The combination of aronia berry fruit extract and Bifidobacterium longum CB108 postbiotic is supplied for the preparation of a composition for improving skin elasticity.

Abstract

This invention discloses a combination of an extract containing Aronia melanocarpafruit and Bifidobacterium longum CB108 (BCRC 910894) as a postbiotic that can be used to improve skin elasticity.

Description

[Technical Field]

[0001] This invention relates to the use of a combination of an extract containing Aronia melanocarpafruit and Bifidobacterium longum CB108 (BCRC 910894) postbiotic to improve skin elasticity. [Previous Technology]

[0002] Dermal fibroblasts play an important role in maintaining skin elasticity. They can synthesize extracellular matrix (ECM) [including collagen and elastin (ELN)] to provide supporting structure, and secrete inhibitors of matrix metalloproteinases (MMPs) (including TIMP-1) to slow down the degradation of the extracellular matrix by MMPs.

[0003] In recent years, the demand for improved skin elasticity has been increasing, especially the use of natural ingredients that do not produce unwanted adverse side effects on the skin, which has become a current market trend. Therefore, researchers are trying to find safe active components from microorganisms or plants to meet the needs of the market.

[0004] Black chokeberry (scientific name: Aronia melanocarpa; common name: Black chokeberry) is a deciduous shrub belonging to the genus Aronia in the family Rosaceae. It is native to North America and was introduced to Europe. The main part of the black chokeberry used is the fruit, which is believed to have antioxidant effects and improve metabolic diseases.

[0005] In Lee HR et al., (2022), Oxid Med Cell Longev., 2022:4392256, Lee HR et al. found that the ethanol extract of aronia berries can promote collagen synthesis in dermal fibroblasts and inhibit the expression of MMPs.

[0006] To the best of the applicant’s knowledge, no literature or prior patent has disclosed that probiotics can be used in combination with chokeberry extract to improve skin elasticity. [Summary of the Invention]

[0007] Summary of the Invention

[0008] In this invention, the applicant unexpectedly discovered that the combined use of ethanol extract of Aronia melanocarpafruit and Bifidobacterium longum CB108 (BCRC 910894) can synergistically regulate dermal fibroblasts to improve skin elasticity.

[0009] Thus, in a first aspect, the present invention provides a combination of an extract of aronia berries and Bifidobacterium longum CB108 for use in preparing a composition for improving skin elasticity.

[0010] Preferably, the extract of chokeberry fruit is an ethanol extract of chokeberry fruit.

[0011] In a second aspect, the present invention provides a method for improving skin elasticity, comprising administering to an individual in need a combination as described above.

Implementation Method

[0012] Detailed Description of the Invention

[0013] It should be understood that if any prior publication is cited herein, such prior publication does not constitute an admission that it forms part of the common general knowledge in the art in Taiwan or any other country.

[0014] For the purposes of this instruction manual, it will be clearly understood that the word “comprising” means “including but not limited to”, and the word “comprises” has a corresponding meaning.

[0015] The present invention provides a combination of an extract of Aronia melanocarpafruit and Bifidobacterium longum CB108 (BCRC 910894) for use in preparing a composition for improving skin elasticity.

[0016] Preferably, the extract of chokeberry fruit is an ethanol extract of chokeberry fruit.

[0017] According to the present invention, the weight ratio of the ethanol extract of aronia berry fruit to Bifidobacterium longum CB108 is 1:0.01 to 1:100, more preferably 1:0.4 to 1:50. In a preferred embodiment of the present invention, the weight ratio of the ethanol extract of aronia berry fruit to Bifidobacterium longum CB108 is 1:0.4. In another preferred embodiment of the present invention, the weight ratio of the ethanol extract of aronia berry fruit to Bifidobacterium longum CB108 is 1:50.

[0018] According to the present invention, Bifidobacterium longum CB108 can be live or dead bacteria, concentrated or non-concentrated, liquid, paste, semi-solid, or solid [e.g., pellets, granules, or powder], and can be heat-killed, frozen, dried, or freeze-dried [e.g., in freeze-dried or spray / fluid bed dried form]. In a preferred embodiment of the present invention, the Bifidobacterium longum CB108 is heat-killed and in spray-dried powder form.

[0019] According to the present invention, Bifidobacterium longum CB108 can be prepared as a bacterial powder having a bacterial concentration of 10⁷ to 10¹³ cells / g, preferably 10¹⁰ to 10¹² cells / g. In a preferred embodiment of the present invention, the bacterial powder has a bacterial concentration of 10¹¹ cells / g.

[0020] As used herein, the terms “heat-killing” and “heat inactivation” may be used interchangeably and refer to killing probiotics by heat treatment for a predetermined period of time.

[0021] According to the present invention, the heat-killed Bifidobacterium longum CB108 can be obtained using techniques well known and commonly used by those skilled in the art. In this regard, references may be made, for example, to Segawa S. et al. (2008), Int. J. Food Microbiol., 128: 371-377 and Ben Othman M. et al. (2020), Food Res. Int., doi: 10.1016 / j.foodres.2019.108792.

[0022] According to the present invention, the thermal death can be caused by heating at 60°C to 140°C for 1 second to 30 minutes. In a preferred embodiment of the present invention, the thermal death is caused by heating at 73±2°C for 15 seconds.

[0023] According to the present invention, the term "aronia melanocarpafruit" means a fruit containing the pulp (i.e., the edible part) of the aronia melanocarpa. Preferably, the fruit further includes the aronia melanocarpa peel and the seed.

[0024] According to the present invention, the ethanol extract of the wild cheri fruit can be a commercially available product or a product produced by means of techniques known and commonly used by those skilled in the art.

[0025] It is understood that the operating conditions of the extraction method for the ethanol extract of the wild aronia fruit can be further varied depending on factors such as the processing method of the wild aronia fruit used and the ratio of ethanol to wild aronia fruit used, in order to achieve the best extraction effect. The selection of these operating conditions is something that a person skilled in this art can routinely decide on their own.

[0026] According to the present invention, the ethanol extraction of chokeberry fruit can use chokeberry fruit harvested from different origins, including, but not limited to: the United States, India, Europe, China, and combinations thereof. In a preferred embodiment of the present invention, the ethanol extraction of chokeberry fruit uses chokeberry fruit harvested from Poland.

[0027] According to the present invention, the ethanol extraction of aronia berries can be performed using fresh aronia berries, or using aronia berries that have undergone prior processing selected from the group consisting of: drying treatment, grinding treatment, chopping treatment, comminuting treatment, and combinations thereof. In a preferred embodiment of the present invention, the ethanol extraction of aronia berries is performed using comminuted aronia berries.

[0028] According to the present invention, the ethanol extraction of the aronia berry fruit can be carried out using an aronia berry fruit and ethanol solution in a weight ratio of 1:1 to 1:20, preferably 1:3 to 1:8. In a preferred embodiment of the present invention, the ethanol extraction of the aronia berry fruit is carried out using an aronia berry fruit and ethanol solution in a weight ratio of 1:5.

[0029] According to the present invention, the ethanol solution may have a concentration of 0.01% to 95%. In a preferred embodiment of the present invention, the ethanol solution has a concentration of 40%.

[0030] According to the present invention, the ethanol extraction of the aronia berry fruit can be carried out at a temperature of 40°C to 100°C, preferably 75°C to 95°C. In a preferred embodiment of the present invention, the ethanol extraction of the aronia berry fruit is carried out at 85°C.

[0031] According to the present invention, the ethanol extraction of the aronia berry fruit can be carried out for 0.5 to 3 hours. In a preferred embodiment of the present invention, the ethanol extraction of the aronia berry fruit is carried out for 2 hours.

[0032] As used herein, the term "combination" means the combined use of two or more active ingredients for co-administering to an individual requiring treatment. In other words, the active ingredients may be combined into a single dosage form or administered simultaneously in separate dosage forms. Alternatively, the active ingredients may be administered alternately or sequentially in separate dosage forms, spaced apart by a predetermined time interval. Preferably, the length of the predetermined time interval may be adjusted as needed so that the pharmacological effects of the active ingredients in an individual may overlap or not overlap in time. In a preferred embodiment of the invention, the ethanol extract of Aronia arguta fruit and Bifidobacterium longum CB108 are in a single dosage form.

[0033] According to the present invention, the composition may be a food composition, for example, in the form of a food additive, which may be added to an edible material to prepare a food product for human or animal consumption. According to the present invention, the types of food products may include, but are not limited to: health foods, dietary supplements, milk powder, fermented milk, yogurt, butter, beverages (e.g., tea, coffee), functional beverages, flour products, baked foods, confectionery, candies, fermented foods, and animal feeds.

[0034] According to the present invention, the food product may further comprise a food additive widely used in food manufacturing technology, including, but not limited to: starch, dextrin, lactose, maize flour, rice flour, tricalcium phosphate, silicon dioxide, magnesium stearate, calcium carbonate, glucose, sucrose, fructose, sugar alcohol, oligosaccharide, sugar substitute, fruit juice powder, yeast powder, nonfat dry milk, casein, whey protein, amino acid, citric acid, citrate, lactic acid, lactate, and nucleotide.

[0035] According to the present invention, the composition may be a pharmaceutical composition.

[0036] According to the present invention, the pharmaceutical composition may be in a dosage form suitable for oral administration or topical administration.

[0037] According to the present invention, the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier widely used in pharmaceutical manufacturing techniques. For example, the pharmaceutically acceptable carrier may comprise one or more reagents selected from the following: solvent, buffer, emulsifier, suspending agent, decomposer, disintegrating agent, dispersing agent, binding agent, excipient, stabilizing agent, chelating agent, diluent, gelling agent, preservative, wetting agent, lubricant, absorption delaying agent, liposome, and the like. The selection and quantity of these reagents fall within the scope of professional competence and routine practice of those skilled in the art.

[0038] According to the present invention, the pharmaceutical composition can be manufactured into a dosage form suitable for oral administration using techniques known to those skilled in the art, including, but not limited to: sterile powders, tablets, troche, lozenges, pellets, capsules, dispersible powders or granules, solutions, suspensions, emulsions, syrups, elixirs, slurries, and the like.

[0039] According to the present invention, the pharmaceutical composition can also be manufactured into an external preparation suitable for topical application to the skin using techniques known to those skilled in the art, including, but not limited to: emulsion, gel, ointment, cream, patch, liniment, powder, aerosol, spray, lotion, serum, paste, foam, drop, suspension, salve, and bandage.

[0040] According to the present invention, the external formulation is prepared by mixing the pharmaceutical composition of the present invention with a base known to those skilled in the art.

[0041] According to the present invention, the substrate may contain one or more additives selected from the following: water, alcohols, glycols, hydrocarbons [such as petroleum jelly and white petrolatum], waxes [such as paraffin and yellow wax], preserving agents, antioxidants, surfactants, absorption enhancers, stabilizing agents, gelling agents [such as carbopol® 941, microcrystalline cellulose, and carboxymethylcellulose], active agents, humectants, odor absorbers, fragrances, pH adjusting agents, chelating agents. Agents, emulsifiers, occlusive agents, softeners, thickeners, solubilizing agents, penetration enhancers, anti-irritants, colorants, and propellants, etc. The selection and quantity of these additives fall within the scope of professional expertise and routine techniques of those familiar with this technology.

[0042] According to the present invention, the composition may be a cosmeceutical composition.

[0043] According to the present invention, the cosmeceutical composition may further comprise a pharmaceutically acceptable carrier as described above and / or a cosmetically acceptable adjuvant widely used in cosmetic manufacturing techniques. For example, the cosmetically acceptable adjuvant may comprise one or more reagents selected from the following: solvents, gelling agents, surfactants, preservatives, antioxidants, screening agents, chelating agents, surfactants, coloring agents, thickening agents, fillers, fragrances, and odor absorbers. The selection and quantity of these reagents fall within the scope of professional competence and routine practice of those skilled in the art.

[0044] According to the present invention, the cosmeceutical composition can be manufactured in a form suitable for skincare or makeup using techniques known to those skilled in the art, including, but not limited to: aqueous solutions, aqueous-alcohol solutions, or oily solutions, in an oil-in-water type, or in a water-in-oil type. Emulsions, gels, ointments, creams, masks, patches, packs, liniments, powders, aerosols, sprays, lotions, serums, pastes, foams, dispersions, drops, suspensions, salves, bandages, mousses, sunblocks, toners, foundations, eyeshadows, makeup removers, soaps, and other body cleansing products (type) or compound types.

[0045] The present invention also provides a method for improving skin elasticity, comprising administering to an individual in need a combination as described above.

[0046] As used herein, the terms “administering” and “administration” may be used interchangeably and mean introducing, providing or delivering a predetermined active ingredient to an individual by any suitable means to perform its intended effect.

[0047] As used herein, the term “subject” means any mammal of interest, such as humans, monkeys, cows, sheep, horses, pigs, goats, dogs, cats, mice, and rats.

[0048] According to the present invention, the dosage and frequency of administration of the combination may vary depending on the following factors: the severity of the condition to be improved, the route of administration, and the age, physical condition, and response of the individual to be improved. Generally, the combination may be administered in a single dose or in several doses. Detailed Description of Preferred Embodiments

[0049] The present invention will be further described with reference to the following embodiments, but it should be understood that these embodiments are for illustrative purposes only and should not be construed as limiting the implementation of the present invention. General experimental materials for the embodiments: 1. Bifidobacterium longum CB108:

[0050] The *Bifidobacterium longum* CB108 used in the following examples was obtained from the Microbiology Laboratory of the Department of Food Science and Biotechnology at National Chung Hsing University. It has been disclosed in TWI 1802009 B (corresponding to US 12090182 B2) and was deposited on May 8, 2019, with registration number BCRC 910894 at the Bioresource Collection and Research Center (BCRC) of the Food Industry Research and Development Institute (FIRDI) (No. 331, Food Rd., Hsinchu City, Taiwan 300), and on June 9, 2021, with registration number DSM 33895, in accordance with the provisions of the Budapest Treaty at the German Microbiology and Cell Culture Collection Center GmbH. Zellkulturen GmbH, DSMZ). 2. Preparation of heat-killed bacterial powder of Bifidobacterium longum CB108:

[0051] The preparation of the heat-killed bacterial powder of Bifidobacterium longum CB108 (hereinafter referred to as "Bifidobacterium longum CB108 postbiotic") was generally carried out in accordance with the method described in TW I802009 B. In short, the Bifidobacterium longum CB108 described in item 1 above was inoculated into MRS broth medium (BD Difco, Cat. No. DF0881-17-5) and cultured at 37°C for 16 hours. Then, the obtained Bifidobacterium longum CB108 bacterial suspension was heat-killed at 73±2°C for 15 seconds using a high temperature short time (HTST) method, followed by centrifugation and removal of the supernatant. The resulting precipitates were then subjected to spray-drying treatment to obtain the Bifidobacterium longum CB108 postbiotic (with a bacterial concentration of 10¹¹ cells / g). 3. Preparation of ethanol extract from Aronia melanocarpafruit:

[0052] The aronia berry fruit (including peel, pulp, and seeds) was washed with deionized water and homogenized using a homogenizer. Then, 100 g of the resulting fruit mixture was mixed with 500 mL of 40% ethanol and extracted at 85°C for 120 minutes. The resulting mixture was then filtered, and the filtrate was collected and dried under reduced pressure to obtain a powdered ethanol extract of aronia berry fruit. Example 1. Evaluation of the efficacy of the combination of ethanol extract of aronia berry fruit and Bifidobacterium longum CB108 in promoting the expression of extracellular matrix (ECM)-related genes. Experimental materials: 1. Source and culture of skin cells:

[0053] The human skin fibroblast CCD-966SK (BCRC 60153) used in the following examples was obtained from the Bioresource Collection and Research Center (BCRC) of the Food Industry Research and Development Institute (FIRDI) in Taiwan.

[0054] CCD-966SK cells were cultured in 10 cm cell culture dishes containing minimum essential medium (MEM) (Sigma, Cat. No. M4526) [containing 10% fetal bovine serum (FBS) (Sigma, Cat. No. F7524), 1.5 g / L sodium bicarbonate (Sigma, Cat. No. S5761), 1 mM sodium pyruvate (Sigma, Cat. No. P2256), 1 mM non-essential amino acids (MEM NEAA) (Sigma, Cat. No. M7145), and 1% penicillin-streptomycin (Sigma, Cat. No. P4333)] and cultured in an incubator with culture conditions set at 37°C and 5% CO2. Afterward, the culture medium was changed to fresh medium approximately every 2-3 days. When the cell density reached approximately 80-90% confluence, subculture was performed. Experimental method: A. Drug administration to skin cells:

[0055] First, CCD-966SK cells were divided into four groups: one control group, two comparison groups (i.e., comparison groups 1 and 2), and one experimental group. Next, each group of CCD-966SK cells was cultured at a density of 6 × 10⁵ cells in 6-cm culture dishes containing 5 mL of minimum essential medium, and then incubated at 37°C, 5% CO₂ for 24 hours. Afterward, the cell cultures of each group were replaced with fresh medium, and comparison groups 1, 2, and the experimental group were treated with the *Bifidobacterium longum* CB108 postbiotic and ethanol extracts of *Aquilaria sinensis* fruit obtained from items 2 and 3 of "General Experimental Materials" as shown in Table 1 below. The control group was left untreated. After culturing at 37°C for 24 hours, the cells from each group were harvested and analyzed in section B below. Table 1. Treatments for each group Group Final concentration (μg / mL) Bifidobacterium longum CB108 postbiotic Ethanol extract of chokeberry fruit Comparison Group 1 - 200 Comparison Group 2 10000 - experimental group 5000 100 B. Determination of the relative expression levels of ECM-related genes:

[0056] First, total RNAs were extracted using a Total RNA Purification Kit (GeneDirex, Cat. No. NA017-0100) and following the manufacturer's instructions. Next, the obtained total RNAs were reverse transcribed using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat. No. 4368813) according to the manufacturer's instructions to synthesize first-strand cDNA.

[0057] Subsequently, using the obtained first cDNA as a template, and with the primer pairs shown in Table 2 below for the genes of collagen type III α1 (COL3A1), tissue inhibitor of metalloproteinases-1 (TIMP-1), and elastin (ELN), quantitative real-time polymerase chain reaction (hereinafter referred to as quantitative real-time PCR) was performed using a StepOne™ Real-Time PCR System according to the manufacturer's instructions. Additionally, the expression of the β-actin gene was used as an internal control. The operating and reaction conditions for quantitative real-time PCR are shown in Table 3 below. Table 2. Primers used for quantitative real-time PCR target gene NCBI Login Number Introduction Nucleotide sequence (5'→3') COL3A1 NM_000090 Forward induction COL3A1-F accaggagagaagggatcgc Reverse primer COL3A1-R ttcccctaggacctggcatg TIMP-1 NM_003254 Forward induction TIMP-1-F accagaccaccttataccagcg Inverted primer TIMP-1-R ggactggaagcccttttcagag ELN M36860 Forward induction ELN-F ggcctggaggcaaacctctt Reverse primer ELN-R ccaccaactcctgggacacc β-actin EF036500 Forward Introduction β-actin-F tcacccacactgtgcccatctacga Reverse pull β-actin-R cagcggaaccgctcattgccaatgg Table 3. Reaction conditions for quantitative real-time PCR Contents Volume (µL) The first cDNA sample (10 ng / µL) 1 Forward inductor (10 µM) 1 Reverse primer (10 µM) 1 KAPA SYBR © FAST qPCR Master Mix premixed reagent (KAPA biosystems) 5 sterile water 2 Operating conditions: Denaturation was performed at 95°C for 20 seconds; followed by 40 cycles of denaturation at 90°C for 30 seconds, and primer annealing and extension at 60°C for 30 seconds.

[0058] The PCR products obtained therefrom were detected by fluorescence using SYBR Green (double-stranded DNA-binding dye), and the cycle threshold (Ct) value of each gene was calculated accordingly. The relative expression level of ECM-related genes in each group was calculated by using the comparative Ct method, which normalized the cycle threshold of each ECM-related gene to the cycle threshold of the β-actin gene, and then divided by the normalized cycle threshold of the ECM-related genes obtained from the control group.

[0059] Subsequently, each group's experiment was repeated three times, and the experimental data are expressed as "mean ± standard error of the mean (SEM)". All data were analyzed using an independent samples t-test to assess differences between groups. A p-value < 0.05 was considered statistically significant. Results:

[0060] Figures 1 to 3 show the relative expression levels of COL3A1, TIMP-1, and ELN genes measured in each group. As can be seen from Figures 1 to 3, compared to the control group, comparison groups 1 and 2 showed varying degrees of improvement in the relative expression levels of COL3A1, TIMP-1, and ELN genes, while the experimental groups all showed significant improvements. Specifically, the relative expression levels of COL3A1, TIMP-1, and ELN genes in the experimental groups were significantly higher than those in comparison group 1, and the relative mRNA expression levels of TIMP-1 and ELN genes were significantly higher than those in comparison group 2. This experimental result shows that the combined use of ethanol extract of aronia berries and Bifidobacterium longum CB108 is significantly more effective than either ingredient alone in promoting the expression of ECM-related genes in dermal fibroblasts. Based on this, the applicant believes that the combination of ethanol extract of aronia berry fruit and Bifidobacterium longum CB108 can improve skin elasticity by synergistically promoting the synthesis of ECM by dermal fibroblasts. Therefore, the applicant further conducted the following experiment. Example 2. Evaluation of the efficacy of the combination of ethanol extract of aronia berry fruit and Bifidobacterium longum CB108 in improving skin elasticity: Experimental subjects:

[0061] After screening according to the exclusion criteria shown in Table 4 below, a total of 9 female subjects aged between 24 and 48 years participated in this trial. Table 4 Exclusion Criteria Item illustrate 1 Individual with skin disease 2 Pregnant women 3 Breastfeeding women 4 Those who took medications that affected their skin condition during the trial period 5 Those who underwent cosmetic procedures during the trial period 6 Those who were exposed to intense sun during the trial Experimental methods:

[0062] First, according to the dosages shown in Table 5 below, the Bifidobacterium longum CB108 postbiotic obtained from items 2 and 3 of "General Experimental Materials" above was mixed with the ethanol extract of Aronia chinensis fruit and made into capsules (i.e., capsule 1). The ethanol extract of Aronia chinensis fruit and maltodextrin were separately made into capsules (i.e., capsules 2 and 3). Table 5 Composition of capsules 1 to 3 capsule Ingredients (mg) maltodextrin Ethanol extract of chokeberry fruit Bifidobacterium longum CB108 postbiotic Capsule 1 150 250 100 Capsule 2 - 500 - Capsule 3 500 - -

[0063] Next, all subjects were randomly divided into one experimental group (n=3), one control group (n=3), and one control group (n=3). According to Table 6 below, different capsules were administered to each group, one capsule daily, for a total of 14 days. Table 6: Capsules administered to each group Group capsule experimental group Capsule 1 Comparison group Capsule 2 control group Capsule 3

[0064] Before the start of medication (i.e., day 0) and on day 14 after the start of medication, the skin elasticity index of the entire face of each group of subjects was measured using the Focuskin full-face skin analyzer (purchased from Precision Biomedical Co., Ltd.). The lower the skin elasticity index, the better the skin elasticity. The rate of change of skin elasticity was calculated by substituting the skin elasticity index measured by each group before the start of medication and on day 14 after the start of medication into the following formula (1): Formula (1): A = (BC) / B Where: A = rate of change of skin elasticity B = skin elasticity index measured by each group before the start of medication C = skin elasticity index result measured by each group on day 14 after the start of medication:

[0065] Table 6 shows the rate of change in skin elasticity measured in each group of subjects. As can be seen from Table 6, after 14 days of testing, the skin elasticity of the control group showed a decreasing trend, the skin elasticity of the comparison group showed only a slight increase, while the skin elasticity of the experimental group showed a significant increase, with an increase of up to 1.5 times that of the comparison group. This experimental result shows that combining Bifidobacterium longum CB108 with the ethanol extract of aronia berry fruit can significantly enhance its efficacy in improving skin elasticity and can greatly reduce the amount of ethanol extract of aronia berry fruit required. Table 6 Rate of change in skin elasticity measured in each group Group Change rate of skin elasticity (%) control group -4.5 Comparison group 6.1 experimental group 9.1

[0066] Based on the above experimental results, it can be seen that the combination of ethanol extract of wild cheriberry fruit and Bifidobacterium longum CB108 can synergistically promote the synthesis of ECM by skin fibroblasts and improve skin elasticity.

[0067] All patents and documents cited in this specification are incorporated herein by reference in their entirety. In the event of any conflict, the detailed description (including its definition) herein shall prevail.

[0068] Although the present invention has been described with reference to the specific examples described above, it is apparent that many modifications and variations can be made without departing from the scope and spirit of the invention. Therefore, it is intended that the invention be limited only to those shown in the claims appended herein. [Simplified Explanation of the Diagram]

[0069] The above and other objects, features and advantages of the present invention will become apparent upon reference to the following detailed description and preferred embodiments and the accompanying drawings, wherein: Figures 1 to 3 show the relative expression levels of the COL3A1, TIMP-1 and ELN genes measured in each group of CCD-966SK cells, respectively, wherein “*” indicates that when compared with the control group, p < 0.05; “#” indicates that when compared with comparison group 1, p < 0.05; and “$” indicates that when compared with comparison group 2, p < 0.05.

Claims

1. The use of a combination of an ethanol extract of Aronia melanocarpafruit and Bifidobacterium longum CB108 (BCRC 910894) for the preparation of a composition for improving skin elasticity.

2. As claimed in claim 1, wherein the ethanol extract of the wild cheri fruit has a weight ratio of 1:0.01 to 1:100 with Bifidobacterium longum CB108.

3. As claimed in claim 1, wherein the component is a food component.

4. As claimed in claim 1, wherein the composition is a pharmaceutical composition.

5. As claimed in claim 4, wherein the pharmaceutical composition is in a dosage form for oral or topical administration.

6. As requested in claim 1, wherein the composition is a cosmeceutical composition.

Images