Modulators of chromosome 9 open reading frame 72 gene expression and uses thereof
Zinc finger protein-based transcriptional regulators are developed to target and inhibit mutant C9orf72 gene transcription, addressing the lack of effective treatments for ALS and C9FTD by reducing pathogenic protein formation.
Patent Information
- Application Number
- TW113139769
- Authority / Receiving Office
- TW · TW
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-01-23
- Filing Date
- 2020-04-23
- Publication Date
- 2026-07-11
- Estimated Expiration
- 2040-04-22
AI Technical Summary
There is no effective treatment for C9orf72-related conditions such as amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD) caused by hexanucleotide amplification in the C9orf72 gene, leading to RNA aggregation and production of pathogenic dipeptide repeat proteins.
Development of zinc finger protein-based transcriptional regulators that target and inhibit the transcription of mutant C9orf72 genes with amplified G4C2 repeat sequences, using fusion proteins with zinc finger domains and transcriptional repressor domains to selectively suppress sense and antisense transcription from the mutant gene, delivered via recombinant adeno-associated virus vectors.
The fusion proteins effectively inhibit a significant portion of mutant C9orf72 gene transcription, reducing the formation of pathogenic proteins and potentially alleviating symptoms of ALS and C9FTD.
Smart Images

Figure IMG-2_DRAW_113139769-A0304-14-0001-1 
Figure IMG-2_DRAW_113139769-A0304-14-0002-3 
Figure IMG-2_DRAW_113139769-A0304-14-0003-4
Abstract
Description
Technical Field
[0001] This invention provides human C9orf72 transcriptional regulators based on zinc finger proteins and the use of these regulators in the treatment of C9orf72-related conditions. Prior Technology
[0002] The chromosome 9 open reading frame 72 (C9orf72) gene encodes a protein abundantly found in neurons. C9orf72 is thought to play a crucial role in endosome transport. Although the function of C9orf72 is not fully understood, recent data suggest that it functions in membrane transport along the endolysosomal pathway by regulating the function of Rab proteins.
[0003] The C9orf72 gene contains a hexanucleotide region (G 4C 2; SEQ ID NO: 1) in intron 1. This region can be repeated tandemly up to 30 times without any discernible biological effect. However, repetitions exceeding 30 times (a phenomenon known as hexanucleotide amplification) lead to C9orf72-related disorders (Renton et al., Neuron (2011) 72:257-68; Douglas, Non-coding RNA Res. (2018) 3:178-87). This amplification produces an autosomal dominant phenotype, and patients are typically amplified heterozygous for the paired gene. Hexanucleotide amplification appears to induce the formation of intracellular RNA aggregation sites (foci), leading to RNA-binding protein segregation and disruption of RNA metabolism. Hexanucleotide amplification via AUG-independent translation also appears to induce the production of non-natural proteins containing dipeptide repeat sequences (DPRs) from all six potential frames in both the sense and antisense directions (Freibaum and Taylor, Front Mol Neurosci. (2017) 10:35; Douglas, cf.). These proteins tend to aggregate (Gendron et al., Acta Neuropathol. (2013) 126:829). DPRs have been reported as inclusion bodies in post-mortem brain material of patients with C9orf72-related disease (Riemslagh et al., Acta Neuropathol Commun. (2019) 7:39).
[0004] C9orf72-related conditions include amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD). ALS is characterized by progressive muscle weakness, loss of muscle mass, and a gradual decline in the ability to move, speak, swallow, and / or breathe. The annual incidence of ALS is 1 to 3 cases per 100,000 people, and it is the most common adult-onset motor neuron disease. For most patients, the disease is fatal within three to five years of the onset of symptoms. C9orf72 gene mutations are responsible for approximately 30% to 40% of familial ALS cases in the United States and Europe, and 5% to 10% of sporadic ALS cases. Some patients with C9orf72-related ALS also suffer from a condition known as C9 frontotemporal dementia (FTD) or C9FTD, which is a neurodegenerative disease affecting personality, behavior, and language (Benussi et al., Front Aging Neurosci. (2015) 7:171). Individuals suffering from both conditions are diagnosed with ALS-FTD.
[0005] There is no effective treatment for C9orf72-related conditions. Therefore, there is an urgent need to develop effective therapies for these conditions. Summary of the Invention
[0006] This invention provides zinc finger protein-based human C9orf72 transcriptional regulators and their use in the treatment of C9orf72-related conditions. In one embodiment, the invention provides a fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain binds to a target region in an intron region (intron 1a) between exons 1a and 1b of a mutant pair gene of the human C9orf72 gene. The mutant pair gene has an amplified G4C2 (SEQ ID NO: 1) repeat sequence region in intron 1a, and the fusion protein targets this amplified repeat sequence region. The mutant pair gene may contain more than 30 tandem G4C2 repeat sequences (e.g., more than 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 repeat sequences). Wild-type pairs may contain no more than 30 such repeating sequences (e.g., no more than 25, 20, 15, 10, or 5 repeating sequences).
[0007] In some embodiments, the fusion protein inhibits the transcription of RNA transcripts (e.g., mRNA) containing repetitive sequences from the mutant pair gene, but does not inhibit the transcription of RNA transcripts (e.g., mRNA) from the wild-type gene.
[0008] In some embodiments, the ZFP domain binds to a sense sequence in the target region, wherein the sense sequence comprises one to three hexanucleotide tandem repeat sequences of GGGGCC (SEQ ID NO:1), GGGCCG (SEQ ID NO:2), GGCCGG (SEQ ID NO:3), GCCGGG (SEQ ID NO:4), CCGGGG (SEQ ID NO:5), or CGGGGC (SEQ ID NO:6). In some embodiments, the fusion protein inhibits sense transcription from the mutant pair gene in human cells. In a particular embodiment, the fusion protein inhibits sense transcription from the C9orf721a promoter but does not inhibit sense transcription from the C9orf721b promoter.
[0009] In some embodiments, the ZFP domain binds to an antisense sequence in the target region, wherein the antisense sequence comprises one to three tandem repeats of the hexanucleotide sequence GGCCCC (SEQ ID NO:7), GCCCCG (SEQ ID NO:8), CCCCGG (SEQ ID NO:9), CCCGGC (SEQ ID NO:10), CCGGCC (SEQ ID NO:11), or CGGCCC (SEQ ID NO:12). In some embodiments, the fusion protein inhibits transcription of antisense from a mutant paired gene in human cells.
[0010] In some embodiments, the fusion protein inhibits both sense and antisense transcription from the mutant C9orf72 pair gene in human cells. In some embodiments, the fusion protein preferentially inhibits the mutant C9orf72 pair gene compared to the wild-type C9orf72 pair gene.
[0011] In other embodiments, the fusion protein inhibits at least about 30%, 40%, 75%, 90%, or 95% of the sense and / or antisense transcription from the mutant dual gene.
[0012] In some embodiments, the fusion protein has one or more ZFP domains, each of which may contain six zinc fingers; binds to the target sequence shown in Table 1; and / or contains six zinc fingers (arranged F1 to F6), each zinc finger containing a DNA-binding (recognition) helical sequence shown in a single column of Table 1, and may contain one or more mutations to residues outside the recognition helical region indicated in Table 1. In other embodiments, the fusion protein binds to the target sequence and contains zinc fingers corresponding to SBS IDs shown in Table 1, which contain DNA-binding (recognition) helical sequences of the SBS IDs shown in a single column of Table 1, wherein the SBS IDs are 78021, 75114, 75115, 74969, 79895, 79898, 74986, 79899, 79901, 79902, 79904, 79916, 75027, or 79921.
[0013] In some embodiments, the fusion protein has one or more transcriptional repressor domains, each of which may contain an amino acid sequence from the KRAB domain of human KOX1, as further described below. In a particular embodiment, the ZFP domain is linked to the transcriptional repressor domain via a peptide linker.
[0014] In another embodiment, the present invention provides a nucleic acid construct comprising the coding sequence of one or more of the fusion proteins described herein, wherein the coding sequence is operatively linked to a transcriptional regulatory element as appropriate. In some embodiments, the transcriptional regulatory element comprises a mammalian promoter that is constitutively active or inducible in brain cell lines, and wherein the promoter is, in appropriate embodiments, the human synaptic protein I promoter. In some embodiments, the construct is a recombinant adeno-associated virus (“AAV” or “rAAV”) construct. rAAV comprising a recombinant AAV construct and a protein shell of serotypes 1 to 10 (e.g., AAV2, AAV6, or AAV9) or pseudotypes derived therefrom (e.g., AAV2 / 9, AAV2 / 6, or AAV2 / 6 / 9) is also provided.
[0015] In another embodiment, the present invention provides a host cell comprising one or more fusion proteins and / or one or more nucleic acid constructs as described herein. The host cell may be, for example, a human cell, such as a neuron or a pluripotent stem cell (e.g., an embryonic stem cell or an induced pluripotent stem cell).
[0016] Pharmaceutical compositions are also provided that comprise one or more fusion proteins as described herein, one or more nucleic acid constructs (e.g., AAV constructs), recombinant viruses comprising nucleic acid constructs (e.g., rAAV), and / or one or more host cells, typically in combination with one or more pharmaceutically acceptable excipients.
[0017] In another embodiment, the present invention provides a method for inhibiting the transcription of a mutant C9orf72 pair gene in human cells (e.g., neurons, glial cells, ependymal cells, or neuroepithelial cells), wherein the mutant pair gene contains an amplified G4C2 repeat sequence region in intron 1a. The method comprises introducing into the cell one or more fusion proteins, one or more nucleic acid constructs (e.g., AAV), one or more recombinant viruses, one or more host cells, and / or one or more pharmaceutical compositions as described herein. In some embodiments, the cell line is in the brain or spinal cord of a patient with a C9orf72-related condition (such as ALS or C9FTD).
[0018] In one related embodiment, the present invention provides a method for treating a patient with a C9orf72-related condition, selected as appropriate from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD), the method comprising introducing the patient with one or more fusion proteins as described herein, one or more nucleic acid constructs (e.g., AAV), one or more host cells, and / or one or more pharmaceutical compositions.
[0019] In the treatment methods of the present invention, the fusion protein can be introduced using a recombinant virus (e.g., an AAV vector) expressing the fusion protein. In some embodiments, the recombinant virus is administered to the patient via intraventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, intranasal, and / or intracisional routes. In some embodiments, two or more different fusion proteins of the present invention are introduced, wherein the coding sequences of the two or more fusion proteins may be carried on the same or different recombinant viral vectors.
[0020] The present invention also provides one or more fusion proteins and / or one or more nucleic acid constructs, one or more recombinant viruses and one or more pharmaceutical compositions for use in the treatment methods described herein, and uses of the fusion proteins, nucleic acid constructs and recombinant viruses for use in the manufacture of agents for the treatment methods described herein.
[0021] Other features, objectives, and advantages of the present invention will become apparent from the following embodiments. However, it should be understood that while the embodiments indicate examples and styles of the invention, they are given by way of illustration rather than limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the embodiments. Simple Explanation of the Diagram
[0022] [picture] [1A] [to] [picture] [1C] A schematic diagram depicting the C9orf72 gene and its transcripts.
[0023] [picture] [1A] The structures of the wild-type C9orf72 pair and the amplified mutant C9orf72 pair are shown. The location of the G4C2 amplification on the amplified mutant pair is indicated (in the genomic region between exons 1a and 1b, i.e., in intron 1a). Exons are shown as boxes. Adapted from Douglas, above; see also Rizzu et al. (2016) Acta Neuropathologica Communications 4:37.
[0024] [picture] [1B] is a magnified view of the region near the G4C2 amplification on the mutant amplified C9orf72 counterpart gene, depicting the promoters and transcripts associated with the amplified counterpart gene. The approximate locations of the promoters involved in positive-sense transcription (solid arrows) and antisense transcription (hollow arrows) are shown. The five different positive transcripts previously described are also shown, along with their approximate locations and antisense directions. Ibid.
[0025] [picture] [1C] shows a model in which ZFP-TF in the targeted amplification region inhibits the 1a promoter and the antisense promoter, wherein ZFP-TF binds downstream of both promoters and at an optimal position for promoter regulation. The 1b promoter is not inhibited in this model because ZFP-TF binds upstream of the 1b promoter.
[0026] [picture] [2A] [to] [picture] [2] [D] shows the inhibition of C9orf72 expression (“total C9”) in a specified cell type using the specified ZFP-TF. Additionally, the diagram shows the inhibition of expression of the longer mRNA isoform (amplification) containing intron 1a, which isoform is primarily produced by the amplified mutant pair gene (“repetitive sequence isoform specific”). The amplified isoform is primarily expressed in C9 patient cell lines.
[0027] [picture] [2A] shows the PCR analysis used for total C9 analysis and isotype-specific analysis containing sense and antisense repeat sequences. The top of the figure depicts the genomic structure of the wild-type and amplified pairs, while the bottom shows the mRNA products obtained from each pair. The arrows on the mRNA plot depict the PCR targets used in the total C9 analysis.
[0028] [picture] [2B] [To the image] [2D] This figure shows the results of C9orf72 expression analysis of different exemplary ZFP-TFs in wild-type cell lines derived from healthy individuals and fibroblast cell lines "C9" derived from ALS patients. The C9 cell line is characterized as "5 / 850", which refers to the number of G 4C 2 repeat sequences in the wild-type pair gene (5) and the number in the amplified pair gene (850). Leftmost figure: Total C9orf72 expression ("Total C9") in wild-type cells in the third round of screening ("Round 3"). Second figure from the left: Total C9 in C9 cells in Round 3. Second figure from the right: Total C9 in C9 cells in the second round of screening ("Round 2"). Rightmost figure: Expression of the amplified C9orf72 pair gene as determined by isoform-specific C9orf72 analysis. A second round of screening was performed in C9 cells to assess the amount of isoform (or disease-specific) C9orf72 transcripts relative to total C9 transcripts after ZFP-TF treatment. In the third round, total C9 was measured in both C9 and wild-type cells to assess the effect of ZFP-TFs on wild-type (WT) paired genes in C9 cells. For each ZFP-TF, the concentrations of 1, 3, 10, 30, 100, and 300 ng mRNA are shown from left to right. [picture] [2B] The results for ZFP-TF 74949, 74951, 74954, 74955 and 74964 are shown in the top plot, and the results for 74969, 74971, 74973, 74978 and 74979 are shown in the bottom plot. [picture] [2B] SEQ ID NO:1, 1 and 3 are disclosed in the order of their appearance. [picture] [2C] The results for ZFP-TF 74983, 74984, 74986, 74987 and 74988 are shown in the top plot, and the results for 74997, 74998, 75001 and 75003 are shown in the bottom plot. [picture] [2C] SEQ ID NO:4 and 5 are disclosed in the order of their appearance. [picture] [2D] The results for ZFP-TF 75023, 75027, 75031, 75032, 75055 and 75078 are shown in the top plot, and the results for 75090, 75105, 75109, 75114 and 75115 are shown in the bottom plot. [picture] [2D] SEQ ID NOs: 8-11 are shown in the order of appearance. The sequences at the bottom of the figure represent the DNA-binding motif of the ZFP-TF. Each ZFP-TF binds to three hexanucleotide repeat sequences containing this motif. The amount of transcript is normalized relative to the amount of green fluorescent protein (GFP) expressed by GFP mRNA transfected with ZFP-TF mRNA. The horizontal dotted lines in the figure indicate 50% or 70% inhibition, as indicated. For example, for ZFP-TF 75115, there is approximately 50% inhibition of total isoform transcripts and approximately 70% inhibition of isoform-specific transcripts containing repeat sequences in the C9 cell line, while the inhibition of total isoforms is minimal in the WT cell line. The figure indicates that 30% of the transcripts remain, indicating 70% inhibition.
[0029] [picture] [3] A diagram showing the promoter regions of the sense and antisense transcripts in the C9orf72 amplified pair gene. Primer pairs are indicated for specific detection of sense, total, and antisense transcripts. AS: antisense. ddPCR: droplet digital PCR. The diagram shows SEQ ID NO: 1, 1, and 7 in the order they appear.
[0030] [picture] [4A] and [picture] [4B] Demonstrates primer-specific detection of antisense precursor mRNA (pre-mRNA) targeting intron 1b. Sense-specific PCR was used to generate sense (S) or antisense (AS) cDNA templates from healthy controls (Con) or C9 cells (C9). For example, C9-AS indicates ddPCR results obtained using antisense cDNA templates generated from RNA isolated from C9 cells. [picture] [4A] shows that only the cDNA template C9-AS produces PCR products, indicating the specificity of the primer for detecting antisense precursor mRNA. [picture] [4B] will [picture] The experiment in [4A] was extended to seven different C9orf72 patient-derived cell lines with different G 4C 2 repeat sequence lengths and six different healthy control cell lines.
[0031] [picture] [5A] [To the image] [5] [C] is a graph showing the inhibition of transcripts in C9 cells obtained using specific analysis of isoforms containing repetitive sequences. [picture] [5A] shows three experiments in which ZFP-TF 74949, 74978, 75003, 75027, 75109, 75114, 75115, 74960 and 74967 were given at three different doses (30, 100 or 300 ng) and the amount of positive transcripts of the disease was subsequently measured. [picture] [5B] Shows three experiments measuring disease antisense transcripts. [picture] [5C] shows three operations of total C9orf72 transcripts.
[0032] [picture] [6] Demonstrates inhibition of total C9 transcripts and amplified sense and antisense transcripts (disease isoforms) in three different fibroblast cell lines from different ALS patients, each containing different numbers of G4C2 repeat sequences (approximately 600, 800, and 850 repeat sequences, respectively) on their amplified counterpart genes. The amount of inhibition was assessed using isoform selectivity assays after cells were exposed to 100 ng ZFP-TF 75109, 75114, and 75115. All three ZFP-TFs maintained selective inhibition in all three cell lines.
[0033] [picture] [7] Repression of total C9 transcripts was shown in two cell lines from healthy individuals with a greater number of G4C2 repeats on their paired genes than the typical number. Healthy individuals typically have 2 to 5 G4C2 repeats on each of their C9orf72 paired genes. However, some healthy individuals contain more repeats. To ensure sufficient ZFP-TF binding sites, cell lines containing more than the typical number of repeats (5 / 8 and 5 / 20 repeats) were used. In these cell lines, total C9 transcripts were minimally affected.
[0034] [picture] [8A] [To the image] [8C] shows the results of microarray analysis in primary fibroblasts (C921, also known as C9021) derived from ALS patients, primary mouse neurons, and primary human neurons, demonstrating the specificity of designated repressors (75027, 75109, 75114, and 75115). ZFP-TF 75027 targets the repeating GCCCCG (SEQ ID NO:8) motif, while ZFP-TF 75109, 75114, and 75115 target the CCGGCC (SEQ ID NO:11) motif in the antisense strand of the C9orf72 gene.
[0035] [picture] [8A] Shows the results of a microarray analysis using Thermo Fisher Clariom™ S assay in patient-derived primary fibroblasts (C9021), which contains 21,000 well-annotated genes in its database. Analysis was performed 24 hours after administration of 300 ng of a repressor in mRNA form to C9021 cells. The figure illustrates genes that respond to upregulation or downregulation of a specified ZFP-TF.
[0036] [picture] [8B] Shows the results of a microarray analysis of primary mouse neurons using Thermo Fisher Clariom™ D analysis, which contains 140,000 labeled and unlabeled coding and non-coding transcripts in its database. Analysis was performed 7 days after AAV transduction. All cells were transduced at 3,000 MOI. The figure shows genes that respond to upregulation or downregulation of specified ZFP-TFs.
[0037] [picture] [8C] shows the results of a microarray analysis using Thermo Fisher Clariom™ D analysis in primary human neurons. Analysis was performed 19 days after AAV transduction at an MOI of 3,000. The figure illustrates genes that respond to upregulation or downregulation of specified ZFP-TFs.
[0038] [picture] [9] In vivo target binding of ZFP in C9orf72BAC transgenic mice. Figure A shows the AAV construct used for injection. The construct contains a synaptic promoter, a ZFP-KRAB coding sequence, and a Venus tag. Figures B and C show the study design in which newborn mice were injected into the intraventricular (ICV) brain with an AAV construct containing the ZFP-KRAB expression construct, and were dissected one month after injection for downstream analysis. Figure D shows the amount of positive, negative, and total C9 RNA in the hippocampus and cortex of animals injected with ZFP-KRAB (75027). Figure E shows representative images of positive and negative RNA aggregation sites in animals injected with ZFP-KRAB (75027) and quantification from the cornu ammonis (CA) and dentate gyrus (DG) regions. Implementation
[0039] Cross-reference to related applications
[0040] This application claims priority to U.S. Patent Application No. 62 / 837,523, filed April 23, 2019, and U.S. Patent Application No. 62 / 964,844, filed January 23, 2020. The disclosures of these priority applications are incorporated herein by reference in their entirety. sequence list
[0041] This application contains a sequence list, which has been submitted electronically in ASCII format and incorporated herein by full reference. The ASCII copy created on April 21, 2020, is named 025297_TW017_SL.txt and is 18,362 bytes in size.
[0042] This invention provides a zinc finger protein-based transcription factor (ZFP-TF) that preferentially targets and inhibits the transcription of mutant C9orf72 gene pairs containing amplified G4C2 repeat sequences into RNA. This amplified region may contain more than 30 G4C2 repeat sequences. The ZFP-TF of this invention is a fusion protein containing (i) at least one zinc finger protein (ZFP) domain that specifically binds to a DNA motif within a repeat sequence on the positive or negative strand of the mutant gene pair, and (ii) at least one transcriptional repressor domain that reduces transcription of the gene pair in either the positive or negative direction. It is anticipated that introducing ZFP-TF into the nervous system (e.g., the brain and spinal cord) will reduce the amount of mutant C9orf72 transcripts in neurons, thereby inhibiting (e.g., reducing or stopping) the formation of pathogenic cytotoxic substances within cells. The ZFP-TF of this invention can be used to treat (including prevent and alleviate) C9orf72-related conditions such as ALS and C9FTD.
[0043] This document discloses methods and compositions for the diagnosis, prevention, and / or treatment of ALS and FTD. Specifically, this document provides methods and compositions for modifying specific genes (e.g., regulating their expression) to treat these diseases, including the use of engineered transcription factor repressors and nucleases. In some embodiments, regulating expression includes regulating both sense and / or antisense expression.
[0044] Therefore, this document describes a method (in vivo, in vitro, and / or in vitro) for suppressing the sense and / or antisense transcription of a mutant C9orf72 gene pair gene with repetitive sequences in cells (e.g., neurons). The method involves treating cells with one or more repressors of the mutant C9orf72 gene pair gene, each repressor comprising a transcriptional repression domain and a DNA-binding domain that binds to a target site in the mutant C9orf72 gene pair gene. The repressors may comprise one or more zinc finger protein transcription factors (ZFP-TF containing a ZFP DNA-binding domain), one or more TAL effector domain transcription factors (TALE-TF containing a TAL effector domain DNA-binding domain), and / or one or more CRISPR / Cas transcription factor systems (containing a single guide RNA DNA-binding domain). In some embodiments, two or more different repressors are used (e.g., pharmaceutical compositions comprising one or more of these two or more different repressors). In some embodiments, the C9orf72 gene comprises a mutant pair containing one or more (G 4C 2) repeat sequences, wherein the DNA-binding domain of the repressor binds to a target site within the one or more (G 4C 2) repeat sequences. Therefore, the present invention provides the use of one or more ZFP-TF, TALE-TF, or CRISPR / Cas TF repressors (e.g., formulated into pharmaceutical compositions containing one or more of these repressors) binding to a mutant C9orf72 amplified pair containing one or more (G 4C 2) repeat sequences for the purpose of suppressing sense and / or antisense transcription in individuals in need (e.g., individuals with ALS and / or FTD, where the disease is treated and / or symptoms are improved) (e.g., suppression of 50%, 70%, or higher compared to untreated cells / individuals). In some embodiments, sense and / or antisense transcription is not suppressed to more than 90% of the normal (control) level. In some embodiments, antisense and sense transcription are suppressed in the same or different amounts (e.g., antisense and sense transcription are similarly suppressed); antisense transcription is suppressed more than sense transcription, or sense transcription is suppressed more than antisense transcription. In some embodiments, certain sense transcripts are suppressed while others are not. In some embodiments, promoter transcription from the 1b intron region is not suppressed, while promoter transcription from the 1a intron and antisense transcripts are suppressed. In some embodiments, transcripts containing amplified repetitive sequences are selectively suppressed (e.g., antisense transcription is suppressed, sense transcription from the 1a promoter is suppressed, and / or sense transcription from the 1b promoter is not suppressed).In some embodiments, one or more ZFP-TF repressors comprising the recognizing helical regions shown in Table 1 are used in the methods and uses described herein, and may be combined with one or more different repressors (e.g., other different ZFP-TFs, such as one or more additional ZFP-TFs comprising the ZFPs shown in Table 1). In some embodiments, one or more repressors are delivered to cells using one or more non-viral vectors (e.g., in mRNA form) and / or viral vectors (e.g., AAV, such as AAV2 / 9). Multiple copies of one or more regulators (e.g., repressors) may be delivered using the same or different modalities (e.g., mRNA and / or AAV). In some embodiments, one or more different regulators (e.g., repressors) may be delivered using the same or different modalities. In vivo methods and uses in living individuals (e.g., humans) may involve administration by any suitable means, including but not limited to intraventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, intranasal, and / or intracisional administration (e.g., a pharmaceutical composition comprising one or more repressors and / or polynucleotides encoding repressors). Brain administration may be unilateral or bilateral (e.g., administration to the hippocampus). Any amount (dosage) may be administered, such as 1E10 to 1E13 (e.g., 6E11) vg / hemispheric. In any of the methods and uses described herein, the individual's ALS and / or FTD are treated (and / or one or more symptoms of these diseases are treated).
[0045] This document provides gene regulators for the C9orf72 gene, comprising a DNA-binding domain (e.g., zinc finger protein (ZFP), TAL effector domain protein (TALE), or single guide RNA) that binds to a target site of at least 12 nucleotides in the C9orf72 gene; and a transcriptional regulatory domain (e.g., a repressor domain). Also provided are one or more polynucleotides (e.g., viral or non-viral gene delivery media, such as AAV vectors) encoding one or more of the gene regulators described herein. In other embodiments, this document describes pharmaceutical compositions comprising one or more polynucleotides and / or one or more gene delivery media as provided herein. In some embodiments, the gene regulator comprises a regulatory domain, and the gene regulator (and pharmaceutical compositions comprising one or more gene regulators or polynucleotides encoding one or more gene regulators) regulates (e.g., inhibits or activates) the expression of the C9orf72 gene. The sense and / or antisense portions of the gene may be bound and / or regulated. This document also provides isolated cells (including cell populations) containing one or more gene regulators as described herein; one or more polynucleotides; one or more gene delivery agents; and / or one or more pharmaceutical compositions. Methods and uses (in vitro, in vivo, or in vitro) for regulating the expression (e.g., inhibiting) of the C9orf72 gene in cells are also provided, including administration of (via any method, including but not limited to intraventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, or intracisional) one or more gene regulators as described herein; one or more polynucleotides; one or more gene delivery agents; and / or one or more pharmaceutical compositions to cells. These methods can be used to treat and / or prevent amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD) in individuals. Uses of one or more gene regulators; one or more polynucleotides; one or more gene delivery agents; and / or one or more pharmaceutical compositions for the treatment and / or prevention of ALS or FTD in individuals are also provided. Kits are also available that contain one or more gene regulators as described herein; one or more polynucleotides; one or more gene delivery agents; and / or one or more pharmaceutical compositions, and instructions for use as appropriate.
[0046] Therefore, in one state, engineered (non-naturally occurring) gene regulators (e.g., repressors) of one or more genes are provided. These gene regulators may comprise systems that regulate (e.g., suppress) the expression of a pair gene (e.g., zinc finger proteins, TAL effector (TALE) proteins, or CRISPR / dCas-TF). The expression of wild-type and / or mutant pair genes may be regulated together or separately. In some embodiments, the mutant pair gene exhibits greater regulation than the wild-type pair gene (e.g., suppression of the wild-type pair gene is no more than 50% of normal compared to the untreated control, but the mutant pair gene is suppressed by at least 70%). In some embodiments, the regulatory expression may comprise regulation of both the sense and antisense transcripts of the C9orf72 gene. In some embodiments, the regulatory expression may primarily regulate the sense transcript, while in other embodiments, the regulatory expression may primarily regulate the antisense transcript.
[0047] Amplification mutations in the C9orf72 paired gene result in the expression of both sense and antisense RNA products associated with ALS and FTD. Therefore, in one embodiment, an engineered transcription factor designed to inhibit the expression of such mutant C9orf72 paired genes is provided for the treatment of ALS or FTD. Engineered zinc finger proteins or TALEs are non-naturally occurring zinc finger or TALE proteins whose DNA-binding domains (e.g., recognition helices or RVDs) have been altered (e.g., through selection and / or rational design) to bind to pre-selected target sites. Any of the zinc finger proteins described herein may include 1, 2, 3, 4, 5, 6, or more zinc fingers, each having a recognition helice that binds to a target subsite in a selected sequence (e.g., multiple genes). In some embodiments, ZFP-TF comprises a ZFP having a recognition helical region as shown in a single column of Table 1. Similarly, any of the TALE proteins described herein may include any number of TALE RVDs. In some embodiments, at least one RVD has non-specific DNA binding. In some embodiments, at least one recognition helix (or RVD) is not naturally occurring. In some embodiments, TALE-TF comprises a TALE that binds to at least 12 base pairs of target sites as shown in Table 1. CRISPR / Cas-TF comprises a single guide RNA that binds to a target sequence. In some embodiments, an engineered transcription factor binds to a target site of at least 9 to 12 base pairs in a disease-related gene (e.g., via a ZFP, TALE, or sgRNA DNA-binding domain), such as a target site comprising at least 9 to 20 base pairs (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more), including continuous or discontinuous sequences within such target sites (e.g., target sites as shown in Table 1). In some embodiments, a gene regulator comprises a DNA-binding molecule (ZFP, TALE, single guide RNA) as described herein, operatively linked to a transcriptional repression domain (to form a gene repressor).
[0048] Therefore, zinc finger proteins (ZFPs), Cas proteins of the CRISPR / Cas system, or TALE proteins, as described herein, can be positioned to be operatively linked to regulatory domains (or functional domains) as part of a fusion molecule. Functional domains can be, for example, transcriptional activation domains, transcriptional repression domains, and / or nuclease (cleavage) domains. By selecting activation or repression domains for use with DNA-binding molecules, such molecules can be used to activate or repress gene expression. In some embodiments, functional or regulatory domains can function in post-translational histone modifications. In some cases, the domain is histone acetyltransferase (HAT), histone deacetylase (HDAC), histone methyltransferase, or an enzyme that sumolylates or biotinylates histones, or other enzyme domains that allow post-translational histone modifications to regulate gene repression (Kousarides, (2007) Cell128:693-705). In some embodiments, a molecule comprising a ZFP, dCas, or TALE fused to a transcriptional repressive domain that can be used to downregulate gene expression is provided, targeting a gene such as that described herein (e.g., C9orf72). In some embodiments, the methods and compositions of the present invention are suitable for treating eukaryotic cells. In some embodiments, the activity of the regulatory domain is regulated by an exogenous small molecule or ligand such that no interaction with the cellular transcriptional apparatus occurs in the absence of the exogenous ligand. Such exogenous ligands control the degree of interaction between the ZFP-TF, CRISPR / Cas-TF, or TALE-TF and the transcriptional apparatus. The regulatory domains may be operatively linked to any portion of one or more of the ZFP, dCas, or TALE, including between, outside of, or in any combination thereof. In a preferred embodiment, the regulatory domain causes repression of gene expression of the target gene (e.g., C9orf72). Any of the fusion proteins described herein can be formulated into pharmaceutical compositions.
[0049] In some embodiments, the artificial regulator binds to the promoter region upstream (e.g., at the 5' end) of the transcription start site (TSS) of the gene. In some embodiments, the artificial regulator binds to the region downstream of the TSS. In a preferred embodiment, the artificial regulator preferentially binds to the amplified repetitive sequence region in the C9orf72 gene. In some embodiments, the binding of the artificial regulator to the C9orf72 gene inhibits the expression of the promoter in the 1a intron. In some embodiments, the binding of the artificial regulator to the C9orf72 gene inhibits the expression of the promoter in the 1b intron. In some embodiments, the binding of the artificial regulator inhibits the expression of the 1a promoter and antisense promoter, but does not inhibit the 1b promoter. See also [picture] [1B] and [picture] [1C].
[0050] In some embodiments, the methods and compositions of the present invention include the use of two or more fusion molecules as described herein, such as two or more C9orf72 regulators (artificial transcription factors). The two or more fusion molecules may bind to different target sites and contain the same or different functional domains. Alternatively, the two or more fusion molecules as described herein may bind to the same target site but include different functional domains. In some cases, three or more fusion molecules are used; in others, four or more fusion molecules are used; and in still others, five or more fusion molecules are used. In some embodiments, two or more, three or more, four or more, or five or more fusion molecules (or components thereof) are delivered to cells in the form of nucleic acids. In a preferred embodiment, the fusion molecules cause inhibition of the expression of the target gene. In some embodiments, the two fusion molecules are given at doses where each molecule is active on its own, but the inhibitory activity is additive in combination. In some embodiments, the two fusion molecules are given at doses where neither is active on its own, but the inhibitory activity is synergistic in combination.
[0051] In another state, a polynucleotide encoding any of the DNA binding domains described herein is provided.
[0052] In some embodiments, the polynucleotide encoding the DNA-binding protein is mRNA. In some states, the mRNA may be chemically modified (e.g., Kormann et al., (2011) Nature Biotechnology 29(2):154-7). In other states, the mRNA may contain an ARCA cap (see U.S. Patent Nos. 7,074,596 and 8,153,773). In other embodiments, the mRNA may contain a mixture of unmodified nucleotides and modified nucleotides (see U.S. Patent Publication No. 2012 / 0195936).
[0053] In another embodiment, a gene delivery vector comprising any of the polynucleotides (e.g., repressors) described herein is provided. In some embodiments, the vector is an adenoviral vector (e.g., Ad5 / F35 vector); a lentiviral vector (LV), including integration-competent or integration-deficient lentiviral vectors; or an adenovirus-associated viral vector (AAV). In some embodiments, the AAV vector is an AAV2, AAV6, AAV8, or AAV9 vector, or a pseudotyped AAV vector, such as AAV2 / 8, AAV2 / 5, AAV2 / 9, and AAV2 / 6. In some embodiments, the AAV vector is an AAV vector capable of crossing the blood-brain barrier (e.g., U.S. Patent Publication No. 2015 / 0079038). In other embodiments, the AAV is a complementary AAV (sc-AAV) or a single-stranded (ss-AAV) molecule. This document also provides adenovirus (Ad) vectors, LV or adenovirus-associated viral vectors (AAV) containing a sequence encoding at least one nuclease (ZFN or TALEN) and / or a donor sequence for targeted integration into a target gene. In some embodiments, the Ad vector is a chimeric Ad vector, such as the Ad5 / F35 vector. In some embodiments, the lentiviral vector is an integrase-deficient lentiviral vector (IDLV) or an integrative lentiviral vector. In some embodiments, the vector is pseudotyped using a VSV-G coat or other coat.
[0054] Additionally, pharmaceutical compositions are provided that comprise nucleic acids and / or fusions, such as artificial transcription factors (e.g., ZFP, Cas, or TALE, or fusion molecules comprising ZFP, Cas, or TALE). For example, some compositions comprise a combination of a nucleic acid containing a sequence encoding one of the ZFP, Cas, or TALE described herein, operably linked to a regulatory sequence, and a pharmaceutically acceptable carrier or diluent, wherein the regulatory sequence allows the nucleic acid to be expressed in cells. In some embodiments, the encoded ZFP, Cas, CRISPR / Cas, or TALE regulates wild-type and / or mutant counterpart genes. In some embodiments, the mutant counterpart gene is preferentially regulated, e.g., repressed, than the wild-type counterpart gene. In some embodiments, the pharmaceutical composition comprises a ZFP, CRISPR / Cas, or TALE that preferentially regulates a mutant counterpart gene, and a ZFP, CRISPR / Cas, or TALE that regulates a neurotrophic factor. Protein-based compositions comprise one or more ZFP, CRISPR / Cas, or TALE as disclosed herein and a pharmaceutically acceptable carrier or diluent.
[0055] In another embodiment, isolated cells comprising any of the proteins, fusion molecules, polynucleotides, and / or compositions described herein are also provided. The isolated cells may be used for non-therapeutic purposes (such as providing cell or animal models for diagnostic and / or screening methods) and / or for therapeutic purposes (such as in vitro cell therapy).
[0056] In another embodiment, a pharmaceutical composition comprising one or more gene regulators as described herein, one or more polynucleotides (e.g., gene delivery agents), and / or one or more (e.g., a group) of isolated cells is also provided. In some embodiments, the pharmaceutical composition comprises two or more gene regulators. For example, some compositions comprise nucleic acids containing sequences encoding one or more gene regulators encoding one of the rare disease-as described herein (e.g., C9orf72). In some embodiments, (multiple) gene regulators (e.g., comprising ZFP, Cas, or TALE as described herein) are operatively linked to a regulatory sequence in combination with a pharmaceutically acceptable carrier or diluent, wherein the regulatory sequence enables the nucleic acid to be expressed in cells. In some embodiments, the encoded ZFP, CRISPR / Cas, or TALE is specific to a mutant or wild-type paired gene (e.g., C9orf72). In some embodiments, the pharmaceutical composition comprises a ZFP-TF, CRISPR / Cas-TF, or TALE-TF that regulates mutant and / or wild-type counterpart genes (e.g., C9orf72), including a TF that preferentially regulates (e.g., suppresses to a greater extent) the mutant counterpart gene compared to the wild-type counterpart gene. Protein-based compositions comprise one or more gene regulators as disclosed herein and a pharmaceutically acceptable carrier or diluent. In some embodiments, compositions comprising two or more gene regulators (loaded on the same or different types of vectors, such as AAV vectors) are used, wherein, where appropriate, one of the gene regulators comprises a ZFP-TF repressor containing a ZFP named 74949, 74978, 75027, or 75109.
[0057] This invention also provides methods and uses for inhibiting gene expression in individuals in need (e.g., individuals suffering from rare diseases as described herein), including by providing the individual with one or more polynucleotides, one or more gene delivery agents, and / or pharmaceutical compositions as described herein. In some embodiments, the compositions described herein are used to inhibit the expression of mutant C9orf72 in an individual, including for the treatment and / or prevention of ALS or FTD. The compositions described herein inhibit gene expression in the brain (including but not limited to the frontal cortex, including but not limited to the prefrontal cortex; parietal cortex; occipital cortex; temporal cortex, including but not limited to the entorhinal cortex; hippocampus; brainstem; striatum; thalamus; midbrain; cerebellum) and spinal cord (including but not limited to the lumbar, thoracic, and cervical vertebrae) for a duration of time (4 weeks, 3 months, 6 months to one year or longer). The compositions described herein can be provided to an individual by any delivery means, including but not limited to intraventricular, intrathecal, intracranial, intravenous, orbital (retroorbital (RO)), intranasal, and / or intracisional administration. Kits are also provided that contain one or more of the compositions described herein (e.g., gene regulators, polynucleotides, pharmaceutical compositions and / or cells) and instructions for use of such compositions.
[0058] In another embodiment, this document provides methods for treating and / or preventing CNS (e.g., ALS and / or FTD) using the methods and compositions described herein. In some embodiments, the methods involve compositions that deliver polynucleotides and / or proteins using viral vectors, non-viral vectors (e.g., plastids), and / or combinations thereof. In some embodiments, the methods involve compositions comprising stem cell populations containing artificial transcription factors (e.g., ZFP-TF, TALE-TF, or dCas-TF). Administration of the compositions described herein (proteins, polynucleotides, cells, and / or pharmaceutical compositions comprising such proteins, polynucleotides, and / or cells) results in therapeutic (clinical) effects, including but not limited to improvement or elimination of any clinical symptoms associated with ALS and / or FTD, and enhancement of function and / or increase in number of CNS cells (e.g., neurons, stellate cells, myelin, etc.). In some embodiments, compared to a control that did not receive an artificial repressor as described herein, the compositions and methods described herein reduce the expression of the sense and / or antisense transcripts of a target gene (e.g., C9orf72) by at least 30% or 40%, such as at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95%. In some embodiments, a reduction of at least 50% is achieved. In some embodiments, the artificial repressor preferentially suppresses the mutant dual gene (e.g., the amplified dual gene) by, for example, at least 20% (e.g., suppressing the wild-type dual gene by no more than 50% and suppressing the mutant dual gene by at least 70%) compared to the wild-type dual gene. In some embodiments, the repressor preferentially suppresses the sense transcripts on the mutant dual gene, while in other embodiments, the repressor preferentially suppresses the antisense transcripts on the mutant dual gene. In some embodiments, the repressor suppresses both the sense and antisense transcripts on the mutant dual gene.
[0059] In another embodiment, this document describes a method for delivering gene repressors to the brain of an individual using viral or non-viral vectors. In some embodiments, the viral vector is an AAV9 vector. Delivery can be made by any suitable means, including via cannulation to any brain region, such as the hippocampus or entorhinal cortex. Broad delivery of gene regulators (e.g., repressors) to the individual's brain is provided by any AAV vector, including delivery via anterograde and retrograde axonal transport to brain regions not directly to which the vector is delivered (e.g., delivery to the putamen results in delivery to other structures, such as the cortex, substantia nigra, thalamus, etc.). In some embodiments, the individual is human, and in other embodiments, the individual is a non-human primate. Dosing can be in the form of a single dose, a series of doses administered simultaneously, or multiple doses (in any temporal order).
[0060] Therefore, in other embodiments, this document describes methods for preventing and / or treating an individual's disease (e.g., ALS and / or FTD), which include administering a gene repressor to the individual using an AAV. In some embodiments, the repressor is administered to the individual's CNS (e.g., hippocampus and / or entorhinal cortex) or PNS (e.g., spinal cord / spinal fluid). In other embodiments, the repressor is administered intravenously. In some embodiments, this document describes methods for preventing and / or treating an individual's ALS or FTD, which include administering a repressor of the C9orf72 paired gene (wild-type and / or mutant) to the individual using one or more AAV vectors. In some embodiments, the AAV encoding the gene regulator is administered to the CNS (brain and / or CSF) via any delivery method, including but not limited to intraventricular, intrathecal, intracranial, intravenous, intranasal, retro-orbital, or intracisional delivery. In other embodiments, the AAV encoding the repressor is administered directly to the individual's brain parenchyma (e.g., hippocampus and / or entorhinal cortex). In other embodiments, the AAV encoding the repressor is administered intravenously (IV). In any of the methods described herein, administration may be performed once (single administration) with the same or different doses each time, or multiple administrations may be performed (with any time interval between administrations). When administration is performed multiple times, the same or different doses and / or administration patterns of the delivery medium may be used (e.g., IV and / or ICV administration with different AAV carriers). These methods include methods for reducing muscle function loss, loss of body coordination, muscle stiffness, muscle spasms, loss of speech function, dysphagia, and cognitive impairment in ALS individuals, methods for reducing motor function loss, and / or methods for reducing one or more cognitive function losses, all compared to individuals who have not received the methods, or compared to the individual before receiving the methods. Therefore, the methods described herein cause a reduction in biomarkers and / or symptoms of rare diseases such as ALS or FTD, including one or more of the following: muscle dysfunction, loss of body coordination, muscle stiffness, muscle spasms, loss of speech, dysphagia, cognitive impairment, ALS-related blood and / or cerebrospinal fluid chemicals, including changes in the levels of G-CSF, IL-2, IL-15, IL-17, MCP-1, MIP-1α, TNF-α, and VEGF (see Chen et al., Front Immunol. (2018) 9:2122) and / or other biomarkers known in this art. In some embodiments, these methods may further include, for example, administering one or more τ (MAPT) gene repressors to individuals with FTD. See, for example, U.S. Patent Publication No. 2018 / 0153921.
[0061] In any of the methods described herein, the repressor targeting the dual gene may be a ZFP-TF, such as a fusion protein comprising a ZFP that specifically binds to the dual gene and a transcriptional repression domain (e.g., KOX, KRAB, etc.). In other embodiments, the repressor targeting the dual gene may be a TALE-TF, such as a fusion protein comprising a TALE peptide that specifically binds to the gene dual gene and a transcriptional repression domain (e.g., KOX, KRAB, etc.). In some embodiments, the repressor targeting the dual gene is a CRISPR / Cas-TF, wherein the nuclease domain in the Cas protein is inactivated, preventing the protein from cleaving DNA. The resulting Cas RNA guides the DNA-binding domain to fuse with a transcriptional repressor (e.g., KOX, KRAB, etc.) to inhibit the targeting dual gene. In some embodiments, engineered transcription factors can inhibit the expression of mutant dual genes rather than wild-type dual genes. In other embodiments, DNA-binding molecules preferentially recognize hexameric GGGGCC (SEQ ID NO:1) amplification.
[0062] In some embodiments, a sequence encoding a gene repressor as described herein (e.g., ZFP-TF, TALE-TF, or CRISPR / Cas-TF) is inserted (integrated) into the genome, while in other embodiments, the sequence encoding the repressor remains free. In some cases, the nucleic acid encoding the TF fusion is inserted at a safe-carrying site containing the promoter (e.g., via nuclease-mediated integration), such that an endogenous promoter drives expression. In other embodiments, a repressor (TF) donor sequence is inserted (via nuclease-mediated integration) into the safe-carrying site, and the donor sequence contains a promoter that drives the repressor's expression. In some embodiments, the promoter sequence is broadly expressive, while in other embodiments, the promoter is tissue- or cell / type-specific. In a preferred embodiment, the promoter sequence is specific to neuronal cells. In other embodiments, the promoter sequence is specific to muscle cells. In some embodiments, the selected promoter is characterized by low expression. Non-limiting examples of suitable promoters include neuron-specific promoters NSE, synaptic proteins, CAMKiia, and MECP. Non-limiting examples of ubiquitous promoters include CMV, CAG, and Ubc. Other embodiments include the use of self-regulating promoters as described in U.S. Patent Publication No. 2015 / 0267205.
[0063] In any of the methods described herein, the method can produce suppression of the target pair gene (e.g., mutant or wild-type C9orf72) by about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more, 98% or more, or 99% or more in one or more neurons of an individual (e.g., an individual with ALS). In some embodiments, the expression of the wild-type pair gene is suppressed by no more than 50% in the individual (compared to an untreated individual), while the mutant pair gene is suppressed by at least 70% (70% or any value above 70%) in the individual (compared to an untreated individual). In some embodiments, the expression of the antisense promoter is suppressed by at least 70%. In some embodiments, antisense promoter expression in regions of C9orf72 introns 1a, 1b and / or 1c is suppressed by at least 70%, while sense promoter expression in region of C9orf72 intron 1b is suppressed by no more than 50%.
[0064] In any of the methods described herein, regulators (e.g., repressors or activators) may be delivered to an individual in the form of proteins, polynucleotides, or any combination of proteins and polynucleotides. In some embodiments, one or more repressors are delivered using an AAV vector. In other embodiments, at least one component of the regulator (e.g., sgRNA of a CRISPR / Cas system) is delivered in RNA form. In other embodiments, regulators are delivered using a combination of any of the expression constructs described herein, such as a repressor (or a portion thereof) on an expression construct (AAV9) and a repressor (or a portion thereof) on a separate expression construct (AAV or other viral or non-viral construct).
[0065] Furthermore, in any of the methods described herein, regulators (e.g., repressors) can be delivered to cells (in vitro or in vivo) at any concentration (dose) to provide the desired effect. In some embodiments, regulators are delivered using an adeno-associated virus (AAV) vector at 10,000 to 500,000 vector genomes / cell (or any value between therewith). In some embodiments, regulators are delivered using a lentiviral vector at an MOI between 250 and 1,000 (or any value between therewith). In other embodiments, regulators are delivered using a plasmonic vector at 0.01 to 1,000 nanograms / 100,000 cells (or any value between therewith). In other embodiments, repressors are delivered in mRNA form at 150 to 1,500 nanograms / 100,000 cells (or any value between therewith). Furthermore, for in vivo use, in any of the methods described herein, (multiple) gene regulators (e.g., repressors) can be delivered to individuals in need at any concentration (dose) to provide the desired effect. In some embodiments, the repressor is delivered using an adeno-associated virus (AAV) vector at a rate of 10,000 to 500,000 vector genomes / cell (or any value between therewith). In some embodiments, the repressor is delivered using a lentiviral vector at an MOI between 250 and 1,000 (or any value between therewith). In other embodiments, the repressor is delivered using a plasmonic vector at a rate of 0.01 to 1,000 nanograms / 100,000 cells (or any value between therewith). In other embodiments, the repressor is delivered as mRNA at a rate of 0.01 to 3,000 nanograms / cell number (e.g., 50,000 to 200,000 (e.g., 100,000) cells) (or any value between therewith). In other embodiments, the repressor is delivered to the brain parenchyma using an adeno-associated virus (AAV) vector at a constant volume of 1 to 300 μL at 1E11-1E14 Vg / mL. In other embodiments, the inhibitor was delivered to the CSF in a fixed volume of 0.5 to 10 mL using an adeno-associated virus (AAV) vector at 1E11-1E14 Vg / mL.
[0066] In any of the methods described herein, the method can produce regulation (e.g., repression) of approximately 50% or higher, 55% or higher, 60% or higher, 65% or higher, approximately 70% or higher, approximately 75% or higher, approximately 85% or higher, approximately 90% or higher, approximately 92% or higher, or approximately 95% or higher in one or more cells of an individual. In some embodiments, the wild-type and mutant mutant genes are regulated in different ways, for example, the mutant mutant gene is preferentially modified compared to the wild-type mutant gene (e.g., the mutant mutant gene is repressed by at least 70% and the wild-type mutant gene is repressed by no more than 50%).
[0067] In any of the methods described herein, the method can produce regulation (e.g., suppression) of antisense expression of a target pair gene at approximately 50% or higher, 55% or higher, 60% or higher, 65% or higher, approximately 70% or higher, approximately 75% or higher, approximately 85% or higher, approximately 90% or higher, approximately 92% or higher, or approximately 95% or higher in one or more cells of an individual. In some embodiments, the sense and antisense expressions in the mutant pair gene are regulated in different ways, for example, in the mutant pair gene, the expression of the antisense transcript is preferentially regulated compared to the expression of the sense transcript (e.g., the antisense expression is suppressed by at least 70% and the sense expression is suppressed by no more than 50%).
[0068] In other forms, such as transcription factors described herein, including those comprising one or more of the following: zinc finger proteins (ZFP-TF), TALE (TALE-TF), and CRISPR / Cas-TF, e.g., ZFP-TF, TALE-TF, or CRISPR / Cas-TF, are used to suppress the expression of mutant and / or wild-type paired genes (e.g., C9orf72) in an individual's brain (e.g., neurons). Suppression can be approximately 50% or higher, 55% or higher, 60% or higher, 65% or higher, 70% or higher, approximately 75% or higher, approximately 85% or higher, approximately 90% or higher, approximately 92% or higher, or approximately 95% or higher compared to the individual's untreated (wild-type) cells. In some embodiments, suppression of the wild-type paired gene is no more than 50% (compared to untreated cells or individuals), and suppression of the mutant (pathogen or isomorphic variant) is at least 70% (compared to untreated cells or individuals). In some embodiments, antisense transcription is completely (total) suppressed. In some embodiments, suppression of the sense transcript is no more than 50% (compared to untreated cells or individuals), and suppression of the antisense transcript is at least 70% (compared to untreated cells or individuals). In some embodiments, targeted regulation of transcription factors can be used to achieve one or more of the methods described herein.
[0069] Therefore, this document describes methods and compositions for regulating gene expression associated with the rare diseases disclosed herein, including suppression with or without the expression of exogenous sequences (such as artificial TFs). The compositions and methods are available for in vitro use (e.g., to provide cells for studying target genes (via their regulation); for drug discovery; and / or for preparing transgenic animals and animal models), in vivo use, or in vitro use, and include administration of artificial transcription factors or nucleases comprising DNA-binding molecules targeting genes associated with rare diseases, where appropriate, with the nuclease accompanied by a donor gene integrated into the gene after cleavage by the nuclease. In some embodiments, the donor gene (transgenic gene) is maintained extrachromosomally in the cells. In some embodiments, the cells are in patients with the disease. In other embodiments, the cells are modified by any of the methods described herein, and the modified cells are administered to individuals in need (e.g., individuals with rare diseases). Genetically modified cells (e.g., stem cells, precursor cells, T cells, muscle cells, etc.) comprising genetically modified genes (e.g., exogenous sequences) are also provided, including cells prepared by the methods described herein. These cells can be used to provide (multiple) therapeutic proteins to individuals with rare diseases, for example by administering (multiple) cells to individuals in need, or alternatively by isolating proteins produced by cells and administering those proteins to individuals in need (enzyme replacement therapy).
[0070] Kits are also provided that contain one or more of the following: gene regulators (e.g., repressors) as described herein and / or polynucleotides containing components of a target regulator (or a component thereof) and / or polynucleotides encoding a target regulator (or a component thereof). Kits may further include cells (e.g., neurons or muscle cells), reagents (e.g., for detecting and / or quantifying proteins, for example, in CSF), and / or instructions for use as described herein.
[0071] The methods and compositions of the present invention are described in further detail below. [I] [.] [Zinc finger protein transcription factor]
[0072] The present invention, ZFP-TF, is a fusion protein containing a DNA-binding zinc finger (ZFP) domain and a transcriptional repressor domain, wherein the two domains can associate with each other by direct peptide linkage or peptide linkers, or by dimerization (e.g., via leucine zippers, the N-terminal domain of STAT proteins, or FK506-binding proteins). As used herein, "fusion protein" refers to a complex of a polypeptide having a covalently linked domain and a polypeptide associated with each other via non-covalent bonds. The transcriptional repressor domain can associate with the ZFP domain at any suitable location, including at the C-terminus or N-terminus of the ZFP domain. []
[0073] In some embodiments, the ZFP-TF of the present invention represses transcription of the human mutant C9orf72 gene by 45% or higher (e.g., 50%, 60%, 70%, 80%, 90%, or 95% or higher). In some embodiments, two or more ZFP-TFs of the present invention are used simultaneously in a patient, wherein the ZFP-TF binds to different DNA motifs in the sense and / or antisense strands of the amplified C9orf72 region to achieve optimal repression of mutant C9orf72 transcription. [] [A] [.] [] [ZFP] [Domain Objective] []
[0074] The ZFP domain of the fusion protein of this invention preferentially binds to the amplified region of the paired gene of the mutant human C9orf72 gene. The human C9orf72 gene is located at position 21.2 (9p21.2) on the short (p) arm of chromosome 9. It spans base pairs 27,546,546 to 27,573,866 on this chromosome. The genomic structure of human C9orf72 is as follows: [picture] As shown in [1A], the DNA-binding ZFP domain of the ZFP-TF guides the fusion protein to the amplified repetitive sequence region of the mutant C9orf72 gene and carries the transcriptional repressor domain of the fusion protein to the target region. The repressor domain then inhibits the transcription of the C9orf72 gene by RNA polymerase. []
[0075] In some embodiments, the target sequence in the amplified region is at least 8 bp in length. For example, the target sequence length can be from 8 bp to 40 bp, such as 12, 15, 16, 17, 18, 19, 20, 21, 24, 27, 30, 33, or 36 bp. In some embodiments, the target sequence of the ZFP-TF of the present invention is 12 to 20 bp in length (e.g., 12 to 18, 15 to 19, 15, 18, or 19). In some embodiments, the target sequence comprises discontinuous subsequences.
[0076] The G4C2 repeat sequence causes the following six-nucleotide DNA motifs in the positive and negative strands of a gene: Justice C9orf72 Stock Fundamentals: (i) GGGGCC (SEQ ID NO:1) (ii) GGGCCG (SEQ ID NO:2) (iii) GGCCGG (SEQ ID NO:3) (iv) GCCGGG (SEQ ID NO:4) (v) CCGGGG (SEQ ID NO:5) (vi) CGGGGC (SEQ ID NO:6) The fundamental element of C9orf72 stocks: (vii) GGCCCC (SEQ ID NO:7) (viii) GCCCCG (SEQ ID NO:8) (ix) CCCCGG (SEQ ID NO:9) (x) CCCGGC (SEQ ID NO:10) (xi) CCGGCC (SEQ ID NO:11) (xii) CGGCCC (SEQ ID NO:12) In some embodiments, the target sequence of the ZFP-TF of the present invention comprises one or more (e.g., 2, 3, or 4) tandem repeat sequences of such DNA motifs. In some embodiments, the target sequence consists of three tandem repeat sequences of one of the motifs. In some embodiments, the target sequence comprises one or more (e.g., 2 or 3) tandem repeat sequences of motifs, plus several (e.g., 1, 2, 3, 4, or 5) nucleotides (e.g., CC(G 4C 2) 2GG) (SEQ ID NO:75) from upstream and / or downstream adjacent sequences.
[0077] The target sequence can be on the positive or negative strand of a gene. In some embodiments, the ZFP-TF used in the patient binds to both the positive and negative strands of the mutant paired gene. To ensure targeting accuracy and to reduce ZFP-TF deviates from the target binding, the selected C9orf72 target region sequence preferably has less than 75% homology with sequences in other genes in the genome (e.g., less than 70%, less than 65%, less than 60%, or less than 50% homology).
[0078] Other criteria for further evaluation of target segments include the prior availability of ZFPs combined with such segments or related segments, the ease of designing new ZFPs that combine with a given target segment, and the risk of deviating from the target combination. [B] [.] [Zinc finger protein domain]
[0079] "Zinc finger proteins" or "ZFPs" are proteins that possess a DNA-binding domain stabilized by zinc. ZFPs bind to DNA in a sequence-specific manner. Individual DNA-binding domains are referred to as "fingers." A ZFP has at least one finger, each finger binding two to four DNA base pairs, typically three or four. Each zinc finger typically contains approximately 30 amino acids and chelates zinc. Compared to naturally occurring zinc finger proteins, engineered ZFPs can possess novel binding specificities. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using a database containing triplet (or tetrat) nucleotide sequences and individual zinc finger amino acid sequences, wherein each triplet or tetrat nucleotide sequence is associated with one or more amino acid sequences of a zinc finger that binds a specific triplet or tetrat sequence. See, for example, the ZFP design methods described in detail below: U.S. Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,140,081; 6,200,759; 6,453,242; 6,534,261; 6,979,539; 8,586,526; 8,841,260; 8,956,828; and 9,234,016; and International Patent Publications WO 95 / 19431; WO 96 / 06166; WO 98 / 53057; WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 98 / 54311; WO 00 / 27878; WO 01 / 60970; WO 01 / 88197; WO 02 / 016536; WO 02 / 099084; and WO 03 / 016496.
[0080] The ZFP domain of the ZFP-TF of this invention may include at least three (e.g., four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen or more) zinc fingers. A ZFP domain with three fingers typically identifies target sites comprising 9 to 12 nucleotides. A ZFP domain with four fingers typically identifies target sites comprising 12 to 15 nucleotides. A ZFP domain with five fingers typically identifies target sites comprising 15 to 18 nucleotides. A ZFP domain with six fingers may identify target sites comprising 18 to 21 nucleotides.
[0081] As described, for example, in U.S. Patent Publication 2018 / 0087072, the target specificity of the ZFP domain can be improved by mutating the ZFP backbone. Mutations include mutations of residues in the ZFP backbone that can nonspecifically interact with phosphate esters on the DNA backbone but are not involved in nucleotide target specificity. In some embodiments, such mutations comprise mutating cationic amino acid residues to neutral or anionic amino acid residues. In some embodiments, such mutations comprise mutating polar amino acid residues to neutral or nonpolar amino acid residues. In other embodiments, mutations are performed at positions (-5), (-9), and / or (-14) relative to the DNA-binding helix. In some embodiments, the zinc fingers may contain one or more mutations at positions (-5), (-9), and / or (-14). In other embodiments, one or more zinc fingers in a multi-finger ZFP domain may contain mutations at positions (-5), (-9), and / or (-14). In some embodiments, the amino acid (e.g., arginine (R) or lysine (K)) at positions (-5), (-9), and / or (-14) is mutated to alanine (A), leucine (L), Ser (S), Asp (N), Glu (E), Tyr (Y), and / or glutamic acid (Q). In some embodiments, the R residue at position (-5) is mutated to Q.
[0082] Alternatively, the DNA-binding domain may be derived from nucleases. For example, the recognition sequences of homing endonucleases such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII, and I-TevII, as well as a wide range of nucleases, are known. See also U.S. Patents 5,420,032 and 6,833,252; Belfort et al., Nucleic Acids Res. (1997) 25:3379-88; Dujon et al., Gene (1989) 82:115-8; Perler et al., Nucleic Acids Res. (1994) 22:1125-7; Jasin, Trends Genet. (1996) 12:224-8; Gimble et al., J Mol Biol. (1996) 263:163-80; Argast et al., J Mol Biol. (1998) 280:345-53; and the New England Biolabs catalogue.
[0083] In some embodiments, the ZFP-TF of the present invention comprises one or more zinc finger domains. These domains may be linked together via an extendable, flexible linker, such that, for example, one domain contains one or more (e.g., 4, 5, or 6) zinc fingers, and another domain contains another one or more (e.g., 4, 5, or 6) zinc fingers. In some embodiments, the linker is a standard interdigital linker, such that the finger array contains a DNA-binding domain comprising 8, 9, 10, 11, or 12 or more fingers. In other embodiments, the linker is an atypical linker, such as a flexible linker. For example, two ZFP domains may be linked to a transcriptional repressor TF in the following configurations (N-terminus to C-terminus): ZFP-ZFP-TF, TF-ZFP-ZFP, ZFP-TF-ZFP, or ZFP-TF-ZFP-TF (two ZFP-TF fusion proteins fused together via a linker).
[0084] In some embodiments, ZFP-TFs are "two-handed," meaning they contain two zinc finger clusters (two ZFP domains) separated by an intermediate amino acid, allowing the two ZFP domains to bind to two discontinuous target sites. An example of a two-handed zinc finger binding protein is SIP1, in which four zinc finger clusters are located at the amino terminus of the protein, and three finger clusters are located at the carboxyl terminus (see Remacle et al., EMBO J. (1999) 18(18):5073-84). In such proteins, each cluster of zinc fingers can bind to a unique target sequence, and the space between two target sequences can contain many nucleotides.
[0085] In alternative embodiments, proteins that are functionally similar to ZFP-TF may be used instead of ZFP-TF. For example, transcriptional repressor fusion proteins may include DNA-binding domains derived from transcriptional activators, such as effector (TALE) DNA-binding domains, rather than ZFP domains. See, for example, U.S. Patents 8,586,526 and 9,458,205; U.S. Patent Publications 2013 / 0196373 and 2013 / 0253040; WO 2010 / 079430; Schornack et al., J Plant Physiol (2006) 163(3):256-72; Kay et al., Science (2007) 318:648-51; Moscou and Bogdanove, Science (2009) 326:1501; and Boch et al., Science (2009) 326:1509-12. In another example, the transcriptional repressor fusion protein may include a DNA-binding domain, which is a single guide RNA of the CRISPR / Cas system. See, for example, U.S. Patent Publication 2015 / 0056705; Jinek et al., Science (2012) 337:816; Ramalingam et al., Genome Biol. (2013) 14:107; Hwang et al., (2013) Nature Biotechnology 31(3):227. [C] [.] [Transcriptional repression domain]
[0086] The ZFP-TF of this invention comprises one or more transcriptional repressor domains that attenuate the transcriptional activity of the mutant C9orf72 paired gene. Non-restrictive examples of transcriptional repressor domains include the KRAB domain of KOX1, KAP-1, MAD, FKHR, EGR-1, ERD, SID, TGFβ-induced early gene (TIEG), v-ERB-A, MBD2, MBD3, DNMT family members (e.g., DNMT1, DNMT3A, DNMT3B), Rb, and MeCP2. See, for example, Bird et al., Cell (1999) 99:451-54; Tyler et al., Cell (1999) 99:443-46; Knoepfler et al., Cell (1999) 99:447-50; Robertson et al., Nature Genet. (2000) 25:338-42. Other illustrative repressor domains include, but are not limited to, ROM2 and AtHD2A. See, for example, Chem et al., Plant Cell (1996) 8:305-21; and Wu et al., Plant J. (2000) 22:19-27.
[0087] In some embodiments, the transcriptional repression domain comprises a sequence from the Kruppel-associated box (KRAB) domain of human zinc finger protein 10 / KOX1 (ZNF10 / KOX1) (e.g., GenBank NM_015394.4). An exemplary KRAB domain sequence is as follows: DAKSLTAWSR TLVTFKDVFV DFTREEWKLL DTAQQIVYRN VMLENYKNLV SLGYQLTKPD VILRLEKGEE PWLVEREIHQ ETHPDSETAF EIKSSV (SEQ ID NO:13).
[0088] Variants of this KRAB sequence can also be used, as long as they have the same or similar transcriptional repression function. [D] [.] [Peptide linker]
[0089] The ZFP domain and transcriptional repression domain of the ZFP-TF of this invention, and / or the zinc finger within the ZFP domain, can be linked via peptide linkers, such as non-cleavable peptide linkers of about 5 to 200 amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids). Some preferred linkers are flexible amino acid sequences synthesized into recombinant fusion proteins. See, for example, the description above; and U.S. Patents 6,479,626; 6,903,185; 7,153,949; 8,772,453; and 9,163,245; and WO 2011 / 139349. The proteins described herein may include any combination suitable for linkers. Non-limiting examples of connectors are DGGGS (SEQ ID NO:14), TGEKP (SEQ ID NO:15), LRQKDGERP (SEQ ID NO:16), GGRR (SEQ ID NO:17), GGRRGGGS (SEQ ID NO:18), LRQRDGERP (SEQ ID NO:19), LRQKDGGGSERP (SEQ ID NO:20), LRQKD(G 3S) 2ERP (SEQ ID NO:21), TGSQKP (SEQ ID NO:22), LRQKDAARGS (SEQ ID NO:26), and LRQKDAARGSGG (SEQ ID NO:76).
[0090] In some embodiments, the peptide linker is 3 to 20 amino acid residues in length and is rich in G and / or S. A non-limiting example of such a linker is the G 4S type linker (“G 4S” disclosed as SEQ ID NO:23), that is, a linker containing one or more (e.g., 2, 3 or 4) GGGGS (SEQ ID NO:23) motifs or variations thereof (such as having one, two or three amino acid insertions, deletions and substitutions in the motif).
[0091] In some embodiments, the ZFP-TF includes a nuclear localization signal (e.g., a nuclear localization signal from the intermediate T antigen SV40) and / or an antigenic determinant tag (e.g., FLAG and hemagglutinin). [II] [.] [ZFP] [-] [TF] [Their performance]
[0092] The ZFP-TF of this invention can be introduced into a patient via a nucleic acid molecule encoding it. For example, the nucleic acid molecule is an RNA molecule, and the RNA molecule is introduced into the patient's brain via injection of a composition comprising a lipid:nucleic acid complex (e.g., liposomes). Alternatively, ZFP-TF can be introduced into a patient via a nucleic acid expression vector comprising the coding sequence of ZFP-TF. The expression vector may include expression control sequences (such as promoters, enhancers), transcription signal sequences, and transcription termination sequences that enable the coding sequence of ZFP-TF to be expressed in cells of the nervous system (e.g., the central nervous system). In some embodiments, the expression vector persists in the cell as a stable, cell-free episome. In other embodiments, the expression vector is integrated into the cell's genome.
[0093] In some embodiments, the promoter on the vector used to guide ZFP-TF expression in the brain is a constitutively active promoter or an inducible promoter. Suitable promoters include, but are not limited to, Rous sarcoma virus (RSV) long terminal repeat (LTR) promoters (with RSV enhancers as appropriate), cytomegalovirus (CMV) promoters (with CMV enhancers as appropriate), CMV immediate early promoters, simian virus 40 (SV40) promoters, dihydrofolate reductase (DHFR) promoters, β-actin promoters, phosphoglycerate kinase (PGK) promoters, EF1α promoters, and Moloney murine leukemia virus (MoMLV). LTR, creatine kinase (CK6)-based promoters, thyroxine transporter promoters (TTR), thymidine kinase (TK) promoters, tetracycline-responsive promoters (TRE), hepatitis B virus (HBV) promoters, human α1-antitrypsin (hAAT) promoters, chimeric liver-specific promoters (LSP), factor E2 (E2F) promoters, human telomerase reverse transcriptase (hTERT) promoters, CMV enhancer / chicken β-actin / rabbit β-hemoglobin promoters (CAG promoter; Niwa et al., Gene (1991) 108(2):193-9), and RU-486-responsive promoters can also be used. Neuron-specific promoters, such as synapticin I promoters, calcium / calcitonin-dependent protein kinase II (CamKII) promoters, methyl CpG-binding protein 2 (MeCP2) promoters, choline acetyltransferase (ChAT) promoters, and calcium-binding protein (Calb) promoters, can also be used. Astrocyte-specific promoters, such as the glial fibrillary acidic protein (GFAP) promoter or the aldehyde dehydrogenase 1 family member L1 (Aldh1L1) promoter, can also be used. Oligodendrical glial cell-specific promoters, such as the Olig2 promoter, can also be used. Additionally, the promoter may include one or more self-regulating elements, thereby allowing ZFP-TF to bind and suppress its own expression to a preset threshold. See U.S. Patent 9,624,498.
[0094] Any method can be used to introduce nucleotide sequences into cells, including but not limited to electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, combinations of liposomes with nuclear localization signals, naturally occurring liposomes (e.g., exosomes), or viral transduction.
[0095] For in vivo delivery of expression vectors, viral transduction can be used. A variety of viral vectors known in this art are suitable for this invention, such as vaccinia vectors, adenovirus vectors, lentiviral vectors, poxvirus vectors, herpesvirus vectors, adeno-associated virus (AAV) vectors, retroviral vectors, and hybrid viral vectors. In some embodiments, the viral vector used herein is a recombinant AAV (rAAV) vector. AAV vectors are particularly suitable for central nervous system (CNS) gene delivery because AAV infects both dividing and non-dividing cells and has very low immunogenicity, and the viral genome exists in a stable, free form for long-term expression (Hadaczek et al., Mol Ther. (2010) 18:1458-61; Zaiss et al., Gene Ther. (2008) 15:808-16). Any suitable AAV serotype can be used. For example, AAV can be AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV8.2, AAV9, or AAVrh10, or have pseudotypes (e.g., AAV2 / 8, AAV2 / 5, AAV2 / 6, AAV2 / 9, or AAV2 / 6 / 9). See, for example, U.S. Patents 7,198,951 and 9,585,971.
[0096] In some embodiments, the expression vector is an AAV vector and is introduced into target human cells via recombinant AAV viral particles. The genome of the recombinant AAV viral particles includes constructs comprising AAV inverted terminal repeat (ITR) sequences at both ends, enabling the production of AAV viral particles in production systems such as insect cell / baculovirus production systems or mammalian cell production systems. AAV may be engineered to reduce the immunogenicity of its capsid protein in humans and enhance its transduction capacity. In some embodiments, AAV9 is used. The viral vector described herein can be produced using methods known in this art. Any suitable permissible or packaging cell type can be used to produce viral particles. For example, mammalian (e.g., 293) insect (e.g., Sf9) cells can be used as packaging cell lines.
[0097] For methods of expressing therapeutic proteins, including ZFP, in the nervous system of patients in need, see also U.S. Patents 6,309,634; 6,453,242; 6,503,717; 6,534,261; 6,599,692; 6,607,882; 6,689,558; 6,824,978; 6,933,113; 6,953,575; 6,979,539; 7,013,219; 7,163,824; 7,182,944; 8,309,355; 8,337,458; 8,586,526; 9,050,299; and 9,089,667. [III] [.] [Pharmaceutical Applications]
[0098] This invention provides a ZFP-TF for the treatment of patients requiring downregulation of C9orf72 expression, particularly downregulation of the expression of the mutant C9orf72 counterpart gene. Patients have or are at risk of developing C9orf72-related neurodegenerative diseases (such as ALS and C9FTD). At-risk patients include those genetically predisposed to the disease, those who have suffered repeated brain injuries (such as concussions), and those exposed to environmental neurotoxins. This invention provides a method for treating individuals (such as human patients in need) with C9orf72-related neurodegenerative diseases (e.g., ALS and C9FTD), comprising introducing a therapeutically effective amount (e.g., an amount sufficient to adequately suppress the expression of the mutant C9orf72 counterpart gene) of ZFP-TF (e.g., an rAAV vector expressing it) into the individual's nervous system (e.g., CNS). The term "treatment" encompasses symptom relief, prevention of symptom onset, slowing disease progression, improving quality of life, and increasing survival.
[0099] This invention provides pharmaceutical compositions comprising a viral vector, such as rAAV in an expression cartridge containing a recombinant genome of ZFP-TF. The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, such as water, physiological saline (e.g., phosphate-buffered saline), dextran, glycerol, sucrose, lactose, gelatin, dextran, albumin, or pectin. Additionally, the composition may contain excipients, such as wetting or emulsifying agents, pH buffers, stabilizers, or other agents that enhance the effectiveness of the pharmaceutical composition. The pharmaceutical composition may contain delivery mediators, such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, and vesicles.
[0100] The therapeutic agents of this invention target cells in the brain and / or spinal cord, including but not limited to neurons (e.g., motor neurons, sensory neurons, dopamine-activated neurons, choline-activated neurons, glutamate-activated neurons, GABA-activated neurons, or serotonin-activated neurons); glial cells (e.g., oligodendrocytes, stellate cells, outer layer cells, Schwann cells, or microglial cells); ependymal cells; or neuroepithelial cells. The targeted brain regions may be the cortex, frontotemporal lobe, entorhinal cortex, hippocampus, cerebellum, pons, and medulla oblongata. These regions can be reached directly via intrahippocampal injection, intracerebral injection, intracisternal injection (ICM), or more generally via intraparenchymal injection, intraventricular injection (ICV), intrathecal injection, or intravenous injection. Other routes of administration include, but are not limited to, intracerebral, intraventricular, intranasal, or intraocular administration. In some embodiments, the viral vector spreads throughout the CNS tissue after being administered directly to the cerebrospinal fluid (CSF), for example via intrathecal and / or intracerebral injection, intracisional injection, or intraventricular injection. In other embodiments, after intravenous administration, the viral vector crosses the blood-brain barrier and achieves widespread distribution throughout the individual's CNS tissue. In other embodiments, the viral vector is delivered directly to the target area via intraparenchymal injection. In some cases, after intraparenchymal delivery, the viral vector may undergo retrograde or anterograde transport to reach other brain regions. In some forms, the viral vector possesses unique CNS tissue targeting capabilities (e.g., CNS tissue tropism), enabling stable and non-toxic gene transfer with high efficiency.
[0101] For example, the pharmaceutical composition can be administered to the patient via intraventricular delivery, such as into the ventricular regions of the patient's forebrain, including the right ventricle, left ventricle, third ventricle, or fourth ventricle. It can also be administered intracerebrally, such as by injecting the composition into or near the cerebrum, medulla oblongata, pons, cerebellum, intracranial cavity, meninges, dura mater, arachnoid membrane, or pia mater. In some cases, intracerebral delivery may include administering the drug into the cerebrospinal fluid (CSF) surrounding the subarachnoid space of the brain.
[0102] In some cases, intracerebral administration involves stereotactic injection. Stereotactic surgery is well-known in this technique and typically involves the use of a computer and a 3D scanning device, which together guide the injection to a specific intracerebral region, such as the ventricles. Microinjection pumps (e.g., from World Precision Instruments) may also be used. In some cases, microinjection pumps are used to deliver compositions containing viral vectors. In some cases, the infusion rate of the composition ranges from 1 μL / min to 100 μL / min. As those skilled in this technique will understand, the infusion rate will depend on a variety of factors, including, for example, the individual's age, weight / size, AAV serotype, the required dose, and the targeted intracerebral region. Therefore, those skilled in this technique may consider other infusion rates appropriate in certain circumstances.
[0103] rAAV can be delivered to an individual, for example, via intravenous administration. In some cases, it may be necessary to deliver rAAV locally to brain tissue, spinal cord, cerebrospinal fluid (CSF), neurons, glial cells, meninges, stellate cells, oligodendrocytes, interstitial spaces, and the like. In some cases, recombinant AAV (e.g., 10⁷–10¹⁵ Vg / dose) can be delivered directly to the CNS by injection into the ventricular region and / or into the hippocampus, cortex, cerebellar lobules, or other brain regions. Neurosurgical techniques known in this field, such as stereotactic injection, can be used with needles, catheters, or related devices to deliver AAV. See, for example, Stein et al., J Vir. (1999) 73:3424-9; Davidson et al., PNAS. (2000) 97:3428-32; Davidson et al., Nat Genet. (1993) 3:219-223; and Alisky and Davidson, Hum. Gene Ther. (2000) 11:2315-29; U.S. Patents 7,837,668 and 8,092,429.
[0104] Unless otherwise defined herein, scientific and technical terms used in connection with this invention will have the meanings commonly understood by one of ordinary skill in the art. Illustrative methods and substances are described below, but similar or equivalent methods and substances may also be used to practice or test this invention. In case of conflict, this specification (including definitions) shall prevail. Generally, the nomenclature and techniques used in neurology, medicine, medical and pharmaceutical chemistry, and cell biology described herein are well known and commonly used in this art. Enzymatic reactions and purification techniques are performed according to the manufacturer's instructions as commonly practiced in this art or as described herein. Furthermore, unless the context otherwise requires, singular terms shall include plural and plural terms shall include singular. Throughout this specification and examples, the words "have" and "comprise," or variations such as "has / having" and "comprises / comprising," shall be understood to imply inclusion of the integers or groups of integers stated herein, but do not exclude any other integers or groups of integers. All disclosures and other references mentioned herein are incorporated herein by reference in their entirety. Although multiple documents are cited herein, such citations do not constitute a license for any of these documents to form part of common general knowledge in the art. As used herein, the terms “approximately” or “about” when applied to one or more values of interest mean a value similar to the stated reference value. In some embodiments, unless otherwise stated or otherwise apparent from the context, the term refers to a range of values within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction of the stated reference value.
[0105] To enable a better understanding of the present invention, the following embodiments and examples are provided. These embodiments and examples are for illustrative purposes only and should not be construed as limiting the scope of the present invention in any way. [IV] [.] [Exemplary Examples]
[0106] Non-limiting exemplary embodiments of the present invention are described below. 1. A method for inhibiting the sense and / or antisense transcription of the C9orf72 gene in cells, the method comprising treating the cell with one or more C9orf72 gene repressors, the one or more repressors comprising a transcriptional repression domain and a DNA-binding domain binding to a target site in the C9orf72 gene, wherein, where appropriate, the one or more repressors comprise one or more zinc finger protein transcription factors (ZFP-TF), one or more TAL effector domain transcription factors (TALE-TF) and / or one or more CRISPR / Cas transcription factors. 2. The method of Example 1, wherein the C9orf72 gene contains a mutant pair containing one or more amplified (G4C2) repeat sequences, wherein the target site is located within one or more amplified (G4C2) repeat sequences. 3. Use of one or more ZFP-TF, TALE-TF and / or CRISPR / Cas TF repressors to a mutant C9orf72 amplified pair containing one or more (G 4C 2) repeat sequences, for the purpose of suppressing sense and / or antisense transcription in individuals in need. 4. The method or use as described in any of the foregoing embodiments, wherein antisense transcription is suppressed by at least 50% compared to untreated cells. 5. The method or use as described in any of the foregoing embodiments, wherein antisense transcription is suppressed by at least 70% compared to untreated cells. 6. The method or use as described in any of the foregoing embodiments, wherein transcripts amplifying repetitive sequences are selectively repressed, wherein antisense transcription is repressed, sense transcription from the 1a promoter is repressed and / or sense transcription from the 1b promoter is not repressed. 7. The method or use as described in any of the foregoing embodiments, wherein one or more ZFP-TF suppressors comprise ZFPs having recognizing helical regions in the order shown in Table 1. 8. The method or use as described in any of the foregoing embodiments, wherein one or more ZFP-TF repressors are administered to cells in the form of mRNA or using a viral vector. 9. The method or use as described in Example 8, wherein the viral vector system is an Ad or AAV vector. 10. The method or use as described in Example 9, wherein the AAV carrier system is an AAV2 / 9 carrier. 11. The method or use as described in any of the foregoing embodiments, wherein the cells are in a living individual and one or more ZFP-TF repressors are administered to the individual. 12. The method or use as described in Example 11, wherein one or more ZFP-TF inhibitors are administered into the ventricles, intrathecal, intracranial, retro-orbital (RO), intravenous, intranasal, and / or intracisional veins of an individual. 13. The method or use as described in Example 12, wherein the ZFP-TF repressor is administered to one or both sides of the hippocampus of an individual, using an AAV carrier at a dose of 1E10 to 1E13 (e.g., 6E11) vg / hemispheric, as appropriate. 14. The method or use as described in any of the foregoing embodiments, wherein the cell line is a neuron. 15. The method or use as described in any of the preceding embodiments, wherein two more ZFP-TF repressors are further administered. 16. The method or use as described in Example 15, wherein two or more ZFP-TF inhibitors are loaded on the same or different non-viral or viral vectors. 17. The method or use as described in any of the foregoing embodiments, wherein the individual's ALS and / or FTD is treated. 18. The method or use as described in any of the foregoing embodiments, wherein one or more symptoms of ALS and / or FTD in an individual are improved. 19. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 78021. 20. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 75114. 21. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 75115. 22. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 74969. 23. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79895. 24. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79898. 25. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 74986. 26. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79899. 27. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79901. 28. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79902. 29. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79904. 30. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79916. 31. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 75027. 32. A ZFP-TF fusion protein that binds to a target sequence and includes zinc fingers corresponding to SBS IDs as shown in Table 1, wherein the zinc fingers include the DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79921. 33. The ZFP-TF fusion protein of any one of Examples 19 to 32, wherein the ZFP-TF fusion protein comprises a transcriptional repressor domain including SEQ ID NO:13. 34. The ZFP-TF fusion protein of any one of Examples 19 to 33, wherein the zinc finger domain and the transcriptional repressor domain are linked by a peptide linker comprising SEQ ID NO:26. Example [Example] [1] [Artificial transcription repressors]
[0107] A set of ZFP-TFs was generated to target and amplify the human C9orf72 paired gene. Indicative ZFP-TFs are shown below. [surface] [1] In. Each of these ZFP-TFs contains a ZFP domain with six fingers and a KRAB domain as described above (SEQ ID NO:13). A peptide linker is used to link the ZFP domain to the KRAB domain. The linker has the following amino acid sequence: LRQKDAARGS (SEQ ID NO:26).
[0108] [surface] [1] The DNA sequence of the target site in each ZFP-TF and the amino acid sequence of the DNA-binding helix of each zinc finger (F1 to F6) are shown. SEQ ID NO is shown in parentheses. The target sequence bound by the ZFP domain in the target site is shown in uppercase letters, while the flanking sequence is shown in lowercase letters. SEQ ID NO:24 is the target site on the positive strand of the gene pair gene, and SEQ ID NO:25 is the target site on the antisense strand of the gene pair gene.
[0109] The DNA-binding helix is a variable portion of the zinc finger and typically contains six or seven amino acid residues. As described, for example, in U.S. Patent Publication 2018 / 0087072, the target specificity of the ZFP domain can be increased by mutating the ZFP backbone. The symbol "^" in the table indicates that the arginine (R) residue at position 4 upstream of the first amino acid in the designated helix is replaced with glutamic acid (Q). In each zinc finger helical sequence, the positions of the seven DNA-binding amino acids are numbered -1, +1, +2, +3, +4, +5, and +6. Therefore, the position numbered for the R to Q substitution is (-5). [surface] [1] [] [illustrative] [, C9orf72 , ] [] [ZFP] [-] [TF] [] [SBS ID] [Target Site] [(SEQ ID NO)] [Zinc Index] [DNA] [Binding helical amino acid sequence] [(SEQ ID NO)] [F1] [F2] [F3] [F4] [F5] [F6] 74949 taGGGGCCGGGGCCGGGGCCggggcgtg (24) DRSDLSR (27) RSTHLVR (28) DRSDLSR (27) RSTHLVR (28) DRSDLSR (27) RSTHLVR (28) 74951 taGGGGCCGGGGCCGGGGCCggggcgtg (24) DRSDLSR (27) RSAHLSR (29) DRSDLSR (27) RSAHLSR (29) DRSDLSR (27) RSAHLSR (29) 74954 taGGGGCCGGGGCCGGGGCCggggcgtg (24) ERGDLKR (30) RSAHLSR (29) ERGDLKR (30) RSAHLSR (29) ERGDLKR (30) RSAHLSR (29) 74955 taGGGGCCGGGGCCGGGGCCggggcgtg (24) ERGTLAR (31) RSAHLSR(29) ERGTLAR (31) RSAHLSR(29) ERGTLAR(31) RSAHLSR(29) 74964 tagGGGCCGGGGCCGGGGCCGgggcgtg (24) RSADLSE (32) RSAHLSR (29) RSADLSE (32) RSAHLSR(29) RSADLSE (32) RSAHLSR(29) 74969 taggGGCCGGGGCCGGGGCCGGggcgtg (24) RSDHLSE (33) DRSHLAR (34) RSDHLSE (33) DRSHLAR(34) RSDHLSE (33) DRSHLAR(34) 74971 taggGGCCGGGGCCGGGGCCGGggcgtg (24) RSDHLSQ (35) DNSHRTR (36) RSDHLSQ (35) DNSHRTR (36) RSDHLSQ (35) DNSHRTR (36) 74973 taggGGCCGGGGCCGGGGCCGGggcgtg (24) RNGHLLD (37) DRSHLAR (34) RNGHLLD (37) DRSHLAR(34) RNGHLLD(37) DRSHLAR(34) 74978 taggGGCCGGGGCCGGGGCCGGggcgtg (24) RNGHLLD (37) DNSHRTR (36) RNGHLLD (37) DNSHRTR(36) RNGHLLD(37) DNSHRTR(36) 74979 taggGGCCGGGGCCGGGGCCGGggcgtg (24) RSAHLSE (38) DNSHRTR (36) RSAHLSE (38) DNSHRTR(36) RSAHLSE (38) DNSHRTR(36) 74983 tagggGCCGGGGCCGGGGCCGGGgcgtg (24) RSAHLSR (29) DRSDLSR (27) RSAHLSR(29) DRSDLSR(27) RSAHLSR (29) DRSDLSR(27) 74984 tagggGCCGGGGCCGGGGCCGGGgcgtg (24) RSDHLSR (39) DWTTRRR (40) RSDHLSR (39) DWTTRRR(40) RSDHLSR (39) DWTTRRR(40) 74986 tagggGCCGGGGCCGGGGCCGGGgcgtg (24) RSAHLSR (29) HRKSLSR (41) RSAHLSR (29) HRKSLSR(41) RSAHLSR (29) HRKSLSR(41) 74987 tagggGCCGGGGCCGGGGCCGGGgcgtg (24) RSAHLSR (29) DSSDRKK (42) RSAHLSR (29) DSSDRKK(42) RSAHLSR (29) DSSDRKK(42) 74988 tagggGCCGGGGCCGGGGCCGGGgcgtg (24) RSAHLSR (29) DSSTRRR (43) RSAHLSR (29) DSSTRRR(43) RSAHLSR (29) DSSTRRR(43) 74997 taggggCCGGGGCCGGGGCCGGGGcgtg (24) RSAHLSR (29) RSDDRKT (44) RSAHLSR (29) RSDDRKT(44) RSAHLSR (29) RSDDRKT(44) 74998 taggggCCGGGGCCGGGGCCGGGGcgtg (24) RSAHLSR (29) RSADRKT (45) RSAHLSR (29) RSADRKT(45) RSAHLSR (29) RSADRKT(45) 75001 taggggCCGGGGCCGGGGCCGGGGcgtg (24) RSAHLSR (29) RNADRITE (46) RSAHLSR (29) RNADRITE(46) RSAHLSR (29) RNADRITE(46) 75003 taggggCCGGGGCCGGGGCCGGGGcgtg (24) RSAHLSR (29) RRATLLD (47) RSAHLSR (29) RRATLLD(47) RSAHLSR (29) RRATLLD(47) 75023 cacGCCCCGGCCCCGGCCCCGgccccta (25) RSDTLSV (48) DTSRTK (49) RSDTLSV (48) DTSTRTK(49) RSDTLSV(48) DTSTRTK(49) 75027 cacGCCCCGGCCCCGGCCCCGgccccta (25) RNADRIT (46) HRKSLSR (41) RNADRIT (46) HRKSLSR(41) RNADRIT(46) RNADRIT(46) 75031 cacGCCCCGGCCCCGGCCCCGgccccta (25) RSADRKT (45) HRKSLSR (41) RSADRKT (45) HRKSLSR(41) RSADRKT(45) HRKSLSR (41) 75032 cacGCCCCGGCCCCGGCCCCGgccccta (25) RSATLSE (50) HRKSLSR (41) RSATLSE (50) HRKSLSR(41) RSATLSE(50) HRKSLSR(41) 75055 cacGCCCCGGCCCCGGCCCCGgccccta (25) RSADRKT (45) DSSTRRR (43) RSADRKT (45) DSSTRRR(43) RSADRKT(45) DSSTRRR(43) 75078 cacGCCCCGGCCCCGGCCCCGgccccta (25) RSADLSE (32) HHRSLHR (51) RSADLSE (32) HHRSLHR(51) RSADLSE (32) HHRSLHR(51) 75090 cacgCCCCGGCCCCGGCCCCGGccccta (25) RSDHLSE (33) TSSDRTK (52) RSDHLSE (33) TSSDRTK(52) RSDHLSE (33) TSSDRTK(52) 75105 cacgcCCCGGCCCCGGCCCCGGCcccta (25) DRSHLTR (53) DSSTRKT (54) DRSHLTR (53) DSSTRKT(54) DRSHLTR (53) DSSTRKT(54) 75109 cacgccCCGGCCCCGGCCCCGGCCccta (25) DKRDLAR (55) RSADRKT (45) DKRDLAR (55) RSADRKT(45) DKRDLAR(55) RSADRKT(45) 75114 cacgccCCGGCCCCGGCCCCGGCCccta (25) ERGTLAR (31) RSADRKT (45) ERGTLAR (31) RSADRKT(45) ERGTLAR (31) RSADRKT(45) 75115 cacgccCCGGCCCCGGCCCCGGCCccta (25) ERRDLRR (77) RSADRKT (45) ERRDLRR (77) RSADRKT(45) ERRDLRR(77) RSADRKT(45) 74967 taggGGCCGGGGCCGGGGCCGGggcgtg (24) RSDHLSE (33) SSRYRTK (56) RSDHLSE (33) SSRYRTK (56) RSDHLSE (33) SSRYRTK (56) 78021 cacgcCCCGGCCCCGGCCCCGGCcccta (25) DRSHLTR ^(53) DSSTRKT (54) DRSHLTR (53) DSSTRKT (54) DRSHLTR (53) DSSTRKT (54) 78025 cacgccCCGGCCCCGGCCCCGGCCccta (25) DKRDLAR^(55) RSADRKT (45) DKRDLAR (55) RSADRKT (45) DKRDLAR (55) RSADRKT (45) 78029 cacgccCCGGCCCCGGCCCCGGCCccta (25) ERRDLRR ^(77) RSADRKT (45) ERRDLRR (77) RSADRKT (45) ERRDLRR (77) RSADRKT (45) 78033 cacgccCCGGCCCCGGCCCCGGCCccta (25) ERRDLRR^(77) RSADRKT (45) ERRDLRR (77) RSADRKT (45) ERRDLRR (77) RSADRKT (45) 79895 taggGGCCGGGGCCGGGGCCGGggcgtg (24) RSDHLSE (33) DRSHLAR ^(34) RSDHLSE ^(33) DRSHLAR (34) RSDHLSE ^(33) DRSHLAR (34) 79897 taggGGCCGGGGCCGGGGCCGGggcgtg (24) RSDHLSE ^(33) DRSHLAR ^(34) RSDHLSE ^(33) DRSHLAR (34) RSDHLSE ^(33) DRSHLAR (34) 79898 taggGGCCGGGGCCGGGGCCGGggcgtg (24) RSDHLSE ^(33) DRSHLAR (34) RSDHLSE ^(33) DRSHLAR ^(34) RSDHLSE (33) DRSHLAR ^(34) 79899 tagggGCCGGGGCCGGGGCCGGGgcgtg (24) RSAHLSR ^(29) HRKSLSR (41) RSAHLSR ^(29) HRKSLSR (41) RSAHLSR (29) HRKSLSR (41) 79901 tagggGCCGGGGCCGGGGCCGGGgcgtg (24) RSAHLSR (29) HRKSLSR (41) RSAHLSR ^(29) HRKSLSR (41) RSAHLSR ^(29) HRKSLSR (41) 79902 tagggGCCGGGGCCGGGGCCGGGgcgtg (24) RSAHLSR (29) HRKSLSR (41) RSAHLSR ^(29) HRKSLSR (41) RSAHLSR (29) HRKSLSR ^(41) 79903 tagggGCCGGGGCCGGGGCCGGGgcgtg (24) RSAHLSR (29) HRKSLSR ^(41) RSAHLSR ^(29) HRKSLSR (41) RSAHLSR ^(29) HRKSLSR (41) 79904 tagggGCCGGGGCCGGGGCCGGGgcgtg (24) RSAHLSR (29) HRKSLSR ^(41) RSAHLSR (29) HRKSLSR ^(41) RSAHLSR (29) HRKSLSR ^(41) 75025 cacGCCCCGGCCCCGGCCCCGgccccta (25) REQDLKQ (57) HRKSLSR (41) REQDLKQ (57) HRKSLSR (41) REQDLKQ(57) HRKSLSR (41) 79915 cacGCCCCGGCCCCGGCCCCGgccccta (25) REQDLKQ^(57) HRKSLSR ^(41) REQDLKQ ^(57) HRKSLSR ^(41) REQDLKQ(57) HRKSLSR (41) 79916 cacGCCCCGGCCCCGGCCCCGgccccta (25) REQDLKQ (57) HRKSLSR ^(41) REQDLKQ (57) HRKSLSR ^(41) REQDLKQ(57) HRKSLSR (41) 79921 cacGCCCCGGCCCCGGCCCCGgccccta (25) RNADRIT ^(46) HRKSLSR ^(41) RNADRIT ^(46) HRKSLSR (41) RNADRIT ^(46) HRKSLSR (41)
[0110] ZFP-TFs were evaluated using standard SELEX analysis (see, for example, Miller et al., Nat Biotech. (2010) doi:10.1038 / nbt.1755; Wilen et al., PLoS(2011) 7(4):e1002020). The results showed that all ZFP-TFs bound to their target sites.
[0111] Five human cell lines and one mouse cell line were used in this study. The C9021 fibroblast cell line was obtained from the ALS Institute at Columbia University and derived from ALS-FTD patients. This cell line contains five G4C2 repeat sequences in its normal pair gene and approximately 850 repeat sequences in its amplified pair gene. The wild-type fibroblast cell line (NDS00035), 353TRAD, and 204TDP fibroblast cell lines were obtained from the National Institute of Neurological Disorders and Stroke. The wild-type cell line contains two G4C2 repeat sequences in each pair gene. The 353TRAD cell line contains five repeat sequences in one pair gene and eight repeat sequences in another pair gene. The 204TDP cell line has two repeat sequences in one pair gene and 20 repeat sequences in another pair gene. For all fibroblast experiments, human neuron lines were obtained from Cell Dynamics International (iCell GABANeurons kit, 01434; catalog number R1013; cell batch number 104901). Mouse cortical neuron lines were obtained from GIBCO (catalog number A15586). ZFP 74960, which binds to its target region but does not have an observable inhibitory effect, was used as a negative control.
[0112] For all experiments performed in patient-derived fibroblasts, ZFP-TF mRNA was transfected into cells using a 96-well Shuttle Nucleofector system from Lonza. ZFP-TF mRNA was transfected at doses of 1, 3, 10, 30, 100, and 300 ng per 40,000 cells using the CA-137 program with the Amaxa P2 Primary Cells Nucleofector kit. After overnight culture, cDNA was generated from transfected cells using the Cells-to-Ct kit (Thermo Fisher Scientific), followed by qRT-PCR for gene expression analysis.
[0113] For neuronal transduction, ZFP was fabricated into AAV6 plastids. Neurons were transduced using AAV6-ZFP. All transductions were performed at 3,000 MOI. Mouse neurons were collected 7 days post-transduction, while human neurons were collected 19 days post-transduction. After cell collection, the cells were processed for microarray analysis.
[0114] Screening analysis was performed in multiple rounds. In each round, ZFP was tested at multiple concentrations to identify ZFP-TFs with suitable target hit (selective inhibition) patterns. A second round of screening was performed in C9 (C9021) cells to assess the amount of amplified positive transcript (disease) C9orf72 relative to total C9orf72 ("total C9") mature mRNA after ZFP-TF treatment. RT-PCR analysis used a primer / probe set targeting intron region 1a. Amplification of positive C9orf72 transcript: Positive: 5' CCCTCTCTCCCCACTACTTG 3' (SEQ ID NO:61) Reverse: 5' CTACAGGCTGCGGTTGTTTCC 3' (SEQ ID NO:62) Probe: 5' TCTCACAGTACTCGCTGAGGGTGA 3' (SEQ ID NO: 63).
[0115] G4C2 amplification leads to inefficient splicing and accumulation of precursor mRNA containing amplified RNA. [picture] [2A]). In contrast, highly spliced wild-type (WT) precursor mRNA was present in extremely low amounts. By using this analysis in C9021 cells, we showed that the ZFP-TF tested exhibited broad-spectrum inhibition of amplified positive (disease) C9orf72 transcripts. [picture] [2B] [To the image] [2] [D]).
[0116] To evaluate the inhibition of total C9orf72 mRNA, different primer / probe sets were used, denoted as "total C9" (…). [picture] [2A]): Total C9orf72 mRNA: Positive: 5' CTATGTGTGTGGTGGGATATGG 3' (SEQ ID NO:58) Reverse: 5' CTCCAGGTTATGTGAAGCAGAA 3' (SEQ ID NO:59) Probe: 5' AGGCCTGCTAAAGGATTCAACTGGAA 3' (SEQ ID NO:60).
[0117] This primer / probe set can detect mRNAs containing regions spanning exons 8 and 9. This region is present in all C9orf72 mRNA isoforms. As shown in Figure 2b, many ZFP-TFs exhibit moderate inhibition of total C9orf72 transcripts. For example, ZFP-TFs 75114 and 75115 inhibited the amplification of positive (disease) transcripts by more than 70%, while maintaining total C9orf72 mRNA expression by more than 50%. [picture] [2D], Second Round Data).
[0118] In round 3, total C9orf72 mRNA was assessed and compared between C9021 cells and wild-type (WT) cells to further evaluate the effect of the tested ZFP-TF on the amount of total C9orf72 mRNA. Data showed that the amount of total C9orf72 mRNA was significantly reduced in mutant cells compared to WT cells. [picture] [2B] [To the image] [2D]), and this equivalent amount had a much smaller effect on wild-type cells treated with the same ZFP-TF. Overall data indicate that for some ZFPs, such as 75109, 75114, and 75115, amplification of isoforms was significantly inhibited (approximately 70%), while maintaining approximately 50% of total C9 transcripts in C9 patient fibroblast cell lines.
[0119] The isoform-selective inhibition of ZFP-TF 75109, 75114, and 75115 was evaluated in fibroblasts from three different patient sources containing different G4C2 amplified repeat sequences (600, 800, and 850) on their amplified pair genes. [picture] [6]). All three ZFPs exhibit similar behavior independent of the length of the repeat amplification, indicating that the selective inhibition of ZFP-TF is independent of the length of the G4C2 repeat.
[0120] The inhibition of total C9 transcripts was assessed in two cell lines derived from healthy individuals, where the number of G4C2 repeat sequences in their paired genes was greater than normal. [picture] [7] ). In healthy cell lines, total C9 transcripts were minimally affected. ZFP-mediated inhibition of total C9 mRNA transcripts in the patient-derived cell line (C9021) does not truly represent the amount of WT isoforms, because PCR analysis to detect target exons 8 and 9 of total C9 mRNA transcripts showed that they were absent in both amplified and non-amplified (WT) isoforms. [picture] [2A]). The total C9 mRNA transcriptomic repression in response to isoform-selective ZFP-TF (75109, 75114, and 75115) was evaluated in two different healthy cell lines with different G4C2 repeat sequence lengths on the paired gene. [picture] [7] ). Cell line 353TREAD has 5 repetitive sequences on one pair of genes and 8 repetitive sequences on another pair of genes, while cell line 204TDP has 2 repetitive sequences on one pair of genes and 20 repetitive sequences on another pair of genes. Although total C9 mRNA transcripts were dose-dependently suppressed in C9 cell line C921 (with 5 repetitive sequences on the non-amplified pair of genes and 850 repetitive sequences on the amplified pair of genes), they were minimally affected in the other two cell lines without amplified pair of genes, indicating that the suppression of total C9 isoforms in the diseased cell lines (5 / 850) was a result of the suppression of amplified isoforms, and that the expression of non-amplified isoforms was not affected by selective ZFP-TF ( [picture] [7]).
[0121] Without being bound by theory, it is possible that the ZFP-TF of this invention can function cooperatively to selectively repress paired genes with a large number of repetitive sequences. This could be mediated by higher-order complexes, for example, via the recruitment of KAP1 co-repressors associated with the KRAB domain linked to the ZFP. Under this assumption, the KAP1 / KRAB "scaffold" spanning multiple ZFP-TFs enhances the stability of the transcriptional repression mechanism and enables preferential repression of the amplified C9orf72 paired gene compared to the wild-type paired gene. [Example] [2] [:] [, C9orf72 , ] [Specificity of Inhibition] []
[0122] The global specificity of ZFP-TF shown in Table 1 was evaluated using microarray analysis in three cell lines: C9021 fibroblasts, primary mouse cortical neurons, and human neurons. In short, for C9021 cells, 100 ng of ZFP-TF-encoded mRNA was transfected in quadruplicate into 150,000 C9021 cells. After 24 hours, total RNA was extracted and processed using the manufacturer's protocol (Affymetrix Genechip MTA1.0). Robust multiarray averaging (RMA) was used to normalize the raw signals from each probe set. Analysis was performed using the "Gene Level Differential Expression Analysis" option in Transcriptome Analysis Console 3.0 (Affymetrix). Samples transfected with ZFP-TF were compared with samples treated with unrelated ZFP-TF (ZFP-TF that does not bind to the C9orf72 target site). Transcript (probe set) reporter changes were called for a mean signal >2-fold difference relative to the control and a p-value < 0.05 (one-way variance analysis, unpaired t-test for each probe set). A similar procedure was performed on neurons, except that they were transduced with AAV6 at 3000 MOI and cultured for 7 days in mouse neurons and 19 days in human neurons before collection.
[0123] Example data is shown in [picture] [8A] [To the image] [8C] Data show that ZFP-TF 75027 deviated from the target several times except for C9orf72 (shown as circled), while ZFP-TF 75109, 75114, and 75115 only inhibited C9orf72, with very little deviation from the target in both human and mouse fibroblasts and neurons. These results demonstrate that representative ZFP-TFs have high specificity for C9orf72. [Example] [3] [Detection of antisense specific inhibition] []
[0124] Because sense and antisense transcripts are encoded by overlapping regions of DNA, we developed a detection strategy based on differential processing of transcripts. For sense mRNA from amplified counterpart genes, the intron containing the amplified region (intron 1a) is misspliced and retained, while all other introns are removed, including intron 1b. In contrast, intron 1b is the predicted exon of the antisense mRNA transcript and should be retained. Therefore, we designed and tested primers located within intron 1b that exhibited specific detection of antisense transcripts, as further described below.
[0125] To detect C9orf72 transcripts, we used droplet-based digital PCR (ddPCR). In short, to establish a sense or antisense cDNA template, RNA was purified from C9orf72 patient and healthy control cells (C9orf72 cell lines: C9-3, C9-6, C9-7, C9-5, C9-10, C9-11, C9-2, C9-4; control cell lines: KinALS6, Con3, Kin1ALS17, Con8, Con10, Con1; see Lagier-Tourenne et al., PNAS (2013) 110(47):E4530-9), and this RNA was used to synthesize cDNA using the Superscript III (Thermo Fischer Scientific) first-strand synthesis system as follows: 1) Mix 0.5 µg RNA, 0.5 µL of 10 mM specific primer and dNTP mixture, and dilute with water to 10 µL. For generating a sense template, use primer 5' CTCTAGCGACTGGTGGAATTG 3' (SEQ ID NO:64). For generating an antisense template, use primer 5' GTGCATGGCAACTGTTTGAATA 3' (SEQ ID NO:65). 2) Incubate this reactant at 65°C for 5 minutes to denature it, and place it on ice for at least 1 minute. 3) Use these reagents to prepare the cDNA synthesis mixture: 10×RT buffer (2 µL); 25 mM MgCl2 (4 µL); 0.1 M DTT (2 µL); ribonuclease OUT (1 µL); Superscript III (1 µL). 4) Add 10 µL of this reactant to the RNA mixture and incubate at 50°C for 50 minutes. Then inactivate the reactant by incubating at 85°C for 5 minutes.
[0126] The template was then subjected to ddPCR using labeled probes according to the manufacturer's protocol. In short, PCR was performed using probe-free dUTP ddPCR ultramix (Bio-Rad) in an ABI PCR 96-well culture dish. The PCR master mixture was prepared according to the manufacturer's instructions. The following shows the antisense primer-probe assembly located on intron 1b. [picture] [3]). Positive: 5' CAAAGCCTGGTGGTGTTCAA 3' (SEQ ID NO:66) Reverse: 5' GGACATGACCTGGTTGCTTC 3' (SEQ ID NO:67) Probe: 5' CGCGGCCAGATAGACCCAATGAGCA 3' (SEQ ID NO:68).
[0127] The reaction is set as follows: 1) Distribute the entire master mixture evenly into 8 wells of an ABI PCR culture dish. 2) Add 10 µL of RT reactant diluted 1:10 or water to the sample well. 3) Transfer 15 µL of the master mixture into the well containing RT. 4) Seal the culture dish, vortex and briefly centrifuge. To prepare droplets, use a tube as follows: 1) Place 70 µL of probe oil in the well labeled "oil" and 20 µL of ddPCR reaction product in the well labeled "sample". 2) Place the rubber pad on top of the cylinder. 3) Transfer 40 µL of the solution to a fresh Eppendorf 96-well culture dish. Seal the culture dish with aluminum foil and perform PCR according to the manufacturer's instructions.
[0128] Data shows that in the C9orf72 fibroblast cell line, these primers amplify exons in the antisense amplification precursor mRNA (C9-AS), and the complementary region is absent in the sense region (C9-S). [picture] [4A]). Therefore, in this study, the antisense primer of ddPCR specifically detected antisense precursor mRNA, and compared with 6 different control fibroblasts, the antisense precursor mRNA was significantly elevated in 7 different fibroblasts derived from C9 patients ( [picture] [4B]). [Example] [4] [:Amplification of the positive and negative precursors of the paired gene] [mRNA] [inhibition]
[0129] To test the activity of the ZFP-TF repressor on amplified paired genes, cells were treated with ZFP-TF 74949, 74978, 75003, 75027, 75109, 75114, 75115, 74967 (Table 1) or 74960 (negative control), as described above. ZFP-TF-mediated repression was assessed by two independent PCR analyses performed by researchers unaware of the sample order. Different primers / probes were used for each analysis. [picture] [5A] [To the image] [5C]).
[0130] For operations 1 and 2, the measurement of positive amplification, antisense amplification, and total C9 analysis are performed as described above, with the exception that amplification is performed using random hexamers and primers shown below, according to the standard protocol in this technique: Antisense amplification of C9orf72 precursor mRNA ( [picture] [5B]): As shown in Example 3 above. Positive amplification of C9orf72 precursor mRNA ( [picture] [5A]): This primer / probe set can detect mRNAs containing regions spanning exon 1a and intron 1a. Positive: 5' ACTACTTGCTCTCACAGTACTCG 3' (SEQ ID NO:69) Reverse: 5' TAGCGCGCGACTCCTGAGTTCC 3' (SEQ ID NO:70) Probe: 5' AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (SEQ ID NO:71). Total C9orf72 mRNA ( [picture] [5C]): This primer / probe set can detect mRNA containing regions within exon 2. Positive: 5' TGTGACAGTTGGAATGCAGTGA 3' (SEQ ID NO:72) Reverse: 5' GCCACTTAAAGCAATCTCTGTCTTG 3' (SEQ ID NO:73) Probe: 5' TCGACTCTTTGCCCACCGCCA 3' (SEQ ID NO:74).
[0131] Operation No. 3 ( [picture] [5A] and [picture] [5C]) Using the primer shown in Example 1 above ( [picture] [2B] [To the image] [2D]). For antisense disease transcripts, the following primer / probe is used to detect intron region 1b ( [picture] [5B]). Positive: 5' CAGCTTCGGTCAGAGAAATGAG 3' (SEQ ID NO:78) Reverse:5' AAGAGGCGCGGGTAGAA 3' (SEQ ID NO:79) Probe: 5' CTCTCCTCAGAGCTCGACGCATTT 3' (SEQ ID NO:80).
[0132] Despite using different primer / probe sets and different PCR analyses (operations 1 and 2 were performed using similar analyses, but different from operation 3), the data were consistent and the inhibition levels were comparable.
[0133] In summary, all operations consistently demonstrate that some ZFP-TFs can strongly suppress all three transcripts (sense, antisense, and total) (e.g., ZFP-TF 74978, 75003, and 75027), while some ZFP-TFs (e.g., ZFP-TF 75109, 75114, and 75115) selectively suppress sense and antisense disease transcripts while maintaining total C9 transcripts (selective suppression). [Example] [5] [:] [BAC] [] [, C9orf72 , ] [Effects on humans in gene-transplanted mouse neurons] [, C9orf72 , ] [Regulation]
[0134] All repressors targeting BAC mouse C9orf72 were selected and colonized into the rAAV6 vector using a CMV promoter that drives performance. Recombinant AAV was generated in HEK293T cells, purified using a CsCl density-gradient, and titrated by real-time qPCR according to methods known in this technique. Cultured primary mouse cortical neurons were infected with the purified virus at 3E5, 1E5, 3E4, and 1E4 Vg / cell. After 7 days, total RNA was extracted, and the expression of C9orf72 sense and antisense transcripts, as well as two reference genes (e.g., Atp5b and Eif4a2), was monitored by RT-qPCR.
[0135] All ZFP-TF-encoded AAV vectors effectively inhibited their target in mouse cells over a wide range of infectious doses, with some ZFPs reducing the target by more than 95% at multiple doses. In contrast, no gene inhibition was observed with CMV-GFP rAAV6 virus tested at equivalent doses, or with pseudo-treated neurons. [Example] [6] [:Depend on] [AAV] [Deliver it] [ZFP] [-] [TF] [Driven in vivo gene repression] []
[0136] The C9orf72BAC gene-transfected mice used for the target conjugation study contained 98 kb of human transgenic genes, which contained a full-length C9orf72 gene pair with approximately 500 G4C2 repeat sequences and substantial side-joint sequences (Liu et al., Neuron (2016) 90(3):521-34). Two ZFP-TFs, ZFP-TF 75027 or ZFP-TF 75114, were selected for this study, and their potency differed (ZFP-TF 75027 was more efficient; [picture] [2D]). The expression cartridges for both fusion proteins were selected and implanted into an rAAV vector containing a synaptic promoter driving expression and a coding sequence for a self-cleaving peptide (e.g., a 2A peptide, such as T2A or P2A), followed by a Venus tag for measuring biodistribution. [picture] [9] [,] [A] [Figure]). rAAV was produced in HEK293T cells and titrated on the ITR using primers via ddPCR.
[0137] To evaluate the in vivo inhibitory effect of ZFP-TF on amplified sense and antisense transcripts, ZFP-TF rAAV was delivered to P0 C9-BAC or WT mice via intraventricular (ICV) injection. In short, PBS or ZFP-TF 75027 rAAV or ZFP-TF 75114 rAAV (total dose 2E10 Vg / ventricle) were administered bilaterally (2 µl / ventricle) to neonatal C9-BAC mice (for repeat sequence length matching) or WT mice. [picture] [9] [,] [C] [Figure]). Animals were sacrificed four weeks after injection, and one hemisphere was embedded for RNA aggregation site analysis. The other hemisphere was microscopically dissected into the cortex, hippocampus, and cerebellum for further analysis. [picture] [9] [,] [B] [Figure] Quantitative analysis of the viral genome, Venus mRNA, and proteins showed a wide biological distribution, and ZFP-TF 75027 and ZFP-TF 75114 were equivalent in transduction and expression.
[0138] Total RNA was extracted from cortical and hippocampal tissues, and cDNA was prepared using the iScript cDNA synthesis kit (BioRad). ddPCR was performed to measure the expression of transcripts containing sense and antisense amplifications, and the total C9 mRNA level normalized relative to mouse TBP. The primers used for this analysis are: Total C9 mRNA: Positive: 5'TGTGACAGTTGGAATGCAGTGA3' (SEQ ID NO:72) Reverse: 5'GCCACTTAAAGCAATCTCTGTCTTG3' (SEQ ID NO:73) Probe: 5'TCGACTCTTTGCCCACCGCCA3' (SEQ ID NO:74). Positive amplification of precursor mRNA: Positive: 5' ACTACTTGCTCTCACAGTACTCG 3' (SEQ ID NO:69) Reverse: 5' TAGCGCGCGACTCCTGAGTTCC 3' (SEQ ID NO:70) Probe: 5' AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (SEQ ID NO:71). Antisense amplification of precursor mRNA: Positive: 5'AGTCGCTAGAGGCGAAAGC3' (SEQ ID NO:81) Reverse: 5'CGAGTGGGTGAGTGAGGAG3' (SEQ ID NO:82) Probe: 5'AAGAGGCGCGGGTAGAAGCGGGGC3' (SEQ ID NO:83).
[0139] Data showed that, compared to the control group injected with PBS, ZFP-TF 75027 inhibited the total C9 mRNA and the amount of positive and negative amplified transcripts in the hippocampus and cortex of C9-BAC animals. [picture] [9] [,] [D] [Figure]). (Selective inhibition could not be observed in this animal model because the transgenic mice do not contain the WT human C9orf72 pair gene and the mouse C9orf72 gene does not contain the G4C2 repeat sequence). No inhibition was observed in the ZFP-TF 75114 case.
[0140] In addition, fluorescence in situ hybridization was used to measure the amount of positive and negative RNA aggregates (aggregates) observed in the hippocampus after ZFP-TF injection. [picture] [9] [,] [E] [Figure]). In short, 10 μm sections were hybridized with fluorescently labeled probes: 5'GGCCCCGGCCCCGGCCCC-Cy3 (SEQ ID NO:84) was used to measure positive RNA aggregates and 5'GGGGCCGGGGCCGGGGCC-Cy3 (SEQ ID NO:85) was used to measure negative RNA aggregates. Stacked images were obtained at 40× magnification using a confocal microscope (LSM880). The number of positive and negative RNA aggregates normalized relative to the total number of cells was quantified from the Amundsen angle (CA) region of the hippocampus. A lower percentage of negative RNA aggregates was observed in animals injected with ZFP-TF 75027.
[0141] These results show that ZFP-TF targeting C9orf72 can effectively inhibit the expression of the pathogenic C9orf72 paired gene in vivo, and differences in ZFP-TF efficacy can be observed.
[0142] <![CDATA[ <110> SANGAMO THERAPEUTICS, INC. (USA) <![CDATA[ <120> Regulation of gene expression and its uses in chromosome 9 open reading frame 72 <![CDATA[ <130> TW 109113701]]> <![CDATA[ <150> US 62 / 964,844 <![CDATA[ <151> 2020-01-23 <![CDATA[ <150> US 62 / 837,523 <![CDATA[ <151> 2019-04-23 <![CDATA[ <160> 85 <![CDATA[ <170> PatentIn version 3.5]]> <![CDATA[ <210> 1]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 1]]> ggggcc 6 <![CDATA[ <210> 2]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 2]]> gggccg 6 <![CDATA[ <210> 3]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 3]]> ggccgg 6 <![CDATA[ <210> 4]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 4]]> gccggg 6 <![CDATA[ <210> 5]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 5]]> ccgggg 6 <![CDATA[ <210> 6]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 6]]> cggggc 6 <![CDATA[ <210> 7]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 7]]> ggcccc 6 <![CDATA[ <210> 8]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 8]]> gccccg 6 <![CDATA[ <210> 9]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 9]]> ccccgg 6 <![CDATA[ <210> 10]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 10]]> cccggc 6 <![CDATA[ <210> 11]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 11]]> ccggcc 6 <![CDATA[ <210> 12]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 12]]> cggccc 6 <![CDATA[ <210> 13]]> <![CDATA[ <211> 96]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 13]]> Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys 1 5 10 15 Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr 20 25 30 Ala Gln Gln Ile Val Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn 35 40 45 Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg 50 55 60 Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln 65 70 75 80 Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val 85 90 95 <![CDATA[<210> 14]]> <![CDATA[<211> 5]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 14]]> Asp Gly Gly Gly Ser 1 5 <![CDATA[ <210> 15]]> <![CDATA[ <211> 5]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 15]]> Thr Gly Glu Lys Pro 1 5 <![CDATA[ <210> 16]]> <![CDATA[ <211> 9]]> <![CDATA[ <212> PRT <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 16]]> Leu Arg Gln Lys Asp Gly Glu Arg Pro 1 5 <![CDATA[ <210> 17]]> <![CDATA[ <211> 4]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 17]]> Gly Gly Arg Arg 1 <![CDATA[ <210> 18]]> <![CDATA[ <211> 8]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 18]]> Gly Gly Arg Arg Gly Gly Gly Ser 1 5 <![CDATA[ <210> 19]]> <![CDATA[ <211> 9]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 19]]> Leu Arg Gln Arg Asp Gly Glu Arg Pro 1 5 <![CDATA[ <210> 20]]> <![CDATA[ <211> 12]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 20]]> Leu Arg Gln Lys Asp Gly Gly Gly Ser Glu Arg Pro 1 5 10 <![CDATA[ <210> 21]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 21]]> Leu Arg Gln Lys Asp Gly Gly Gly Ser Gly Gly Gly Ser Glu Arg Pro 1 5 10 15 <![CDATA[ <210> 22]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> PRT]]> <![CDATA[<213]]> > Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 22]]> <![CDATA[Thr Gly Ser Gln Lys Pro 1 5 <![CDATA[ <210> 23]]> <![CDATA[ <211> 5]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 23]]> Gly Gly Gly Gly Ser 1 5 <![CDATA[ <210> 24]]> <![CDATA[ <211> 28]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 24]]> taggggccgg ggccggggcc ggggcgtg 28 <![CDATA[ <210> 25]]> <![CDATA[ <211> 28]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 25]]> cacgccccgg ccccggcccc ggccccta 28 <![CDATA[ <210> 26]]> <![CDATA[ <211> 10]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 26]]> Leu Arg Gln Lys Asp Ala Ala Arg Gly Ser 1 5 10 <![CDATA[ <210> 27]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[<22]]> 0>]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 27]]> <![CDATA[Asp Arg Ser Asp Leu Ser Arg 1 5 <![CDATA[ <210> 28]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 28]]> Arg Ser Thr His Leu Val Arg 1 5 <![CDATA[ <210> 29]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 29]]> Arg Ser Ala His Leu Ser Arg 1 5 <![CDATA[ <210> 30]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 30]]> Glu Arg Gly Asp Leu Lys Arg 1 5 <![CDATA[ <210> 31]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 31]]> Glu Arg Gly Thr Leu Ala Arg 1 5 <![CDATA[ <210> 32]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 32]]> Arg Ser Ala Asp Leu Ser Glu 1 5 <![CDATA[ <210> 33]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 33]]> Arg Ser Asp His Leu Ser Glu 1 5 <![CDATA[ <210> 34]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 34]]> Asp Arg Ser His Leu Ala Arg 1 5 <![CDATA[ <210> 35]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 35]]> Arg Ser Asp His Leu Ser Gln 1 5 <![CDATA[ <210> 36]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 36]]> Asp Asn Ser His Arg Thr Arg 1 5 <![CDATA[ <210> 37]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 37]]> Arg Asn Gly His Leu Leu Asp 1 5 <![CDATA[ <210> 38]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 38]]> Arg Ser Ala His Leu Ser Glu 1 5 <![CDATA[ <210> 39]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 39]]> Arg Ser Asp His Leu Ser Arg 1 5 <![CDATA[ <210> 40]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 40]]> Asp Trp Thr Thr Arg Arg Arg 1 5 <![CDATA[ <210> 41]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 41]]> His Arg Lys Ser Leu Ser Arg 1 5 <![CDATA[ <210> 42]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 42]]> Asp Ser Ser Asp Arg Lys Lys 1 5 <![CDATA[ <210> 43]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 43]]> Asp Ser Ser Thr Arg Arg Arg 1 5 <![CDATA[ <210> 44]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 44]]> Arg Ser Asp Asp Arg Lys Thr 1 5 <![CDATA[ <210> 45]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 45]]> Arg Ser Ala Asp Arg Lys Thr 1 5 <![CDATA[ <210> 46]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 46]]> Arg Asn Ala Asp Arg Ile Thr 1 5 <![CDATA[ <210> 47]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 47]]> Arg Arg Ala Thr Leu Leu Asp 1 5 <![CDATA[ <210> 48]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 48]]> Arg Ser Asp Thr Leu Ser Val 1 5 <![CDATA[ <210> 49]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 49]]> Asp Thr Ser Thr Arg Thr Lys 1 5 <![CDATA[ <210> 50]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 50]]> Arg Ser Ala Thr Leu Ser Glu 1 5 <![CDATA[ <210> 51]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 51]]> His His Arg Ser Leu His Arg 1 5 <![CDATA[ <210> 52]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 52]]> Thr Ser Ser Asp Arg Thr Lys 1 5 <![CDATA[ <210> 53]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 53]]> Asp Arg Ser His Leu Thr Arg 1 5 <![CDATA[ <210> 54]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 54]]> Asp Ser Ser Thr Arg Lys Thr 1 5 <![CDATA[ <210> 55]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 55]]> Asp Lys Arg Asp Leu Ala Arg 1 5 <![CDATA[ <210> 56]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 56]]> Ser Ser Arg Tyr Arg Thr Lys 1 5 <![CDATA[ <210> 57]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 57]]> Arg Glu Gln Asp Leu Lys Gln 1 5 <![CDATA[ <210> 58]]> <![CDATA[ <211> 22]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 58]]> ctatgtgtgt ggtgggatat gg 22 <![CDATA[ <210> 59]]> <![CDATA[ <211> 22]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 59]]> ctccaggtta tgtgaagcag aa 22 <![CDATA[ <210> 60]]> <![CDATA[ <211> 26]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic probes]]> <![CDATA[ <400> 60]]> aggcctgcta aaggattcaa ctggaa 26 <![CDATA[ <210> 61]]> <![CDATA[ <211> 20]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 61]]> ccctctctcc ccactacttg 20 <![CDATA[ <210> 62]]> <![CDATA[ <211> 21]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 62]]> ctacaggctg cggttgtttc c 21 <![CDATA[ <210> 63]]> <![CDATA[ <211> 24]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic probes]]> <![CDATA[ <400> 63]]> tctcacagta ctcgctgagg gtga 24 <![CDATA[ <210> 64]]> <![CDATA[ <211> 21]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 64]]> ctctagcgac tggtggaatt g 21 <![CDATA[ <210> 65]]> <![CDATA[ <211> 22]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 65]]> gtgcatggca actgtttgaa ta 22 <![CDATA[ <210> 66]]> <![CDATA[ <211> 20]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 66]]> caaagcctgg tggtgttcaa 20 <![CDATA[ <210> 67]]> <![CDATA[ <211> 20]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 67]]> ggacatgacc tggttgcttc 20 <![CDATA[ <210> 68]]> <![CDATA[ <211> 25]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic probes]]> <![CDATA[ <400> 68]]> cgcggccaga tagacccaat gagca 25 <![CDATA[ <210> 69]]> <![CDATA[ <211> 23]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 69]]> actacttgct ctcacagtac tcg 23 <![CDATA[ <210> 70]]> <![CDATA[ <211> 22]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 70]]> tagcgcgcga ctcctgagtt cc 22 <![CDATA[ <210> 71]]> <![CDATA[ <211> 30]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic probes]]> <![CDATA[ <400> 71]]> agggaaacaa ccgcagcctg tagcaagctc 30 <![CDATA[ <210> 72]]> <![CDATA[ <211> 22]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 72]]> tgtgacagtt ggaatgcagt ga 22 <![CDATA[ <210> 73]]> <![CDATA[ <211> 25]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 73]]> gccacttaaa gcaatctctg tcttg 25 <![CDATA[ <210> 74]]> <![CDATA[ <211> 21]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic probes]]> <![CDATA[<40]]> 0> 74]]> <![CDATA[tcgactcttt gcccaccgcc a 21 <![CDATA[ <210> 75]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Homo sapiens <![CDATA[ <400> 75]]> ccggggccgg ggccgg 16 <![CDATA[ <210> 76]]> <![CDATA[ <211> 12]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 76]]> Leu Arg Gln Lys Asp Ala Ala Arg Gly Ser Gly Gly 1 5 10 <![CDATA[ <210> 77]]> <![CDATA[ <211> 7]]> <![CDATA[ <212> PRT]]> <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic peptides]]> <![CDATA[ <400> 77]]> Glu Arg Arg Asp Leu Arg Arg 1 5 <![CDATA[ <210> 78]]> <![CDATA[ <211> 22]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 78]]> cagcttcggt cagagaaatg ag 22 <![CDATA[ <210> 79]]> <![CDATA[ <211> 17]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 79]]> aagaggcgcg ggtagaa 17 <![CDATA[ <210> 80]]> <![CDATA[ <211> 24]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic probes]]> <![CDATA[ <400> 80]]> ctctcctcag agctcgacgc attt 24 <![CDATA[ <210> 81]]> <![CDATA[ <211> 19]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 81]]> agtcgctaga ggcgaaagc 19 <![CDATA[ <210> 82]]> <![CDATA[ <211> 19]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: Synthetic primers]]> <![CDATA[ <400> 82]]> cgagtgggtg agtgaggag 19 <![CDATA[ <210> 83]]> <![CDATA[ <211> 25]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic probes]]> <![CDATA[ <400> 83]]> aagaggcgcg ggtagaagcg ggggc 25 <![CDATA[ <210> 84]]> <![CDATA[ <211> 18]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic probes]]> <![CDATA[ <400> 84]]> ggccccggcc ccggcccc 18 <![CDATA[ <210> 85]]> <![CDATA[ <211> 18]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Description of artificial sequences: synthetic probes]]> <![CDATA[ <400> 85]]> ggggccgggg ccggggcc 18
Claims
1. The use of a fusion protein for preparing an agent that inhibits transcription of a mutant counterpart of the C9orf72 gene in human cells, the fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repression domain, wherein the ZFP domain binds to a target region in an intron region between exon 1a and exon 1b of the mutant counterpart of the human C9orf72 gene, wherein the target region comprises more than 30 tandem repeats of G4C2 (SEQ ID NO: 1), wherein the ZFP domain comprises six recognition helical regions, the recognition helical regions comprising SEQ ID NO: 46, 41, 46, 41, 46 and 41 respectively.
2. As claimed in claim 1, wherein the fusion protein inhibits transcription of mRNA containing repetitive sequences from the mutant pair gene, but does not inhibit transcription of wild-type mRNA from the gene.
3. As claimed in claim 1 or 2, wherein the fusion protein inhibits positive transcription of the mutant C9orf72 paired gene in human cells.
4. As claimed in claim 3, wherein the fusion protein inhibits positive transcription from the C9orf721a promoter and does not inhibit positive transcription from the C9orf721b promoter.
5. As claimed in claim 1 or 2, wherein the ZFP domain binds to an antisense sequence in the target region, wherein the antisense sequence comprises one to three tandem repeats of a hexanucleotide GCCCCG (SEQ ID NO:8).
6. As used in claim 5, wherein the ZFP field is incorporated into SEQ ID NO:
25.
7. As claimed in claim 1 or 2, wherein the fusion protein inhibits antisense transcription from the mutant C9orf72 paired gene in human cells.
8. As claimed in claim 1 or 2, wherein the fusion protein inhibits both sense and antisense transcription from the mutant C9orf72 pair gene in human cells.
9. As claimed in claim 1 or 2, wherein the fusion protein inhibits 30% to 95% of the sense and / or antisense transcription from the mutant C9orf72 paired gene.
10. As requested in claim 9, wherein the fusion protein does not inhibit positive transcription from the C9orf72 1b promoter.
11. As requested in claim 1 or 2, wherein the transcriptional repression domain comprises an amino acid sequence from the KRAB domain of human KOX1.
12. As requested in claim 1 or 2, wherein the ZFP domain is linked to the transcriptional repressor domain via a peptide linker.
13. As requested in claim 1 or 2, wherein the human cell line is a neuron, glial cell, ependymal cell, or neuroepithelial cell.
14. As claimed in claim 13, wherein the human cell line is in the brain or spinal cord of a patient with C9orf72-related disease.
15. As claimed in claim 14, wherein the C9orf72-related condition is selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD).
16. As claimed in claim 15, wherein the fusion protein is introduced via a recombinant adeno-associated virus (rAAV) expressing the fusion protein.
17. As claimed in claim 16, wherein the rAAV has serotype 9 or pseudotype AAV2 / 9 or AAV2 / 6 / 9.
18. As claimed in claim 17, wherein the rAAV is administered to the patient via intraventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, intranasal, and / or intracisional routes.