Investigation of Inflammatory Pathways in Uterine and Adult Periods in the Cc2d1a Autistic Mouse Model: A Method for Determining Autism Risk via Cytokines

TR202418078A2Pending Publication Date: 2026-06-22ERCİYES ÜNİVERSİTESİ STRATEJİ GELİŞTİRME DAİRE BAŞKANLIĞI
0 Cites 0 Cited by

Patent Information

Application Number
TR202418078
Authority / Receiving Office
TR · TR
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-12-09
Publication Date
2026-06-22
Patent Text Reader

Abstract

Autism is defined as a complex neurogenetic disorder for which there is no effective treatment. More than 1000 genes and genomic regions, and various mutations, have been associated with autism. The Cc2d1a (coiled coil and C2 domain containing 1A) gene is one of the candidate genes for autism and is a transcription factor important for the central nervous system. The invention relates to the investigation of inflammatory pathways in utero and adulthood in an autistic mouse model with this gene (Cc2d1a), and to a method for determining the risk of autism based on the gene and protein expression levels of IL-4, IL-5, IL-13, IL-10, IL-6, IL-1 beta, IL-1 alpha, IL-17, IL-22, IL-23, TNF-alpha, IFN-gamma, TGF-beta, GMCSF, and AREG markers in serum, sperm, and ovarian tissues of parents and siblings of autistic children.
Need to check novelty before this filing date? Find Prior Art

Description

1 TARIFF Cc2d1a AUTISTIC MOUSE MODEL IN UTERUS AND ADULT PERIODS INVESTIGATION OF INFLAMMATORY PATHWAYS: RISK OF AUTISM IDENTIFICATION METHOD BASED ON CYTOKINES TECHNICAL FIELD Autism is defined as a complex neurogenetic disorder, and its effective treatment... It is not possible to do so. More than 1000 genes and genomic regions and various mutations are associated with autism. It has been associated with autism. The Cc2d1a (coiled coil and C2 domain containing 1A) gene is also linked to autism. It is one of the candidate genes and a transcription factor important for the central nervous system. This is the factor. The invention was made in an autistic mouse model with deleted gene expression (Cc2d1a) both in utero and in adulthood. inflammation in five different tissues (blood, intestines, brain, sperm, and ovaries) during this period Investigating pathways and determining autism risk using tissue-specific markers. It is related to the method. With this discovery, autism, which generally appears in humans in the first three years of life, can be treated in 15 years. with effective cytokines specific to blood and various tissues found in the early stages (before the first three years of life) A method for determining the risk of autism has been found. PREVIOUS TECHNIQUE Autism is defined as a complex neurogenetic disorder, and its effective treatment... It is not possible to do so. More than 1000 genes and genomic regions and various mutations are associated with autism. It has been linked to [autism], but so far no gene or mutation has been clearly identified as responsible for autism. It has not been identified. The Cc2d1a (coiled coil and C2 domain containing 1A) gene is also associated with autism. It is one of the candidate genes and a transcription important for the central nervous system. 25 It is a factor. The gene Cc2d1a, located at the gene site given in parentheses, is associated with autism. It was introduced to the literature by Elif Funda Şener. There is very little literature on the Cc2d1a mouse model (https: / / humandiseasegenes.nl / cc2d1a). Studies are also available on Cc2d1a knock-out mice in different tissues and at different developmental stages. The baseline signs of inflammation in the stages are unknown. Autism, bowel 30 also with immune regulation disorders including dysfunction of the immune system and autoimmunity. It has been characterized. Recently, neurodevelopmental disorders and the immune system Research between them has accelerated. 2 As shown below, there are many current and previous studies in the literature on the relationship between autism and the immune system. The study is available; Sallam DE, Shaker YS, Mostafa GA, El-Hossiny RM, Taha SI, Ahamed MAEH. Evaluation of serum interleukin-17 A and interleukin-22 levels in pediatric patients with 5 autism spectrum disorder: a pilot study. BMC Pediatr. 2024 Jan 5;24(1):18. doi: 10.1186 / s12887-023-04484-2. PMID: 38183030; PMCID: PMC10768424. Than UTT, Nguyen LT, Nguyen PH, Nguyen XH, Trinh DP, Hoang DH, Nguyen PAT, Dang VD. Inflammatory mediators drive neuroinflammation in autism spectrum disorder and cerebral palsy. Sci Rep. 2023 Dec 18;13(1):22587. doi: 10.1038 / s41598-023-10 49902-8. PMID: 38114596; PMCID: PMC10730823. Petrova B, Lacey TE, Culhane AJ, Cui J, Raskin A, Misra A, Lehtinen MK, Kanarek N. Metabolomics of Mouse Embryonic CSF Following Maternal Immune Activation. bioRxiv [Preprint]. 2023 Dec 24:2023.12.06.570507. doi: 10.1101 / 2023.12.06.570507. PMID: 38105934; PMCID: PMC10723469. 15 Maric DM, Vojvodic D, Maric DL, Velikic G, Radomir M, Sokolovac I, Stefik D, Ivkovic N, Susnjevic S, Puletic M, Dulic O, Abazovic D. Cytokine Dynamics in Autism: Analysis of BMAC Therapy Outcomes. Int J Mol Sci. 2023 Oct 11;24(20):15080. doi: 10.3390 / ijms242015080. PMID: 37894761; PMCID: PMC10606637. Belica I, Janšáková K, Celušáková H, Kopčíková M, Polónyiová K, Rašková B, 20 Vidošovičová M, Ostatníková D, Babinská K. Plasma cytokine concentrations of children with autism spectrum disorder and neurotypical siblings. Cytokine. 2023 Oct;170:156333. doi: 10.1016 / j.cyto.2023.156333. Epub 2023 Aug 18. PMID: 37598479. Kaminski VL, Michita RT, Ellwanger JH, Veit TD, Schuch JB, Riesgo RDS, Roman T, Chies JAB. Exploring potential impacts of pregnancy-related maternal immune activation 25 and extracellular vesicles on immune alterations observed in autism spectrum disorder. Heliyon. 2023 Apr 29;9(5):e15593. doi: 10.1016 / j.heliyon.2023.e15593. PMID: 37305482; PMCID: PMC10256833. In the study referred to, the mice with deleted Cc2d1a gene expression (knock-30 (Cc2d1a knock-out mice) has been used. The relationship between Cc2d1a knock-out mice and autism is also relatively new in the literature. However, immune system pathways in the Cc2d1a knock-out autistic mouse model are being elucidated. No research investigating this has been found. In this discovery, we examined both the mouse in question. 3 in 5 different tissues of the model (blood, hippocampus, intestine, ovary, sperm) as well We investigated immune system markers in the brain tissue of embryonic mice. And thus, by identifying different tissue-specific markers, early autism diagnosis can be detected. for use in diagnosis or in determining the risk of having autism through cytokines We have discovered a new method that we designed. Furthermore, our discovery involves 5 different methods for analyzing sperm and ovarian tissue. The risk of having an autistic child can also be determined through the different cytokines that are identified. These tissue-specific markers that have been identified will enhance our country's scientific prestige in the field of neuroscience. will make a significant contribution to the diagnosis of autism, which is not yet available on the world market. This will enable the design of usable kits. Thus, other unknown It will be a pioneer in the production of new kits that can be used in the diagnosis of diseases. 10 Early diagnosis of autism plays a crucial role in the treatment of the disease. A definitive diagnosis of autism... and there are no applications, methods, or drug treatments available for its treatment, Existing drug treatments are also limited and are not specifically for autism; they target additional symptoms of autism. These are treatments. Autism is diagnosed by clinicians according to DSM-V standards. 15 Any molecular method used to determine the risk of autism It is not available. In addition, this invention concerns; at the molecular level and in different tissues, There is also no method in the literature to determine autism risk through cytokines. DESCRIPTION OF THE INVENTION 20 Generally speaking, all of them are compatible both in adulthood and in embryonic development. an increase in pro-inflammatory cytokines in tissues (blood, hippocampus, gut, ovary, sperm) Suppression and an increase in anti-inflammatory cytokines have been observed in both females and males. Although inflammatory differences were observed, they were quite consistent with the nature of autism. High heterogeneity is exhibited. This study investigated female and male autistic mice in the Cc2d1a autistic mouse model. In men, basal levels in blood, gut, hippocampus, sperm, and ovarian tissues. inflammation pathways are suppressed, and anti-inflammatory pathways are more active in all tissues. It has been shown to be active. With this discovery, autism spectrum disorder is detected in five different tissues (blood, hippocampus, gut, sperm, cytokines that are activated or inhibited from the embryonic period (egg) These cytokines have been identified. Tissue-specific drugs or tissue-specific treatments can be developed using these identified cytokines. 4 The goal is to further develop these methods and advance these results for therapeutic purposes. Therefore, findings from the embryonic period are important for early diagnosis in adults. The planned treatment methods also have an advantage compared to its counterparts, based on the findings of that period. This has been achieved because immune system studies were conducted in the Cc2d1a knock-out mouse model. Although not found in the literature, 5 studies have focused on treatment or early diagnosis. It is not available. The application of this invention resulted in a noticeable reduction in inflammation in all tissues. Differences have been identified. By correcting these differences during the embryonic period, these The aim is to eliminate the disorder. With this invention, diagnosis in different tissues is possible. The markers to be used as part of the method have been determined. In adult blood tissue; Il-6 and Gmcsf In adult ovarian tissue; Il-1 Beta, Il-1 Alpha, Il-6, Il-5, Il-10, Il-13, Il-17 and Il-23 In adult sperm tissue; TNF-alpha, IFN-gamma, IL-4, IL-5, IL-13, IL-10, TGF-beta, IL-22, Il-23 and Areg 15 In adult hippocampal tissue; TNF-alpha, TGF-beta, IL-1beta, IL-6 and IL-10 Ifn-gamma in adult intestinal tissue. Embryonic period, 14-day-old embryonic brain tissue; Il-1beta, Il-4, Il-5, Il-13, Il-10, Il- 17, Ifn-gama, Gmcsf and Areg The risk of being autistic and having an autistic child (especially ovarian and sperm abnormalities 20 It has been determined that there are markers that can be used in the identification of different cytokines in tissues. It has been done. m- Il-6 forward ACCAGAGGAAATTTTCAATAGGC m- Il-6 reverse TGATGCACTTGCAGAAAACA m- Gmcsf forward ACCACCTATGCGGATTTCAT 25 m- Gmcsf reverse TCATTACGCAGGCACAAAAG m- Il-1alfa forward ATG GTT TTA GAA ATC ATC AAG CCT AGG GCA m- Il-1 alpha reverse ATT GAA AGG AGG GGA GGA TGA CAG AAA TGT m- Il-1beta forward GCCCATCCTCTGTGACTCAT m- Il-1beta reverse AGGCCACAGGTATTTTGTCG 30 m- Il-4 forward TCGGCATTTTGAACGAGG m- Il-4 reverse TGCAGCTCCATGAGAACACTA m- Il-5 forward CTCTGTTGACAAGCAATGAGAC m- Il-5- reverse TCTTCAGTATGTCTAGCCCCTG m- Il-13 forward GAGCTGAGCAACATCACACA m- Il-13 reverse GTCCTGTAGATGGCATTGC m- Il-10 forward CCCTTTGCTATGGTGTCCTT m- Il-10 reverse TGGTTTCTCTTCCCAAGACC 5 m- Il-17 forward CATGAGTCCAGGGAGAGCTT m- Il-17 reverse GCTGAGCTTTGAGGGATGAT m- Il-23 forward CTGAGGTTCGTGGGATGATT m- Il-23 reverse AAAAGAAACTGGCAGCCTTG m- Tnf-alpha forward TGCCTATGTCTCAGCCTCTT 10 m- Tnf-alpha reverse GAGGCCATTTGGGAACTTCT m- Ifn-gama forward TCAAGTGGCATAGATGTGGAAGAA m- Ifn-gamma reverse TGGCTCTGCAGGATTTTCATG m- Tgf-beta forward CTCCCGTGGCTTCTAGTGC m- Tgf-beta reverse GCCTTAGTTTGGACAGGATCTG 15 m- Il-22 forward ATGAGTTTTTCCCTTATGGGGAC m- Il-22 reverse GCTGGAAGTTGGACACCTCAA m- Areg forward GCATTTCGCTTATGGTGGA m- Areg reverse TGCTGCTGGTCTTAGGCTC In our study, the Cc2d1a knock out autistic fare model was used and the behavior performed Experiments have shown that these mice exhibit an autistic phenotype. Both the embryos of these mice... This study was conducted in both adult and adult stages. In both male and female siblings of these mice, the Cc2d1a gene was found. Serum in individuals with a mutated genotype in terms of Cc2da and a normal genotype in terms of the Cc2da gene, Cytokine 25 in sperm, ovary, gut, hippocampus and embryonic brain tissues Significant differences in expression levels were found compared to the control group, and this A new study suggests that tissue-specific cytokines could be used as markers in the diagnosis of autism. The method has been determined. The steps of the method are as follows: 1. Taking brain tissue from autistic mice when they are 14 days old embryos (early 30 days of autism) (to identify defects in brain development during this period). Adult autistic mice during that period, that is, when neurological maturity is reached, blood, intestines, sperm, Removal of ovarian and hippocampal tissues (both because they are siblings and...) 6 (Gender differences were emphasized). Total tissue analysis was performed on these obtained tissues using the trizol method. RNA isolation is performed. 2. Blood, intestinal, sperm, ovarian, hippocampal, and embryonic brain tissues were collected. Separation of cDNA from total RNA. Isolated cDNA samples were coated with the designed primers (Il-6, gmcsf, Il-1Beta, Il-1alpha, Il-6, Il-5 5, Il-10, Il-13, Il-17, Il-23, Tnf-alpha, Ifn-gamma, Il-4, Il-5, Il-13, Il-10, Tgf-beta, Il-22 and Areg) expression levels in real-time PCR by treatment determination. Figure Explanation 10 Figure 1. All Stages of the Method Figure 2. Production Stages of Embryonic and Adult Animals. Figure 3. Method Summary Figure 4. Cytokines Identified as Markers in Embryo Brain Tissues Figure 5. Expression of markers to be used to determine the risk of autism in blood serum. 15 levels. Figure 6. Genes and markers to be used in determining the risk of autism in ovarian tissue. protein expression levels. Figure 7. Expression of markers used to determine the risk of autism in sperm tissue. levels. 20 Figure 8. Gene and marker to be used in determining autism risk in intestinal tissue. protein expression levels. Figure 9. Markers in hippocampus tissue to be used in determining the risk of autism. Expression levels. DETAILED DESCRIPTION OF THE INVENTION This detailed description explains the subject of the invention, the Cc2d1a autistic mouse model, both in utero and in adulthood. During this period, the preferred alternatives to investigating inflammation pathways were only 30 for the purpose of better understanding the subject and without imposing any limiting effects This is explained as follows. Cc2d1a autistic mouse adult blood samples showed IL-6 and Gmcsf, and IL-1beta in ovarian tissue. Il-1alpha, Il-6, Il-13, Il-10, Il-5, Il-17, Il-23; Tnf-alpha, Ifn-gamma, Il-4, Il-13, 7 Il-10, Tgf-beta, Il-5, Il-22, Il-23, Areg; Tnf-alpha, Tgf-beta, Il-1beta, IL-6 and IL-10 can be used as markers in intestinal tissue, while IFn-gamma can be used in embryonic tissue. Il-1beta, Il-13, Il-17, Il-4, Il-5, Ifn-gamma, Il-10, Gmcsf and Areg can be used as markers. Therefore, based on our findings, the aforementioned method is used to determine autism risk. This can be done by determining the expression levels of the relevant markers from the tissues obtained, and these 5 In this way, early diagnosis, which is very important in the treatment of autism, can be made and a number of treatment strategies can be developed. This could open the way. The invention proposes autism based on the expression levels of these markers in the relevant tissues. It relates to the method of determining risk. Autism is a neurogenetic disorder. It is a highly complex and heterogeneous multifactorial condition. It is a disorder. This disorder is caused by genetic, environmental, and epigenetic factors. In addition, more than 1000 genes and genomic regions have been implicated in autism. This candidate One of these genes is the Cc2d1a gene. The Cc2d1a gene is involved in the central nervous system. It is a transcription factor. In humans, its homozygous absence is associated with intellectual disability. When associated, the absence of homozygosity in mice resulted in lethality. Result 15 inflammation (NF-κB), which regulates important pathways, primarily cell death. And it is a gene whose absence results in death. In summary, autism-Cc2d1a gene-inflammation-Nf-kb The pathways appear to be intertwined processes. Our results have already proven this. This is the situation. Based on this evidence, in our study; 1. The Cc2d1a knock-out mouse model involves two different developmental stages (embryonic and 20°C). (adult) inflammatory in blood, hippocampus, intestine, sperm and ovarian tissues We determined the basal-level formation of the markers. We analyzed mice at embryonic and... We examined it in two separate periods: embryonic and adulthood. Fathers with mutated Cc2d1a gene and fathers with normal Cc2d1a gene We mated mothers with the specified genotype. Plaque monitoring was performed on day 14 following mating. We monitored whether the mother was pregnant by doing this. We analyzed the embryos of pregnant mothers. We obtained them. The embryos were used at 14 days old. On the 14th day, brain development and an immune response were observed. We chose day 14 because it is an important day for the development of microglia, which are microcellular cells. 2. Separating 14-day-old embryos according to their sex and genotype to extract their brain tissue. We obtained 30 samples, which we determined according to their pro-inflammatory and anti-inflammatory functions. We examined them in terms of markers. 8 3. In adulthood, their fathers also have a mutated cc2d1a gene, and their mothers do. We mated animals that had a normal genotype in terms of the Cc2d1a gene. This We raised the offspring born from the mating until they were 2 months old. 4. Five distinct signs that are indicative of autism were detected in animals that reached neurological maturity at 2 months of age. behavioral experiments (open field, tail hanging, glass bead embedding, social test and 5 We performed novel object recognition. Through these behavioral experiments, we determined the autism phenotype in mice. We determined what they showed. 5. We determined the sex and genotype of the mice and took tissue samples. 6. RNA isolation from collected tissues. We isolated cDNA from RNA and protein. We completed the insulation. 10 7. We analyzed the tissues of the animals using the QPCR method at the gene level and multiplex analysis. Using the ELISA method, we examined inflammatory markers at the protein level. In conclusion, as a new method for diagnosing autism, the embryonic period; IL-4, IL-5, IL- 13, IL-10, and TNF-alpha markers have been identified. In adulthood, autism risk assessment is performed. 15 For blood tissue, IL-6 and Gmcsf were determined as methods. For ovarian and sperm tissue; Cytokines IL-13, IL-10, IL-5, and IL-23 have been identified as markers for hippocampus tissue. TNF-alpha, TGF-beta, 1L-1 beta, 1L-6, and 1L-10 cytokines were identified as markers. Intestinal For tissue, the Ifn-gamma cytokine was identified as a marker. In both females and males. Although inflammatory differences were observed, they were quite consistent with the nature of autism. High heterogeneity is exhibited. In the Cc2d1a autistic mouse model, blood in females and males, basal levels in the gut, particularly in the hippocampus, sperm, and ovarian tissues. inflammation pathways are suppressed, and anti-inflammatory pathways are more active in all tissues. It has been shown to be active. Adult ELISA results also show the gene expression profile. It supports. 25 Autism diagnostic markers are found in autistic children and in the sperm of their fathers and mothers. It is determined in egg tissues as follows: A blood, sperm, or egg sample is taken from the person being tested and quickly sent to the laboratory. Samples of 0.5-1 ml are sufficient. Total RNA isolation is performed from the samples. After this, cDNA isolation is performed. Il-6 and Gmcsf 30 are isolated from the cDNA obtained from the blood. By treating human primers, cDNA obtained from sperm was synthesized with TNf-alpha, Ifn-gamma, Il- By treating human primers 4, IL-5, IL-13, IL-10, Tgf-beta, IL-22, IL-23 and areg, cDNA obtained from eggs contains Il-1beta, Il-1alpha, Il-6, Il-5, Il-13, Il-10, Il-17 and Il-23 9 Expression levels are determined by real-time PCR after treating human primers. and changes in expression levels are examined by comparing it with a control group. Invention Ultimately, it was understood that autism has a genetic-epigenetic nature and is a familial disease. The disease can be caused by different cytokines in different tissues, and familial transmission can occur both paternally. (sperm) and maternal (sperm) play a major role, even more so maternal 5 It can be concluded that this is transferred. Thanks to this discovery, 1) the risk of having an autistic child is reduced. 1) by being identified and 2) through cytokines (especially type 2 cytokines) in the early stages (first three years) In other words, diagnosing autism (IL-4, IL-5, IL-13, and IL-10) will contribute to the development of autism treatment methods. These cytokines and growth factors are involved in the differentiation process and functions of microglia. It plays a critical role in its regulation. In laboratory microglia production, this The molecules are frequently used and various experiments are conducted to understand microglia biology. These studies examine neurodegenerative diseases and neuroinflammatory disorders in various models. new approaches in the treatment of central nervous system diseases such as these conditions It contributes to its development. Cytokines involved in microglia production and 15 in our results Comparing the cytokines that yield significant results suggests that the focus should be on microglia. A method used to determine the risk of autism. • Blood, serum, saliva, or urine samples from autistic patients can be used to identify parents of autistic children. sperm and blood samples from the father, egg and blood samples from the mother who has an autistic child Isolation of total RNA from samples using the trisol method 20 • All stages of the experiments conducted are explained in the figures below. 30

Claims

REQUESTS 1. The invention describes inflammation in utero and adulthood in the Cc2d1a autistic mouse model. It is a method of investigating pathways, and its characteristic feature is; - Embryonic and adult stages Cc2d1a group and control group 5 creation, - Conducting behavioral experiments on the formed groups, - Animal tissues selected from each group of mice after the experiments were completed taking, - RNA isolation from the collected tissues, gene expression (Q-10 (PCR) testing, - Protein isolation and protein analysis using the multiplex ELISA method. Completion of expression studies, - This involves the steps involved in conducting statistical analyses. - According to this study, the risk of being autistic or having an autistic child is 15. At least one of the following listed below shall be used to determine the risk. adverb m-Il-6 forward ACCAGAGGAAATTTTCAATAGGC m-Il-6 reverse TGATGCACTTGCAGAAAACA m-Gmcsf forward ACCACCTATGCGGATTTCAT 20 m-Gmcsf reverse TCATTACGCAGGCACAAAAG m-Il-1alfa forward ATG GTT TTA GAA ATC ATC AAG CCT AGG GCA m-Il-1 alfa reverse ATT GAA AGG AGG GGA GGA TGA CAG AAA TGT m-Il-1beta forward GCCCATCCTCTGTGACTCAT m-Il-1beta reverse AGGCCACAGGTATTTTGTCG 25 m-Il-4 forward TCGGCATTTTGAACGAGG m-Il-4 reverse TGCAGCTCCATGAGAACACTA m-Il-5 forward CTCTTGTTGACAAGCAATGAGAC m-Il-5-reverse TCTTCAGTATGTCTAGCCCCTG m-Il-13 forward GAGCTGAGCAACATCACACA 30 m-Il-13 reverse GTCCTGTAGATGGCATTGC m-Il-10 forward CCCTTTGCTATGGTGTCCTT m-Il-10 reverse TGGTTTCTCTTCCCAAGACC 11 m-Il-17 forward CATGAGTCCAGGGAGAGCTT m-Il-17 reverse GCTGAGCTTTGAGGGATGAT m- Il-23 forward CTGAGGTTCGTGGGATGATT m- Il-23 reverse AAAAGAAACTGGCAGCCTTG m- Tnf-alpha forward TGCCTATGTCTCAGCCTCTT 5 m- Tnf-alpha reverse GAGGCCATTTGGGAACTTCT m-Ifn-gamma forward TCAAGTGGCATAGATGTGGAAGAA m-Ifn-gamma reverse TGGCTCTGCAGGATTTTCATG m- Tgf-beta forward CTCCCGTGGCTTCTAGTGC m- Tgf-beta reverse GCCTTAGTTTGGACAGGATCTG 10 m- Il-22 forward ATGAGTTTTTCCCTTATGGGGAC m- Il-22 reverse GCTGGAAGTTGGACACCTCAA m- Areg forward GCATTTCGCTTATGGTGGA m- Areg reverse TGCTGCTGGTCTTAGGCTC 2. According to Claim 1, the markers indicate a risk of having autism or a child with autism, up to 15. used in the preparation of diagnostic kits for identification purposes 3. A method for determining the risk of being autistic or having a child with autism. feature, a. Trizol method for serum, sperm, ovarian (egg), and intestinal (stool) samples isolating total RNA with 20 b. RNA isolations were performed from the following samples (serum, intestine, sperm, ovary, hippocampus (brain of a 14-day-old embryo) cDNA synthesis takes place c. Primers designed from cDNA samples synthesized from different tissues... 4, IL-5, IL-13, IL-10, IL-6, IL-1 beta, IL-1 alpha, IL-17, IL-22, IL-23, TNF-alpha, IFN-gamma, 25 of the tgf-beta, gmcsf and areg markers in real-time PCR. Determining expression levels. d. Protein samples taken bilaterally from 3 different tissues (serum, intestine, ovary) insulation e. Antibodies designed from tissue samples in which proteins were isolated In the multiplex ELISA method, IL-4, IL-5, IL-13, IL-10, IL-6, IL-1 beta, IL-1 alpha, IL-17, 30 IL-22, IL-23, TNF-alpha, IFN-gamma, TGF-beta, GMCSF and AREG are the end-product proteins. Determining expression levels.