A method of generating an induced pluripotent stem cell, an induced pluripotent stem cell and methods of using the induced pluripotent stem cell

Abstract

This invention relates to a method for generating induced pluripotent stem cells (iPSCs). The method comprises expressing exogenous nucleic acids encoding OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC proteins and p53-shRNA in stem cells from the umbilical cord amnion under conditions suitable for reprogramming stem cells, thereby generating iPSCs. This invention also relates to an iPSC population obtainable by this method and an iPSC population obtained by this method. Furthermore, it relates to a pharmaceutical composition comprising the iPSCs of this invention. This invention also relates to a method for differentiating the iPSCs of this invention. Furthermore, it relates to a pharmaceutical composition comprising differentiated iPSCs obtained by this method. Additionally, this invention relates to a method for treating an individual with congenital or acquired degenerative diseases, comprising administering target cells differentiated from pluripotent stem cells to the individual.

Description

Technical Field

[0001] Cross-reference to related applications. This application claims priority to U.S. Provisional Application No. 63 / 054,206, filed July 20, 2020, the entire contents of which are incorporated herein by reference for all purposes.

[0002] This invention relates to a method for generating induced pluripotent stem cells. Furthermore, this invention relates to a population of induced pluripotent stem cells obtainable by this method, and to a population of induced pluripotent stem cells obtained by this method. This invention also relates to a pharmaceutical composition comprising the induced pluripotent stem cells of this invention. This invention further relates to a method for differentiating the induced pluripotent stem cells of this invention. Furthermore, it relates to a pharmaceutical composition comprising differentiated induced pluripotent stem cells obtained by this method. Additionally, this invention relates to a method for treating an individual's congenital or acquired degenerative diseases, comprising administering target cells differentiated from pluripotent stem cells to the individual. Prior Technology

[0003] Stem cells are populations of cells with the unlimited capacity for self-renewal and differentiation into various cell or tissue types. This self-renewal capacity is crucial for their function as a reservoir of primitive, undifferentiated cells; stem cell "plasticity" depends on their ability to transdifferentiate into tissues different from their origin and can potentially differentiate across embryonic germ layers. In contrast, most somatic cells have only limited self-renewal capacity due to telomere shortening (e.g., in the review in Dice, JF (1993) Physiol. Rev. 73, 149-159). Therefore, stem cell-based therapies hold promise for treating a wide range of human and animal diseases.

[0004] Embryonic stem cells (approximately day 3 to 5 post-fertilization) proliferate indefinitely and can spontaneously differentiate into all tissue types; therefore, they are called pluripotent stem cells (e.g., in a review in Smith, AG (2001) Annu. Rev. Cell. Dev. Biol. 17, 435-462). Despite the immense potential of embryonic stem cells, their use raises numerous ethical concerns. Therefore, non-embryonic stem cells have been proposed as alternative sources.

[0005] Adult stem cells are more tissue-specific and may have less replicative capacity; therefore, they are called pluripotent stem cells (e.g., in a review in Paul, G. et al. (2002) Drug Discov. Today 7, 295-302). These cells can be derived from bone marrow matrix, adipose tissue, and dermis, and have the ability to differentiate, in particular, into chondrocytes, adipocytes, osteoblasts, myogenes, cardiomyocytes, astrocytes, and tendon cells. However, in many cases, the number of stem cells extracted from bone marrow matrix, adipose tissue, dermis, and umbilical cord blood is quite small.

[0006] Very young and adaptable adult stem cells (also known as neonatal stem cells) are synthesized from umbilical cord blood or tissue or placenta. For example, a large number of stem cells can be derived from umbilical cord tissue, specifically from Wharton's jelly in the umbilical cord stroma (Mitchell, KE et al. (2003) Stem Cells 21, 50-60; U.S. Patent No. 5,919,702; U.S. Patent Application Publication No. 2004 / 0136967). These cells have been shown to have the ability to differentiate, for example, into neuronal phenotypes and cartilage tissue. Mesenchymal stem cells have also been isolated from the subendothelial layer of the umbilical vein, one of the three vessels (two arteries and one vein) found in the umbilical cord (Romanov, YA et al. (2003) Stem Cells 21, 105-110; Covas, DT et al. (2003) Braz. J. Med. Biol. Res. 36, 1179-1183). Furthermore, mesenchymal stem cells and epithelial stem cells have been successfully isolated from the amniocentesis tissue of the umbilical cord (US Patent Application Publication No. 2006 / 0078993). For example, while mesenchymal stem cells can differentiate in vitro and in vivo, making them promising candidates for mesodermal defect repair and disease management, the use of adult stem cells is limited by their pluripotency. To overcome this limitation, non-embryonic cells can be reprogrammed into pluripotent stem cells: so-called induced pluripotent stem cells (iPS).

[0007] iPS was originally coined by Takahashi and Yamanaka, who reprogrammed non-embryonic cells into a pluripotent state by overexpressing four transcription factors: OCT3 / 4, SOX2, KLF4, and CMYC (also known as Yamanaka factors) (Takahashi, K. & Yamanaka, S. (2006), Cell, 126(4), pp. 663–676). Specifically, Takahashi and Yamanaka used mouse embryonic fibroblasts and introduced Yamanaka factors via retroviral transduction, thereby allowing the overexpression of these transcription factors and producing cells exhibiting embryonic cell morphology and growth characteristics. Although this approach was a significant breakthrough, the transduction process could lead to the incorporation of transferred DNA into the host cell's genome, jeopardizing the therapeutic potential of iPS in humans. Okita, K. et al., Nature methods, 8(5), pp. 409–412, developed a non-integrative alternative for generating iPS in 2011. Okita et al. used electroporation to transfer three additional plasmonic vectors encoding the Yamanaka factor, along with p53 shRNA for p53 inhibition, into human dermal fibroblasts and dental pulp, causing overexpression of this exogenous DNA and thereby generating unintegrated human iPSs. To support the growth and maintenance of these unintegrated human iPSs, Okita et al., ibid., cultured iPSs on a feeder layer composed of mouse embryonic fibroblast (MEF) or STO cell lines, the STO cell lines having been transfected with neomycin resistance and the mouse LIF gene (SNL). However, culturing on a feeder layer may introduce the risk of exogenous DNA contamination of the iPSs. Therefore, according to Okita et al., ibid., such unintegrated iPSs may also jeopardize therapeutic efficacy in humans.

[0008] Ten years after its initial conception, iPS technology has entered the clinical application stage, with the first human trials conducted for age-related macular degeneration (AMD; Mandai, M. et al., N Engl J Med, 2017, 376(11): p. 1038-1046) and Parkinson's disease (PD; Reardon, S. and Cyranoski, D. (2014) 'Japan stem-cell thermal stirs envy', Nature. England, pp. 287–288. doi: 10.1038 / 513287a). The greatest promise of iPS technology lies in its potential to realize autologous cell therapy, which may avoid the need for long-term immunosuppression or tissue compatibility pairing to prevent rejection of transplanted cells. This paradigm has been demonstrated in non-human primate models using fibroblast and bone marrow-derived iPS (Morizane, A. et al., Stem Cell Reports, 2013, 1(4): p. 283-92; Hallett, PJ et al., Cell Stem Cell, 2015, 16(3): p. 269-74; Wang, S. et al., Cell Discov, 2015, 1: p. 15012; Shiba, Y. et al., Nature, 2016. 538(7625): p. 388-391), and forms the basis for the first human trial of iPS-based AMD cell therapy (Mandai, M. et al., N Engl J Med, 2017, 376(11): p. 1038-1046). However, the significant time and cost associated with producing clinical-grade iPS will make large-scale implementation for human treatment unlikely. Furthermore, there are situations where generating autologous iPS cells from patients may be impractical. For example, for patients carrying pathogenic mutations, these mutations must first be corrected before iPS cells from these patients can be used. This is feasible when the mutations are easily manageable, but in cases where the mutations are difficult to manage, such as sporadic forms of many diseases, gene correction strategies may not be feasible.

[0009] Therefore, alternative methods for generating iPS cells, wherein the generated iPS cells can differentiate into target cells suitable for therapeutic treatment in humans, remain needed. Therefore, the object of this invention is to provide a method for generating and differentiating iPS cells that meet these requirements. Summary of the Invention

[0010] This invention relates to a method for generating induced pluripotent stem cells as described herein, an induced pluripotent stem cell generated therefrom, a method for differentiating induced pluripotent stem cells, and a method for treating individual diseases with differentiated cells derived from induced pluripotent stem cells.

[0011] In a first aspect, the present invention provides a method for generating induced pluripotent stem cells, wherein the method includes expressing exogenous nucleic acids encoding OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC proteins and p53-shRNA in stem cells of the umbilical cord amnion under conditions suitable for reprogramming stem cells, thereby generating induced pluripotent stem cells. In a specific embodiment of the method, the umbilical cord amnion stem cells are umbilical cord amnion mesenchymal stem cells or umbilical cord amnion epithelial stem cells.

[0012] In a second aspect, the present invention also provides an induced pluripotent stem cell population that can be obtained by this method and an induced pluripotent stem cell population obtained by this method. The induced pluripotent stem cell population may be an induced pluripotent stem cell population derived from mesenchymal stem cells (population) of the umbilical cord amnion or an induced pluripotent stem cell population derived from epithelial stem cells (population) of the umbilical cord amnion.

[0013] In a third aspect, the present invention also provides a pharmaceutical composition comprising the induced pluripotent stem cells of the present invention.

[0014] In a fourth aspect, the present invention provides a method for differentiating the induced pluripotent stem cells of the present invention into target cells, wherein the induced pluripotent stem cells differentiate into target cells under suitable differentiation conditions. Therefore, the present invention also provides a pharmaceutical composition comprising induced pluripotent stem cells differentiated through the present invention.

[0015] In a fifth aspect, the present invention provides a method for treating an individual’s congenital or acquired degenerative disease, comprising administering to an individual target cells differentiated from pluripotent stem cells obtained through the present invention.

[0016] In a sixth aspect, the present invention provides an extracellular membrane vesicle generated from the induced pluripotent stem cell population of the present invention or from cells differentiated through the induced pluripotent stem cells of the present invention. This sixth aspect further includes the use of such extracellular membrane vesicles of the present invention as a delivery carrier for a therapeutic agent.

[0017] In a seventh aspect, the present invention provides a cell culture medium comprising mammary epithelial basal medium MCDB 170, EpiLife medium, DMEM (Dulbecco modified Eagle medium), F12 (Ham's F12 medium) and fetal bovine serum (FBS). Simple Explanation of the Diagram

[0018] The invention will be better understood when considered in conjunction with the non-limiting embodiments and the accompanying drawings, and with reference to the detailed description, in which:

[0019] [Figure] 1 shows a flowchart illustrating the experimental steps of a schematic embodiment of the method for generating the induced pluripotent stem cells of the present invention. The stem cells used herein are isolated from the umbilical cord amnion—also known as cord lining stem cells (CLSCs). This embodiment begins by harvesting isolated CLSCs by separating cells from a cell culture device (however, it should be noted here that CLSCs can also be provided in an isolated form to the method of the present invention). The number of CLSCs is then counted, approximately 700,000 cells are aliquoted into microcentrifuge tubes, and the cells are precipitated. The cell pellet is resuspended in a buffer suitable for electroporation before adding plastids encoding the Yamanaka factor to the cell buffer mixture. Electroporation is performed on cord lining mesenchymal cells (CLMCs) and cord lining epithelial cells (CLECs) with a single pulse of 1600 V for approximately 20 ms or two pulses of 1350 V for 30 ms, respectively. Following electroporation, stem cells were immediately transferred to a recovery medium containing compounds that inhibited inflammation and enhanced cell survival. After an appropriate recovery period, the recovery medium was replaced with a 1:1 mixture of two different cell culture media: the recovery medium and a second cell culture medium. To refresh the cell culture medium, the mixture was replaced with the same cell culture medium mixture approximately 4 days after electroporation. This resulted in umbilical cord liner-induced pluripotent stem cell colonies (also referred to herein as CLiPS). After approximately 2 days, the 1:1 mixture of the two different cell culture media was replaced with the second cell culture medium. The medium was also changed approximately every other day to maintain its freshness. When the diameter reached approximately 0.5 mm to 1.5 mm, the CLiPS colonies were picked and transferred to coated cell culture vessels suitable for cell culture and proliferation. Again, the cell culture medium was periodically changed with the same medium. After achieving approximately 50% cell coverage, the CLiPS colonies were isolated from the coated culture apparatus and transferred to another suitable cell culture vessel for cell culture and proliferation. This further isolated the CLiPS colonies. When approximately 70-80% cell coverage was achieved, the CLiPS were subcultured at a ratio of approximately 1:3 (v / v), where subculture was performed by contacting one volume of isolated CLiPS with two volumes of fresh culture medium. The CLiPS were then cultured in a medium containing cell viability promoters until approximately 30-60% cell coverage was achieved.At this point, CLiPS cells are able to differentiate into any desired target cell type.

[0020] [Figure]2 illustrates an exemplary comparison of reprogramming efficiencies for individual CLSC populations. Stem cells were transfected with exogenous nucleic acids using different electroporation settings. Electroporation was performed using the electroporation parameters (1650V, 10 ms, 3 pulses) described by Okita et al., as above. The parameters used for transfection of each cell type in this invention were: umbilical cord amniotic epithelial stem cells (also referred to herein as "umbilical cord liner epithelial stem cells" or CLEC, 1350V, 30 ms, 2 pulses), and umbilical cord amniotic mesenchymal stem cells (also referred to herein as umbilical cord liner mesenchymal stem cells or CLMC, 1600V, 20 ms, 1 pulse). 200K transfected cells were seeded in 6-well plates for triple replicates. Approximately 21 days post-transfection, the percentage of reprogramming efficiency was calculated as community number / 200,000 x 10.

[0021] [Figure] 3 shows an exemplary community development of induced pluripotent stem cells from human CLMCs. [3a-f] shows representative time processes of community development, in which [picture] [3a] shows the typical morphology of human CLMCs cultured in their maintenance medium on day 0 of culture. Figure [3b] shows the typical morphology of human CLMCs cultured in their maintenance medium on day 15 of culture. Figure [3c] shows the typical morphology of human CLMCs cultured in their maintenance medium on day 24 of culture. [3d] shows the typical morphology of human CLMCs cultured in their maintenance medium on day 29 of culture. Figure [3e] shows a 4x magnified view of the typical morphology of the first generation of an iPS community. [3f] shows a 10x magnified view of a typical morphology of an iPS community during its first generation. [3g-l] shows an exemplary immunofluorescence staining of iPS cells derived from human umbilical cord liner cells, demonstrating the activation of endogenous expression of pluripotent embryonic stem cell markers, wherein Figure [3g-l] is shown. [3g] shows the performance of KLF4, Figure [3h] shows the performance of NANOG, Figure [3i] shows the performance of OCT3 / 4, Figure [3j] shows the behavior of SOX2, Figure [3k] shows the performance of SSEA4, and the graph... [3l] shows the performance of Tra-1-60. [3m] shows an exemplary karyotype analysis, demonstrating the normal chromosome number and G-banding of CLiPS cells in individual cell lines CLEC23 (EC23-CLiPS), CLMC23 (MC23-CLiPS), CLEC44 (EC44-CLiPS), and CLMC44 (MC44-CLiPS). [3n] shows a 20x magnified image of an exemplary human CLMSC-DTHN culture that appeared 10 days after reprogramming. [3o] shows a 4x magnified image of the morphology of expanded human CLMSC-DTHN cells cultured on a laminin-511 matrix. [3p] shows a 10x magnified image of the morphology of expanded human CLMSC-DTHN cells cultured on a laminin-511 matrix. [3q] shows a 20x magnified image of the morphology of expanded human CLMSC-DTHN cells cultured on a laminin-511 matrix. [3r] shows an exemplary performance of the human pluripotent marker NANOG in third-generation CLMSC-DTHN iPS. [Figure]3s shows an exemplary performance of the human pluripotent marker OCT3 / 4 in the third-generation CLMSC-DTHN iPS. [Figure] 3t shows an exemplary performance of the human pluripotent marker SOX2 in the third-generation CLMSC-DTHN iPS. [Figure 3u] illustrates the exemplary performance of the human pluripotent marker NTRA-1-81 in third-generation CLMSC-DTHN iPS cells. Scale bar: All scale bars are 100 µm. [3v] shows exemplary RT-PCR analyses of reprogrammed gene and pluripotent gene expression in primary parental cells, parental cells 11 days post-vector transfection (D11 transfected cells), and established iPS selective lines (CLiPS). "Vec" indicates specific amplification of the vector-derived sequence. Glycerinal dehyd-3-phosphat-dehydrogenase (GAPDH) was used as an internal control. PCR of unreverse-transcribed human (H1) total RNA was used to control for genomic contamination of all primer pairs.

[0022] [Figure] 4 shows an exemplary histological analysis of teratomas formed in immunocompromised, non-obese diabetic severely combined immunodeficiency (NOD-SCID) mice after injection of CLiPS. Teratoma formation analysis reveals the formation of all three germ layers. [4a] [Illustration] shows a teratoma obtained from human CLEC-derived iPS three months after subcutaneous injection. Further analysis of the teratoma sections was performed using hematoxylin and eosin staining. Figure [4a] shows the presence of respiratory epithelium-like structures in teratomas. [picture] [4b] shows the presence of glandular structures representing the endoderm in a teratoma. (See figure...) In [4c], the arrow indicates the presence of cartilage within the teratoma. [picture] In [4d], the arrows indicate the presence of mesodermal skeletons within a teratoma. [4e] shows the presence of kidney tissue in a teratoma. Solid arrows indicate glomeruli, and hollow arrows indicate renal tubules.

[0023] At In Figure 4f, the arrows indicate the presence of ectodermal neuroepithelium in teratomas. Using a directed differentiation approach, CLiPS were induced to differentiate into specific tissues. [4g] shows CLiPS cells differentiating into hepatocytes, stained with alpha-fetoprotein (AFP) and 4',6-diamidino-2-phenylindole (DAPI). Figure [4h] shows CLiPS cells differentiating into hepatocytes, stained with human serum albumin (HAS), cytokeratin 18 (CK18), and DAPI. [4i] shows CLiPS cells differentiating into hepatocytes, stained with Oil Red O. Figure [4j] shows CLiPS cells differentiating into cardiomyocytes, stained with alpha-actinin (αACT), cardiac troponin I (cTnl), myosin regulatory light chain 2a (MLC2a), and DAPI. Figure [4k] shows CLiPS cells differentiating into dopamine neurons, stained with the basement marker FOXA2, the top plate marker LMX1A, and DAPI. [4l] shows CLiPS cells differentiating into dopamine neurons, as indicated by neuron-specific type III β-tubulin (TUJI) and tyrosine hydroxylase (TH) staining. Figure [4n] shows CLiPS differentiated into oligodendritic glial precursor cells, as indicated by OLIG2 and DAPI staining. [4o] shows CLiPS differentiated into oligodendritic glial precursor cells, as indicated by O4 and DAPI staining. [4m] shows the electrophysiological analysis of mature human CLiPS-derived dopamine neurons on day 45 of differentiation. These human CLiPS-derived dopamine neurons elicit a series of action potentials via injected current. Scale bar: Figure [4a] [Figure] 4c and [picture] The scale bar in [4d] is 200 μm; Figure [4b] [Figure] 4e and [picture] The scale bar in [4f] is 100 μm; Figure [4g] [Figure] 4h [,picture] [4i], Figure 4k [,picture] [4l] The scale bar in Figure 4m is 50 μm; Figure [4j] The scale bar in Figure 4n is 25 μm.

[0024] Figure 5 illustrates exemplary directed differentiation of human CLiPS cells into various cell types. [5a] shows human CLiPS-derived neurons as indicated by TH, Tuik, and DAPI staining. [5b] shows human CLiPS-derived hepatocytes stained with CK18, HAS, and DAPI. [5c] shows human CLiPS-derived cardiomyocytes stained with cTnl, αAct, and DAPI, and figure [ ]. [5d] shows an electrophysiological analysis of contracted human CLiPS-derived cardiomyocytes, revealing cells that generate spontaneous action potentials.

[0025] [Figure] 6 shows exemplary flow cytometry analyses of major histocompatibility complex (MHC) types I and II, and the expression of T cell co-stimulatory proteins on iPS cells and dopamine-producing neural progenitor cells. [6a] shows a flow cytometry atlas of the expression of immune-related genes on undifferentiated iPS cells. [6b] shows a flow cytometry analysis of a population positive for neural cell adhesion molecule (NCAM). These populations were gated to analyze the expression of immune-related proteins. Figure [6c] shows an analysis of the expression of immune-related proteins on dopamine-producing neural progenitor cells differentiated to day 25.

[0026] [Figure 7] shows an in vivo comparison of implantation of dopamine neuronal progenitor cells (NPCs) from human CLiPS and human adult fibroblast-iPS (asF-iPS) in NOD-SCID mice. Dopamine NPCs differentiated to day 25 were injected into the striatum of NOD-SCID mice to assess their implantation and differentiation potential in an immunodeficient environment. TH immunoreactive dopamine neurons are present in abundant human NCAM-positive transplanted neurons. [7a] shows the in vivo transplantation of dopamine NPCs from human asF-iPS differentiation to day 25. [7b] shows the in vivo implantation of dopamine NPCs from human CLEC-iPS (EC23 CLiPS) on day 25 after differentiation. [7c] shows the in vivo implantation of dopamine NPCs from CLMC-iPS (MC23-CLiPS) differentiation to day 25. [7d] shows antibody staining of the transplanted hemisphere in an immunocompetent C57BL / 6NTac mouse model of Parkinson's Disease (PD) established one month after transplantation of human CLEC iPS-derived dopamine NPCs. Numerous human NCAM (green) and TH (red) double-positive neurons are present at the injection site. [7e] shows long neuronal processes originating from the transplantation site, projecting along the large forceps of the corpus callosum to distant regions of the brain. The arrows in [7f] indicate human NCAM and TH double-positive neurons, which are abundant at the injection site, as shown by the arrows. Figure [7g] shows the relationship with [Figure] The opposite non-transplanted hemisphere with the same cross-section shown in Figure 7d. [7h] indicates that no surviving cells were observed in the striatum of transplanted adult human asF-iPS-derived NPCs, suggesting immune rejection. Figure [7i] shows abundant microglia / macrophage aggregation in the transplanted hemisphere. Figure [7j] shows the absence of microglia / macrophage aggregation in the non-transplanted hemisphere. Figure [7k] shows [Figure] Higher magnification of 7i. It can be seen that the microglia located proximal and internally of the graft exhibit more amoeba-like morphological characteristics of activated microglia. Figure [7l] shows [Figure] A higher magnification of 7k shows the performance of CD68, a marker for microglial cell activation. Scale bar: Figure [7a-c] and [Figure] The scale bar in 7k is 100 μm; Figure [7d] [Image] 7g and [picture] The scale bar in [7h] is 200 μm; Figure [7e] [Figure] 7f and [picture] The scale bar in [7l] is 50 μm.

[0027] Figure 8 shows the survival rate of human CLEC-derived (EC23-CLiPS) dopamine neurons in a mouse PD model 9 months after transplantation. [8a] represents HuNu+ / hNCAM+ / TH+ neurons present in the transplanted hemisphere. Figure [8b] is [Figure] Overlay diagram of 8c-f, as shown in the figure. [8a] Higher magnification of the area within the square frame. [picture] [8c] indicates hNCAM+ neurons present in the transplanted hemisphere. Figure [8d] indicates the HuNu+ neurons present in the transplanted hemisphere. Figure [8e] indicates TH+ neurons present in the transplanted hemisphere. Figure [8f] represents the nucleus of a neuron present in the transplanted hemisphere. [picture] [8g] This describes the experimental procedures beginning with the induction of PD lesions by injecting 6-hydroxydopamine (6-OHDA) into the striatum of C57BL / 6NTac mice. Pre-transplant rotational behavior analysis was performed one and two weeks prior to NPC transplantation. Figure [8h] shows the results of apomorphine-induced rotation asymmetry analysis in mice transplanted with dopamine NPCs differentiated from human EC23-CLiPS and asF-iPS, as well as in sham controls. Measurements were performed every two weeks post-transplantation until week 22. From week 20 post-transplantation, animals in the human EC23-CLiPS group showed statistically significant rotation recovery compared to the asF-iPS group (n=5, p<0.05). No recovery was observed in the sham-operated group. Figure [8i] shows representative in vivo positron emission tomography (PET) images of [18F]PE-P2I ligand uptake to assess the recovery of dopamine transporter (DAT) function in striatal dopamine neurons 6 months post-transplantation. Mice transplanted with human EC23-iPS NPCs showed a recovery of DAT activity compared to mice transplanted with human asF-iPS NPCs or sham controls. Scale bar: Figure The scale bar in [8a] is 200 µm; Figure The scale bar in [8b-f] is 100 µm.

[0028] [Figure]9 shows an exemplary in vivo PET imaging of striatal dopamine production in transplanted mice. The PET illustrates the uptake of the [18F]PE P21 ligand to assess the recovery of dopamine transporter (DAT) function in striatal dopamine neurons 6 months after iPS-derived NPCs transplantation. Mice transplanted with human CLEC iPS-derived NPCs showed significantly restored DAT activity compared to mice transplanted with human adult iPS-derived NPCs or sham transplantation controls.

[0029] [Figure] 10 illustrates the maintenance of human CLiPS-derived grafts in vivo at 6 and 9 months post-implantation into the mouse brain. The grafts were positive for human antigen NCAM and TH dopamine markers. Tumor formation was not recorded. Scale bar: 50 µm.

[0030] [Figure]11 shows the results of histological and functional analysis of transplanted human EC23-CLiPS dopamine NPCs in a PD medial forebrain bundle (MFB) lesion model, which was created in fully immunocompetent Wistar Hannover rats. [Figure] 11a shows human EC23-CLiPS neurons implanted in the striatum region of a rat brain three months after transplantation, as evidenced by positive double staining of human cytoplasm (STEM 121) and human nuclear antigen (HuNu) antibody. This staining indicates functional recovery. [11b] indicates the co-localization of synaptic protein 1 immunoreactivity with hNCAM+ / TH+ neurons, suggesting that transplanted human CLiPS-derived cells may integrate with host tissues 3 months post-transplantation. Figure [11c] shows retrograde damage to the dopamine system in the substantia nigra of the rat brain. [picture] [11d] Image showing an undamaged rat brain, confirmed by tyrosine hydroxylase (TH) immunostaining. [11c] Retrograde damage to the dopamine system in the substantia nigra. [picture] [11e] shows the results of apomorphine-induced rotational asymmetry assays in rats transplanted with dopamine NPCs differentiated from human CLEC23 iPS. The results indicate that, over a 6-month study period, CLiPS-NPC transplantation modulated the recovery of functional motor deficits in a PD rat MFB model. Scale bar: Figure [11a] and The scale in Figure 11b is 100 µm; Figure [11c] and The scale bar in Figure 11d is 200 µm.

[0031] [Figure] 12a [、] [b] and c respectively show exemplary populations of induced pluripotent stem cells derived from human CLECs generated by using PTTe-3 culture medium as a recovery medium. Implementation

[0032] This invention relates to a method for generating induced pluripotent stem cells (iPS) from stem cells in the umbilical cord amnion under conditions suitable for reprogramming stem cells.

[0033] In this invention, mesenchymal stem cells and epithelial stem cells of the umbilical cord amnion—collectively referred to herein as cord lining stem cells (CLSCs)—are used to generate iPSs—also referred to herein as cord lining-derived induced pluripotent stem cells or "CLiPSs". Surprisingly, the cord lining-derived induced pluripotent stem cells of this invention are robust and homogeneous stem cells capable of differentiating into functional target cells of different lineages (see Examples 3 and 4). For example, cord lining-derived induced pluripotent stem cells have the ability to differentiate into various cell types, such as hepatocytes representing endoderm tissue (see Example 8), cardiomyocytes representing mesodermal tissue (see Example 9), and dopamine neurons (see Example 7) and oligodendroglial cells representing ectoderm tissue (see Example 10). More surprisingly and importantly, it was found that, for example, human CLiPS-derived dopamine neurons could be functionally transplanted in different species and survive for up to 9 months in an immunosuppressed mouse model of Parkinson's disease (PD) and 6 months in an immunosuppressed rat model of PD (see Examples 12 and 13). Therefore, in summary, the inventors have generated a low-immunogenic cell source that can be transplanted, integrated, and modulated for therapeutic recovery in a host with full immune activity. The umbilical cord lining-derived induced pluripotent stem cells of this invention have the potential to serve as a universal cell source for human allogeneic cell transplantation without immunosuppression, making them ideal candidates for such cell-based therapies. As a further advantage, it was found that the umbilical cord lining-derived induced pluripotent stem cells of this invention can be generated through an integrated, trophoblast-free method, thereby allowing the production of iPSs under current good manufacturing practice (cGMP) conditions. With the recent establishment of GMP processes for the mass production of umbilical cord amniotic mesenchymal stem cells (see PCT International Application Publication No. WO 2018 / 067071 or US Patent Application Publication No. US2018127721), this invention provides an ideal platform for the production of iPS for subsequent cell therapies in humans or animals.

[0034] The method for generating the iPS of this invention is now described first, which may include exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, L-MYC, and p53-shRNA. The nucleic acid encoding OCT3 / 4 (SEQ ID No: 1), sometimes also referred to as POU5FL, OCT3, or OCT4, encodes octamer-binding transcription factor 4. OCT3 / 4 (SEQ ID No: 2) forms a heterodimer with SOX2 to regulate pluripotency factors in cells. SOX2 (SEQ ID No: 3), sometimes also referred to as SEY, encodes the sex-determining region Y-box 2 transcription factor (SEQ ID No: 4). When bound to OCT3 / 4, SOX2 binds to a non-palindromic genomic sequence, thereby activating the transcription of pluripotency factors in cells. KLF4 (SEQ ID No: 5), sometimes also referred to as GKLF, encodes a Krueppel-like factor 4. KLF4 (SEQ ID No: 6) is a zinc finger transcription factor that acts as a tumor suppressor, controlling the G1-G2 transition of the cell cycle by regulating the tumor suppressor p53. L-MYC (SEQ ID No: 7) encodes a transcription factor that activates the expression of proliferative genes (SEQ ID No: 8). LIN28 (SEQ ID No: 9) encodes the RNA-binding protein Lin-28 homolog A (SEQ ID No: 10), which regulates stem cell self-renewal. p53-shRNA (SEQ ID No: 11) encodes a small hairpin RNA targeting p53, a protein that regulates the cell cycle by arresting it when it accumulates in the cell. To prevent p53 from arresting the cell cycle, p53-shRNA may silence p53 expression post-transcriptionally. To generate CLiPS, exogenous nucleic acids encoding OCT3 / 4, SOX2, KLF4, LIN28, L-MYC, and p53-shRNA can be transferred to CLSCs for expression. Alternatively, proteins OCT3 / 4, SOX2, KLF4, LIN28, L-MYC, and p53 shRNA can be directly transferred to the CLSC.

[0035] As described above, the induced pluripotent stem cell population of the present invention can be obtained by reprogramming umbilical cord amniotic stem cells. Umbilical cord stem cells can be (isolated) mesenchymal stem cells of the umbilical cord amnion, also known as umbilical cord liner mesenchymal stem cells (CLMC), or (isolated) umbilical cord amniotic epithelial stem cells, also known as umbilical cord liner epithelial stem cells (CLEC). The CLECs and CLMCs used to generate the iPS of the present invention can be derived from any mammalian species, such as mice, rats, guinea pigs, rabbits, goats, horses, dogs, cats, sheep, monkeys, or humans; in one specific embodiment, the stem cells are preferably of human origin. Therefore, the iPS of the present invention can also be derived from any mammalian species, such as mice, rats, guinea pigs, rabbits, goats, horses, dogs, cats, sheep, monkeys, or humans; in one specific embodiment, the stem cells are preferably of human origin.

[0036] If umbilical cord amniotic epithelial stem cells are used as the starting material, these epithelial stem cells can be obtained as described in U.S. Patent Application Publication No. 2006 / 0078993 (and subsequently, granted U.S. Patents Nos. 9,085,755 and 9,737,568) or their corresponding International Patent Application Publication No. WO2006 / 019357. If umbilical cord amniotic mesenchymal stem cells are used as the starting material, these cells can also be obtained as described in U.S. Patent Application Publication No. 2006 / 0078993 (and subsequently, granted U.S. Patents Nos. 9,085,755 and 9,737,568) or their corresponding International Patent Application Publication No. WO2006 / 019357.

[0037] Mesenchymal stem cell populations described in published U.S. Application Publication No. 2018 / 127721 or its corresponding International Application Publication No. WO 2018 / 067071 can also be used as starting materials. The advantage of the mesenchymal stem cell population in International Application Publication No. WO 2018 / 067071 is that 99% or more of this population is positive for the three mesenchymal stem cell markers CD73 and CD90, while lacking expression of CD34, CD45, and HLA-DR. This indicates that 99% or even more of the mesenchymal stem cell population in International Application Publication No. WO 2018 / 067071 expresses the stem cell markers CD73, CD90, and CD105, but not the markers CD34, CD45, and HLA-DR. This highly homogeneous and well-defined cell population is an ideal candidate for clinical trials and cell-based therapies because it fully meets the generally accepted criteria for human mesenchymal stem cells used in cell therapy, such as those defined by Dominici et al., “Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement,” Cytotherapy (2006), Vol. 8, No. 4, pp. 315-317; Sensebe et al., “Production of mesenchymal stromal / stem cells according to good manufacturing practices: a, review,” Stem Cell Research & Therapy, 2013, 4:66; Vonk et al., Stem Cell Research & Therapy (2015), 6:94; or Kundrotas, Acta Medica Lituanica, 2012, Vol. 19, No. 2, pp. 75–79. Therefore, the mesenchymal stem cell population disclosed in International Application Publication No. WO 2018 / 067071 is an ideal starting material for producing the CLiPS of this invention under GMP conditions.

[0038] In this case, it should be noted that transgenic CLMCs will retain their stemness and stem cell characteristics, but may show a decrease in the percentage of cells expressing mesenchymal stem cell markers such as CD73, CD90, and CD105, and may also show an increase in the percentage of cells expressing negative markers such as CD34, CD45, or HLA-DR. See, Yap et al., Malaysian J Pathol 2009; 31(2): 113-120; see also Madeira et al., Journal of Biomedicine and Biotechnology, Vol. 2010, No. 735349, p. 12. In view of this, the CLiPS of the present invention, which have been generated by reprogramming the CLMC described herein and isolated from the amnion of the umbilical cord, may be a population of stem cells in which at least about 81% or more, about 82% or more, at least 83% or more, at least 84% or more, at least about 85%, or about 86% or more, about 87% or more, about 88% or more, about 89% or more, about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more may express each of the following markers: CD73, CD90, and CD105. Furthermore, the CLMC-derived induced pluripotent stem cell populations of this invention may contain at least about 81% or more, about 82% or more, at least 83% or more, at least 84% or more, at least about 85%, or about 86% or more, about 87% or more, about 88% or more, about 89% or more, about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% of the cells that may lack expression of each of CD34, CD45, and HLA-DR. A preferred embodiment of such CLMC-derived induced pluripotent stem cell populations of the present invention may be in which at least about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more of the CLMC population express each of CD73, CD90 and CD105 and lack expression of each of CD34, CD45 and HLA-DR.

[0039] Returning again to the generation of induced pluripotent stem cells (populations) of the present invention, it is important to note that such induced pluripotent stem cells can be obtained by any suitable method of reprogramming umbilical cord amniotic stem cells (populations) into such induced pluripotent stem cells (populations). While one method of generating such induced pluripotent stem cells includes expressing exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC and p53-shRNA in umbilical cord amniotic stem cells under conditions suitable for reprogramming stem cells to generate induced pluripotent stem cells, the present invention is not limited to CLiPS obtained by this method. Instead, CLiPS can be obtained by any suitable method, such as that reviewed in Cieslar-Probuda et al., "Transdifferentiation and reprogramming: Overview of the processes, their similarities and differences," BBA – Molecular Cell Research, Vol. 1864, No. 7, July 2017, pp. 1359-1369. For example, in this invention, reprogramming can also be carried out chemically using small molecules, or biologically by expressing exogenous nucleic acids encoding reprogramming factors within cells. Alternatively, exogenous nucleic acids encoding proteins OCT3 / 4, SOX2, KLF4, LIN28, L-MYC, and p53 shRNA can be provided as any suitable nucleic acid for expression. For example, the nucleic acid can be deoxyribonucleic acid (DNA), ribonucleic acid (RNA) containing messenger RNA (mRNA), and microRNA (miRNA). The exogenous nucleic acid can be transferred as is, or the exogenous nucleic acid can be incorporated into one or more vectors suitable for transfer into cells. In this case, any vector suitable for transfer into CLSCs can be used. An illustrative example of such a vector is a plastid. In this invention, the exogenous nucleic acid can be provided by one, two, three, or four vectors suitable for transfer into stem cells. In one illustrative example, three vectors may be provided to provide exogenous nucleic acids for reprogramming CLSCs into CLiPSs, wherein the vector may be pCXLE-hOCT3 / 4-shp53-F (Addgene plasmid #27077; SEQ ID No: 12), pCXLE-hSK (Addgene plasmid #27078; SEQ ID No: 13), and pCXLE-hUL (Addgene plasmid #27080; SEQ ID No: 14).

[0040] Based on the above, any method suitable for transferring exogenous nucleic acids or proteins into CSLCs can be used. In one embodiment, a viral vector can be used to transfer exogenous nucleic acids into CSLCs. Examples of such viral vectors may be retroviruses, lentiviruses, inducible lentiviruses, Sendai viruses, or adenoviruses. Alternatively, transfection can be performed to transfer exogenous nucleic acids into CSLCs. In this invention, transfection may include electroporation, microinjection, liposomes, and non-liposome-regulated transfection and acoustic transfection.

[0041] In a preferred embodiment, CLSCs can be electroporated, wherein the electrical parameters can be adjusted according to the type of CLSC used, as CLMCs may require different electroporation conditions than CLECs. The electrical parameters may include the number of electrical pulses applied to the stem cells, the duration of the applied electrical pulses, and the voltage of the applied electrical pulses. Each electrical parameter can be adjusted to further optimize the electroporation of the present invention. When doing so, each electrical parameter can be adjusted independently or in combination with one or more other electrical parameters (see Example 1). In the present invention, any parameter settings suitable for allowing the transfer of exogenous nucleic acids to CLSCs can be applied. In one embodiment of the present invention, CLMCs can be electroporated. In this case, electroporation can be performed with a single electrical pulse, which may have a duration of about 15 milliseconds (ms) to about 25 ms and a voltage of about 1550V to about 1650V. Therefore, in one embodiment, CLMCs can be electroporated with a single electrical pulse, which may have a duration of about 20 ms and a voltage of about 1600V. Furthermore, it has been found in this paper that the available amount / number of electroporation filaments for producing CLiPS derived from CLMCs depends on the ratio of each transfected vector (plastoma) DNA to the number of CLMCs used for transfection. Herein, this ratio is expressed as the amount (in µg) of each vector (plastoma) DNA in a fixed number of CLMCs (in 1 x 10⁶ cells) used for electroporation. In illustrative examples, the ratio of the amount of vector (plastoma) DNA per vector to the number of cells can range from approximately 1.5 μg DNA to approximately 1 x 10⁶ CLMCs to approximately 2.5 μg DNA to approximately 1 x 10⁶ CLMCs. Therefore, the ratio can be approximately 2.5 μg DNA to approximately 1 x 10⁶ CLMCs, approximately 2.25 μg DNA to approximately 1 x 10⁶ CLMCs, approximately 1.8 μg DNA to approximately 1 x 10⁶ CLMCs, approximately 1.7 μg DNA to approximately 1 x 10⁶ CLMCs, approximately 1.67 μg DNA to approximately 1 x 10⁶ CLMCs, approximately 1.6 μg DNA to approximately 1 x 10⁶ CLMCs, or approximately 1.5 μg DNA to approximately 1 x 10⁶ CLMCs (see Table 1, which shows that the ratio of carrier (plastomer) DNA per plastid to the number of cells is approximately 1.67 μg DNA to approximately 1 x 10⁶ CLMCs for efficient transformation yield). Therefore, in one specific embodiment for producing CLiPS derived from CLMCs, it is preferable to use each carrier in the same amount during electroporation of the CLMCs. CLECs can also be electroporated to produce the CLiPS of the present invention. In the case of CLiPS derived from CLEC, electroporation can be performed using two electrical pulses, each pulse having a duration of approximately 25 ms to approximately 35 ms and a voltage of approximately 1300 V to approximately 1400 V.Therefore, in one embodiment, CLECs can be electroporated with two electrical pulses, each pulse having a duration of approximately 30 ms and a voltage of approximately 1350 V. Regarding CLMCs, it has also been found that for CLiPS derived from CLECs, the usable amount / number of CLiPS derived from CLECs produced by electroporation depends on the ratio of the amount of DNA per plastid transfected cell to the number of CLECs used for transfection. This ratio is also expressed herein as the ratio of the amount of vector (plastid) DNA used for transfection (in µg) to the number of CLECs to be transfected (in 1 x 10⁶ cells). In illustrative embodiments, the ratio of vector (plastid) DNA to the number of cells can range from approximately 1.5 μg DNA to approximately 1 x 10⁶ CLECs to approximately 2.5 μg DNA to approximately 1 x 10⁶ CLECs. Therefore, this ratio can be approximately 1.5 μg DNA to approximately 1 x 10⁶ CLECs, approximately 1.6 μg DNA to approximately 1 x 10⁶ CLECs, approximately 1.67 μg DNA to approximately 1 x 10⁶ CLECs, approximately 1.7 μg DNA to approximately 1 x 10⁶ CLECs, approximately 1.8 μg DNA to approximately 1 x 10⁶ CLECs, approximately 1.9 μg DNA to approximately 1 x 10⁶ CLECs, approximately 2.0 μg DNA to approximately 1 x 10⁶ CLECs, or approximately 2.5 μg DNA to approximately 1 x 10⁶ CLECs (see Table 1, showing that the ratio of plasmid DNA to cell number using each vector provides an effective transformation rate of approximately 1.67 μg DNA to approximately 1 x 10⁶ CLECs). Therefore, in one specific embodiment producing CliPS derived from CLECs, it is preferable to use each vector in the same amount during electroporation of the CLECs. Electroporation of CLECs and CLMCs can be performed in a uniform electric field using the method described in this invention. Therefore, key consequences of electroporation, such as pH changes, ion formation, or heating, can be minimized. A uniform electric field can be generated by maximizing the gap between electrodes while minimizing the surface area of ​​each electrode. One illustrative example of a system providing such a uniform electric field is the Neon™ transfection system from Thermo Fisher Scientific. Another example of a suitable commercially available transfection system is the Gene Pulser MXcell electroporation system, available from Bio-Rad. Finally, transfection can be performed using any suitable electroporation buffer. If a commercially available transfection system, such as the Neon™ transfection system, is used, electroporation is typically performed using the appropriate electroporation buffer provided by the transfection system manufacturer.

[0042] Following transfection, stem cells can be transferred to a culture medium suitable for cell recovery and cell culture. In this invention, any cell culture medium suitable for cell recovery and / or proliferation can be used. Illustrative examples of such suitable cell culture media include those commonly used for culturing (proliferating) human induced pluripotent stem cells, such as mTeSR1, StemMACS™ iPS-Brew XF, TeSRTM-E8, mTeSRTMPlus, TeSRTM2, and mTeSRTM1. Any culture medium capable of supporting the proliferation (undifferentiated) / healthy growth of CLECs or CLMCs can also be used for cell recovery culture. Examples of suitable culture media for such CLEC culture are described in U.S. Patent Application Publication No. 2006 / 0078993, including EpiLife medium, medium 171, MEGM-mammary epithelial cell medium, or mixtures of such media, such as PTT-e3 medium (used herein to generate CLiPS derived from CLECs and described in detail below). Examples of suitable culture media for such CLMC culture include those described in U.S. Patent Application Publications 2006 / 0078993 and 2018 / 127721 and International Patent Application Publication WO2007 / 046775, including DMEM / 10% FBS, DMEM:F12 medium (a 1:1 mixture of DMEM and Ham's F-12 medium), or media such as PPT-6 (a medium containing DMEM, F12-medium, medium 171, and FBS, see U.S. Patent Application Publication 2018 / 127721) or PTT4 (the latter of which has been used in the examples paragraphs herein to generate CLiPS derived from CLMCs). Cell recovery culture mixtures of these media (e.g., a mixture of mTeSR1 with medium PTTe-3 or medium PTT-4) may also be used. Culture media suitable for cell recovery of transfected CLECs or CLMCs as described herein may also contain growth factors that stimulate cell growth and proliferation. Growth factors may be added to the cell culture medium as is. In addition, the recovery medium may contain serum, such as fetal bovine serum (FBS). Therefore, the medium suitable for cell recovery after transfection can be serum-free or serum-containing.

[0043] According to the above disclosure, the composition of the culture medium suitable for cell recovery may vary depending on the CLSC used.

[0044] For example, a culture medium suitable for post-transfection CLMC recovery can consist of a (chemically) defined medium and FBS. Therefore, a culture medium suitable for post-transfection CLMC recovery can consist of approximately 80% (v / v), approximately 85% (v / v), approximately 90% (v / v), or approximately 95% (v / v) of a chemically defined medium and approximately 20% (v / v), approximately 15% (v / v), approximately 10% (v / v), or approximately 5% (v / v) of FBS. In a preferred embodiment, CLMCs are cultured in PTT-4 medium for post-transfection cell recovery, wherein, as described in International Patent Application Publication No. WO2007 / 046775, the PTT-4 medium consists of 90% (v / v) CMRL 1066 and 10% (v / v) FBS. A culture medium suitable for post-transfection CLEC recovery can be a serum-free medium, wherein the medium may contain cytokines and growth factors.

[0045] This method is also applicable to CLEC recovery media after transfection, which can be media with defined components. Such recovery media may include mammary epithelial basal medium MCDB 170, EpiLife medium, DMEM (Dulbecco's modified Eagle medium), F12 (Ham's F12 medium), and FBS (fetal bovine serum).

[0046] In illustrative embodiments, such culture media comprise MCDB 170 basal breast epithelial medium at a final concentration of about 10% to about 30% (v / v), EpiLife medium at a final concentration of about 20% to about 40% (v / v), F12 at a final concentration of about 5% to about 15% (v / v), DMEM at a final concentration of about 30% to about 45% (v / v), and FBS at a final concentration of about 0.1% to 2% (v / v). Such a culture medium may comprise MCDB 170 basal breast epithelial medium at a final concentration of about 15% to about 25% (v / v), EpiLife medium at a final concentration of about 25% to about 35% (v / v), F12 at a final concentration of about 7.5% to about 13% (v / v), DMEM at a final concentration of about 35% to about 40% (v / v), and FBS at a final concentration of about 0.5% to 1.5% (v / v). Another such culture medium may comprise MCDB 170 basal mammary epithelial medium at a final concentration of approximately 20% (v / v), EpiLife medium at a final concentration of approximately 30% (v / v), F12 at a final concentration of approximately 12.5% ​​(v / v), DMEM at a final concentration of approximately 37.5% (v / v), and FBS at a final concentration of approximately 1.0% (v / v). As used herein, the value of "% (v / v)" refers to the volume of a single component relative to the final volume of the culture medium. This means, for example, if DMEM is present in the culture medium at a final concentration of approximately 35% to approximately 40% (v / v), then 1 liter of culture medium contains approximately 350 ml to 400 ml of DMEM. In one specific embodiment, a culture medium suitable for the recovery of transfected CLEC cells is obtained by mixing to obtain a final volume of 1000 ml. - 200 ml MCDB 170 basal culture medium for mammary epithelial cells - 300 ml EpiLife culture medium, - 250 ml DMEM, - 250 ml DMEM / F12, and - 1% fetal bovine serum.

[0047] Growth factors suitable for post-transfection CLEC recovery in the culture medium may include insulin-like growth factor (IGF), such as IGF-1 or IGF-2; epidermal growth factor (EGF), such as HB-EGF or EPR; transforming growth factor (TGF), such as TGF-α or TGF-β1; activin; bone morphogenic protein (BMP); platelet-derived growth factor (PDGF); transferrin; and insulin. In one embodiment, CLECs are cultured in PTTe-3 medium for post-transfection cell recovery, wherein PTTe-3 medium contains human epidermal growth factor (EGF), one or more transforming growth factors, such as TGF-α and / or TGF-β (TGF-β1, TGF-β2, and / or TGF-β3), or insulin.

[0048] As described above, a culture medium suitable for CLEC recovery after transfection may contain human epidermal growth factor (EGF) at a final concentration of about 1 to about 15 ng / ml. The recovery medium may also contain insulin at a final concentration of about 1 to about 7.5 μg / ml. The recovery medium may further contain at least one of the following additives: adenine, hydrocorticosterone, and sodium 3,3',5-triiodo-L-thyroxine (T3). In one specific embodiment, the culture medium contains adenine, hydrocorticosterone, and all three of the following: sodium 3,3',5-triiodo-L-thyroxine (T3). In this case, the culture medium may contain adenine at a final concentration of about 0.05 to about 0.1 mM, hydrocorticosterone at a final concentration of about 0.1 to 0.5 μM, and sodium 3,3',5-triiodo-L-thyroxine (T3) at a final concentration of about 0.1 to about 5 ng / ml. The recovery medium may contain one of several transforming growth factors (TGFs), such as transforming growth factor β1 (TGF-β1) and / or transforming growth factor α (TGF-α). In such a medium, TGF-β1 may be present at a final concentration of about 0.1 to about 5 ng / ml, and TGF-α may be present at a final concentration of about 1.0 to about 10 ng / ml. Furthermore, the CLEC recovery medium may contain cholera toxin from Vibrio cholerae (commercially available, e.g., from Sigma Aldrich, model C8052). If cholera toxin from Vibrio cholerae is used, it may be present at a final concentration of about 1 x 10⁻¹¹ M to about 1 x 10⁻¹⁰ M.

[0049] "DMEM" refers to the modified Eagle medium developed by Dulbecco in 1969, an improvement on the basal medium Eagle (BME) (see Figure 1, showing the DMEM data sheet available from Lonza). The original DMEM formulation contained 1000 mg / L glucose and was first reported for culturing embryonic mouse cells. Since then, DMEM has become the standard medium for cell culture and is commercially available from various sources, including Thermo Fisher Scientific (model 11965-084), Sigma Aldrich (model D5546), and Lonza, to name just a few. Therefore, any commercially available DMEM can be used in this invention. In a preferred embodiment, the DMEM used herein is DMEM medium available from Lonza, model 12-604F. This medium is DMEM supplemented with 4.5 g / L glucose and L-glutamic acid. In another preferred embodiment, the DMEM used herein is Sigma Aldrich's D5546 DMEM medium, which contains 1000 mg / L glucose and sodium bicarbonate, but does not contain L-glutamic acid.

[0050] "F12" medium refers to Ham's F12 medium. This medium is also a standard cell culture medium, a nutrient mixture originally designed for culturing various mammalian and hybridoma cells when used in conjunction with serum, hormones, and transferrin. Any commercially available Ham's F12 medium (e.g., from ThermoFisher Scientific (model 11765-054), Sigma Aldrich (model N4888), or Lonza, to name just a few suppliers) can be used in this invention. In a preferred embodiment, Ham's F12 medium from Lonza is used. "DMEM / F12" or "DMEM:F12" refers to a 1:1 mixture of DMEM and Ham's F12 medium. Furthermore, DMEM / F12 (1:1) medium is a widely used basal medium for supporting the growth of many different mammalian cells and is available from various suppliers such as ThermoFisher Scientific (model 11330057), Sigma Aldrich (model D6421), or Lonza. Any commercially available DMEM:F12 medium can be used in this invention. In a preferred embodiment, the DMEM:F12 medium used herein is a DMEM / F12 (1:1) medium (which is DMEM:F12 with added L-glutamic acid, 15 mM HEPES and 3.151 g / L glucose) available from Lonza, product number 12-719F.

[0051] "M171" refers to medium 171, which has been developed as a basal medium for culturing normal human mammary epithelial cells. Furthermore, this basal medium is widely used and available from suppliers such as ThermoFisher Scientific or Life Technologies (model M171500). Any commercially available M171 medium can be used in this invention. In a preferred embodiment, the M171 medium used herein is the M171 medium available from Life Technologies (model M171500).

[0052] "MCDB 170 basal culture medium for mammary epithelial cells" refers to a basic nutrient culture medium used for the growth of mammary epithelial cells. It is commercially available in powder form, for example, from United States Biological, Salem, Massachusetts, USA, model M2162, or from Bio-Connect BV, Huysen, Netherlands, model (MBS652676_10l).

[0053] EpiLife medium refers to HEPES and bicarbonate-buffered saline medium that does not contain calcium chloride. It is commonly used for long-term serum-free culture of human epidermal keratinocytes and human corneal epithelial cells, and is designed for incubation in an environment of 5% CO2 and 95% atmospheric pressure. It is available from Thermo Fisher Scientific, model MEPICF500, or from Sigma Aldrich, product code E 0151.

[0054] "CMRL medium" refers to the medium originally developed by Connaught Medical Research Laboratories for culturing Earle's 'L' cells under serum-free conditions. When supplemented with horse or calf serum, CMRL medium is also particularly suitable for the growth of selected monkey kidney cells and other mammalian cell lines. CMRL medium is commercially available, for example from Thermo Fisher Scientific (model 11530037).

[0055] "FBS" refers to fetal bovine serum (also known as "fetal calf serum"), which is the portion of blood remaining after natural clotting, followed by centrifugation to remove any remaining red blood cells. FBS is the most widely used serum supplement for eukaryotic cell culture in vitro because it has a very low antibody content and contains a high concentration of growth factors, making it versatile in many different cell culture applications. FBS is preferably obtained from members of the International Serum Industry Association (ISIA), which focuses on ensuring the safety and safe use of serum and animal-derived products through appropriate traceability, label authenticity, and proper standardization and oversight. ISIA member FBS suppliers include Abattoir Basics, Animal Technologies, Biomin Biotechnologia LTDA, GE Healthcare, Gibco (a subsidiary of Thermo Fisher Scientific), and Life Science Production, to name a few. In the present preferred embodiment, FBS is obtained from GE Healthcare, model A15-151.

[0056] Culture media suitable for cell recovery may also contain compounds that inhibit inflammatory responses and / or enhance post-transfected cell survival and proliferation. An illustrative example of such a compound is a glucocorticoid. Glucocorticoids are steroid hormones that upregulate the expression of anti-inflammatory proteins in the cell nucleus and inhibit the expression of pro-inflammatory proteins in the cytoplasm. The glucocorticoids used herein may be prednisolone, methylprednisolone, dexamethasone, betamethasone, corticosterone, or hydrocortisone, to name only a few exemplary examples of suitable glucocorticoids. Two or more such glucocorticoids may also be used together, such as a mixture of corticosterone and hydrocortisone. Glucocorticoids may be used at any suitable concentration, for example, from about 0.1 μM to about 2.5 μM or about 5 μM. In one illustrative example, the glucocorticoid in the culture medium suitable for post-transfection CLSC recovery may be a concentration of hydrogenated corticosterone of about 0.1 μM to about 2.5 μM. In one example, the concentration of hydrogenated corticosterone in the culture medium suitable for post-transfection CLSC recovery is about 0.5 μM to about 2 μM. In this illustrative example, the concentration of hydrogenated corticosterone is about 1 μM.

[0057] Post-transfection recovery of CLSCs can be performed in cell culture apparatus, such as cell culture vessels. Cell culture vessels can be, but are not limited to, culture flasks, culture dishes, roller bottles, and multi-well trays. Furthermore, cell culture vessels can be coated to provide a coating layer that promotes cell growth by supplying metabolites to the cells. The coating layer of the cell culture vessel can be serum-derived or serum-free. Examples of serum-derived coating layers include those with gel-like proteins derived from a basement membrane matrix, such as matrix gel. Serum-free coating layers of cell culture vessels can be characterized as being animal-free and xenogeneic, thus allowing cell culture under cGMP conditions. Examples of serum-free coatings for cell culture vessels may include coatings containing recombinant proteins or portions thereof, such as coatings containing extracellular matrix proteins like collagen, fibronectin, elastin, or laminin, including, for example, laminin-511 E8 fragments or laminin 521, or vitrin, for example, in the form of commercially available citronella XF™, CELLstart, or Synthemax™ vitrin matrices. In one embodiment of the invention, transfected CLECs are preferably cultured in cell culture vessels with serum-derived coatings, while CLMCs are preferably cultured in cell culture vessels with serum-free coatings.

[0058] After a suitable period, the culture medium suitable for post-transfection CLSC recovery can be replaced with another cell culture medium. A suitable period may be, for example, about 1, about 2, or about 3 days after transfection. Therefore, in one embodiment, the culture medium can be replaced about 2 days after transfection. The other cell culture medium used for culture medium replacement may also be a mixture of different cell culture media. In this invention, any cell culture medium or cell culture medium mixture suitable for generating iPS can be used. Furthermore, a suitable cell culture medium or cell culture medium mixture may contain compounds that can inhibit inflammatory responses and enhance cell survival. In this invention, the culture medium suitable for post-transfection cell recovery can be replaced with a mixture of two different cell culture media after a suitable period to ensure that the cells are adequately supplied with nutrients and a suitable mixture of growth factors as they transition from their primitive state to a more pluripotent state during somatic cell reprogramming. Therefore, the cell culture medium mixture of this invention may consist of a culture medium suitable for cell recovery, which may contain hydrogenated corticosterone, and a second cell culture medium. In one preferred embodiment, the two different cell culture media are mixed in a ratio of approximately 1:1 (v / v), wherein the mixture can be prepared by contacting one volume of a cell recovery medium with one volume of a second cell culture medium. In another preferred embodiment, the two different cell culture media are mixed in a ratio of approximately 1:2 (v / v) or 2:1, wherein the mixture can be prepared by contacting one volume of a cell recovery medium with two volumes of a second cell culture medium (or two volumes of a cell recovery medium with one volume of a second cell culture medium). The second cell culture medium used to generate the cell culture mixture can be any cell culture medium suitable for enhancing or maintaining iPS proliferation (such a medium is also referred to herein as "maintenance medium"). Using a 1:1 mixture of cell recovery medium and maintenance medium provides the advantage of allowing CLiPS cells to gradually transition from their homologous medium to ES / iPSC medium, rather than a sudden conversion that could impair their viability. To avoid being bound by theory, we assume that about two days after transfection, some successfully transfected umbilical cord liner stem cells will begin to acquire pluripotent stem cell characteristics and simultaneously meet the nutritional needs of PSCs.Illustrative examples of suitable cell culture media include, but are not limited to, commercially available maintenance media such as mTeSR1, StemMACS™ iPS-Brew XF, TeSRTM-E8, mTeSRTMPlus, TeSRTM2 or mTeSRTM1, Corning® NutriStem® hPSC XF Medium, Essential 8 Medium (ThermoFisher Scientific), StemFlex (ThermoFisher Scientific), StemFit Basic02 (Ajinomoto), or PluriSTEM (Merck Millipore). If the iPS population is cultured under animal-free and xenogeneic GMP conditions, the medium mTeSRTM1 is preferred because it is manufactured under GMP conditions. Therefore, in a preferred embodiment, mTeSR1 can be a second cell culture medium used to generate the cell culture mixture. In this invention, the 1:1 (v / v) cell culture medium mixture can be replaced with the same cell culture medium mixture over a suitable period of time. This suitable period of time can be approximately 3, 4, 5, or 6 days post-transfection. Therefore, in one embodiment, the 1:1 (v / v) cell culture medium mixture may be replaced with the same mixture 4 days after transfection. After a suitable period of time, the 1:1 (v / v) cell culture medium mixture may be further replaced with a second cell culture medium used solely for generating the cell culture mixture. In this regard, suitable time periods may be approximately 4, 5, 6, or 7 days after transfection. In one embodiment, the 1:1 (v / v) cell culture medium mixture may be replaced with the second cell culture medium 6 days after transfection. In a preferred embodiment, the 1:1 (v / v) cell culture medium mixture may be replaced with mTeSR1 and mTeSRTM1, respectively, 6 days after transfection. Regularly changing and replacing the cell culture medium may help increase the survival rate of CLiPS. Therefore, the CLiPS community may grow and proliferate.

[0059] CLiPS cells can be further cultured by changing the cell culture medium mixture to a single cell culture medium. For this purpose, the cell culture medium can also be periodically changed to the same medium to ensure that the cells are provided with appropriate nutrients and a suitable mixture of growth factors. For example, the cell culture medium can be changed daily, every two days, every three days, or every four days. In one embodiment of the invention, the cell culture medium can be changed every two days. Therefore, the CLiPS community may further grow and proliferate.

[0060] CLiPS colonies are visible to the naked eye approximately 10, 11, 12, 13, 14, 15, or 16 days post-transfection (see Example 2). When a suitable size is reached, CLiPSs can be screened and transferred to another coated culture vessel for further culture and proliferation. In this regard, a suitable colony size can include a length from approximately 0.1 mm to approximately 2 mm in diameter. In one embodiment of the invention, CLiPS colonies are screened when a length from approximately 0.5 mm to approximately 1.5 mm in diameter is reached, wherein the CLiPS colonies reach this size approximately 20 days post-transfection. To transfer CLiPS colonies of suitable size to another culture vessel, CLiPS colonies can be selected. This can be done manually if necessary. To facilitate colony selection, a device that allows magnification of the colony view can be used. Examples of such devices include magnifying glasses or microscopes. In this invention, CLiPSs can be selected and chosen under a bright-field microscope. Regarding the cell culture vessel, the selected CLiPS colonies can be transferred to another cell culture vessel, wherein the coating of this cell culture vessel may be different from or the same as the coating of the cell culture vessel used for CLSC recovery after transfection. In a preferred embodiment, the coating of the culture vessel is the same because CLMC-derived CLiPS cultured under suitable cGMP conditions so far remain animal-free and xenogeneic-free, thereby maintaining cGMP conditions. Therefore, for example, CLMC-derived CLiPS colonies can be transferred to a cell culture vessel coated with a serum-free substance, such as a fragment of laminin-511 E8, for further culture (see Example 3). Alternatively, for example, CLEC and / or CLMC-derived CLiPS colonies can be transferred to a cell culture vessel coated with a serum-derived substance, such as matrix gel, for further culture. The cell culture medium is preferably the same as the medium used before colony selection. In embodiments of the invention, the cell culture medium can also be changed periodically after colony selection. For example, the culture medium can be changed daily, every two days, or every three days. In one preferred embodiment of the present invention, the cell culture medium can be changed daily after community selection.

[0061] When a suitable cell coverage is achieved, CLiPS colonies, or cell populations formed from colonies, are typically separated from the enclosed cell culture vessel and transferred to a larger cell culture vessel for further culture under the same culture conditions used directly after colony selection. Suitable cell coverage can be at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, and at least about 65%. It should be noted in this document that the term "cell population" is more appropriate when used for the proliferation of CLiPS colonies, as CLiPS cells do not present a colony-like appearance when they reach about 70% to about 80% cell coverage. To separate CLiPS colonies, or cell populations formed from colonies, from the enclosed cell culture vessel, any dissociative agent suitable for disrupting cell adhesion or hydrolyzing peptide bonds can be used. Examples of suitable dissociation agents may be solutions containing chelating agents, such as ethylenediaminetetraacetic acid (EDTA), or solutions containing enzymes, such as trypsin or dispersants (see the experimental paragraphs of this application, where dispersants have been used to isolate CLiPS colonies from coated cell culture vessels). The cell culture medium may also be changed periodically, for example, daily, every two days, or every three days. In one preferred embodiment of the invention, the cell culture medium may be changed daily. In this way, CLiPS may further grow and proliferate.

[0062] In this invention, CLiPS colonies or cell populations formed therefrom can be subcultured when they reach a suitable size. A suitable size can correspond to approximately 50%, approximately 55%, approximately 60%, approximately 65%, approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90%, and approximately 95% cell coverage. In one embodiment of the invention, CLiPS colonies or cell populations formed therefrom can be subcultured when the culture reaches approximately 60-90% cell coverage. Therefore, in a preferred embodiment, CLiPS colonies or cell populations formed therefrom can be subcultured when they reach approximately 70-80% cell coverage. For subculture, CLiPS can be subcultured at a suitable ratio, wherein one volume of CLiPS can be contacted with multiple volumes of cell culture medium. In this invention, CLiPS can be subcultured at a ratio of about 1:3 (v / v), or about 1:4 (v / v), or about 1:5 (v / v), or about 1:6 (v / v), wherein subculture can be performed by dividing one volume of dissociated CLiPS into about 2, or about 3, or about 4, or about 5 volumes of dissociated CLiPS. In a preferred embodiment, CLiPS can be subcultured at a ratio of about 1:3 (v / v). To subculture the CLiPS cultured in this invention, any enzyme suitable for separating cells from the culture vessel can also be used. For example, dispersing enzymes can be used for this purpose. Furthermore, in the context of this invention, any chemical suitable for removing intercellular adhesion can be used for CLiPS subculture, wherein the concentration of the chemical is suitable for removing cell-cell adhesion without harming the cells. An illustrative example of such a chemical is EDTA. Since EDTA can kill cells at higher concentrations, a suitable EDTA concentration in this invention is about 0.5 mM. In this invention, the cell culture medium used for passage may be supplemented with substances suitable for improving the survival rate of Clips upon dissociation. For this purpose, any substance suitable for improving the survival rate of Clips upon dissociation can be used. An example of such a suitable substance could be an inhibitor of a signaling pathway, such as an inhibitor of the rho-associated protein kinase (ROCK) signaling pathway. Therefore, the RHO / ROCK pathway inhibitor Y-27632 may be an illustrative example of a substance suitable for improving the survival rate of dissociated Clips. Alternatively, specific supplements for single-cell selection of human iPS cells, such as CloneRTM (available from StemCell Technologies), can also be used to improve the survival rate of dissociated cells. In this invention, the passaged Clips may be cultured for a suitable period in a medium supplemented with substances suitable for improving the survival rate of dissociated Clips, and then differentiated into target cells.

[0063] By culturing CLiPS cells after subculturing, a master cell bank containing (primary) isolated CLiPS cells can be obtained. To generate a master cell bank of CLiPS cells, CLiPS cells obtained using the methods described herein can be seeded in culture containers such as cell culture dishes. For this purpose, CLiPS cells can be suspended and cultured in any suitable medium, typically a maintenance medium for iPS cells, such as the aforementioned commercially available media, such as mTeSR1, StemMACS™ iPS-Brew XF, TeSRTM E8, mTeSRTMPlus, TeSRTM2 or mTeSRTM1, Corning® NutriStem® hPSC XF Medium, Essential 8 Medium (ThermoFisher Scientific), StemFlex (ThermoFisher Scientific), StemFit Basic02 (Ajinomoto), or PluriSTEM (Merck Millipore). CLiPS cells from CLMC and CLEC can both be cultured in such iPS maintenance media. For subculture, CLiPS cells (CLiPS from CLMC and CLEC) can be seeded at any suitable concentration, for example, from about 0.5 x 10⁶ cells / ml to about 5.0 x 10⁶ cells / ml. In one embodiment, cells are suspended at a concentration of about 1.0 x 10⁶ cells / ml for subculture. Subculture can be performed in simple culture flasks or in multilayer systems, such as CellSTACK (Corning, NY, USA) or Cell Factory (Nunc, part of Thermo Fisher Scientific, Watson, MA, USA), which can be stacked in an incubator. Alternatively, subculture can also be performed in a closed, self-contained system, such as a bioreactor. Different designs of bioreactors, such as parallel plate, hollow fiber, or microfluidic bioreactors, are known to those skilled in the art. See, for example, Sensebe et al., "Production of mesenchymal stromal / stem cells according to good manufacturing practices: a review," ibid.An example of a commercially available hollow fiber bioreactor is the Quantum® Cell Expansion System (Terumo BCT), for instance, for the expansion of bone marrow mesenchymal stem cells for clinical trials (see Hanley et al., Efficient Manufacturing of Therapeutic Mesenchymal Stromal Cells Using the Quantum Cell Expansion System, Cytotherapy. Aug 2014; 16(8): 1048-1058) and for the expansion of high-purity umbilical cord mesenchymal stem cell populations described in International Patent Application Publication No. WO 2018 / 067071. Another example of a commercially available bioreactor that can be used for the subculture of the CLiPS population of this invention is the Xuri Cell Expansion System, available from GE Healthcare. If a working cell bank for therapeutic applications is to be produced under GMP conditions and a large number of cells are required, then culturing CLiPS populations in an automated system, such as the Quantum® Cell Expansion System, is particularly advantageous. Also for subculture, CLiPS can be cultured to a suitable number of cells for growth. In the illustrative embodiments, CLiPS were not subcultured until they reached approximately 70% to 80% cell coverage. The isolation / culture of the CLiPS population can be performed under standard mammalian cell culture conditions. Once the desired / suitable number of CLiPS is obtained from the subculture, cells are harvested by removing them from the culture vessel used for subculture. CLiPS harvesting is typically performed via enzymatic treatment. The isolated CLiPS are then collected and used directly or stored for further use. Typically, storage is performed via cryopreservation. The term "cryopreservation" is used herein in its conventional sense to describe a process in which CLiPS are preserved by cooling to temperatures below zero, such as (typically) -80°C or -196°C (the boiling point of liquid nitrogen). Cryopreservation can be performed as known to those skilled in the art and may include the use of cryoprotectants, such as dimethylsulfoxide (DMSO) or glycerol, which slow the formation of ice crystals in the CLiPS cells.

[0064] This invention also relates to CLIPS obtainable by the methods described herein and to the acquisition of CLIPS by the methods described herein. CLIPS obtainable / acquired by this invention can grow and proliferate robustly (see Examples 2 and 3). Therefore, CLIPS culture may be more efficient than the culture of iPS derived from, for example, bone marrow matrix, adipose tissue, dermis, or Farrow's gum. Functional analysis of CLIPS reveals the performance of human embryonic stem cell markers, showing self-renewal characteristics and a normal karyotype (see Examples 4 and 5). Furthermore, CLIPS can differentiate into multiple cell types (functional target cells) in vitro and in vivo, indicating their pluripotency (see Example 6). Therefore, CLIPS are well-suited for medical and therapeutic applications. Therefore, this invention also relates to pharmaceutical compositions comprising iPS obtainable / acquired by the methods described herein.

[0065] This invention further relates to a method for differentiating CLiPS into target cells under suitable differentiation conditions. Examples of suitable target cells include, but are by no means limited to, neurons, dopamine neurons, oligodendrocytes, astrocytes, cortical neurons, hepatocytes, chondrocytes, muscle cells, osteocytes, dental cells, hair follicle cells, inner ear hair cells, skin cells, melanocytes, cardiomyocytes, hematopoietic precursor cells, blood cells, immune cells, T or B lymphocytes, microglia, natural killer cells, or motor neurons, to name just a few. To promote directed differentiation into target cells, CLiPS may be exposed to an initiating substance, typically under conditions known to those skilled in the art for differentiating iPS derived from other sources into target cells. Exposure may be performed under suitable conditions, which may include culturing in a cell culture vessel filled with cell culture medium suitable for initiating CLiPS differentiation and for subsequent culture. In this invention, any cell culture medium suitable for initiating, proliferating, and differentiating iPSs can be used, wherein the composition of the culture medium and the differentiation method may depend on the target cells and may be taken from known methods for differentiating iPSs into the desired target cells (for this, see Hirschi et al.'s review "Induced Pluripotent Stem Cells for Regenerative Medicine" Annu Rev Biomed Eng. 2014 July 11;16: 277–294, or Shi et al.'s "Induced pluripotent stem cell technology: a decade of progress" Nat Rev Drug Discov. 2017 Feb;16(2): 115–130). For example, CLiPSs can be cultured in a medium suitable for CLiPS proliferation and differentiation into dopamine neurons. In this case, the medium can be Neurobasal medium supplemented with growth factors such as B-27 minus vitamin A, transforming growth factor 3-β (TGFβ3), glial cell line-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), ascorbic acid, butyl cAMP, inhibitors of glycogen synthase kinase 3 such as CHIR99021, and γ-secretase inhibitors such as (2S)-N-[(3,5-difluorophenyl)acetyl]-L-propylaminoacetyl-2-phenyl]glycine 1,1-dimethylethyl ester (DAPT), which can induce neuronal differentiation. An illustrative example of such a medium is NB27.An example of CLiPS differentiating into dopamine neurons is shown in Example 7. As another example, CLiPS can be cultured in a medium suitable for CLiPS proliferation and differentiation into hepatocytes. In this case, the medium can be protein-free, lipid-free, and growth factor-free, supplemented with compounds that induce differentiation into mesoderm fate. RPMI 1640-B27 supplemented with activin A may be an example of a suitable medium for CLiPS differentiation into hepatocytes. CLiPS differentiation into hepatocytes is exemplarily shown in Example 8. As another illustrative example, CLiPS can be cultured in a medium suitable for CLiPS proliferation and differentiation into cardiomyocytes. In this case, the medium can be protein-free, lipid-free, and growth factor-free, supplemented with a glycogen synthase kinase 3 inhibitor, such as CHIR99021. RPMI / 2%-B27 minus insulin may be an example of a suitable medium for CLiPS differentiation into hepatocytes. An example of CLiPS differentiating into cardiomyocytes is shown in Example 9. As another illustrative example, CLiPS cells can differentiate into oligodendrical glial cells, which are then differentiated into paired box 6-positive (PAX6+) neural stem cells using a chemically defined, growth factor-rich culture medium, subsequently generating oligodendrical glial cell transcription factor-positive (OLIG2+) precursor cells (see Example 10). In this regard, it can be noted that CLiPS differentiation into target cells can also be performed under conditions suitable for cGMP production.

[0066] The present invention also includes pharmaceutical compositions comprising differentiated CLiPS obtained by the methods described herein. Immunogenicity analysis of CLiPS and its neural derivatives showed reduced immunogenicity (Example 11). One example of a pharmaceutical composition comprising differentiated CLiPS is an injectable solution or any type of graft suitable for implantation of differentiated CLiPS. In one embodiment, such a graft may comprise multilayered tissues derived from differentiated CLiPS, such as organs or portions thereof. In one embodiment, a graft suitable for implantation of differentiated CLiPS may comprise an implantable matrix coated with differentiated CLiPS. The pharmaceutical composition may be formulated / suitable for parenteral administration. In this case, parenteral administration may comprise a sterile preparation for injection, infusion, or implantation in humans or animals. Transplantation of CLiPS-derived dopamine neurons in fully immunocompetent mouse and rat models of Parkinson's disease showed functional implantation and even significant recovery of dopamine reuptake function (see Examples 12 and 13).

[0067] The present invention further includes a method for treating a congenital or acquired degenerative disease in an individual, wherein the individual may be selected from mice, rats, rabbits, pigs, dogs, cats, non-human primates, or humans. In a preferred embodiment, the individual is a human. In this case, treatment may include administering to the individual target cells differentiated from CLiPS cells using the methods described herein. The disease may be any known disease, and the disease has been considered for treatment with cell-based therapies, see, for example, Shi et al., "Induced pluripotent stem cell technology: a decade of progress," ibid. Congenital or acquired degenerative diseases may have different origins. For example, such congenital or acquired degenerative diseases may be neurological diseases such as Parkinson's disease, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia (SCA), and Baden's disease. Examples of liver degenerative diseases include, in particular, liver failure, cirrhosis, and viral hepatitis. Congenital or acquired degenerative diseases can also be heart diseases, including acute Danon's disease, short QT syndrome, Brugada syndrome, myocardial infarction, and Jervell and Lange-Nielsen syndromes. These conditions can also be autoimmune diseases, such as multiple sclerosis.

[0068] This invention also relates to extracellular membrane vesicles that can be generated from CLiPS or differentiation derivatives of CLiPS. Such vesicles may include, but are not limited to, vesicles with a diameter ranging from 30 to 150 nanometers (nm), also known as extracellular bodies. Initially thought to be primarily responsible for excretion functions, extracellular bodies are now known to participate in a variety of important biological processes, such as intercellular communication, cell senescence, proliferation and differentiation, tissue homeostasis, tissue repair and regeneration, antigen presentation and immune regulation (e.g., see Pegtel, DM and SJ Gould, Exosomes. Annu Rev Biochem, 2019, 88: p. 487-514, or Kalluri, R. and VS LeBleu, The biology, function, and biomedical applications of exosomes. Science, 2020, 367(6478)). Exosomes are associated with a variety of diseases, including cancer (see, for example, Visan, KS, RJ Lobb, and A. Moller, The role of exosomes in the promotion of epithelial-to-mesenchymal transition and metastasis. Front Biosci (Landmark editor), 2020, 25: p. 1022-1057, or Zhang, L. and D. Yu, Exosomes in cancer development, metastasis, and immunity. Biochim Biophys Acta Rev Cancer, 2019, 1871(2): p. 455-468), osteoarthritis (Asghar, S. et al., Exosomes in intercellular communication and implications for osteoarthritis. Rheumatology (Oxford), 2020, 59(1): p. 1022-1057). 57-68), Central nervous system diseases, such as stroke, Alzheimer's disease (AD), Parkinson's disease (PD), infectious protein granulation disease, and amyotrophic lateral sclerosis (ALS) (see, for example, Liu, W. et al., Role of Exosomes in Central Nervous System Diseases. Front Mol Neurosci, 2019, 12: p. 240 or Quek, C.).See also AF Hill, The role of extracellular vesicles in neurodegenerative diseases. Biochem Biophys Res Commun, 2017, 483(4): p. 1178-1186, Saeedi, S. et al., The emerging role of exosomes in mental disorders. Transl Psychiatry, 2019, 9(1): p. 122, Wang, Y. et al., Exosomes: An emerging factor in atherosclerosis. Biomed Pharmacother, 2019, 115: p. 108951, and metabolic diseases (see, for example, Dini, L. et al., Microvesicles and exosomes in metabolic diseases and inflammation. Cytokine Growth Factor Rev, 2020, 51: p. 27-39, or Soazig, LL, A. Ramaroson, and MM Carmen, Exosomes in metabolic syndrome, in Exosomes: A Clinical Compendium, edited by LR Edelstein et al., 2020, Academic Press, pp. 343–356, etc.

[0069] Extracellular transporters have been shown to consist of various biomolecules, including proteins, lipids, and nucleic acids. RNA types such as tRNA, mRNA, lncRNA, circular RNA, and miRNA can potentially regulate gene expression in target cells and tissues. Extracellular bodies derived from certain cell types have been shown to possess therapeutic properties. In this regard, mesenchymal stem cells (MSCs) isolated from various sources, such as bone marrow, adipose tissue, and umbilical cord, have become particularly advantageous. MSC-derived extracellular bodies have shown potential therapeutic effects in animal models of corneal, cardiovascular, Alzheimer's, Parkinson's, and inflammatory bowel diseases. In addition to endogenous cells, in vitro cultured pluripotent stem cells (PSCs), such as embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), have been shown to generate extracellular bodies (Song, YH et al., Exosomes Derived from Embryonic Stem Cells as Potential Treatment for Cardiovascular Diseases. Adv Exp Med Biol, 2017).

[0998] : p. 187-206, or Jeske, R. et al., Human Pluripotent Stem Cell-Derived Extracellular Vesicles: Characteristics and Applications. Tissue Eng Part B Rev, 2020,

[26] (2): p. 129-144.). Due to the risk of tumor formation from residual undifferentiated cells, cell-free iPS-derived extracellular bodies are considered safer than iPS-derived cells (Riazifar, M. et al., Stem Cell Extracellular Vesicles: Extended Messages of Regeneration. Annu Rev Pharmacol Toxicol, 2017).

[57] : p. 125-154). Notably, extracellular bodies isolated from iPS differentiation derivatives have also been shown to have therapeutic properties. For example, treatment with extracellular bodies purified from iPS-derived cardiomyocytes enhanced cardiac recovery in a mouse model of myocardial infarction, with significantly reduced apoptosis and fibrosis compared to untreated animals. Extracellular bodies also rescued in vitro cultures of iPS cardiomyocytes from hypoxia and extracellular biogenesis inhibition (Liu, B. et al., Cardiac recovery via extended cell-free delivery of extracellular vesicles secreted by cardiomyocytes derived from induced pluripotent stem cells. Nat Biomed Eng, 2018, 2(5): p. 293-303). In another study, extracellular bodies isolated from iPS-derived MSCs accelerated the proliferation of human dermal fibroblasts and human keratinocytes and enhanced wound healing in an in vitro scratch assay. Compared to extracellular bodies isolated from primary mesenchymal stem cells, these extracellular bodies did not show significant differences in function (Kim, S. et al., Exosomes Secreted from Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells Accelerate Skin Cell Proliferation. Int J Mol Sci, 2018).

[19] (10)).

[0070] Therefore, according to these reports, extracellular membrane vesicles or extracellular bodies generated from the CLiPS of the present invention (derived from CLMC or CLEC) or differentiated derivatives of CLiPS are considered to be useful for treating diseases including the aforementioned exemplary diseases, such as cancer, osteoarthritis, central nervous system diseases such as stroke, Alzheimer's disease (AD), Parkinson's disease (PD), infectious protein granulation disease, and amyotrophic lateral sclerosis (ALS), mental disorders, or metabolic diseases.

[0071] Furthermore, leveraging their efficient cargo delivery capabilities, extracellular bodies are actively sought as delivery carriers to facilitate the cellular uptake of various therapeutic agents, including microRNAs, drugs, and peptides (see Antimisiaris, SG, S. Mourtas, and A. Marazioti, Exosomes and Exosome-Inspired Vesicles for Targeted Drug Delivery. Pharmaceutics, 2018, 10(4), Liao, W. et al. Exosomes: The next generation of endogenous nanomaterials for advanced drug delivery and therapy. Acta Biomater, 2019).

[86] : p. 1-14, or Wang, X. et al., Cell-derived Exosomes as Promising Carriers for Drug Delivery and Targeted Therapy. Curr Cancer Drug Targets, 2018,

[18] (4): p. 347-354). Consistent with this, extracellular membrane vesicles or extracellular bodies generated from the CLiPS of the present invention (derived from CLMC or CLEC) or differentiation derivatives of CLiPS are also considered as delivery carriers to facilitate cellular uptake of therapeutic agents. Therefore, the present invention also includes the use of CLiPS or differentiation derivatives of CLiPS for delivering molecules with exogenous loading or transgenic expression.

[0072] Extracellular membrane vesicles and extracellular bodies derived from CLiPS (derived from CLMC or CLEC) or their differentiation derivatives can be isolated using the methods described in the literature. Typically, extracellular bodies are purified from their secreted extracellular environment. Known methods for isolating extracellular bodies include ultracentrifugation, ultrafiltration, particle size chromatography, field flow fractionation, polymer coprecipitation, immunoaffinity, microfluidics, or acoustic nanofiltration. All of these methods can be used to isolate extracellular bodies derived from CLiPS or their differentiation derivatives as described herein.

[0073] The present invention will be further illustrated by the following non-limiting experimental examples. Experimental Examples

[0074] [Example 1] [for] [CLiPS] Developing suitable electroporation parameters

[0075] It was found that electroporation using the method described by Okita et al., as above, was completely ineffective. Following the method of Okita et al., no IPS communities were detected when the CLMC reaction mixture was electroporated with the additional carriers pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, and pCXLE-hUL. For CLEC, using the add-on vectors pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, and pCXLE-hUL (Addgene plasmids #27077 (SEQ ID NO:12), #27078 (SEQ ID NO:13), #27080 (SEQ ID NO:14) and following the method described by Okita et al., ibid., the average reprogramming efficiency (expressed as iPS colony counts) was only 0.2%. Therefore, it is necessary to develop a suitable electroporation method from scratch for CLMC-derived CLiPS methods, or, in the case of CLEC, to provide a significantly improved electroporation method. To this end, the electrical parameters constituting electroporation, such as the number of pulses, duration, and voltage, were varied to develop electroporation conditions suitable for CLSC. In this experiment, many different electroporation settings were tested on single CLMC and CLEC samples cultured under the cell-specific conditions described herein. After each electroporation, approximately 200,000 Cells were seeded in 6-well plates and cultured in triplicate. Approximately 21 days after electroporation, the established CLSC colonies were counted to determine viability. Viability was used to draw conclusions about electroporation efficiency. The efficiency percentage was calculated as colony count / 200,000 x 100%.

[0076] like [Table] 1 and [picture] The results shown in [2] indicate that suitable electroporation conditions can be found for CLMC and CLEC. This study found that the optimal electroporation settings for CLEC included two pulses, each 30 ms long and 1350 V, using 1.67 μg (plastosome) DNA from each of three vectors (pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, and pCXLE-hUL) for 1 x 10⁶ cells. The viability of four separate CLEC cell lines (CLEC42, CLEC44, CLEC23, and CLEC30) transfected with these settings was 4.67%, 7.33%, 9.33%, and 7.50%, respectively. Compared to Okita et al., the electroporation settings for CLEC, as described above, improved the electroporation efficiency of CLEC42 by approximately 23.35% and CLEC44 by approximately 36.65%. Therefore, it was surprising to find that these electroporation parameters / settings improved the electroporation efficiency of CLECs by an average of about 30% compared to the conditions used by Okita et al. for electroporation of human dermal fibroblasts. It is noteworthy that the electroporation settings used here (one pulse, 30 ms and 1300 V, and a 1:1 ratio of plasmid DNA (μg) to cell number (1 x 10⁶ cells)) are quite different from the conditions for successful electroporation of epithelial cells, such as corneal epithelial cells (see Png, E. et al. (2011), Journal of Cellular Physiology. United States, 226(3), pp. 693–699).

[0077] The optimized electroporation method was even more effective for CLMCs, as, as mentioned above, no CLMCs survived under the electroporation method of Okita et al. This study found that four separate CLMC cell lines (CLMC42, CLMC44, CLMC23, and CLMC30) were successfully transfected using a single 20 ms, 1600 V electrical pulse and three additional vectors (pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, and pCXLE-hUL) at a ratio of 1.67 µg (plastosome) DNA to approximately 1 x 10⁶ CLMCs. The viability of the resulting transgenic cells was 6.17%, 7.50%, 5.00%, and 7.33%, respectively. Notably, the optimal electroporation / transfection conditions for generating CLiPS from CLMCs discovered in this study differ from those reported to date. See, for example, Sprangers, AJ, Freeman, B., and Ogle, BM (2011), pp. 62-66, who investigated the potential negative effects of electroporation on mesenchymal stem cells derived from human embryonic stem cells (hESCs). Following their method, Sprangers et al. found that transfecting a total of 4 μg (plastosomal) DNA into 1 x 10⁶ mesenchymal stem cells using a single 20 ms, 1400 V electrical pulse provided optimal conditions for MSC transfection. Therefore, this invention provides a unique and efficient method for electroporation of CLECs and CLMCs, respectively. The difference in transfection efficiency among the four individual CLSC cell lines (cells from different donors) is an inter-individual variability, an innate and documented characteristic of iPS-derived cells. To confirm the sex of the donor CLSC cell lines and the CLiPS derived from them, PCR amplification of genomic DNA isolated from individual CLSC cell lines was performed using gene-specific primers to determine the presence of the DYS439 and SRY loci, both located on the Y chromosome. aSF4 adult skin fibroblasts, confirmed to be derived from male donors, were used as a positive control.

[0078] Table 1: Optimized electroporation conditions for generating CLiPS 1650V [、] [10 ms]、 3 [Second pulse] (Okita [Wait for someone,]

[2011] Year) Optimized CLEC [method] 1350V [、] [30 ms] 2 [Second pulse] Optimized CLMC [method] 1600V [、] [20ms] 1 [Second pulse] The ratio of DNA quantity to cell number [µg / 1x10⁶ cells] per vector [1.67 µg / 1x10, 6 ] cells [1.67 µg / 1x10, 6 ] cells [1.67 µg / 1x10, 6 ] cells Average community number Average % efficiency (x10-3) Average community number Average % efficiency (x10-3) Average community number Average % efficiency (x10-3) CLEC42 0.33±0.58 0.2±0.3 9.33±1.53 4.67±0.76 - - CLEC44 0.33±0.58 0.2±0.3 14.67±2.08 7.33±1.04 - - CLMC42 0 0 - - 12.33±1.53 6.17±0.76 CLMC44 0 0 - - 15±3 7.50±1.50 CLEC23 - - 18.67±1.53 9.33±0.77 - - CLEC30 - - 15.00±2.00 7.50±1.00 - - CLMC23 - - - - 10.00±1.00 5.00±0.50 CLMC30 - - - - 14.67±1.15 7.33±0.58

[0079] [Implementation Example] 2 [GMO Integration and Atrophic Humans] [iPS] [Derivatives]

[0080] Umbilical cord liner epithelial cells (CLEC) and umbilical cord liner mesenchymal cells (CLMC) were isolated and supplied by Cell Research Corporation Pte Ltd, Singapore. CLEC and CLMC were thawed and propagated in their respective media, PTT-e3 and PTT-4. Adult skin fibroblasts from a healthy 78-year-old Asian male donor were purchased from Cell Research Corporation Pte Ltd and cultured in DMEM / 10% FBS.

[0081] The PTT-4 culture medium consists of 90% (v / v) CMRL-1066 and 10% (v / v) FBS, while the PTTe-3 culture medium has the following components: MCDB - 170 / EpiLife 200 ml / 300 ml DMEM 250 ml DMEM / F12 250 ml fetal bovine serum 1% adenine 0.05 to 0.1 mM Hydrogenated corticosterone 0.1 to 0.5 µM Epidermal growth factor 1 to 15 ng / ml T3 (3,3',5-triiodo-L-thyroxine sodium salt) 0.1 to 5 ng / ml cholerae toxin from Vibrio cholerae 1 x 10⁻¹¹M to 1 x 10⁻¹⁰M insulin 1 to 7.5 µg / ml TGF-α 1.0 to approximately 10 ng / ml TGF-β1 0.1 to 5 ng / ml

[0082] Somatic cell reprogramming was performed using the conditions established in Example 1, and further in a feeder-independent manner. Logarithmic-phase cultures were harvested by dissociation using TrypLE Express (Thermo Fisher Scientific), and 720,000 cells were pelleted in 1.5 ml centrifuge tubes. The cell pellet was resuspended in 120 µL of buffer R (Neon™ Transfection System 100 µL Kit, Thermo Fisher Scientific, MPK10096). A mixture containing 1.2 µg of addative vectors pCXLE-hOCT3 / 4-shp53-F, pCXLE-hSK, and pCXLE-hUL (Addgene plasmids #27077 (SEQ ID NO:12), #27078 (SEQ ID NO:13), and #27080 (SEQ ID NO:14), respectively) was added to the cells and thoroughly mixed (1.67 μg (plastid) DNA per vector for 1 x 10⁶ cells). Cell suspensions were loaded into 100 µL Neon® Tip and subjected to Neon electroporation using the following parameters: Adult dermal fibroblasts – 1,650 V, 10 ms, 3 pulses; CLEC – 1350 V, 30 ms, 2 pulses; CLMC – 1600 V, 20 ms, 1 pulse. Cells were immediately transferred to 6 ml of CLEC or CLMC medium containing 1 µM hydrocorticosterone (StemCell Technologies) and evenly distributed into 3 wells of a 6-well dish coated with matrix gel. Two days later, the medium was switched to a 1:1 mixture of CLEC or CLMC medium and mTeSR1, with the addition of 1 μM hydrocorticosterone. On day 4 post-transfection, the medium was changed back to the same medium. On day 6 post-transfection, the medium was switched back to whole mTeSR1, omitting hydrocorticosterone from this point onwards. Subsequently, mTeSR1 was changed every two days. When the iPS colonies reached a diameter of approximately 1–2 mM (around day 20), they were manually selected under a bright-field microscope, and each colony was placed in a single well of a 24-well plate coated with Matrigel (Nunc). When the cells in each well reached approximately 50% cell coverage, they were separated using a dispersant enzyme (StemCell Technologies) and transferred to the wells of a 6-well plate coated with Matrigel. Subsequently, when the cells were nearly confluent, they were subcultured at a 1:3 ratio using 0.5 mM EDTA. The newly subcultured cells were cultured overnight in medium containing 10 µM of the ROCK inhibitor Y-27632.Besides mTeSR1, other commercially available ES / iPS media, such as StemMACS™ iPS-Brew XF (Miltenyi Biotec) and TeSR-E8 (StemCell Technologies), have been used to maintain iPS cultures.

[0083] Methods for generating CLiPS: 1. Actively dividing CLECs or CLMCs cultured in T-75 flasks and in their maintenance media PTTe-3 and PTT-4 were harvested by isolation using TrypLE Express (ThermoFisher Scientific). 2. Count the cells, divide 720,000 cells into microcentrifuge tubes and precipitate them. 3. Resuspend the cell pellet in 120 µL buffer R (Neon™ Transfection System 100 µL Kit, Thermo Fisher Scientific, MPK10096). Add the mixture containing 1.2 µg each of pCXLE hUL, pCXLE-hSK, and pCXLE-hOCT3 / 4-shp53-F and mix thoroughly. 4. Load the cell suspension into 100 µL Neon® Tip. Perform electroporation using the following CLEC parameters: 1350 V, 30 ms, 2 pulses, and the following CLMC parameters: 1600 V, 20 ms, 1 pulse. 5. Immediately transfer the cells to 4 ml of CLEC or CLMC medium (PTTe-3 and PTT-4, respectively) containing 1 µM hydrocorticosterone, and then distribute them into 3 wells of a 6-well substrate-coated disc. 6. Two days after electroporation, the medium was changed to a 1:1 (v / v) mixture of CLEC or CLMC medium (PTT-e3 and PTT-4, respectively) and mTeSR1, and 1 µM hydrocorticosterone was added. 7. After 4 days of electroporation, replace the medium with the same 1:1 (v / v) medium mixture. 8. Six days after electroporation, change the medium only with mTeSR1. From this point onwards, omit the use of hydrocorticosterone. 9. Change the culture medium every two days. 10. iPS colonies may begin to appear as early as 2 weeks after transfection. When the iPS colony diameter reaches about 0.5 mm to about 1 mm (around day 20), they are manually picked under a bright-field microscope and each colony is placed in a single well of a 24-well tray (Nunc) coated with matrix gel. 11. After separating the colony, change the culture medium of the isolated colony daily. 12. When the cells in each well cover approximately 50% of the culture well surface, they are separated with a dispersing enzyme (StemCell Technologies) and transferred to the wells of a 6-well plate coated with a matrix gel. 13. Subsequently, when the cells reached approximately 70%-80% cell coverage, they were subcultured at a 1:3 ratio using 0.5 mM EDTA permeation separation. The newly subcultured cells were cultured overnight in medium containing 10 µM ROCK inhibitor Y-27632.

[0084] Following the above method, small cell clusters morphologically different from the parent cells began to appear around day 10. By day 15, the cell clusters developed well-defined edges (Figure 1). [3b]), and discrete embryonic stem cell-like populations appear from day 20 onwards (Figure 1). [3c] and [Figure 3d]. When the colony diameter reaches 1-2 mm, the colony is picked out and expanded for characterization and storage. The expanded CLiPS cells exhibit morphology indistinguishable from adult dermal fibroblast-derived iPS cells or human embryonic stem cells (ES), characterized by large nuclei and thin cytoplasm (Figure 3d). [3e] and [Figure 3f]

[0085] [Example 3] [:] [cGMP] Compatible with CLiPS [(] [CLMSC-DTHN]) derivative

[0086] To provide proof of concept for the production of Clius-Lips under conditions compatible with human therapeutic applications, iPS were generated from a cGMP-grade CLMC cell line named CLMSC-DTHN using the method for producing mesenchymal stem cell populations described in International Patent Application Publication No. WO2018 / 067071, wherein 99% of the stem cells expressed the markers CD73, CD90, and CD105, but not the markers CD34, CD45, and HLA-DR, using cGMP-quality reagents whenever possible. Reprogramming scheme and examples. The method described for CLMC in [2] is the same, but the matrix gel, an extracellular matrix substrate prepared from Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells, was replaced with a recombinant human laminin-511 E8 fragment (iMatrix-511 SILK, ReproCELL), a well-defined, animal-free, and xenogeneic substrate used to coat cell culture containers. Furthermore, mTeSR1, used for reprogramming and subsequent maintenance of the CLiPS community, was replaced with cGMP mTeSRTM1 (StemCell Technologies).

[0087] Under the conditions described in this paper, CLMSC-DTHN were reprogrammed with comparable kinetics and efficiency to CLMC (data not shown). Ten days after transfection with the reprogramming vector, small cell clusters with a compact morphology were observed (Figure 1). [3n]). From day 20 onwards, these clusters developed into separable communities. The expanded communities exhibited the characteristic cell morphology of human pluripotent stem cells (Figure 1). [3n-q]).

[0088] Propagation and cryopreservation of [CLiPS]

[0089] Perform a secondary culture of CLiPS cells when the culture reaches approximately 90% cell coverage (again using a medium suitable for maintaining iPS cells, such as mTeSR1 or TeSR-E8). Aspirate the used medium along with any areas of significant differentiation that may be present. Avoid prolonged exposure of cells to air. Rinse the culture once with preheated (37°C) Dulbecco's Phosphate Buffered Saline (DPBS). Depending on the culture vessel, add an appropriate volume of rewarmed (37°C) 0.5 mM EDTA solution to the culture – 0.5 ml / well for 24-well plates, 1 ml / well for 6-well plates, or 2 ml for 6 cm dishes. Incubate the culture at 37°C for 5 minutes, then observe under a microscope. Cells should appear round but not separated from the surface. The duration of incubation at 37°C varies depending on the CLiPS cell line and may range from 5 to 10 minutes. The culture duration will be primarily based on prior experience with each cell line. After culture, gently aspirate the EDTA solution, being careful not to move the cells. Using a 1 ml pipette, directly dispense medium containing the ROCK inhibitor Y-27632 (such as mTeSR1 or TeSR-E8) onto the cells to remove them. The volume of medium used depends on the container size used – 0.5 ml / well for a 24-well culture dish, 1 ml / well for a 6-well culture dish, or 2 ml for a 6 cm culture dish. Repeat gentle pipetting until most cells have been removed. Then transfer the cell suspension to 15 ml Falcon tubes. Rinse the culture container with fresh medium, mixing the rinse with the cell suspension in the Falcon tubes. Dilute the cells in the tubes to an appropriate volume for seeding onto new Matrigel-coated containers. The cell splitting ratio may be between 1:3 and 1:10, depending on the initial culture density and the growth rate of the individual CLiPS cell lines.

[0090] For cryopreservation, suspend cells in mTeSR1 or TeSR-E8 (or any other suitable medium) and add 10% v / v tissue culture grade dimethyl sulfoxide (DMSO; e.g., Hybri-Max™, Sigma-Aldrich). Then aliquot the cell suspension into an appropriate number of cryovials. The cell density per aliquot depends on the rate at which cells reach full well coverage during thawing and culturing. Transfer the cryovials to a slow-freezing device, such as a Mr. Frosty™ cryovial (Thermo Scientific) or a CoolCell® cell cryovial (BioCision LLC), and incubate overnight at -80°C. The following day, transfer the cryovials to liquid nitrogen for storage. It is not recommended to incubate CLiPS aliquots at -80°C for more than 24 hours. Many commercially available cryopreservation media, such as mFreSR™ (StemCell Technologies) and CryoStor® CS10 (Biolife Solutions), can also be used for cryopreservation and should be used according to the manufacturer's instructions.

[0091] [Example] 4 [:] [CLiPS] Functional Analysis

[0092] CLiPS function was determined by immunofluorescence staining of developing CLiPS colonies after electroporation. Therefore, the expression of pluripotent embryonic stem cell markers (OCT4, SOX2, KLF4, NANOG, SSEA-4, TRA-1-81) was analyzed. For this purpose, cells were fixed with 4% formaldehyde in phosphate-buffered saline (PBS) for 15 min, followed by washing three times with PBS for 5 min each time. For staining of intracellular or nuclear markers (OCT4, SOX2, KLF4, NANOG), cells were permeabilized in PBS with 0.1% Triton X-100 for 10 min and then blocked with FDB (5% FCS / 1% NGS / 1% BSA) for 1 h. For staining of surface markers (SSEA-4, TRA-1-81), the permeabilization step was omitted. Cells were cultured overnight at 4ºC with a primary antibody appropriately diluted with FDB, followed by 2 h at room temperature with a secondary antibody conjugated with an appropriate fluorescent dye. The stained samples were mounted in a ProLong Diamond Antifade Mountant (ThermoFisher Scientific) with DAPI.

[0093] In addition, the number and structure of chromosomes in individual CLiPS cell lines were assessed by karyotype analysis and G-banding analysis, with the G-banding analysis conducted by Cytogenetics Laboratory, KK Women and Children’s Hospital Pte Ltd, Singapore.

[0094] In addition, RT-PCR analysis was performed to analyze the expression of reprogrammed and pluripotent genes in primary parental cells, parental cells 11 days after vector transfection (D11 transfected cells), and CLiPS cells. For this purpose, total RNA was isolated from cell pellet using an RNeasy Mini or Plus Mini kit (Qiagen). 2 µg of total RNA was treated with DNase I, and cDNA was synthesized using a RevertAid H Minus first-strand cDNA synthesis kit (Fermentas, Thermo Fisher Scientific). The PCR reaction setup was as follows: 0.5 µl cDNA, 5 µl 2x MyTaq HS Mix (Bioline), 0.2 µl forward primer (10 µM), 0.2 µl reverse primer (10 µM), and 4.2 µl PCR water. Thermal cycling was conducted in an MJ Mini Thermal Cycler (Bio-Rad) under the following conditions: 1 x 95 °C for 1 minute, 30 x (95 °C for 15 seconds, Tm for 15 seconds, 72 °C for 15 seconds), and 72 °C for 1 minute. The initiator sequence and bonding temperature (Tm) used are shown in Table 2 below.

[0095] Qualitative characterization was performed using agarose gel electrophoresis, in which samples were loaded onto 2% agarose gels containing SYBR Safe DNA dye (Thermo Fisher Scientific) in 1x TAE buffer and electrophoresed at 80V for 30 minutes. Gel images were captured using a ChemiDoc imaging system (Bio-Rad).

[0096] Table 2: Primitive Sequences [Oligonucleotide Name] [SEQ] [ID] [No] [sequence(] [5' → 3'] [)] [T, m [Amplified fragment(][[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​pCXLE-R2 24 TAGCGTAAAAGGAGCAACATAG Lin28F / VecF 25 CCATATGGTAGCCTCATGTCC 55 126 hLin28R 26 TCAATTCTGTGCCTCCGGGAG Klf4VecF 27 ACCACCTCGCCTTACACATGAAG 55 156 pCXLE-R2 28 TAGCGTAAAAGGAGCAACATAG L-mycVecF 29 GGCTGAGAAGAGGATGGCTAC 55 124 pCXLE-2AR 30 AGTTTGTTTGACAGGAGCGAC Sox2VecF 31 TCACATGTCCCAGCACTACC 55 112 pCXLE-2AR 32 AGTTTGTTTGACAGGAGCGAC hL-mycF 33 AACCCAAGACCCAGGCCTGC 60 135 hL-mycR 34 GGTCTGCTCGCACCGTGATG EBNA-1F 35 GAAATGGCCTAGGAGAGAAG 55 214 EBNA-1R 36 CAGCCAATGCAACTTGGACG hGDF3F 37 CTTATGCTACGTAAAGGAGCTGGG 60 633 hGDF3R 38 TTGTGCCAACCCAGGTCCCGGAAG hREX1F 39 TATCAGATCCTAAACAGCTCGCAG 55 308 hREX1R 40 CGTACGCAAATTAAAGTCCAGAG hFGF4F 41 ACTACAACGCCTACGAGTCCTAC 60 372 hFGF4R 42 GTTGCACCAGAAAAGTCAGAGTTG hDPPA5F 43 ATATCCCGCCGTGGGTGAAAGTTC 60 243 hDPPA5R 44 ACTCAGCCATGGACTGGAGCATCC hTERTF 45 CCTGCTCAAGCTGACTCGACACCGTG 65 446 hTERTR 46 GGAAAAGCTGGCCCTGGGGTGGAGC hDNMT3BF 47 TGCTGCTCACAGGGCCCGATAC 60 242 hDNMT3BR 48 TCCTTTCGAGCTCAGTGCACCAC hGAPDHF 49 CTGGCGCTGAGTACGTCGTGG 60 200 hGAPDHR 50 GCAGTTGGTGGTGCAGGAGGC

[0097] The results showed that, as demonstrated by antibody staining, CLiPS exhibited robust performance of human embryonic stem cell (hES) markers KLF4, NANOG, OCT4, SOX2, SSEA4, and TRA-1-60 (Figure 1). [3g-1]). G-band analysis showed that CLiPS maintained a normal karyotype, with a maximum of 17 generations from the start of community selection (Figure). [3m]). RT-PCR analysis of gene expression in parental cells, cells on day 11 post-transfection, and expanded iPS communities showed that activation of endogenous OCT4, SOX2, KLF4, LIN28, and L-MYC genes replaced the vector-driven expression of these genes in maintaining pluripotency in fully reprogrammed CLiPS (Figure 1). [3v] Induction of the endogenous NANOG locus (a key gene for somatic cell reprogramming) was evident on day 11 post-transfection. The lack of detectable levels of EBNA-1 transcript in the CLiPS community indicated the loss of this plastid vector from these cells. The expression of other hES-specific genes GDF3, DPPA5, DNMT3, FGF4, and REX-1 in CLiPS further confirmed their hES-like molecular phenotype. TERT, which encodes a telomerase catalytic reverse transcriptase subunit crucial for regulating self-renewal and maintaining pluripotency, was expressed at the same level in CLiPS as in H1 hES.

[0098] [Example] 5 [:] Performance analysis of pluripotent embryonic stem cell markers in [CLiPS-DTHN]

[0099] To analyze the expression of pluripotent embryonic stem cell markers (Oct4, Sox2, Klf4, Nanog) indicating pluripotency, immunofluorescence staining was performed on developing CLMSC-DTHNs after electroporation. Immunofluorescence staining method and examples. The method described for CLiPS in [4] is the same.

[0100] The results showed that CLMSC-DTHN expressed the pluripotent stem cell markers NANOG, OCT4, SOX2, and TRA-1-81 (Figure 1). [3r-u]), whose expression level is indistinguishable from its non-GMP counterpart. Therefore, CLMSC-DTHN can provide the same embryonic characteristics required for non-GMP-derived CLiPS.

[0101] [Example] 6 [:Sure] [CLiPS] pluripotency

[0102] The pluripotency of CLiPS and aSF-iPS cells was assessed using a teratoma formation assay in NOD-SCID mice. For this purpose, 1 x 10⁶ CLiPS cell pellets were resuspended in 0.1 ml of ice-cold matrix gel and injected dorsally into 6–8 week old NOD / MrkBomTac-Prkdcscid mice. Mice were sacrificed 3 months later, and teratomas were collected for histological analysis, including paraffin sectioning and hematoxylin and eosin staining using standard techniques.

[0103] The results showed that, starting one month after subcutaneous injection of iPS into the dorsal side of mice, some mice developed palpable tumors. Histological analysis of teratomas isolated three months after injection revealed that CLiPS spontaneously differentiated into endoderm, mesoderm, and ectoderm lineages (Figure 1). [4a-f]).

[0104] [Example] 7 [:] [CLiPS] differentiates into dopamine neurons

[0105] As a crucial prerequisite for the future potential therapeutic applications of CLiPS, it is necessary to demonstrate their ability to differentiate into specific tissue types under defined in vitro conditions. For dopamine neuron differentiation, the midbrain plate induction method described in Kriks, S. et al., Nature, 2011, 480(7378): p. 547-51 was used to differentiate iPS into dopamine neuronal precursor cells and neurons. Briefly, iPS were seeded at a density of 3.5–4.0 x 10⁴ cells per square centimeter on matrix gel-coated culture dishes and cultured for 5 days in knockout serum-alternative medium (KSR) containing knockout DMEM, 15% knockout serum substitute, 1 X GlutaMAX, and 10 mM β-mercaptoethanol. Starting from day 5, the KSR medium was gradually transitioned to N2 medium, as described in Tomishima's "Midbrain dopamine neurons from hESCs." June 10, 2012, In: StemBook. Cambridge (MA): Harvard Stem Cell Institute; 2008-. Available at https: / / www.ncbi.nlm.nih.gov / books / NBK133274 / doi: 10.3824 / stembook.1.70.1. On day 11, the culture medium was replaced with NB27 medium, which consists of Neurobasal medium, 2% B27 minus vitamin A, and 1x GlutaMAX. CHIR (until day 13), BDNF (brain-derived neurotrophic factor, 20 ng / ml; Miltenyi), ascorbic acid (0.2 mM; Sigma), GDNF (glial cell line-derived neurotrophic factor, 20 ng / ml; Miltenyi), TGFβ3 (β3 transforming growth factor, 1 ng / ml; R&D), dibutyl cAMP (0.5 mM; Santa Cruz Biotechnology), and DAPT (10 nM; Tocris) were added, and the culture was continued for 9 days. On day 20, cells were isolated using Accutase (Gibco) and reseeded at high cell density (3–4 x 10⁵ cells / cm²) into culture dishes pre-coated with poly-L-ornithine (PLO; 15 mg / ml) / laminoid (1 µg / ml) / fibronectin (2 µg / ml) in NB27 medium supplemented with 10 µM ROCK inhibitor Y-27632. Cultures were maintained in NB27 medium, with the medium changed every other day until the desired endpoint was reached. The performance of cell-specific markers in differentiated cells was analyzed at this stage.For this purpose, cryosectioning was performed, in which glass slides containing the sections were dehydrated by exposure to 37°C for 30 minutes, cooled to room temperature, and washed three times with TBST. As in the example. [4] describes the process of permeabilization, barrier, antibody staining, and mounting. A primary antibody from the same host species was used, and the first primary antibody was saturated with a fluorescently conjugated monovalent antibody (Jackson Immuno Research), and then reacted sequentially with a second primary antibody and a conjugated secondary antibody.

[0106] The results showed that dopamine neurons could be obtained from CLiPS and asF5-iPS using this method. Antibody staining revealed that almost 90% of the cells co-expressed the basal plate marker FOXA2 and the apical plate marker LMX1A (Figure 1). [4k] [、]k' [、] [k]”), which is a clear marker of the midbrain DA neuron precursor. Further differentiation produces abundant mature neurons, as shown by TUJ1 staining, of which approximately 30-50% co-express dopamine-labeled tyrosine hydroxylase (TH) (Figure). [4l] [、]l' [、] [l]”). Electrophysiological analysis of CLiPS-derived neurons on day 45 of differentiation showed that the cells exhibited mature functional characteristics, and the action potential sequence showed the voltage drop response characteristics of mature midbrain DA neurons after injection of hyperpolarizing current (Figure). [4m]).

[0107] [Example] 8 [:] [CLiPS] differentiate into hepatocytes

[0108] As a crucial prerequisite for the future potential therapeutic applications of CLiPS, it is necessary to demonstrate their ability to differentiate into desired target cell types or specific tissue types under defined in vitro conditions. For liver differentiation, a method initially developed for differentiating human embryonic cells (ES) on mouse trophoblasts (Medine, CN et al., J Vis Exp, 2011(56): p. e2969) is applicable to the differentiation of CLiPS and asF-iPS on matrix gel with mTeSR1. When the iPS culture reached 20-30% cell coverage, the method was modified by adding DMSO to 2% and culturing for 24 hours. When the culture reached approximately 30-60% cell coverage, the formation of a fixed endoderm was induced by replacing mTeSR1 with an initiation medium (RPMI 1640-B27 supplemented with 100 ng / mL activin A and 50 ng / mL Wnt3a). The cultures were maintained in the initiation medium for 3 days, with the medium changed every 24 hours. After 72 hours in the initiation medium, the medium was replaced with SR DMSO (80% KO-DMEM, 20% KO-SR, 0.5% L-glutamic acid, 1% non-essential amino acids, 0.1 mM β-mercaptoethanol, and 1% DMSO) and cultured for 5 days, changing the medium every 48 hours. On day 8, the culture was replaced with L-15 maturation and maintenance medium (Leibovitz L-15 medium, 8.3% trypsin phosphate broth, 8.3% heat-inactivated FBS, 10 μM hydrogenated corticosterone 21-hemisuccinate, 1 μM insulin (bovine pancreas), 1% L-glutamic acid, 0.2% ascorbic acid) and supplemented with 10 ng / mL hHGF and 20 ng / mL OSM and cultured for 9 days (changing the medium every 48 hours). At this stage, the performance of cell-specific markers of differentiated cells was analyzed again. For this purpose, as in the example... [7] describes the frozen sectioning process.

[0109] The results showed that hepatocyte-like cells could be obtained from CLiPS and asF5-iPS using this method. Seventeen days after differentiation, antibody staining revealed the hepatocyte marker alpha-fetoprotein (AFP); Figure [4g] [、]g' [、] [g'']), cytokeratin 18 (CK18), and human serum albumin (HSA; Figure [4h] [、]h' [、] The cells exhibited the characteristic polygonal shape of hepatocytes. Furthermore, Oil Red O staining revealed abundant lipid droplet accumulation in the cells, a hallmark of cultured hepatocytes (Figure 1). [4i] [、]i' [、] [i]」).

[0110] [Example] 9 [:] [CLiPS] differentiate into cardiomyocytes

[0111] As a crucial prerequisite for the future potential therapeutic applications of CLiPS, it is necessary to demonstrate their ability to differentiate into specific tissue types under defined in vitro conditions. For cardiomyocyte differentiation, the method for iPS cardiomyocyte differentiation was adapted from Lian, X. et al., Proc Natl Acad Sci USA, 2012, 109(27), p. E1848-57. iPS maintained on a matrix gel in mTeSR1 were isolated into single cells by incubation with StemPro Accutase (Thermo Fisher Scientific) at 37°C for 5 minutes, followed by incubation for 24 hours with 5 μM ROCK inhibitor (Y-27632; Stemgent) at a concentration of 1 x 10⁵–2 x 10⁵ cells / cm² (5 x 10⁵ cells / 24 wells). One modification involved replacing the medium with mTeSR1 and adding 2% DMSO when the cells reached approximately 80% cell coverage. When cells reached full confluence, they were treated with CHIR99021 in RPMI / B27-insulin for 24 hours. In another modification, the concentration of CHIR99021 was reduced from 12 μM to 5 μM at this stage. The next day, the medium was replaced with insulin-free RPMI / 2%B27. Two days later, half of the old medium was mixed with an equal volume of fresh medium containing 10 μM IWP2 (Tocris). The remaining medium in the wells was removed, and the mixture was added to the culture. Two days later, the medium was replaced with RPMI / 2%B27, insulin-free. After 48 hours, the culture was maintained in RPMI / 2%B27, with the medium changed every 3 days, until the desired endpoint was reached. (See Example) As described in [7], beating cardiomyocytes were fixed and stained with cell-specific markers.

[0112] The results showed that cardiomyocytes were successfully obtained from CLiPS and asF5-iPS using this method. Antibody staining revealed spontaneous contraction of cardiomyocytes starting from day 8 of differentiation. Immunofluorescence antibody staining of functional cardiac markers myosin-regulated light chain 2a (MLC2a), cardiac troponin I (cTnI), and α-actin (αACT) revealed sarcomere structures within differentiated cardiomyocytes (Figure 1). [4j] [、]j' [、] [j]”). No significant difference in differentiation efficiency was observed between them.

[0113] [Example] 10 [:] [CLiPS] differentiate into oligodendroglial cells.

[0114] To further demonstrate the ability of the induced pluripotent stem cells of this invention to differentiate into a given target cell type, CLiPS were differentiated into oligodendrocytes. The oligodendrocyte differentiation of CLiPS and asF-iPS was performed according to the method of Douvaras, P. and V. Fossati, Nat Protoc, 2015, 10(8): p. 1143-54. Furthermore, as [Example] [7] describes the use of frozen sections to analyze the performance of cell-specific markers.

[0115] On day 75 of differentiation, Olig2-positive oligodendrocyte precursor cells (OPCs) were obtained. [Figure] 4n) and cell clusters of O4-positive late-stage OPCs (Figure) [4o]).

[0116] [Example] 11 [Immunogenicity analysis]

[0117] To gain a deeper understanding of the immunogenicity of CLiPS and its neural derivatives, the performance of a set of immunogenicity-related markers in these cells was evaluated by flow cytometry. For this purpose, primary cells and DA NPCs differentiated for 25 days were harvested via TrypLE Express, while iPS cultures were harvested via 0.5 mM EDTA. Cells were resuspended in 1x Ca2+- and Mg2+---free DPBS containing 0.1% bovine serum albumin (BSA) to a concentration of 5 million cells / ml. 100 µl of cells were stained on ice in the dark for 30 minutes with an appropriate conjugated antibody or its isotype control. For HLA-E and HLA-G staining, cells were permeabilized with BD Phosflow Perm / Wash Buffer I (BD Biosciences) prior to staining according to the manufacturer's instructions. After staining, cells were washed twice in 1x Ca2+- and Mg2+-free DPBS / 5 mM EDTA, fixed in the dark with 1% paraformaldehyde for 1 hour, and then washed twice in 1x Ca2+- and Mg2+-free DPBS / 5 mM EDTA. Cells were resuspended in 0.5 ml of 1x Ca2+- and Mg2+-free DPBS / 5 mM EDTA and analyzed by flow cytometry. Stained primary cells and iPS cells were analyzed on FACSCalibur, while stained dopamine neuron precursor cells (NPCs) were analyzed on a FACSCanto II instrument (both from BD Biosciences). Data were analyzed using FlowJo software (FlowJo Corporation). The antibodies used are listed in Table 3.

[0118] Table 3: Antibodies used for flow cytometry analysis [antigen] [same type] [Conjugate] [dilution] [BioLegend] [Company Model Number] CD40 Mouse IgG1,κ FITC 1:20 303604 CD80 Mouse IgG1,κ FITC 1:20 305206 CD86 Mouse IgG2b,κ Alexa Fluor 488 1:20 305414 HLA-A, B, C Mouse IgG2a,κ PE 1:20 311406 HLA-DR Mouse IgG2a,κ PE 1:20 307606 HLA-E Mouse IgG1,κ PE 1:20 342604 HLA-G Mouse IgG2a,κ APC 1:20 335910 NCAM / CD56 Mouse IgG1,κ APC / Cy7 1:20 318332 isomorphic reference Mouse IgG1,κ FITC 1:20 400108 isomorphic reference Mouse IgG2b,κ Alexa Fluor 488 1:20 400329 isomorphic reference Mouse IgG1,κ PE 1:20 400112 isomorphic reference Mouse IgG2a,κ PE 1:20 404212 Isotype control Mouse IgG1,κ APC 1:20 400120 Isotype control Mouse IgG2a,κ APC 1:20 400222 Isotype control Mouse IgG1,κ APC / Cy7 1:20 400128

[0119] MHC class I HLA-A, -B, and -C, as well as MHC class II HLA-DR molecules, are known to be important for alloimmune responses. Results showed that HLA-ABC were present in all iPS samples, but a significant decrease in EC23-CLiPS levels was observed. [Figure] 6a). No HLA-DR expression was found in any of the iPS samples (Figure). [6b]), which is consistent with previous reports that HLA-II expression in iPS is negligible (Säljö, K. et al., Sci Rep, 2017, 7(1): p. 13072, and Chen, HF et al., Cell Transplant, 2015, 24(5): p. 845-64.). T cell co-stimulatory molecules CD40, CD80, and CD86 play important roles in activating T cells during alloimmune responses. Of the three molecules examined, only CD40 was expressed in iPS, with the lowest expression in asF-iPS and the highest expression in MC23-CLiPS compared to the other molecules (Fig. 6a). It has been reported that tolerogenic HLA-E and HLA-G were expressed in CLMC (Deuse, T. et al., Cell Transplant, 2011, 20(5): p. 655-67) and CLEC (Zhou, Y. et al., Cell Transplant, 2011, 20(11-12): p. 1827-41), and the expression of CLiPS for these antigens was also studied. Analysis of permeabilized cells showed that HLA-E had only a small expression in MC23-CLiPS and EC44-CLiPS, and was below detectable levels in other samples. Next, the expression profile of the entire marker combination was repeated in DA differentiation culture on day 25. The NCAM-gated neural cell population was analyzed. The NCAM+ fraction of all samples exceeded 97%, and asF-iPS and EC23-CLiPS showed a comparable differentiation efficiency of 99.5% (Figure 1). [6b]). All NPCs samples showed HLA-ABC, but at a generally lower level compared to their parental iPS (Figure 1). [6c]). Among all samples, EC23-CLiPS-derived NPCs showed the lowest levels of HLA-ABC, reflecting the trend shown by their parental iPS. The degree of HLA-ABC expression on MC23-CLiPS decreased after differentiation into NPCs. CD40 expression was downregulated in all NPCs samples, with only EC23-iPS showing a slight expression in EC44-iPS-derived NPCs. HLA-E expression was absent in all NPCs samples, but a slight upregulation of HLA-G was observed in asF-iPS and EC23-iPS-derived NPCs. These results suggest reduced immunogenicity in CLiPS.

[0120] [Example] 12 [Transplantation in a fully immunocompetent mouse model of Parkinson's disease] [CLiPS] [Derived dopaminergic neurons]

[0121] Previous studies have shown that dopamine neurons generated from human embryonic stem cells and iPS cells using various methods can be implanted into rodents (Kriks, S. et al., Nature, 2011, 480(7378): p. 547-51; Hargus, G. et al., Proc Natl Acad Sci USA, 2010, 107(36): p. 15921-6; Doi, D. et al., Stem Cell Reports, 2014, 2(3): p. 337-50; Grealish, S. et al., Cell Stem Cell, 2014, 15(5): p. 653-65; Kirkeby, A. et al., Cell Rep, 2012, 1(6): p. 703-14; Qiu, L. et al., Stem Cells Transl Med, 2017, 6(9): p. 1803-1814; Rhee, YH et al., J Clin Invest, 2011, 121(6): p. 2326-35; Samata, B. et al., Nat Commun, 2016, 7: p. 13097; Wakeman, DR et al., Stem Cell Reports, 2017, 9(1): p. 149-161) and non-human primates (Kriks, S. et al., Nature, 2011, 480(7378): p. 547-51; Hargus, G. et al., Proc Natl Acad Sci USA, 2010, 107(36): p. 15921-6; Wakeman, DR et al., Stem Cell Reports, 2017, 9(1): p. 149-161; Daadi, MM et al., PLoS One, 2012, 7(7): p. e41120; Kikuchi, T. et al., Nature, 2017, 548(7669): p. 592-596) Parkinson's disease (PD) model. In all these studies, the animals were either immunocompromised or required immunosuppression with drugs to prevent transplant rejection.Immunocompromised or immunosuppressed animals are not required when using autologous (Morizane, A. et al., Stem Cell Reports, 2013, 1(4): p. 283-92; 4. Hallett, PJ et al., Cell Stem Cell, 2015, 16(3): p. 269-74; Wang, S. et al., Cell Discov, 2015, 1: p. 15012; Emborg, ME, et al., Cell Rep, 2013, 3(3): p. 646-50; Sundberg, M. et al., Stem Cells, 2013, 31(8): p. 1548-62) or MHC-paired allogeneic (Morizane, A. et al., 2017, 8(1): p. 385) iPS-derived cells for transplantation.

[0122] To demonstrate the transplantability of CLiPS-derived DA NPCs differentiated using the methods described in this invention, NPCs differentiated from asF-iPS, EC23 CLiPS, and MC23-CLiPS on day 25 were transplanted into immunocompromised NOD-SCID mice (n = 3). In this regard, it is noteworthy that all animal experiments were conducted according to methods approved by the Institutional Animal Care and Use Committee (IACUC) of the National Neuroscience Institute (NNI) of Singapore.

[0123] To test the immunogenicity of CLiPS-derived DA NPCs, transplantation into a PD model was required. For this purpose, a unilateral 6-hydroxydopamine (6-OHDA) lesion mouse model was generated. Unilateral 6-OHDA lesion is an established method in rodents, involving injection of 6-OHDA into the rodent brain to induce motor dysfunction characterized by rotational asymmetry (Bagga, V., Dunnett, SB & Fricker, RA (2015) Behavioural Brain Research. Elsevier BV, 288, pp. 107–117). In this invention, 6-OHDA lesions were induced in NOD / MrkBomTac-Prkdcscid mice (4 weeks old), which were purchased from InVivos Pte Ltd and housed under SPF conditions at the Animal Research Facility of NNI, while male C57BL / 6NTac mice (6-8 weeks old) were purchased from InVivos Pte Ltd. The mice used in this experiment were fully immunocompetent and were not given immunosuppression before or after transplantation.

[0124] To generate a mouse PD model, 7.5 µg of 6-OHDA (Sigma, Merck-Millipore; dissolved at a concentration of 2.5 mg / ml in 0.9% NaCl containing 0.2% ascorbic acid) was delivered to the left striatum via stereotactic injection at the following coordinates: anterior-posterior (AP) +0.5 mm from the anterior fontanelle; medial-lateral (ML) -1.8 mm; dorsoventral (DV) from the skull -3.0 mm. After two weeks of adaptation, three NPCs (i.e., NPCs derived from asF-iPS, EC23-CLiPS, and MC23-CLiPS) were transplanted into the immunocompetent striatum. Stereotactic injection of 6-OHDA into C57BL / 6 mice was considered a successful model of PD.

[0125] To determine a suitable transplantation model, apomorphine-induced rotation was scored, and mice rotating more than 6 times per minute were used for transplantation. For transplantation, dopamine precursor cells were harvested via isolation on day 25 and resuspended in HBSS supplemented with 10 ng / mL BDNF and 10 ng / mL GDNF to approximately 1.25 x 10⁵ cells / μl. 2 µL of the cell suspension was injected into the affected mice at the following coordinates: AP distance from the skull +0.5 mm; ML -2.0 mm; DV -2.8 mm. Rotation asymmetry tests were performed every 2 weeks to assess whether transplanted NPCs could integrate and modulate functional benefits in the affected animals. Rotation tests were performed every 2 weeks until 9 months of age, in which mice were intraperitoneally injected with 0.05 mg / kg apomorphine dissolved in 0.9% NaCl containing 0.1% w / v ascorbic acid. Rotations were recorded using a digital camera and counted manually. Animals were sacrificed under terminal anesthesia at 1, 6, and 9 months post-transplantation.

[0126] Six months post-transplantation, striatal dopamine transporter (DAT) activity in NPC-transplanted, sham-injected, and unmanipulated mice was assessed by positron emission tomography (PET) using the radioligand (2-[18F]fluoroethyl 8-[(2E)-3-iodoprop-2-en-1-yl]-3-(4-methylphenyl)-8-azabicyclo[3.2.1]octane-2-carboxylate) ([18F]FE-PE2I). Animals were fasted for 3 hours prior to imaging. An integrated heated air channel from the imaging bed kept animals warm during the scan. Respiratory rate and body temperature were monitored throughout the scan to ensure adequate anesthesia. Mice were imaged at the SingHealth Experimental Medicine Centre (SEMC) using a nanoScan PET / MRI scanner (Mediso GmbH, Hungary). The scanner is equipped with 12 detector modules, with a longitudinal field of view (FOV) of 94 mm and a transverse field of view of 94 mm or 120 mm in diameter, in 1:3 and 1:5 overlap modes, respectively. Animals were placed in a prone position and subjected to 62 minutes of 3D dynamic PET scanning, with the duration increasing the number of images taken: 4 images at 10 seconds, 4 images at 20 seconds, 3 images at 1 minute, 7 images at 3 minutes, and 6 images at 6 minutes. Subsequently, 3.57–10.61 MBq of [18F]FE-PE2I was injected intravenously via the tail vein at a maximum volume of 0.1 ml. [18F]PE-PE2I was synthesized at Radiopharmaceuticals Pte Ltd, Singapore. MRI images were used for attenuation correction of the PET scans and as a structural reference for the PET images in data analysis. Therefore, T1-weighted MRI images were acquired using the MRI component of the nanoScan PET / MRI scanner. During the MRI scan, the entire mouse head coil covered the entire brain. 0.6 mm slices were obtained using 3D GRE EXT sequences: 64 mm square FOV, 128 x 128 matrix, 20 ms repetition time (TR), 2.3 ms echo time (TE), and 25-degree flip angle. [18F] All image and dynamic analyses of FE-PE2I PET images were performed using PMOD (version 3.5; PMOD Technologies). First, the FUSION tool in PMOD was used to automatically register all PET images to MRI images.The MRI images were then manually registered to a T2-weighted mouse template (M. Mrillone, C57BL / 6J mice; Ma, Y. et al., Neuroscience, 2005, 135(4): p. 1203-15; Mirrione, MM et al., Neuroimage, 2007, 38(1): p. 34-42), which contained a target volume of interest (VOI) template with 20 regions. The accuracy of the manual registration was performed and verified by two different personnel. Finally, the PET images were transformed into the MRI mouse template using a combined transformation matrix. VOIs from the left and right striatum and cerebellum were used for analysis. To reduce registration errors and misdefinition errors (He, B. and EC Frey, Phys Med Biol, 2010, 55(12): p. 3535-44), a 3D erosion of a stereopixel was applied to the obtained VOIs. [18F]FE-PE2I binding was quantified using non-invasive reference tissue models, as they were as accurate as kinetic analyses using arterial input functions (Varrone, A. et al., Nucl Med Biol, 2012, 39(2): p. 295-303). Binding potential (BPnd) values ​​were calculated using a simplified reference tissue model (SRTM) (Lammertsma, AA and SP Hume, 1996. 4(3 Pt 1): p. 153-8), with the cerebellum as a reference. Regional time activity curves (TACs) were also extracted from VOIs in the striatum and cerebellum. Anesthesia was induced with 5% isoflurane in 100% O2 and maintained with 1.5-2% isoflurane during imaging.

[0127] The presence of microglia / macrophages in mouse brain sections was analyzed, as these cells are known to play important roles in allogeneic and xenograft rejection in the CNS (Hoornaert, CJ et al., Stem Cells Transl Med, 2017, 6(5): p. 1434-1441). For this purpose, immunostaining of the microglia / macrophage-specific marker Iba1 was performed after cardiac perfusion with 4% PFA. PFA-perfused brains were fixed overnight in 4% PFA and then equilibrated with 15% w / v sucrose solution in PBS until they settled to the bottom of the tube. The brains were embedded in OCT cryopreservation medium and 18 µm sections were cut on a CM3050 S cryostat (Leica Biosystems) and collected on BOND Plus slides (Leica Microsystems).

[0128] The results showed that hNCAM+ / TH+ neurons were present in all three groups one month after transplantation (Figure 1). [7a-c]), indicating that NPCs can differentiate into mature neurons and survive in the host environment. However, in asF-iPS (Figure... No obvious signs of implantation were observed in the [7h] or MC23-iPS (data not shown) groups. hNCAM / TH+ fibers could be seen extending from neurons in the EC23-CLiPS graft core along the axonal bundles of the corpus callosum (Figure 1). [7d] and [Figure 7e] Immunostaining with the microglia / macrophage-specific marker Iba1 showed that the injected hemisphere was rich in microglia / macrophages compared to the uninjected hemisphere (Figure 7e). [7i] and [Figure 7j]. Microglia / macrophages infiltrating the graft core exhibited amoeba-like morphology characteristic of activated microglia, while microglia / macrophages at the graft periphery showed typical branching morphology of quiescent cells. Furthermore, the infiltrating microglia were positive for CD68 staining, a marker of activated microglia. One month post-transplantation, no accumulation of microglia was observed at the injection sites in brains transplanted with asF5-iPS- and MC23-CLiPS NPCs, possibly because they had dispersed and returned to a quiescent state after xenograft removal. As confirmed by human nuclear antigen (HuNu) and human NCAM staining, human TH+ neurons survived for up to 9 months in some animals transplanted with EC23-CLiPS NPCs (Figure 7j). [8a-f]). Rotation asymmetry tests showed that when challenged with the dopamine agonist apomorphine, damaged animals exhibited reverse rotation due to dopamine depletion and the hypersensitivity of the damaged striatal postsynaptic D2 dopamine receptors. This improvement in rotation asymmetry reflects the efficacy of the applied intervention. Compared to asF-iPS NPCs or sham transplanted animals, only animals transplanted with EC23-CLiPS NPCs showed improvement in rotation behavior in both species (Figure). [8h]). In these mice, the reduction in rotation became significant starting at week 20 post-transplantation (p<0.05), decreasing to 18.2 ± 24.7% and 11.1 ± 20.8% at weeks 20 and 22, respectively. The model showed delayed recovery, with initial post-transplantation deterioration observed. This may be due to the inflammatory response induced by stereotactic injection and the time required for NPCs to mature, integrate, and dominate host tissues. Functional improvement of Parkinsonian motor symptoms in EC23-CLiPS NPC transplant animals indicates functional recovery of dopamine function in the transplanted striatum. To further investigate this, we used the dopamine transporter (DAT) ligand [18F]FE-PE2I for PET imaging in transplanted mice (Bang, JI et al., Nucl Med Biol, 2016, 43(2): p. 158-64; Sasaki, T. et al., J Nucl Med, 2012, 53(7): p. 1065-73). DAT is a presynaptic transmembrane protein primarily responsible for the reuptake of dopamine released at the synapse. Molecular imaging of DAT is a well-established tool for studying dopamine function. PET imaging 6 months post-transplantation showed that DAT activity in the transplanted damaged hemisphere recovered to approximately 71.4 ± 10.3% of the activity in the undamaged hemisphere of EC23-iPS NPC transplanted mice (n=3) (Figure). [8i]). In contrast, the recovery rate in asF-iPS-NPC transplanted mice was only 16.4 ± 4.0%. These results clearly demonstrate the significant recovery of dopamine reuptake function in EC23-iPS-NPC transplanted mice.

[0129] [Example] 13 Transplantation in a fully immune rodent model of Parkinson's disease [CLiPS] [Derived dopaminergic neurons]

[0130] Our transplantation results showed that EC23-CLiPS-derived NPCs were tolerable when transplanted into the striatum of C56BL / 6 mice. To rule out any species-specific bias in this phenomenon, the transplantation studies were repeated in another different species, Wistar rats. Parkinson's disease was induced in these rats by injecting 6-OHDA into MFB to disrupt the substantia nigra-striatal pathway. In this regard, it is worth noting that all animal experiments were conducted according to methods approved by the Institutional Animal Care and Use Committee (IACUC) of the National Institute of Neuroscience (NNI) in Singapore. The IACUC of the National Technological University (NTU) provided additional approval for the rat experiments. Compared to striatal lesions, MFB lesions are known to cause more complete depletion of the dopamine system and are therefore considered less likely to lead to spontaneous recovery (Torres, EM & SB Dunnett, Animal Models of Movement Disorders: Volume I, eds. EL Lane & SB Dunnett, 2012, Humana Publishing: Totowa, New Jersey, pp. 267-279). Rats were fully immunocompetent and had not been given immunosuppression before or after transplantation. For analysis, approximately 8-week-old female Wistar rats were purchased from InVivos Pte Ltd. Unilateral lesions were induced by stereotactic injection of 4 µl of 20 µg 6-OHDA into the left medial forebrain tract (MFB) at the following coordinates: AP -4.4 mm from the dura mater; ML -1.2 mm; and DV -8.6 mm. To determine a suitable transplantation model, see Examples.

[12] The apomorphine-induced rotations were scored. Rats with >6 rotations / min were transplanted into the left striatum with 3 µl of approximately 1.25 x 10⁵ cells / µl of dopamine precursor cells on day 25, with reference to the anterior fontanelle at the following coordinates: AP from the dura mater +0.8 mm; ML -2.5 mm; and DV -5 mm. To assess whether the transplanted NPCs could integrate and modulate the function of the impaired animal, as in the example

[12] describes performing rotational asymmetry tests at 1-month intervals. As in the embodiment...

[12] As described, rats were sacrificed at 6 months by terminal anesthesia, and their brains were harvested for immunohistochemical analysis after cardiac perfusion with 4% PFA. Some animals that did not meet the injury criteria were also transplanted and sacrificed at 1 month and 3 months post-transplantation to assess cell survival and engraftment.

[0131] The results showed that, due to retrograde transport of 6-OHDA via MFB, unilateral depletion of dopamine neurons in the substantia nigra was confirmed in the model by DAB staining of TH in midbrain sections (Figure 1). [11d]). Animals exhibiting at least 5 revolutions per minute under apomorphine challenge were transplanted with asF-iPS-, EC23-CLiPS-, and MC23-CLiPS-derived NPCs. Histological analysis 3 months post-transplantation showed that hCyto+ / HuNu+ and hNCAM+ / TH+ cells were present only in the EC23-CLiPS group. Furthermore, TH+ neurons in the grafts showed Synapsin1 expression, indicating integration with host neurons (Figure 1). [11b] Furthermore, compared to asF-iPS NPCs or sham transplanted animals, only animals transplanted with EC23-CLiPS NPCs showed improvements in rotational behavior in both species ( [Figure 11e]. Furthermore, the rat model showed delayed recovery, with initial deterioration observed post-transplantation. This is likely due to the inflammatory response induced by stereotactic injection and the time required for NPC maturation, integration, and domination of host tissues. Results also showed significant recovery of dopamine reuptake function in CLiPS-derived NPC transplanted rats.

[0132] It will be apparent to those skilled in the art that various substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention.

[0133] All patents and publications mentioned in this specification are intended to be of a degree suitable for a person skilled in the art to which this invention pertains. All patents and publications are incorporated herein by reference to the same degree as if each individual publication were specifically and individually indicated to be incorporated by reference.

[0134] The invention described herein may be suitably practiced in the absence of any one or more elements, limitations, or restrictions not specifically disclosed herein. Therefore, terms such as "comprising," "including," and "containing" should be interpreted broadly and non-limitingly. Furthermore, the terms and expressions used herein are descriptive rather than limiting, and their use is not intended to exclude any equivalents of the features shown and described or portions thereof, but rather to recognize that various modifications are possible within the scope of the claimed invention. Therefore, it should be understood that while the invention has been specifically disclosed through preferred embodiments and optional features, modifications and variations of the invention disclosed herein can be used by those skilled in the art, and such modifications and variations are considered to be included within the scope of the invention. The invention has been described broadly and generally herein. Each narrower group of species and subgenus belonging to the general disclosure also constitutes a part of the invention. This includes a general description of the invention, with any accompanying conditions or negative limitations removed, regardless of whether excerpts are specifically cited herein. Furthermore, in the context of describing features or aspects of the invention according to the Markusi Group, those skilled in the art will recognize that the invention is therefore also described according to any individual member or subgroup of members of the Markusi Group. Further embodiments of the invention will become apparent from the following claims.

[0135] none

[0136] none

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

Claims

1. A method for generating induced pluripotent stem cells, wherein the method includes expressing exogenous nucleic acids encoding one or more of the proteins OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC, and p53-shRNA in stem cells of the umbilical cord amniotic membrane under conditions suitable for reprogramming stem cells, wherein the umbilical cord amniotic stem cells are umbilical cord amniotic epithelial stem cells, wherein the umbilical cord amniotic stem cells are transfected to transfer the exogenous nucleic acid into the stem cells, wherein the transfected stem cells are cultured in a medium suitable for the recovery of epithelial cells after transfection, wherein the medium suitable for the recovery of umbilical cord amniotic epithelial stem cells after transfection comprises MCDB (mammary epithelial basal medium) at a final concentration of 10% to 30% (v / v).

170. The induced pluripotent stem cells were generated by using EpiLife medium with a final concentration of 20 to 40% (v / v), F12 medium with a final concentration of 5 to 15% (v / v), DMEM with a final concentration of 30% to 45% (v / v), and FBS with a final concentration of 0.1 to 2% (v / v).

2. The method of claim 1, wherein the exogenous nucleic acids encoding the proteins OCT3 / 4, SOX2, KLF4, LIN28 and L-MYC, as well as p53-shRNA, are provided by one, two, or three vectors.

3. The method of claim 2, wherein the first vector encodes proteins OCT3 / 4 and p53-shRNA, the second vector encodes proteins SOX2 and KLF4, and the third vector encodes proteins L-MYC and LIN28.

4. The method of request item 2, wherein the first, second or third vector is a viral vector.

5. The method of request item 4, wherein the virus vector is the Sendai virus vector.

6. The method of claim 1, wherein the umbilical cord amniotic epithelial stem cells are electroporated to transfer the exogenous nucleic acid into the epithelial stem cells.

7. The method of claim 6, wherein the umbilical cord amniotic epithelial stem cells are subjected to two pulsed electroporations, each lasting 25-35 ms and at a voltage of 1300-1400 V.

8. The method of claim 7, wherein the ratio of the amount of vector DNA in each vector to the number of umbilical cord amniotic epithelial stem cells undergoing electroporation is in the range of 1.5 μg plastid DNA to 1 x 10⁶ cells to 2.5 μg DNA to 1 x 10⁶ cells.

9. The method of claim 1, wherein the culture medium suitable for the recovery of the transfected umbilical cord amniotic epithelial stem cells comprises MCDB 170 mammary epithelial basal medium at a final concentration of 15% to 25% (v / v), EpiLife medium at a final concentration of 25% to 35% (v / v), F12 medium at a final concentration of 7.5% to 13% (v / v), DMEM at a final concentration of 35% to 40% (v / v), and FBS at a final concentration of 0.5% to 1.5% (v / v).

10. The method of claim 9, wherein the culture medium suitable for the recovery of the transfected umbilical cord amniotic epithelial stem cells comprises MCDB 170 mammary epithelial basal medium at a final concentration of 20% (v / v), EpiLife medium at a final concentration of 30% (v / v), F12 medium at a final concentration of 12.5% ​​(v / v), DMEM at a final concentration of 37.5% (v / v), and FBS at a final concentration of 1.0% (v / v).

11. The method of claim 10, wherein the culture medium suitable for the recovery of the transfected umbilical cord amniotic epithelial stem cells is a culture medium with a final volume of 1000 ml obtained by mixing the following substances: 200 ml mammary epithelial basal medium MCDB 170, 300 ml EpiLife medium, 250 ml DMEM, 250 ml DMEM / F12, and 1% fetal bovine serum.

12. The method of claim 1, wherein the culture medium suitable for the recovery of the transfected umbilical cord amniotic epithelial stem cells contains insulin at a final concentration of 1 to 7.5 μg / ml.

13. The method of claim 1, wherein the culture medium suitable for the recovery of the transfected umbilical cord amniotic epithelial stem cells contains human epidermal growth factor at a final concentration of 1 to 15 ng / ml.

14. The method of claim 1, wherein the culture medium suitable for the recovery of the transfected umbilical cord amniotic epithelial stem cells further comprises at least one of the following supplements: adenine, hydrocorticosterone, and sodium 3,3',5-triiodo-L-thyroxine (T3).

15. The method of claim 14, wherein the culture medium suitable for the recovery of the transfected umbilical cord amniotic epithelial stem cells comprises all three of the following: adenine, hydrocorticosterone, and sodium 3,3',5-triiodo-L-thyroxine (T3).

16. The method of claim 1, wherein the culture medium suitable for the recovery of the transfected umbilical cord amniotic epithelial stem cells further comprises one of transforming growth factors (TGF).

17. The method of claim 16, wherein the culture medium contains transforming growth factor β (TGF-β) and / or transforming growth factor α.

18. The method of claim 1, wherein the culture medium suitable for the recovery of the transfected umbilical cord amniotic epithelial stem cells further contains cholera toxin from Vibrio cholerae.

19. The method of claim 1, wherein the culture medium suitable for the recovery of transfected umbilical cord amniotic epithelial stem cells contains compounds that inhibit inflammatory responses and enhance cell survival.

20. The method of claim 19, wherein the compound is a glucocorticoid.

21. The method of claim 20, wherein the glucocorticoid is selected from the group consisting of prednisolone, methylprednisolone, dexamethasone, betamethasone, corticosterone, and hydrocortisone.

22. The method of claim 21, wherein the hydrogenated corticosterone is present at a concentration of 0.5 μM to 2 μM.

23. The method of claim 1, wherein the culture is performed in a coated cell culture vessel.

24. The method of claim 1, wherein the culture medium suitable for the recovery of transfected umbilical cord amniotic epithelial stem cells is replaced with a mixture of two different cell culture media 1, 2 or 3 days after transfection, thereby generating an induced pluripotent stem cell population.

25. The method of claim 24, wherein the two different cell culture media are the culture medium suitable for cell recovery and the second cell culture medium.

26. The method of claim 24, wherein the two different cell culture media are mixed in a 1:1 (v / v) ratio and prepared by contacting one volume of the cell recovery culture medium with one volume of the second cell culture medium.

27. The method of claim 25, wherein the second cell culture medium is a maintenance culture medium for culturing induced pluripotent stem cells.

28. The method of claim 24, wherein the cell culture medium mixture is replaced with the same cell culture medium mixture within 3, 4 or 5 days after transfection.

29. The method of claim 24, wherein the cell culture medium mixture is replaced with the second cell culture medium within 5, 6 or 7 days after transfection.

30. The method of claim 29, wherein the second cell culture medium is changed daily, every two days, or every three days.

31. The method of claim 29, wherein selection is performed when the diameter of the induced pluripotent stem cell population reaches a size of 0.5 mm to 1.5 mm, and the selected induced pluripotent stem cell population is transferred to a coated cell culture vessel for culture and proliferation.

32. The method of claim 31, wherein the induced pluripotent stem cell population is selected under a bright-view microscope.

33. The method of claim 31, wherein the cell culture medium is changed daily or every two days.

34. The method of claim 32, wherein the induced pluripotent stem cell population is isolated from the coated cell culture apparatus when 50% cell coverage is achieved.

35. The method of claim 34, wherein the induced pluripotent stem cell community is isolated using a reagent selected from a group consisting of dissociation reagents, dispersants, or EDTA solutions.

36. A method for differentiating induced pluripotent stem cells into target cells, the method comprising a) generating induced pluripotent stem cells by a method defined in any one of claims 1 to 35, and b) differentiating the induced pluripotent stem cells obtained in a) into the target cells under suitable differentiation conditions.

37. The method of claim 36, wherein the target cell is selected from the group consisting of: dopamine neurons, oligodendrocytes, hepatocytes, cardiomyocytes, hematopoietic precursor cells, blood cells, neurons, motor neurons, chondrocytes, muscle cells, osteocytes, dental cells, hair follicle cells, inner ear hair cells, skin cells, melanocytes, immune cells, astrocytes, germ cells, corneal cells, intestinal cells, lung cells, kidney cells, gastric cells, mesenteric cells, and adipocytes.

38. The method of claim 37, wherein the immune cells are selected from a group consisting of T lymphocytes, B lymphocytes, microglia, and natural killer cells.

39. The method of claim 37, wherein the target cell is a dopamine neuron, and the induced pluripotent stem cell is cultured in a culture medium suitable for the proliferation and differentiation of induced pluripotent stem cells into the dopamine neuron.

40. The method of claim 37, wherein the target cell is a hepatocyte, and the induced pluripotent stem cell is cultured in a culture medium suitable for the proliferation and differentiation of induced pluripotent stem cells into the hepatocyte.

41. The method of claim 37, wherein the target cell is a cardiomyocyte, and the induced pluripotent stem cell is cultured in a culture medium suitable for the proliferation and differentiation of induced pluripotent stem cells into the cardiomyocyte.

42. The method of claim 37, wherein the target cell is an oligodendrocyte, and the induced pluripotent stem cell is cultured in a culture medium suitable for the proliferation and differentiation of induced pluripotent stem cells into the oligodendrocyte.

43. A cell culture medium comprising mammary epithelial basal medium MCDB 170, EpiLife medium, DMEM (Dulbecco's modified Eagle medium), F12 medium (Ham's F12 medium), and FBS (fetal bovine serum), wherein the medium comprises mammary epithelial basal medium MCDB 170 at a final concentration of 10% to 30% (v / v), EpiLife medium at a final concentration of 20% to 40% (v / v), F12 medium at a final concentration of 5% to 15% (v / v), DMEM at a final concentration of 30% to 45% (v / v), and FBS at a final concentration of 0.1% to 2% (v / v).

44. The cell culture medium of claim 43, wherein the culture medium comprises MCDB 170 mammary epithelial basal medium at a final concentration of 15% to 25% (v / v), EpiLife medium at a final concentration of 25% to 35% (v / v), F12 medium at a final concentration of 7.5% to 13% (v / v), DMEM at a final concentration of 35% to 40% (v / v), and FBS at a final concentration of 0.5% to 1.5% (v / v).

45. The cell culture medium of claim 44, wherein the culture medium comprises MCDB 170 mammary epithelial basal medium at a final concentration of 20% (v / v), EpiLife medium at a final concentration of 30% (v / v), F12 medium at a final concentration of 12.5% ​​(v / v), DMEM medium at a final concentration of 37.5% (v / v), and FBS at a final concentration of 1.0% (v / v).

46. ​​The cell culture medium of claim 45, wherein the culture medium is a medium obtained by mixing the following substances to a final volume of 1000 ml: 200 ml of mammary epithelial basal medium MCDB 170, 300 ml of EpiLife medium, 250 ml of DMEM, 250 ml of DMEM / F12, and 1% fetal bovine serum.

47. The cell culture medium of claim 43, wherein the culture medium contains insulin at a final concentration of 1 to 7.5 μg / ml.

48. The cell culture medium of claim 43, wherein the culture medium contains human epidermal growth factor (EGF) at a final concentration of 1 to 15 ng / ml.

49. The cell culture medium of claim 43, wherein the culture medium suitable for the recovery of transfected umbilical cord amniotic epithelial stem cells comprises at least one of the following supplements: adenine, hydrocorticosterone, and sodium 3,3',5-triiodo-L-thyroxine (T3).

50. The cell culture medium of claim 49, wherein the culture medium contains adenine, hydrocorticosterone, and all three of sodium 3,3',5-triiodo-L-thyroxine (T3).

51. The cell culture medium of claim 50, wherein the culture medium comprises adenine at a final concentration of 0.05 to 0.1 mM, hydrocorticosterone at a final concentration of 0.1 to 0.5 μM, and / or sodium 3,3',5-triiodo-L-thyroxine (T3) at a final concentration of 0.1 to 5 ng / ml.

52. The cell culture medium of claim 43, wherein the culture medium contains one or more transforming growth factors (TGF).

53. The cell culture medium of claim 52, wherein the culture medium contains transforming growth factor beta 1 (TGF-β1) at a final concentration of 0.1 to 5 ng / ml and / or transforming growth factor α (TGF-α) at ​​a final concentration of 1.0 to 10 ng / ml.

54. The culture medium of claim 43, wherein the culture medium contains cholerae toxin from Vibrio cholerae at a final concentration of 1×10⁻¹¹ M to 1×10⁻¹⁰ M.

Images