22:0 0.3 0.3 0.4 0.3 0.3 0.2 Erucic acid C22:1 <0.1 <0.1 <0.1 <0.1 <0.1 <0.1 Lignoceric acid C24:0 0.2 0.2 0.2 0.2 0.3 0.5 Tetracocenoic acid C24:1 0.1 0.2 0.2 0.1 0.2 0.6 Multiple I'm not satisfied acids 1.3 1.7 14.8 22.0 16.2 76.4 Single satisfaction or acids 92.6 92.9 76.0 68.5 75.4 12.7 He's full. acids 6.1 5.4 9.2 9.5 8.4 10.9 * Seed samples were taken from the NSW Basic Industries Testing Services Department and Analyzed by CSIRO. Fatty acid levels, total fatty acids by weight. Presented as a percentage of the content. Homozygous seeds for GOR73226 and GOR73240. Examples include the field study conducted in Kununurra, Western Australia in 2016. It was obtained from experiments. 5 90 Analysis of safflower meal Feed quality analysis Safflower meal from GOR73226 and GOR73240, CBI1582 parental control. and traditional aspirin feed quality evaluation was carried out. GOR73226 and GOR73240 is derived from parental control CBI1582 and 5 of the tested traditional safflower strains. They weren't significantly different either. Plant tissue analysis Safflower retains its green color and has a higher feed value under dry conditions. Therefore, it is also a valuable feed for the Mediterranean regions (Stanford et al., 2001; 10 Landau et al., 2005; Peiretti 2009). Potential in Australian farming systems. The exact meaning is not fully understood, but various reports suggest strategic use. can offer satisfactory growth rates and productivity for livestock farming This shows (French et al., 1988). Safflower is consumed by sheep and cattle. It can be grazed directly or fed fresh using a cut-and-carry system. Safflower 15 It is also used as straw, especially if it has been damaged by frost. Budding from safflower. It is recommended to prepare silage during this period (Peiretti, 2009; Oyen et al., 2007). GOR73226 and GOR73240 plants, especially in safflower stubble after harvest. If the remaining seeds sprout early, they will germinate in the autumn, feeding the animals. early plant growth suitable for grazing during drought 20 This can offer a feeding opportunity. Therefore, the feed quality of GOR73226 and GOR73240... It has been examined. Feed quality analysis Feed quality analysis of the plant tissues of GOR73226 and GOR73240 was 25%. The study showed that it did not differ significantly from traditional safflower. The components examined... Most of the results were within the reported literature ranges for plant-based safflower tissue. Caution. The point to be noted is that some components differ from those reported elsewhere. For example, the protein levels of GOR73226 and GOR73240 are reported in the literature. It was much higher than reported. However, protein levels increased during growth 30 It depends on the timing and agricultural conditions, resulting in higher crude protein levels. 91 It was related to nitrogen application (Danieli et al., 2011) and subsequent development the decreases in crude protein recorded in their studies (Corleto et al., 2005; It is stated that this happened (Peiretti, 2009). Mineral content 5 Mineral nutrition plays a role in maintaining the health and productivity of livestock. This is an important component. Therefore, understanding the mineral nutrient composition of a feed source is crucial. And balancing them can be important. The likelihood of mineral deficiencies occurring. It is more than just toxicity, and feed rations are generally minimal for animals. It is formulated to meet the requirements. In these cases, the mineral in the diet is 10 concentrations of the maximum tolerable concentrations for animals It is important to determine whether it is beyond or beyond the limit. Excessive feed or water. Mineral toxicities resulting from contamination can lead to decreased animal performance or It can have observable effects, such as changes in animal behavior. The levels of essential minerals in the plant tissue of GOR73226 and GOR73240 are 15. were examined. None of the minerals tested were at the maximum tolerated level for farm animals. It was close to or above acceptable levels. Results A comprehensive analysis of the markers GOR73226 and GOR73240 was conducted. The results are 20. parental control CBI1582 and commercially available safflower varieties Compound and feed quality analyses were performed on GOR73226 and GOR73240. The desired characteristic is high levels of oleic acid and low levels of linoleic acid. Apart from having a fatty acid profile that includes palmitic acid, it differs from other safflower varieties. He confirmed that it was not significantly different. 25 This even includes feed quality analysis and testing of conventional safflower strains. and / or when compared with reference literature, GOR73226 and GOR73240 are respectively It has been confirmed that it is safe for human and animal consumption. Experts in the field, given the broadly described scope of the invention, and without separating from its spirit, as shown in specific arrangements, the cloud contains numerous 30 It will appreciate that variations and / or modifications can be made. Therefore, 92 The existing regulations should be considered in all respects to be explanatory and not restrictive. It is a province. All publications discussed and / or referenced herein are included here in their entirety. It is included. The documents, actions, materials, devices, and clauses included in this specification are listed in Article 5. or any discussion relating to similar things is merely a context for the present discovery. This is aimed at ensuring the safety of the property. Any or all of these aspects, this Because each of the applications exists before the priority date, the existing the invention formed part of the previous technical foundation or general knowledge in the related field. That should not be accepted. 10 93 REFERENCES Abdullah et al. (1986) Biotech. 4:1087. Allen et al. (2007) PNAS 104:16371-16376. Ascherio and Willett (1997) Am. J. Clin. Nutr. 66:1006S-1010S. 5 Axtell (2013) RNA 19:740-751. Bartholomew (1971) The effect of temperature on the fatty acid composition of developing safflower seeds. effect, Carthamus tinctorius L. Thesis, University of California, 1971. Belide et al. (2011). Plant Methods 7:12. Bligh and Dyer (1959). Canadian Journal of Biochemistry and Physiology 37:911-7. 10 Bowers et al. (2016) G3 Genes|Genomes|Genetics 6:2203-2211. Bonanome and Grundy (1988). N. Engl. Med. 318: 1244-1248. Broun et al. (1999) Annu. Rev. Nutr. 19: 197-216. Butler and Rogler (1992) Biochemical Antinutritional Effects of Tannins Mechanisms. Phenolic Compounds Found in Foods and Their Effects on Health I, Chapter 23, 15 pp. 298–304. Canadian Canola Board (2015). Canola Meal Feed Industry Guide. http: / / www.canolacouncil.org / media / 516716 / 2015_canola_meal_feed_industry_guide. pdf. Cao et al. (2013) BMC Plant Biol. 13:5. 20 Chung et al. (1998) Crit Rev Food Sci Nutr 38:421-464. Corleto et al. (2005) Aspirin in the breeding stage for straw and ensiling purposes. Development of biomass and quality. Proceedings of the 6th International Safflower Conference. Istanbul, Türkiye, pp. 69-73. Coutu et al. (2007) Transgenic Research 16:771-781. 25 Cope et al. (2017) An Overview of Cyanide Poisoning. Merck Veterinary Manual (http: / / www.merckvetmanual.com / toxicology / cyanide-poisoning / overview-of-cyanide- (poisoning). Danieli et al. (2011) Italian J Agron 6:e4. Dougherty et al. (1995). Am. J. Clin. Nutr. 61:1120–1128. 30 Fenandez San Juan (1995). Alimentaria 33: 93-98. 94 French et al. (1988) Tropical Grasslands, 22:85-90. Fujimura et al. (1985) Plant Tissue Culture Lett. 2:74. Gamez et al. (2003) Food Res International 36: 721-727. Gunstone (2001) Inform 11: 1287-1289. Helliwell and Waterhouse (2005) Methods Enzymol 392:24-35. 5 Heuze et al. (2016) Sunflower seed meal. Feedipedia, an INRA programme, CIRAD, AFZ and FAO. http: / / www.feedipedia.org / node / 732. Heuze et al. (2017a) Rapeseed meal. Feedipedia, an INRA programme, CIRAD, AFZ and FAO. http: / / www.feedipedia.org / node / 52. Heuze et al. (2017b) Soybean seeds. Feedipedia, an INRA programme, 10 CIRAD, AFZ and FAO. http: / / www.feedipedia.org / node / 42. Hill and Knowles (1968). Crop Sci. 8:275-277. Hu and di . (1997) N. Engl. J. Med. 337: 1491-1499. Knowles (1968) Economic Botany 22: 195-200. Knowles (1972) Journal of the American Oil Chemists' Society 49:27-29. 15 Knowles (1989) The world's wild plants: their reproduction and use / ed. G. Robbelen, R. Keith Downey, A.Ashri. McGraw-Hill, New York. Landau et al. (2005 Small Ruminant Res 59:239-249.) Langridge et al. (2001) Aust J Agric Res 52: 1043-1077. Lemieux (2000) Current Genomics 1: 301-311. 20 Liu et al. (2002). J. Am. Coll. Nutr. 21: 205S-211S. Marangoni et al. (1995) Trends in Food Sci. Technol. 6: 329-335. Mensink and Katan (1990) N. Engl. J. Med. 323: 439-445. Noakes and Clifton (1998) Am. J. Clin. Nutr. 98: 242-247. Oelke et al. (1992) Safflower. Guide to Alternative Field Crops, Wisconsin-25 Exension University, Cooperative Extension. Oil World Annual (2004) International Seed Testing Association (ISTA) Mielke GmbH, Hamburg, Germany. Oyen and Umali (2007) Carthamus tinctorius L. Record from Protabase. van der Vossen, HAM; Mkamilo, GS (Editors). PROTA (Tropical African Plant Resources) / 30 Ressources végétales de l'Afrique tropicale), Wageningen, Netherlands. 95 Peiretti (2009) Livestock Research for Rural Development. Volume 22, Article #206. Perez-Vich et al. (1998) JAOCS 75:547-555. Phillips et al. (2002) Journal of Food Composition and Analysis 12:123-142. Reynolds et al. (2015) Front Plant Sci 6, Artcile number 164. 5 Roche and Gibney (2000) Am. J. Clin. Nutr. 71: 232S-237S. Ryan et al. (1984) J. Am. Oil Chem. Soc. 61:1610-1619. Scarth and Tang (2006) Crop Science 46:1225-1236. Sebedio et al. (1994) Fett. Wiss. Technol. 96: 235-239. Smith et al. (2000) Nature 407: 319-320. 10 Stanford et al. (2001) Can J Anim Sci 81:289-292. Thelen and Ohlrogge (2002) Metabolic Engineering 4: 12-21. Tholstrup et al. (1994) Am. J. Clin. Nutr. 59: 371-377. Toriyama et al. (1986) Theory. Appl. Genet. 205:34. Waterhouse et al. (1998) Proc. Natl. Acad. Sci. USA 95: 13959-13964. 15 Williams (2012) Medicinal Plants of Australia Volume 3: Plants, Potions and Poisons. Australia: Rosenberg Publishing. Zhou et al. (2011) Journal of Biological Chemistry 286:2877–2885. Zhou and Di. (2013) FEBS Lett 587:2371-2376. Zock and Katan (1992) J. Lipid Res. 33:399-410. 20

Claims

96 STEMS 1. A safflower plant cell containing a T-DNA molecule, where T-DNA The molecule is supplied as 296 to 8640 nucleotides of SEC NO:

7. It contains a polynucleotide that includes a nucleotide sequence, where T-DNA 5 The molecule is inserted into a region of a chromosome in the cell, where the region, It has a nucleotide sequence given as SEC D NO:18, where, The cell contains a nucleotide sequence identified as SEC NO:

21. a polynucleotide and a nucleotide sequence provided as SEC NO:22 It contains a polynucleotide, and here the cell also contains T-DNA(s) 10 Reduced CtFAD2-2 compared to safflower cells that do not contain warm snow. It includes reduced CtFATB-3 activity.

2. According to stem 1, it is a safflower plant cell, and its characteristic is; polynucleotide and T-DNA. being homozygous for. 15 3. Stem 1 or 2 is a safflower plant cell, and its characteristics are as follows: one or more or all of them are valid (a) oleic acid, which constitutes 90% by weight of the total fatty acids in the cell. It constitutes 95%, 20 (b) at least 95% by weight of the lipid must be triacylglycerol (TAG), (c) palmitic acid as a percentage of total fatty acids in the cell. Less than 2.7%, preferably by weight of the total fatty acids in the cell. constituting 2.5% to 2.7%, (d) linoleic acid, 1.7% to 25% by weight of total fatty acids in the cell. a small amount, preferably 1.2% to 1.2% by weight of the total fatty acids in the cell. It constitutes 1.6%, (ε)-linolenic acid is among the total fatty acids in the cell. absence or weight of total fatty acids in the cell It constitutes less than 0.2%, and 30 The cell contains a hygromycin phosphotransferase polypeptide. 97 4. Stem 1 through 3 is a safflower plant cell, and its characteristic is; one ol allele of the CtFAD2-1 gene or one ol1 allele of the CtFAD2-1 gene or it must contain both alleles, preferably be homozygous for the ol allele.

5. Stem 1 through 4 is a safflower plant cell, and its characteristic is; this 5 The cell is a germ cell.

6. Stem 5 is a safflower plant cell, and its characteristic is; one that grows in a field. It is found in the seeds of the safflower plant.

7. A safflower seed containing a cell from stem 1 to 6.

8. A collection of safflower seeds, characterized by the fact that at least 95% of the seeds are... According to requirement 7, there must be seeds.

9. A safflower plant or a part thereof, characterized by having stem cells 1 to 6. According to one, it contains a cell and / or a seed according to claim 7. its ability to produce.

10. Stem 9 is a safflower plant or part thereof, and its characteristic is that stem 7 is 20 It is produced by cultivating its seeds.

11. Safflower plant or a part thereof, according to stem 9 or stem 10, Its characteristic feature is that the polynucleotide and T-DNA remain in the plant for at least nine generations. or the stable integration of a portion of it into the genome. 25 12. A safflower plant or part thereof, according to stems 9 through 11. and its characteristic is that it possesses one or more or all of the following characteristics: grown under the same conditions but without polynucleotides and T-DNA The difference between a plant that grows in warm conditions and one that grows in cold conditions is: seedling vitality, plant height, 30 time to flowering, harvest settling, seed crude protein content, Seed crude oil content, seed ash content, and seed carbohydrate content. 98 13. A safflower plant or part thereof, according to any of stems 9 through 12. Its characteristic feature is that it contains polynucleotides and a transgene called T-DNA. The 14th stem is either the pollen of the plant or an ovule, according to any of the 9th to 13th stem. Its characteristic feature is that it contains T-DNA. 5 15. It is a tissue culture consisting of renewable cells, and its characteristic feature is that the cells It should be as defined in any of items 1 through 6, preferably. tissue; leaves, pollen, embryos, roots, root tips, pods, It is the selection of a group consisting of flowers, ovules, and stems. 10 16. This is a method for identifying a safflower plant, and its characteristic feature is; the method involves extracting DNA from the plant, as defined in claim 1. Analysis of one or more polynucleotide(s) and / or T-DNA. It includes the following: 15 17. This is a method for producing safflower oil, and its characteristic feature is that it is safflower according to claim 8. to obtain the seed collection and to obtain safflower oil It involves the processing of the seed.

18. It is one type, and its characteristic is that it is obtained from a collection of safflower seeds according to requirement 8. It is the process where oleic acid or 90% of the total fatty acids are present. It contains 95%.

19. A component, preferably a food or feed component, whose characteristic is; requirement 1 to 25 Choose one or more cells according to any of option 6, or according to option 7. seed, or according to claim 18, one or more acceptable It includes the carrier.

20. According to stem 1 to 6, the cell, or according to stem 18, 30 one or more of them for the production of an industrial product It is the use of. 99 21. A method for producing a feedstuff / nutrient, characterized by the fact that the method meets the requirements. One or more cells according to any of 1 to 6, request 7. according to the seed, the safflower plant according to any of claims 9 to 12, According to claim 18, or according to claim 19, one or more of the elements It involves mixing it with at least one other food ingredient. 5 22. A method for producing a feedstuff / nutrient, characterized by the fact that the method meets the requirements. According to article 18, it involves heating a food product in the presence of oil.

23. It is seed meal, and its characteristics are; according to requirement 8, safflower seeds 10 It is extracted from the collection and here seed meal T-DNA includes.