Natural exosome extraction method derived from rice stem cells and skincare composition

TWI932393BActive Publication Date: 2026-07-11GECOLL BIOMEDICAL CO LTD
0 Cites 0 Cited by

Patent Information

Application Number
TW114133984
Authority / Receiving Office
TW · TW
Patent Type
Patents
Current Assignee / Owner
Priority Date
2025-07-03
Filing Date
2025-09-04
Publication Date
2026-07-11
Estimated Expiration
2045-09-03

Smart Images

  • Figure IMG-2_DRAW_114133984-A0305-14-0001-1
    Figure IMG-2_DRAW_114133984-A0305-14-0001-1
  • Figure IMG-2_DRAW_114133984-A0305-14-0001-2
    Figure IMG-2_DRAW_114133984-A0305-14-0001-2
  • Figure IMG-2_DRAW_114133984-A0305-14-0002-3
    Figure IMG-2_DRAW_114133984-A0305-14-0002-3
Patent Text Reader

Abstract

This invention provides a method for extracting natural exosomes derived from rice stem cells and a skincare product composition. The exosomes have a bilayer membrane spherical structure with a particle size ranging from 20 to 1000 nm. These exosomes are obtained from rice callus tissue and possess high biocompatibility, stability, and sustainable production capabilities. Furthermore, experiments have demonstrated that these exosomes have anti-aging, cell regeneration and tissue repair promotion, and protective functions, and can significantly improve cell absorption efficiency and the delivery efficiency of active ingredients such as peptides.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant exosome extraction technology, specifically relating to a method for extracting natural exosomes derived from rice stem cells and a skincare product composition. Prior Technology

[0002] Plant-derived extracellular vesicles (PDEVs), as important mediators for the delivery of bioactive substances, have gradually attracted high attention in the fields of functional cosmetics and medicinal plants. Plant exosomes are typically tiny vesicles formed through exocytosis via the intracellular membrane system. They are approximately 20-1000 nm in size and possess a typical bilayer phospholipid membrane structure, enabling them to naturally encapsulate various intracellular bioactive molecules, such as proteins, small metabolites, nucleic acids (DNA, mRNA, miRNA), and lipids, facilitating intercellular communication without compromising structural integrity. Compared to traditional synthetic liposomes, plant exosomes exhibit superior transdermal penetration and cellular absorption efficiency. This characteristic is related to their natural lipid-protein hybrid conformation, specific marker proteins on the membrane, and negatively charged surface properties, allowing for more effective penetration of the stratum corneum and fusion with cell membranes. Furthermore, plant exosomes possess high stability and are not easily degraded, effectively reducing the risk of degradation of active substances during transport and prolonging their retention time in target tissues. Compared to exosomes derived from mammalian cells, PDEVs have lower immunogenicity and biosafety risks, and do not raise concerns about human pathogens or animal-derived components. This effectively avoids immune reactions and ethical controversies, making them more suitable for clinical and aesthetic applications. Recent studies have indicated that PDEVs can effectively encapsulate ingredients such as peptides and antioxidants, thereby enhancing their cellular absorption efficiency and biological function, demonstrating their potential application in the cosmetics field.

[0003] However, regardless of whether the source is plant-based or animal-based, the process of obtaining exosomes generally faces problems such as high extraction costs, strong equipment dependence, difficulty in standardizing raw material sources, and poor stability, which seriously restricts its industrialization process and leads to many obstacles in its practical application. Summary of the Invention

[0004] In view of this, the purpose of this invention is to explore new sources of plant exosomes and their functional applications, in order to solve a series of problems such as high cost of exosome extraction, strong dependence on equipment, difficulty in standardizing raw material sources, and poor stability, and to attempt to transform them into industrialization and clinical applications. Therefore, this invention provides a method for extracting natural exosomes from rice stem cells and a skin care product composition.

[0005] To achieve the above technical objectives, the technical solution adopted in this application is as follows:

[0006] A method for extracting natural exosomes from rice stem cells, including the following steps: Step 1: Obtain rice callus tissue; Step 2: The rice callus tissue obtained in Step 1 is subjected to suspension culture and then scale-up culture in a bioreactor. Step 3: Extract the rice callus culture obtained in Step 2 to obtain cell sap; Step 4: Centrifuge the cell solution obtained in Step 3 in stages, and then perform ultrafiltration on the supernatant to obtain the exosome stock solution.

[0007] In one possible implementation: step 1 includes: selecting healthy, mature rice seeds without disease spots, removing the shells from the rice seeds to retain the embryos, disinfecting the embryos, and then inducing the culture with 2,4-dichlorophenoxyacetic acid to obtain rice callus tissue.

[0008] The above disinfection process is a routine procedure. In some implementation schemes, the disinfection process includes: after surface disinfection with 75% ethanol for 30 seconds to 1 minute, treatment with 0.1% to 0.5% sodium hypochlorite solution (with a small amount of Tween-20 added) for 10 to 15 minutes, followed by rinsing with sterile distilled water 3 to 5 times to remove residual disinfectant.

[0009] In some embodiments, the 2,4-dichlorophenoxyacetic acid is added by inoculating the embryos into MS medium containing 1-3 mg / L 2,4-dichlorophenoxyacetic acid and 25-30 g / L sucrose under aseptic conditions; more preferably, the induction culture conditions include: culturing at 25±2°C in the dark for 1-2 weeks.

[0010] In some embodiments, the MS medium can also be replaced with at least one of B5 medium, N6 medium, WPM medium, and DCR medium.

[0011] In one possible implementation: step 2 includes: inoculating the rice callus tissue obtained in step 1 into a liquid culture medium and culturing it in suspension at 110-130 rpm, 25-28°C in the dark, or at a light intensity of 10-100 μmol photons·m⁻²·s⁻¹ for 14-30 days; after the suspension culture is completed, the callus tissue is inoculated into a bioreactor and liquid culture medium is added, and culturing it in suspension at an atmospheric air intake rate of 0.25-0.5 VVM, 25-28°C in the dark, or at a light intensity of 10-100 μmol photons·m⁻²·s⁻¹ for 7-14 days;

[0012] In some preferred embodiments, the inoculum solid-liquid ratio for suspension culture and bioreactor scale-up culture is 1:50~100;

[0013] In some preferred embodiments, the liquid culture medium comprises, according to the final concentration: 2,4-D, 1.5~2.5 mg / L; sucrose, 25~35 g / L; MS liquid culture medium as the basal medium; and pH adjusted to 5.7~5.8.

[0014] In one possible implementation: step 3 includes: grinding and crushing the rice callus culture obtained in step 2 with water, coarsely filtering it with nylon filter cloth and retaining the filtrate; passing the filtrate through 100 mesh, 200 mesh and 400 mesh sieves in sequence, and retaining the filtrate, which is the cell sap.

[0015] The above grinding and crushing process is a routine procedure, and the grinding and crushing should be carried out without damaging the integrity of the cells.

[0016] In one possible implementation: step 4 includes: centrifuging the obtained cell slurry at 2000g~4000g for 20~40 minutes, then at 5000g~7000g for 20~40 minutes, and finally at 12000g~18000g for 50~70 minutes; filtering the supernatant sequentially through filter membranes with pore sizes of 0.45, 0.22, and 0.1 μm; and then introducing the supernatant sequentially into a hollow fiber membrane column with a specification of 1000-500 kD and a hollow fiber membrane column with a specification of 100-50 kD for ultrafiltration to obtain exosome stock solution.

[0017] In one possible implementation: the natural exosomes obtained by the preparation method described above.

[0018] In one possible implementation: the natural exosomes, wherein the natural exosomes have a bilayer membrane spherical structure and a particle size range of 20~1000nm, preferably 30~500nm.

[0019] In one possible implementation: the natural exosomes, wherein the rice bundles are non-GMO rice.

[0020] A method for preparing freeze-dried exosome powder derived from rice stem cells, wherein the exosome stock solution obtained by the above preparation method is mixed with mannitol and water and then freeze-dried.

[0021] In one possible implementation: the mass percentages of exosome stock solution, mannitol, and water are 60-80%, 3-5%, and 24-28%, respectively; and / or, the control parameters for freeze-drying are: pre-freezing the exosome stock solution at -20±1℃ for 550-650 min; then drying sequentially at -20±1℃ for 150-250 min, -15±1℃ for 250-350 min, and 0±1℃ for 250-350 min; finally drying sequentially at 10±1℃ for 250-350 min, 25±1℃ for 150-250 min, and 36±1℃ for 200-280 min.

[0022] A lyophilized exosome powder obtained by the above preparation method.

[0023] A delivery carrier encapsulating an active ingredient, including the aforementioned exosome lyophilized powder.

[0024] A skincare composition comprising the aforementioned natural exosomes, the aforementioned lyophilized exosome powder, or the aforementioned delivery carrier.

[0025] In some embodiments, the exosome content in the skincare composition is 0.05-99%, and in some preferred embodiments it is 1-98%; or, the exosome stock solution in the skincare composition is 0.05-100%; or, the exosome lyophilized powder in the skincare composition is 0.05-99%, and in some preferred embodiments it is 1-98%; or, the delivery carrier in the skincare composition is 0.05-99%, and in some preferred embodiments it is 1-98%.

[0026] In some embodiments, the skincare composition includes a pharmaceutical composition or a cosmetic composition, especially a cosmetic composition, such as a cosmetic composition having at least one function such as anti-oxidation, repair, whitening, anti-aging, soothing, spot removal, moisturizing, and promoting penetration and absorption.

[0027] In some embodiments, the skincare composition may optionally include, but is not limited to, various excipients, such as surfactants, diluents, emulsifiers, thickeners, dispersants, etc. Surfactants include, for example, cetearyl oleate, sorbitan oleate, polysorbate-60, polysorbate-80, methyl glucosebistearate, PEG-20 methyl glucosebistearate, PEG-40 hydrogenated castor oil, PPG-26-butanol polyether-26, PEG-4 polyglycerol-2 stearate, etc. Diluents include, for example, glycerin, dipropylene glycol, butylene glycol, etc. Emulsifiers include one or more of the following: polyglycerol-3-methylglucose distearate, glyceryl stearate citrate, polyglycerol-10 stearate, polyglycerol-10 myristate, polyglycerol-10 dioleate, polyglycerol-10 laurate, polyglycerol-10 isostearate, polyglycerol-10 oleate, polyglycerol-10 diisostearate, polyglycerol-6 laurate, polyglycerol-6 myristate, sucrose stearate, and sucrose polystearate. Thickeners include one or more of the following polymers: carbomers, acrylics (esters) and their derivatives, xanthan gum, gum arabic, polyethylene glycol-14M, polyethylene glycol-90M, succinate, hydroxyethyl cellulose, hydroxypropyl cellulose, and hydroxypropyl methylcellulose. Dispersants include gelatin, pectin, starch, polyvinyl alcohol, and polyacrylic acid.

[0028] In some embodiments, the skincare composition may optionally also contain other active ingredients, such as: tocopherol (vitamin E), retinol, retinyl palmitate, hydrolyzed collagen, hydrolyzed elastin, allantoin, yeast extract, oryzanol, tetrahydrocurcumin, ellagic acid, ubiquinone, whey protein, polypeptides, acetyl hexapeptide-8, palmitoyl pentapeptide-4, salicylsphingosine, concentrated birch sap, silymarin, silk fibroin, sodium tocopheryl phosphate, ribonucleic acid (RNA), dipeptide diaminobutyric acid benzylamine diacetate, palmitoyl tripeptide-5, oligopeptide-1, hexapeptide-9, palmitoyl oligopeptide, palmitoyl tetrapeptide-7, grape (VITIS VINIFERA) seed extract, rosewood (PTEROCARPUS MARSUPIUM) bark extract, tea (CAMELLIA SINENSIS) polyphenols, wine extract, apple seed extract, European beech (FAGUS) Sylvatica bud extract, hydrolyzed baobab (Adansonia digitata) extract, Artemisia (Artemisia) extract, Iris florentina root extract, hesperidin, ginsenosides, Salvia miltiorrhiza (Salvia miltiorrhiza) extract, nicotinamide, ursolic acid, sodium hyaluronate, acetylated sodium hyaluronate, hydrolyzed sodium hyaluronate, lycopene, coffee (Coffea arabica) extract, dipeptide-2, lactic acid, superoxide dismutase (SOD), evening primrose (Oenothera) extract. One or more of the following: BIENNIS oil, ceramide, dipalmitoylproline, hydroxystearic acid, salicylic acid, ergothioneine, lysophosphatidylcholine, carnosine, decarboxylated carnosine HCl, lipoic acid, adenosine, glycogen, resveratrol, ferulic acid, Bifida ferment lysate, and lactic acid bacteria ferment lysate.

[0029] The exosomes, exosome stock solution, exosome lyophilized powder, or delivery carrier of the present invention can be mixed with other pharmaceutical or cosmetic ingredients using any method known in the skincare composition industry to obtain a pharmaceutical or cosmetic composition. The other pharmaceutical or cosmetic ingredients mentioned above are commonly used components in skincare compositions.

[0030] In addition, the skincare composition can be formulated into various dosage forms, such as solutions, suspensions, ointments, creams, lotions, gels, powders, or sprays, as needed.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] Firstly, given that rice has the advantages of being easy to induce, having stable growth, and being able to be mass-produced through suspension culture in a controlled environment without relying on a large amount of planting space, this invention prepares a rice-derived exosome that simultaneously possesses high biocompatibility, stability, and sustainable mass production.

[0033] Secondly, experiments have confirmed that the exosomes prepared by this invention possess anti-aging, cell regeneration and tissue repair promotion, and protective functions, and can also significantly improve the efficiency of cell absorption of peptides or other active ingredients. The exosomes of this invention can function as carriers for stable peptide delivery, improving peptide stability, cell absorption, and transdermal efficiency, thus better meeting the global demand for the manufacture and transdermal delivery of high-performance skincare active ingredients.

[0034] Third, the method for preparing exosomes in this invention is simple, requires low equipment, and is highly feasible for industrialization. It can complete the enrichment and drug loading of exosomes. The entire process does not rely on high-end equipment and is suitable for GMP or large-scale cosmetic raw material production environments, while achieving cost control and batch consistency.

[0035] Fourth, this invention contains no animal-derived ingredients, no endotoxin risk, and no risk of zoonotic pathogens, which aligns with the trend of green and sustainable biomanufacturing. This exosome can be widely used in functional cosmetics (such as anti-aging, repair, whitening, and transdermal delivery), medical aesthetic raw materials (peptide carriers, postoperative repair exosome therapy), health foods (immune regulation, anti-oxidation), skin repair drugs (wound dressings, burn healing), drug delivery carriers (carrying siRNA, anticancer drugs), and even extends to multiple cutting-edge fields such as oral care, hair regeneration, eye mucosal repair, and biological agent co-carrying systems. Simple Explanation of the Diagram

[0036] To more clearly illustrate the technical solutions of the embodiments of this application, the accompanying drawings in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of this application and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0037] Figure 1 is a schematic diagram of the preparation process of exosome stock solution in Example 1 of the present invention.

[0038] Figure 2 shows the transmission electron microscope (TEM) images of the exosome stock solution obtained in Example 1, where A is an image of a few cells focused in the stock solution, and B is an image of multiple cells.

[0039] Figure 3 shows the particle size analysis (NTA) results of the exosome stock solution obtained in Example 1. The horizontal axis represents the particle size (nm), and the vertical axis represents the concentration (particles / mL).

[0040] Figure 4 shows the surface potential analysis results of the exosome stock solution obtained in Example 1.

[0041] Figure 5A shows the particle size characterization of the exosome stock solution obtained in Example 1 after freeze-drying.

[0042] Figure 5B shows the concentration characterization of the exosome stock solution obtained in Example 1 after lyophilization.

[0043] Figure 6 shows the freeze-dried and reconstituted forms of the exosome stock solution obtained in Example 1.

[0044] Figure 7 shows the surface potential analysis results of the exosome stock solution obtained in Example 1 after lyophilization.

[0045] Figure 8 shows TEM images of the exosome stock solution obtained in Example 1 after lyophilization, where A is an image of multiple cells and B is an image of a single cell focused on.

[0046] Figure 9 is a comparison of the clarity of the supernatant after each centrifugation in the centrifugation parameter investigation experiment of Example 1.

[0047] Figure 10 shows the filtration results of the supernatant after each centrifugation stage in the centrifugation parameter investigation experiment of Example 1, using a 0.45 μm filter membrane.

[0048] Figure 11 shows the evaluation of the antioxidant efficacy of exosomes obtained in Example 1; where (a) is the result of the antioxidant activity detection by analyzing the DPPH free radical scavenging ability of rice callus exosomes; and (b) is the result of the total phenol content (TPC) analysis of rice callus exosomes.

[0049] Figure 12 shows the results of the effect analysis of exosomes obtained in Example 1 on cell proliferation and wound healing. (a) In the cell proliferation experiment, HaCaT cells were treated with vitamin C (0.25 mg / mL) and different concentrations of rice callus exosomes for 24 hours; (b) Image analysis of the wound healing experiment was performed on the control group and cells treated with rice callus exosomes (1 × 10¹⁰ particles / mL) for 24 hours; (c) The healing rate of the wound healing experiment was quantified in the control group and cells treated with rice callus exosomes (1 × 10¹⁰ particles / mL) for 24 hours. Data are expressed as mean ± standard deviation (mean ± SD), and statistical difference was defined as p < 0.001.

[0050] Figure 13 shows evidence that the exosomes obtained in Example 1 can be endocytosed into cells by HaCaT.

[0051] Figure 14 shows the preparation process and related characteristics of exosome-coated pentapeptide-48 obtained in Example 1. In Figure 14, A shows the preparation process of exosome-coated pentapeptide-48 obtained in Example 1; B shows the particle size distribution and particle concentration of rice callus exosomes and rice callus exosome-coated pentapeptide-48 determined by a nanoparticle size tracer (NTA); and C shows the morphology of rice callus exosomes and rice callus exosome-coated pentapeptide-48 observed by a transmission electron microscope (TEM). The scale bar is 100 nanometers.

[0052] Figure 15 shows the cell delivery capacity analysis results of pentapeptide-48, exosomes obtained in Example 1, and pentapeptide-48-encapsulated exosomes (OsEVs+Pentapeptide-48) in human skin keratinocytes; (a) fluorescence image of HaCaT cells, showing the cell penetration capacity of pentapeptide-48, rice callus exosomes, and pentapeptide-48-encapsulated exosomes. Scale bar is 50 μm; (b) quantitative analysis of FITC fluorescence intensity of HaCaT cells, which reflects the cell penetration degree of pentapeptide-48, rice callus exosomes, and pentapeptide-48-encapsulated exosomes. Data are expressed as mean ± standard deviation (***p < 0.001).

[0053] Figure 16 shows the anti-aging and skin protection effects of pentapeptide-48 and exosome-encapsulated pentapeptide-48 obtained in Example 1. The expression levels of genes such as MMP-3 (A), TIMP-1 (B), Hyal-1 (C), and TGM-1 (D) were analyzed by real-time quantitative polymerase chain reaction (RT-qPCR). Data are expressed as mean ± standard deviation (mean ± SD), * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001, which is statistically significant.

[0054] Figure 17 shows the particle size analysis of exosomes coated with other active ingredients obtained in Example 1. Implementation

[0055] This invention provides a method for extracting natural exosomes from rice stem cells, comprising the following steps: Step 1: Obtain rice callus tissue; Step 2: The rice callus tissue obtained in Step 1 is subjected to suspension culture and then scale-up culture in a bioreactor. Step 3: Extract the rice callus culture obtained in Step 2 to obtain cell sap; Step 4: Centrifuge the cell solution obtained in Step 3 in stages, and then perform ultrafiltration on the supernatant to obtain the exosome stock solution.

[0056] In one possible implementation: step 1 includes: selecting healthy, mature rice seeds without disease spots, removing the shells from the rice seeds to retain the embryos, disinfecting the embryos, and then inducing the culture with 2,4-dichlorophenoxyacetic acid to obtain rice callus tissue.

[0057] The above disinfection process is a routine procedure. In some implementation schemes, the disinfection process includes: after surface disinfection with 75% ethanol for 30 seconds to 1 minute, treatment with 0.1% to 0.5% sodium hypochlorite solution (with a small amount of Tween-20 added) for 10 to 15 minutes, followed by rinsing with sterile distilled water 3 to 5 times to remove residual disinfectant.

[0058] In some embodiments, the 2,4-dichlorophenoxyacetic acid is added by inoculating the embryos into MS medium containing 1-3 mg / L 2,4-dichlorophenoxyacetic acid and 25-30 g / L sucrose under aseptic conditions; more preferably, the induction culture conditions include: culturing at 25±2°C in the dark for 1-2 weeks.

[0059] In some embodiments, the MS medium can also be replaced with at least one of B5 medium, N6 medium, WPM medium, and DCR medium.

[0060] In one possible implementation: step 2 includes: inoculating the rice callus tissue obtained in step 1 into a liquid culture medium and culturing it in suspension at 110-130 rpm, 25-28°C in the dark, or at a light intensity of 10-100 μmol photons·m⁻²·s⁻¹ for 14-30 days; after the suspension culture is completed, the callus tissue is inoculated into a bioreactor and liquid culture medium is added, and culturing it in suspension at an atmospheric air intake rate of 0.25-0.5 VVM, 25-28°C in the dark, or at a light intensity of 10-100 μmol photons·m⁻²·s⁻¹ for 7-14 days;

[0061] In some preferred embodiments, the inoculum solid-liquid ratio for suspension culture and bioreactor scale-up culture is 1:50~100;

[0062] In some preferred embodiments, the liquid culture medium comprises, according to the final concentration: 2,4-D, 1.5~2.5 mg / L; sucrose, 25~35 g / L; MS liquid culture medium as the basal medium; and pH adjusted to 5.7~5.8.

[0063] In one possible implementation: step 3 includes: grinding and crushing the rice callus culture obtained in step 2 with water, coarsely filtering it with nylon filter cloth and retaining the filtrate; passing the filtrate through 100 mesh, 200 mesh and 400 mesh sieves in sequence, and retaining the filtrate, which is the cell sap.

[0064] The above grinding and crushing process is a routine procedure, and the grinding and crushing should be carried out without damaging the integrity of the cells.

[0065] In one possible implementation: step 4 includes: centrifuging the obtained cell slurry at 2000g~4000g for 20~40 minutes, then at 5000g~7000g for 20~40 minutes, and finally at 12000g~18000g for 50~70 minutes; filtering the supernatant sequentially through filter membranes with pore sizes of 0.45, 0.22, and 0.1 μm; and then introducing the supernatant sequentially into a hollow fiber membrane column with a specification of 1000-500 kD and a hollow fiber membrane column with a specification of 100-50 kD for ultrafiltration to obtain exosome stock solution.

[0066] In one possible implementation: the natural exosomes obtained by the preparation method described above.

[0067] In one possible implementation: the natural exosomes, wherein the natural exosomes have a bilayer membrane spherical structure and a particle size range of 20~1000nm, preferably 30~500nm.

[0068] In one possible implementation: the natural exosomes, wherein the rice bundles are non-GMO rice.

[0069] A method for preparing freeze-dried exosome powder derived from rice stem cells, wherein the exosome stock solution obtained by the above preparation method is mixed with mannitol and water and then freeze-dried.

[0070] In one possible implementation: the mass percentages of exosome stock solution, mannitol, and water are 60-80%, 3-5%, and 24-28%, respectively; and / or, the control parameters for freeze-drying are: pre-freezing the exosome stock solution at -20±1℃ for 550-650 min; then drying sequentially at -20±1℃ for 150-250 min, -15±1℃ for 250-350 min, and 0±1℃ for 250-350 min; finally drying sequentially at 10±1℃ for 250-350 min, 25±1℃ for 150-250 min, and 36±1℃ for 200-280 min.

[0071] A lyophilized exosome powder obtained by the above preparation method.

[0072] A delivery carrier encapsulating an active ingredient, including the aforementioned exosome lyophilized powder.

[0073] A skincare composition comprising the aforementioned natural exosomes, the aforementioned lyophilized exosome powder, or the aforementioned delivery carrier.

[0074] In some embodiments, the exosome content in the skincare composition is 0.05-99%, and in some preferred embodiments it is 1-98%; or, the exosome stock solution in the skincare composition is 0.05-100%; or, the exosome lyophilized powder in the skincare composition is 0.05-99%, and in some preferred embodiments it is 1-98%; or, the delivery carrier in the skincare composition is 0.05-99%, and in some preferred embodiments it is 1-98%.

[0075] In some embodiments, the skincare composition includes a pharmaceutical composition or a cosmetic composition, especially a cosmetic composition, such as a cosmetic composition having at least one function such as anti-oxidation, repair, whitening, anti-aging, soothing, spot removal, moisturizing, and promoting penetration and absorption.

[0076] In some embodiments, the skincare composition may optionally include, but is not limited to, various excipients, such as surfactants, diluents, emulsifiers, thickeners, dispersants, etc. Surfactants include, for example, cetearyl oleate, sorbitan oleate, polysorbate-60, polysorbate-80, methyl glucosebistearate, PEG-20 methyl glucosebistearate, PEG-40 hydrogenated castor oil, PPG-26-butanol polyether-26, PEG-4 polyglycerol-2 stearate, etc. Diluents include, for example, glycerin, dipropylene glycol, butylene glycol, etc. Emulsifiers include one or more of the following: polyglycerol-3-methylglucose distearate, glyceryl stearate citrate, polyglycerol-10 stearate, polyglycerol-10 myristate, polyglycerol-10 dioleate, polyglycerol-10 laurate, polyglycerol-10 isostearate, polyglycerol-10 oleate, polyglycerol-10 diisostearate, polyglycerol-6 laurate, polyglycerol-6 myristate, sucrose stearate, and sucrose polystearate. Thickeners include one or more of the following polymers: carbomers, acrylics (esters) and their derivatives, xanthan gum, gum arabic, polyethylene glycol-14M, polyethylene glycol-90M, succinate, hydroxyethyl cellulose, hydroxypropyl cellulose, and hydroxypropyl methylcellulose. Dispersants include gelatin, pectin, starch, polyvinyl alcohol, and polyacrylic acid.

[0077] In some embodiments, the skincare composition may optionally also contain other active ingredients, such as: tocopherol (vitamin E), retinol, retinyl palmitate, hydrolyzed collagen, hydrolyzed elastin, allantoin, yeast extract, oryzanol, tetrahydrocurcumin, ellagic acid, ubiquinone, whey protein, polypeptides, acetyl hexapeptide-8, palmitoyl pentapeptide-4, salicylsphingosine, concentrated birch sap, silymarin, silk fibroin, sodium tocopheryl phosphate, ribonucleic acid (RNA), dipeptide diaminobutyric acid benzylamine diacetate, palmitoyl tripeptide-5, oligopeptide-1, hexapeptide-9, palmitoyl oligopeptide, palmitoyl tetrapeptide-7, grape (VITIS VINIFERA) seed extract, rosewood (PTEROCARPUS MARSUPIUM) bark extract, tea (CAMELLIA SINENSIS) polyphenols, wine extract, apple seed extract, European beech (FAGUS) Sylvatica bud extract, hydrolyzed baobab (Adansonia digitata) extract, Artemisia (Artemisia) extract, Iris florentina root extract, hesperidin, ginsenosides, Salvia miltiorrhiza (Salvia miltiorrhiza) extract, nicotinamide, ursolic acid, sodium hyaluronate, acetylated sodium hyaluronate, hydrolyzed sodium hyaluronate, lycopene, coffee (Coffea arabica) extract, dipeptide-2, lactic acid, superoxide dismutase (SOD), evening primrose (Oenothera) extract. One or more of the following: BIENNIS oil, ceramide, dipalmitoylproline, hydroxystearic acid, salicylic acid, ergothioneine, lysophosphatidylcholine, carnosine, decarboxylated carnosine HCl, lipoic acid, adenosine, glycogen, resveratrol, ferulic acid, Bifida ferment lysate, and lactic acid bacteria ferment lysate.

[0078] The exosomes, exosome stock solution, exosome lyophilized powder, or delivery carrier of the present invention can be mixed with other pharmaceutical or cosmetic ingredients using any method known in the skincare composition industry to obtain a pharmaceutical or cosmetic composition. The other pharmaceutical or cosmetic ingredients mentioned above are commonly used components in skincare compositions.

[0079] The skincare composition can be formulated into various dosage forms, such as solutions, suspensions, ointments, creams, lotions, gels, powders, or sprays, as needed.

[0080] Furthermore, it should be noted in the description of this invention that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0081] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0082] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0083] Example 1:

[0084] This invention provides an embodiment for the preparation of exosomes from rice callus, as detailed below:

[0085] (1) Exosomes were prepared using the Chinese rice variety Tainong 67. The preparation process is shown in Figure 1, and includes the following steps:

[0086] Step 1: Select healthy rice seeds, remove the husks and retain the embryos. Choose healthy, mature rice seeds without disease spots, remove the husks and retain the intact embryos. After surface disinfection with 75% ethanol for 30 seconds to 1 minute, treat with 0.1%~0.5% sodium hypochlorite solution (with a small amount of Tween-20 added) for 10~15 minutes, then rinse 3~5 times with sterile distilled water to remove residual disinfectant. Under sterile conditions, inoculate the embryos into MS induction medium containing 2 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) and 30 g / L sucrose, and culture in the dark at 25±2°C for 1~2 weeks to induce callus formation.

[0087] Step 2: Rice callus tissue was cultured in suspension in 0.25 L Erlenmeyer flasks for amplification. Primary generation rice callus tissue was inoculated into 0.25 L Erlenmeyer flasks at a solid-liquid ratio of 1:50-100, and liquid culture medium (MS liquid medium containing 2 mg / L 2,4-D, with 30 g / L sucrose, pH adjusted to 5.8) was added. The flasks were placed on a shaker and cultured at a constant temperature of 110–130 rpm at 25–28 °C in darkness or at light intensities below the light compensation point (10–100 μmol photons·m⁻²·s⁻¹). The culture period was generally 7–14 days, during which the proliferation of cell clumps and the uniformity of the suspension were observed. Cell clumps were visually screened based on size, texture, and morphology, removing undispersed or necrotic clumps. The selected cell clusters were inoculated into new culture flasks at a ratio of 1:50-100, and the above steps were repeated for about one month to obtain stable suspended rice callus.

[0088] Step 3: Take rice callus tissue that has undergone stable suspension culture and inoculate it into a 5 L fermenter (bioreactor) at a solid-liquid ratio of 1:50–1:100. Add MS liquid medium containing 2 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) and 30 g / L sucrose, with the pH adjusted to 5.8. Initially, aeration is performed at an atmospheric gas flow rate of 0.25–0.5 VVM (unadjusted composition). The temperature is controlled at 25–28 °C, and the culture is kept in darkness or at a light intensity below the light compensation point (10–100 μmol photons·m⁻²·s⁻¹). The culture period is 7–14 days, during which the aeration ratio is dynamically adjusted by monitoring dissolved oxygen levels. After one week of culture, a 5–10-fold increase in rice callus proliferation can be obtained. After culture, fresh rice callus culture is collected, washed three times with pure water, and used as raw material for exosome extraction.

[0089] Step 4: Add the rice callus culture obtained in Step 3 to purified water at a ratio of 1g:1.5mL and grind to obtain a pulp. Since the grinding equipment generates heat during operation, and high temperatures can damage nanovesicles, the pulp temperature should be controlled below 30℃ during the grinding process. Pour the pulp into a 140-mesh nylon filter cloth and squeeze to filter, removing large fiber residue. Then, pass the filter cloth filtrate sequentially through sieves with pore sizes of 100, 200, and 400 mesh to remove residue, obtaining the filtrate.

[0090] Step 5: Centrifuge the obtained filtrate multiple times. Collect the supernatant after each centrifugation and then centrifuge again until the supernatant is obtained.

[0091] Step 6: The obtained supernatant is sequentially filtered through a sterile membrane to remove particulate impurities, and then the supernatant is ultrafiltered through a hollow fiber membrane to obtain exosome stock solution.

[0092] Step 7: Mix the exosome stock solution, mannitol, and water in a ratio of 70%, 4%, and 26% by weight, respectively, and then freeze-dry the mixture to obtain exosome lyophilized powder, which is then dispensed into sterile glass bottles for storage.

[0093] In step 5, the obtained filtrate is subjected to staged centrifugation to separate the solid residue: first, centrifuge at 3,000 × g for 30 minutes, then at 6,000 × g for 30 minutes, and finally at 12,000 × g for 60 minutes.

[0094] In step 6, the supernatant is sequentially filtered through filter membranes with pore sizes of 0.45, 0.22, and 0.1 μm to obtain a supernatant with particulate impurities removed. The supernatant is then injected into a hollow fiber membrane column of 1000-500 kD using a peristaltic pump. Using the principle of tangential flow filtration (TFF), exosomes smaller than 500 nm are separated. The supernatant is then injected into a hollow fiber membrane column of 100-50 kD to remove impurities smaller than 30 nm, thus obtaining the exosome stock solution derived from rice tissue culture.

[0095] In step 7, the control parameters for freeze drying are as follows: pre-freeze the exosome stock solution at -20±1℃ for 600 min; then dry it sequentially at -20±1℃ for 200 min, -15±1℃ for 300 min, and 0±1℃ for 300 min; finally, dry it sequentially at 10±1℃ for 300 min, 25±1℃ for 200 min, and 36±1℃ for 240 min.

[0096] (2) Performance evaluation of exosome stock solution and exosome lyophilized powder

[0097] As shown in Figure 2, the exosome stock solution observed under a transmission electron microscope (TEM) exhibits a typical double-membrane spherical morphology with clear outlines and complete structure, consistent with the characteristics of cell exosomes.

[0098] As shown in Figure 3, the particle size range of the exosome stock solution is 30-300 nm, with an average particle size of 94.0±0.5 nm, uniform particle size, extremely low impurities, and a concentration as high as 3×10¹² particles / mL, as determined by nanoparticle tracking analysis (NTA).

[0099] As shown in Figure 4, the average potential of the exosome stock solution measured by the Zeta potentiometer was -17 mV, which is consistent with the characteristic range of cell exosomes (between -25 and -6 mV).

[0100] As shown in Figures 5A and 5B, NTA analysis revealed that the exosome particle size distribution after lyophilization ranged from 70 to 140 nm, with an average particle size of approximately 100 nm, showing little difference compared to the original solution. The lyophilized exosomes retained approximately 73–78% of the nanoparticle concentration, maintaining a high degree of concentration while ensuring stable particle size. The total particle concentration after lyophilization remained as high as 1 × 10¹² particles / mL.

[0101] As shown in Figure 6, the weight of freeze-dried rice callus exosomes was 0.25 ± 0.05 g / bottle, with a water content of less than 3.5%. They appeared as white, non-collapsed solids. No insoluble solids were observed to form upon reconstitution with 5 mL of pure water, indicating that the freeze-dried rice callus exosome product has excellent water solubility.

[0102] As shown in Figure 7, the surface potential of rice callus exosomes after freeze-drying is as high as -18.9 mV, and they do not aggregate excessively due to freeze-drying.

[0103] As shown in Figure 8, under a 100 nm scale field of view, the lyophilized exosomes from rice callus tissue all exhibited a stable saucer-like double-membrane spherical structure. The particle size was approximately 120-150 nm in the 100 nm field of view, consistent with NTA results, indicating that the membrane structure remained largely intact after lyophilization.

[0104] (3) Investigation of centrifugation control parameters in step 5 of exosome preparation

[0105] This invention takes into account factors such as process requirements, environmental requirements of equipment, equipment price, and ease of scaling up, and selects a high-speed centrifuge with a centrifugal force of less than 20,000 ×g for process development.

[0106] 1) The filtrate obtained in step 5 is sieved and centrifuged sequentially at 3000×g for 30 min, 6000×g for 30 min, 12000×g for 60 min, and 20000×g for 60 min. The supernatant is collected after each centrifugation, and then the next centrifugation is carried out.

[0107] 2) The clarity of the supernatant was compared after each centrifugation. The results are shown in Figure 9. There was no significant difference in clarity between the supernatant after centrifugation to 12000 ×g (3 centrifugations in total) and after centrifugation to 20000 ×g (4 centrifugations in total).

[0108] 3) The supernatant of each centrifuged segment was filtered through a 0.45 μm pore size membrane. The volume of solution that could be filtered before the membrane became clogged was recorded, and the membrane filtration rate (filtered volume / original liquid volume × 100%) was calculated. The results are shown in Figure 10. There was no significant difference in the filtration rate of the supernatant after centrifugation to 12000 ×g (3 centrifugations) and to 20000 ×g (4 centrifugations) through the 0.45 μm membrane.

[0109] After comparative experiments, it was found that centrifugation at 3,000 × g for 30 minutes, 6,000 × g for 30 minutes, and 12,000 × g for 60 minutes in sequence was sufficient for the next step of membrane filtration without significantly affecting the filtration volume. Therefore, these three centrifugation conditions were selected as the optimal treatment steps.

[0110] (4) Evaluation of the antioxidant effects of exosomes

[0111] This experiment evaluated the antioxidant activity of rice callus exosomes by using the scavenging rate of 1,1-diphenyl-2-trinitrophenylhydrazine (DPPH) and the total phenol content.

[0112] (4-1) DPPH method for detecting the free radical scavenging ability of rice callus exosomes

[0113] Prepare a 0.12 mg / mL DPPH solution (dissolved in 95% ethanol); add 50 μL of 95% ethanol to 950 μL of DPPH solution (blank); take cucumber-derived exosomes (1×10¹² particles / mL) and rice callus exosomes (1×10¹² particles / mL) respectively, add 950 μL of DPPH solution (reaction tube) or RO water (bottom tube), mix, and react at room temperature in the dark for about 40 minutes. Finally, measure the absorbance at 517 nm wavelength using a microplate reader and calculate the absorbance by passing through ((reaction tube - bottom tube) / blank) × 100%.

[0114] The raw material for preparing cucumber-derived exosome stock solution is cucumber seeds, and the preparation method is the same as steps 1 to 6 above.

[0115] (4-2) Method for determining total phenol content (TPC)

[0116] Rice callus exosomes were mixed with 1 mL of Milli-Q purified water, vortexed for 1 minute, and centrifuged. The supernatant was collected as the sample solution (diluted 10–20 times to ensure the absorbance falls within the standard curve range). The preparation method for fresh plant (fruit or vegetable) extracts included: adding 1 gram of plant sample to 1.5 mL of purified water and grinding. The temperature of the slurry should be controlled below 30°C during grinding to avoid component denaturation. After grinding, the resulting slurry was poured into a 140-mesh nylon filter cloth and squeezed to remove larger fibrous impurities. Subsequently, the filtrate was filtered sequentially through sieves with pore sizes of 100 mesh, 200 mesh, and 400 mesh to further remove residues and obtain a relatively pure filtrate. This filtrate was centrifuged at 12000×g in a high-speed centrifuge. The supernatant was collected after centrifugation; this is the plant extract liquid, used for subsequent analysis or applications (diluted 10–20 times to ensure the absorbance falls within the standard curve range). Gallic acid standard solution was prepared at a concentration of 1 mg / mL and diluted to a gradient of 20–200 μg / mL to establish a standard curve. In the reaction system, 200 μL of 90 mg / mL Na₂CO₃ solution, 100 μL of standard or sample solution, and then 100 μL of 50% Folin-Ciocalteu reagent were added sequentially. The mixture was thoroughly mixed (using pipetting), and incubated in a 45 °C water bath for 30 minutes. After the reaction, the sample was centrifuged, and 200 μL of the supernatant was added to a 96-well microplate. The absorbance was measured at 750 nm. A linear regression equation (y = ax + b) was established using the standard, and the total phenol content in the sample was calculated using interpolation. The results are expressed as gallic acid equivalents (GAE), in mg GAE / mL.

[0117] The results are shown in Figure 11. Figure (a) shows the DPPH free radical scavenging capacity analysis of rice callus exosomes and the antioxidant activity detection results. Cucumber exosomes (EVs) showed a scavenging rate of 26%, while rice callus exosomes achieved a scavenging rate of 47%, significantly higher than the cucumber exosome group (p < 0.05). Most existing plant-derived exosomes (EVs / ELNs) exhibit DPPH free radical scavenging capacity between 30% and 70% in DPPH free radical scavenging experiments. The rice callus exosomes of this invention, with a DPPH scavenging rate of approximately 47%, demonstrate a high free radical scavenging capacity and possess at least basic antioxidant function. (b) Analysis of total phenol content (TPC) in rice callus exosomes. The results showed that the total phenol concentration in rice callus exosomes was as high as 14.25 mg GAE / mL, which was significantly higher than that in cucumber exosomes (5.18 mg GAE / mL) and fresh plant extracts in this experiment (approximately 1.5–8.5 mg GAE / mL).

[0118] Further comparison with other plant exosome literature also showed significant advantages: 1) Ma, L., Ye, Z., Guo, D., Nie, C., & Zhou, Z. (2024). Citri reticulate pericarpium-derived extracellular vesicles exert antioxidant and anti-inflammatory properties and enhance the bioactivity of nobiletin by forming EVs-nob nanoparticles. Frontiers in Cell and Developmental Biology, 12, Article 1509123.(https: / / doi.org / 10.3389 / fcell.2024.1509123) reported that the total phenolic content of citrus peel exosomes was 0.173 ± 0.02 mg GAE / mL, (Danh, J., Canup, B., Najjar, R., Meister, M., Laroui, H., & Feresin, R. (2021). Characterization and uptake of strawberry-derived Exosome-like nanovesicles by human aortic endothelial cells. Current Developments in Nutrition, 5, nzab0310. (https: / / doi.org / 10.1093 / cdn / nzab0310) reported strawberry exosomes with a concentration of 158.9 ± 22.6 μmol GAE / L (approximately 0.27 mg GAE / mL), while Li, S., Ye, Z., Zhao, L., Yao, Y., & Zhou, Z. (2023). Evaluation of antioxidant activity and drug delivery potential of cell-derived extracellular vesicles from Citrus reticulata blanco cv. 'Dahongpao'. Antioxidants, 12(9), Article 1706. (https: / / doi.org / 10.1093 / cdn / nzab0310) reported strawberry exosomes with a concentration of 158.9 ± 22.6 μmol GAE / L (approximately 0.27 mg GAE / mL).The exosome content of tangerine peel (obtained from org / 10.3390 / antiox12091706) was 0.755 ± 0.05 mg GAE / mL. These values ​​are significantly lower than the total phenolic content of rice exosomes measured in this invention.

[0119] In conclusion, the enhanced capacity of rice callus exosomes to accumulate phenolic metabolites may be one of the key factors contributing to their superior antioxidant properties.

[0120] (5) Effects of exosomes on cell proliferation

[0121] To evaluate the effect of rice callus exosomes on cell proliferation, a dose-response experiment was conducted in human skin keratinocytes (HaCaT) using a cell counting kit (CCK-8). The experimental method is as follows:

[0122] (5-1) Cell Culture Methods

[0123] Human skin keratinocytes (HaCaT) were cultured in DMEM medium containing 10% fetal bovine serum (FBS) and 1% antibiotics, respectively, at 37 °C and 5% CO₂.

[0124] (5-2) Cell proliferation analysis methods

[0125] In this embodiment, HaCaT human keratinocytes were seeded at a density of 5 × 10³ cells per well in 96-well culture plates and cultured at 37 °C for 24 hours to promote cell attachment. After attachment, the cells were treated with different concentrations (0, 6.25 × 10⁸, 1.25 × 10⁹, 2.5 × 10⁹, 5 × 10⁹, 1 × 10¹⁰) of rice callus exosomes (OsEVs) in PBS and vitamin C (0.25 mg / mL) in PBS for 24 hours. After culture, 10 μL of CCK-8 reagent was added to each well, and the reaction was carried out at 37 °C for 1 hour. Finally, the absorbance was measured at 450 nm using a microplate reader to assess the cell proliferation rate.

[0126] (5-3) Experimental methods for cell wound healing

[0127] HaCaT keratinocytes were seeded in 6-well culture dishes and cultured at 37 °C in a 5% CO2 incubator for 24 hours to promote cell attachment. After cell attachment, the inserts were gently removed (ensuring no scratching of the culture substrate), forming a standard-width "cell defect area" (i.e., wound). The cells were then washed twice with phosphate-buffered saline (PBS). Subsequently, the cells were divided into a treatment group and a control group. The treatment group was given a PBS solution containing 1 × 10¹⁰ particles / mL of rice callus-derived exosomes (OsEVs), while the control group was not given OsEVs. The treatment time for both groups was 24 hours. After treatment, the culture medium was removed, and the cells were washed twice more with PBS. Images of the cell healing area were captured using an optical microscope, and the healing area was quantitatively analyzed using ImageJ software.

[0128] The experimental results in Figure 12 show that (a) rice callus exosomes significantly promoted the proliferation of HaCaT keratinocytes, with a proliferation rate of up to 142.4%, which is 19.0% higher than that of the vitamin C treatment group (approximately 119.6%), demonstrating its significant advantage in in vitro proliferation.In contrast, exosomes from various plant sources have also been reported in the literature to have the potential to promote cell proliferation. For example, the proliferation rate of HaCaT cells treated with ginseng-derived nanoparticles (GDNPs) increased to approximately 120% (Yang, S., Lu, S., Ren, L., Bian, S., Zhao, D., Liu, M., & Wang, J. (2023). Ginseng-derived nanoparticles induce skin cell proliferation and promote wound healing. Journal of Ginseng Research, 47(1), 133–143.(https: / / doi.org / 10.1016 / j.jgr.2022.04.003)); the proliferation rate of exosomes derived from wheatgrass juice was approximately 130% (Şahin, F., Koçak, P., Güneş, MY, Özkan, İ., Yıldırım, E., & Kala, EY (2019). In vitro wound healing activity of Wheat-derived nanovesicles. Applied Biochemistry and Biotechnology, 188, 381–394. (https: / / doi.org / 10.1007 / s12010-018-02944-3)); while grapefruit-derived exosomes increased to about 125% (Savcı, Y., Kırbaş, OK, Bozkurt, BT, Abdik, EA, Taşlı, PN, Şahin, F., & Abdik, H. (2021). Grapefruit-derived extracellular vesicles as a promising cell-free therapeutic tool for wound healing. Food & Function, 12(11), 5144–5156. (https: / / doi.org / 10.1039 / D0FO02953J)). Although these exosomes promoted cell activity to some extent, none of them achieved the proliferation rate (142.4%) exhibited by the rice exosomes in this invention.

[0129] Furthermore, the results of in vitro wound healing experiments shown in Figures (b) and (c) indicate that the cells with added rice callus exosomes achieved a healing rate of 60.9%, which is 38.3% higher than the untreated control group. In the literature, exosomes from various plant sources have also shown a promoting effect on wound healing of HaCaT keratinocytes: the healing rate of the ginseng-derived nanoparticles (GDNPs) treatment group was 60% (Yang, S., Lu, S., Ren, L., Bian, S., Zhao, D., Liu, M., & Wang, J. (2023). Ginseng-derived nanoparticles induce skin cell proliferation and promote wound healing. Journal of Ginseng Research, 47(1), 133–143.(https: / / doi.org / 10.1016 / j.jgr.2022.04.003)); grapefruit-derived exosomes also showed a 60% rate (Savcı, Y., Kırbaş, OK, Bozkurt, BT, Abdik, EA, Taşlı, PN, Şahin, F., & Abdik, H. (2021). Grapefruit-derived extracellular vesicles as a promising cell-free therapeutic tool for wound healing. Food & Function, 12(11), 5144–5156. (https: / / doi.org / 10.1039 / D0FO02953J)); while wheatgrass juice-derived nanovesicles reached 65% (Şahin, F., Koçak, P., Güneş, MY, Özkan, İ., Yıldırım, E., & Kala, EY (2019). In vitro wound healing activity of wheat-derived nanovesicles. Applied Biochemistry and Biotechnology, 188, 381–394. (https: / / doi.org / 10.1007 / s12010-018-02944-3)).The above results indicate that rice callus exosomes, consistent with other plant exosomes reported in existing literature, can significantly promote epidermal cell migration and regeneration, demonstrating excellent potential for skin repair and regeneration applications.

[0130] (6) Exosomes can enter human skin keratinocytes via pinocytosis.

[0131] The exosome stock solution was diluted and stained with DIO fluorescent dye, then filtered through a hollow fiber membrane to remove free dye. HaCaT human skin keratinocytes were seeded into 6-well plates, and the seeding density was adjusted after cell counting to achieve a final cell count of 3 × 10⁵ per well. Cells were cultured for approximately 24 hours until they fully adhered and covered the bottom of the wells. The cells were washed three times with PBS to remove the old culture medium. Exosomes stained with DIO containing 1 × 10¹⁰ particles / mL were added to the wells, and the cells were cultured for another 24 hours. Afterward, the cells were washed three times with PBS to remove any unabsorbed exosomes. The uptake and absorption of vesicles by cells was observed under a fluorescence microscope. The results are shown in Figure 13. Under a fluorescence microscope, the green fluorescence emitted by the dye after blue light excitation indicates that the fluorescence signal is concentrated within the cells, demonstrating that exosomes derived from rice tissue culture can be uptaken and absorbed by the cells.

[0132] Example 2:

[0133] Pentapeptide-48 possesses antioxidant properties, promotes collagen synthesis, and can also smooth and firm the skin. Therefore, this invention provides an example of a high-purity OsEVs formulation coated with pentapeptide-48 to investigate the relevant effects of exosomes coated with pentapeptide-48, as detailed below:

[0134] (1) Pentapeptide-48 was coated with the exosome lyophilized powder obtained in Example 1. The process is shown in Figure 14(a), and specifically includes the following steps:

[0135] Pentapeptide-48 or FITC-conjugated pentapeptide-48 was dissolved at concentrations of 0.1%–2% (w / v) (0.1%, 0.5%, 1.0%, 1.5%, and 2.0% were tested in this example) in ice-cold 15 mM sodium citrate buffer (pH 6.0–6.5). After complete dissolution, lyophilized rice callus exosome powder reconstituted at a concentration of 50 mg / mL was added to achieve a final exosome concentration of approximately 1 × 10¹⁰–1 × 10¹¹ particles / mL. The mixture was then thoroughly mixed to obtain a uniformly dispersed composite solution. To improve peptide coating efficiency, the mixture was ultrasonically treated at 4–8°C for 5 minutes, followed by incubation at 4°C for 30 minutes to promote peptide entry into exosome vesicles. After the encapsulation process, unencapsulated free pentapeptide-48 and pentapeptide-48 encapsulated in extracellular vesicles were separated from the sample using ultrafiltration. Since the molecular weight of pentapeptide-48 is less than the 100 kDa cutoff of the ultrafiltration membrane, while the particle size corresponding to the extracellular vesicle diameter is greater than the 100 kDa cutoff, no pentapeptide-48 was detected in the flow-through after centrifugation at 4°C, 3000×g for 30 minutes, repeated three times, indicating that free pentapeptide-48 had been effectively removed. Subsequently, high-performance liquid chromatography (HPLC) was used to separate and detect pentapeptide-48 at a wavelength of 215 nm, utilizing the characteristic absorption of pentapeptide-48 at this wavelength for quantitative analysis. The content of pentapeptide-48 in the sample was calculated by comparing it with the peak area corresponding to a known concentration in an established standard curve. The results showed that the number of pentapeptide-48 encapsulated molecules was approximately 7.17 × 10⁶ molecules / vesicle, indicating that a high-purity OsEV formulation encapsulated with pentapeptide-48 has been obtained.

[0136] Figure 14(b) shows the results for a 2.0% concentration of pentapeptide-48, confirmed by a nanoparticle size analyzer (NTA). The reconstituted exosome lyophilized powder from Example 1 exhibits high purity, with an average particle size of 112.5 ± 1.2 nm and a Zeta potential of approximately -17 mV. When pentapeptide-48 was successfully encapsulated in OsEVs, its average particle size increased to 128 ± 7.0 nm, an increase of approximately 14%. This particle size change is presumably related to the embedding of peptide molecules into the exosome structure. The results for other pentapeptide-48 concentrations are similar. As shown in Figure 14(c), transmission electron microscopy (TEM) reveals that the exosomes encapsulated with pentapeptide-48 also exhibit a typical bilayered vesicle structure with a saucer-like morphology and a particle size between 80 and 130 nm.

[0137] (2) Intracellular delivery efficiency of pentapeptide-48 encapsulated in rice callus exosomes

[0138] To verify the intracellular delivery efficiency of rice callus exosomes coated with pentapeptide-48, this embodiment uses fluorescein-labeled pentapeptide (Pentapeptide-48-FITC) and encapsulates it in rice callus exosomes to treat HaCaT cells. The preparation method of fluorescein-labeled pentapeptide-48 exosomes is described in (1) of this embodiment.

[0139] HaCaT cells were seeded at a density of 5 × 10³ cells per well in 6-well culture dishes and cultured at 37 °C in a 5% CO₂ incubator for 24 hours. After culture, the cells were subjected to the following treatments:

[0140] 1) Fluorescently labeled pentapeptide-48 (FITC), final concentration 20 μg / mL;

[0141] 2) Rice callus exosomes (OsEVs), concentration 1 × 10¹⁰ particles / mL;

[0142] 3) Rice callus exosomes coated with pentapeptide-48 (OsEVs+Pentapeptide-48-FITC) had a concentration of 1 × 10¹⁰ particles / mL and contained 20 μg / mL of fluorescently labeled pentapeptide-48.

[0143] The treatment time for all three cell treatment methods was 24 hours. After treatment, the culture medium was removed, and the cells were washed twice with phosphate-buffered saline (PBS). Fluorescence images were captured using a fluorescence microscope, and the average fluorescence intensity was quantitatively analyzed using ImageJ software. The results, shown in Figure 15, indicate that compared to the pentapeptide-48 group alone, Pentapeptide-48-FITC encapsulated in rice callus exosomes exhibited the highest intracellular fluorescence intensity, demonstrating that this carrier system effectively improves the intracellular delivery efficiency of peptides. This evidence suggests that rice callus exosomes possess the potential to be natural nanoscale peptide carriers.

[0144] (3) Exosomes of rice callus encapsulating pentapeptide-48 can effectively enhance the skin's anti-aging and barrier protection functions.

[0145] To further verify the regulatory effect of rice callus exosome-encapsulated pentapeptide-48 on skin-related functional genes, this study used human skin fibroblasts (HSF) to analyze the expression of genes related to aging and skin barrier protection. Three genes related to extracellular matrix (ECM) regeneration were detected, including matrix metalloproteinase-3 (MMP-3), tissue inhibitor of matrix metalloproteinases-1 (TIMP-1), and hyaluronidase-1 (Hyal-1), as well as one gene related to skin barrier function, transglutaminase-1 (TGM-1).

[0146] The specific procedures were as follows: Human skin fibroblasts (HSF) were seeded in 6-well cell culture dishes and incubated at 37°C for 24 hours in an incubator containing 5% CO2 to promote cell attachment. After attachment, the cells were treated for 24 hours with the following reagents: 1) Phosphate-buffered saline (PBS) as the control group; 2) Pentapeptide-48 at a final concentration of 20 μg / mL; 3) OsEVs-coated pentapeptide-48 combined treatment group, which contained 1 × 10¹⁰ particles / mL of OsEVs coated with 20 μg / mL of pentapeptide-48. After treatment, the culture medium was removed, and the cells were washed twice with PBS. Subsequently, total RNA was extracted according to the TRIzol reagent instructions, and the obtained RNA was reverse transcribed using a reverse transcriptase kit to generate complementary DNA (cDNA). Real-time quantitative polymerase chain reaction (RT-qPCR) was used to assess the expression of extracellular matrix (ECM)-related genes, including matrix metalloproteinase-3 (MMP-3), tissue inhibitor of metalloproteinases-1 (TIMP-1), hyaluronidase-1 (Hyaluronidase-1), and transglutaminase-1 (TGM-1). Table 1 lists all primer sequences, and Table 2 shows the PCR reaction system composition. Gene expression levels were calculated using the ΔCt method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal reference gene. All experimental data were statistically analyzed using one-way ANOVA, and results are expressed as mean ± standard deviation (mean ± SD). Statistical significance is indicated by p-values, where p < 0.05 is marked as *, p < 0.01 as **, and p < 0.001 as ***. Quantitative image analysis was performed using ImageJ software, while statistical analysis and data presentation were completed using GraphPad Prism 8.0 software.

[0147] Table 1 Primer Sequences Gene Primer name sequence TIMP 1 h-TIMP 1-F CAGGGCCAAGAGCTGTAAGA(SEQ ID NO.1) h-TIMP 1-R GGTGGTCCAGGTAGACATCC(SEQ ID NO.2) MMP-3 h-MMP3-F ACATGGAGACTTTGTCCCTTTG(SEQ ID NO.3) h-MMP3-R GTCACCTCCAGCCGTCAAT(SEQ ID NO.4) Hyal 1 h-Hyal 1-F CAGCTGGACCTCAAGGTCTA(SEQ ID NO.5) h-Hyal 1-R GGCATCCAGGTAGGTGTTGT(SEQ ID NO.6) TGM1 h-TGM1-F GACTGGGCTTCAGCAACTTC(SEQ ID NO.7) h-TGM1-R TCCTTGTCCTGGTTCTGGTT(SEQ ID NO.8) Table 2 Composition of PCR reaction system Name Volume (total 20 μl) forward primer 1μl reverse primer 1μl cDNA template 1μl Ultrapure water 7μl 2× qPCR Master Mix 10μl

[0148] Amplification reaction conditions: 95.0℃ for 30s; 95.0℃ for 5s, 60.0℃ for 30s, 40 cycles; 65.0℃ for 5s; 95.0℃ for 5s.

[0149] The amplification results are shown in Figure 16. Compared with pentapeptide-48 alone, pentapeptide-48 encapsulated in rice callus exosomes significantly regulated the expression of genes related to extracellular matrix regeneration and skin barrier function. Specifically, MMP-3 and Hyal-1 decreased by approximately 10.4% and 8.6%, respectively, while TIMP-1 and TGM-1 increased by approximately 18.9% and 7.0%, respectively. MMP-3, TIMP-1, and Hyal-1 are mainly involved in the extracellular matrix regeneration process, while TGM-1 is a key enzyme in maintaining skin barrier integrity. These results confirm that pentapeptide-48 delivery via rice callus exosomes can enhance its anti-aging and skin barrier support effects at the molecular level, demonstrating the potential of rice callus exosomes as a natural and highly effective nanocarrier for active substances. This research indicates that pentapeptide-48 encapsulated in rice callus exosomes has the potential for developing innovative and effective cosmetic applications.

[0150] (4) Particle size analysis of other active ingredients encapsulated in exosomes obtained in Example 1

[0151] In current reports on the engineered encapsulation of exosomes or vesicles (see references [1]-[3]), particle size analysis (NTA) can be used to quickly assess whether active ingredients are encapsulated in exosomes or vesicles, and the average particle size of exosomes or vesicles containing encapsulated ingredients will increase. To evaluate the application potential of engineered encapsulation of exosomes derived from rice tissue culture, this experiment further tested the encapsulation results of common active ingredients: ergothioneine, collagen, and arbutin.

[0152] References: [1] A doxorubicin delivery platform using engineered natural membrane vesicle exosomes for targeted tumor therapy (Tian, ​​Y. et al. (2014). NTA showed that the average particle size of unencapsulated Exo was 100 nm; after encapsulation with Dox, the average particle size of Exo-Dox increased to 150 nm. [2] Mesenchymal Stem Cell Derived Exosomes as Nanodrug Carrier of Doxorubicin for Targeted Osteosarcoma Therapy via SDF1-CXCR4 Axis. (Wei, Y. et al. (2022). NTA showed that the average particle size of uncoated Exosomes was 140 nm; after coating with Dox, the average particle size of Exo-Dox increased to 178 nm. [3] Han R. et al., Folic acid-modified ginger-derived extracellular vesicles for targeted treatment of rheumatoid arthritis, J. Nanobiotechnol. 23, 41 (2025). The peak size of the original GDEVs was 241 nm, and the peak size of FA-GDEVs increased to 268 nm after FA modification.

[0153] The specific procedure is as follows: Ergothioneine, collagen, and arbutin were dissolved in ice-cold 15 mM sodium citrate buffer (pH 6.0–6.5) at proportions of 1–8% (1%, 2%, 4%, 8%), 0.1–2% (0.1%, 0.5%, 1.0%, 2.0%), and 1–8% (1%, 2%, 4%, 8%) (w / v). After complete dissolution, rice callus exosome lyophilized powder reconstituted at a concentration of 50 mg / mL was added to achieve a final exosome concentration of approximately 1 × 10¹⁰–1 × 10¹¹ particles / mL. The mixture was then thoroughly mixed to obtain a uniformly dispersed composite solution. The solution was then ultrasonically treated at 4–8°C for 5 minutes, followed by incubation at 4°C for 30 minutes to promote peptide entry into exosome vesicles. After the coating process, uncoated free peptides were removed by ultrafiltration to obtain a high-purity OsEVs formulation coated with ergothioneine, collagen, and arbutin. NTA analysis of the nanovesicle particle size was performed, and the results are shown in Figure 17. The figure shows the results for 2% ergothioneine, 1.0% collagen, and 2% arbutin. The particle size of exosomes coated with the active ingredients increased, while the results for other contents were similar. Therefore, it can be preliminarily inferred that exosomes derived from rice tissue culture can encapsulate multiple active ingredients and have potential for engineered encapsulation applications.

[0154] Furthermore, the present invention has now entered the pilot-scale preparation stage for the preparation of various exosome stock solutions and freeze-dried powders. It is planned to use the existing 250-liter fermentation tank to carry out large-scale fermentation production, and combine it with an industrial-grade centrifuge system and hollow fiber membrane modules with a filtration area of ​​490–790 square centimeters for the purification and concentration of rice-derived exosomes.

[0155] The above embodiments are only used to illustrate the technical solutions of this application and are not intended to limit it. Although this application has been described in detail with reference to the above preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions to the technical solutions of this application should not depart from the spirit and scope of the technical solutions of this application.

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

Claims

1. A method for extracting natural exosomes derived from rice stem cells, comprising the following steps: Step 1, obtaining rice callus tissue; Step 2, sequentially subjecting the rice callus tissue obtained in Step 1 to suspension culture and then to bioreactor scale-up culture; Step 3, extracting the rice callus tissue culture obtained in Step 2 to obtain cell slurry; Step 4, subjecting the cell slurry obtained in Step 3 to staged centrifugation, obtaining supernatant, and then ultrafiltration to obtain exosome stock solution; wherein, Step 2 includes: inoculating the rice callus tissue obtained in Step 1 into liquid culture medium and culturing it in suspension at 110-130 rpm, 25-28℃ in the dark, or 10-100 μmol photons·m⁻²·s⁻¹ for 14-30 days; after suspension culture, the callus tissue is inoculated into a bioreactor and liquid culture medium is added, and culturing it in suspension at an atmospheric air intake rate of 0.25-0.5 VVM, 25-28℃ in the dark, or 10-100 μmol photons·m⁻²·s⁻¹ for 7-14 days; Step 3 includes: grinding and crushing the rice callus tissue culture obtained in Step 2 with water, coarsely filtering it with nylon filter cloth, and retaining the filtrate; passing the filtrate through 100-mesh, 200-mesh, and 400-mesh sieves in sequence, and retaining the filtrate, which is the cell sap; Step 4 includes: the obtained cell slurry is first centrifuged at 2000g~4000g for 20~40 minutes, then centrifuged at 5000g~7000g for 20~40 minutes, and finally centrifuged at 12000g~18000g for 50~70 minutes; the supernatant is sequentially filtered through filter membranes with pore sizes of 0.45, 0.22, and 0.1 μm; the supernatant is then sequentially introduced into a hollow fiber membrane column with a specification of 1000-500 kD and a hollow fiber membrane column with a specification of 100-50 kD for ultrafiltration to obtain exosome stock solution.

2. The extraction method as described in claim 1, wherein step 1 includes: Rice seeds were dehulled and embryos were retained. Rice callus tissue was obtained by induction culture with 2,4-dichlorophenoxyacetic acid.

3. The extraction method as described in claim 2, wherein the 2,4-dichlorophenoxyacetic acid is added in the following manner: under aseptic conditions, the embryo is inoculated into MS medium containing 1-3 mg / L 2,4-dichlorophenoxyacetic acid and 25-30 g / L sucrose; the induction culture conditions include: culture at 25±2°C in the dark for 1-2 weeks.

4. The extraction method as described in claim 1, wherein in step 2, the inoculum solid-liquid ratio for suspension culture and bioreactor scale-up culture is 1:50~100.

5. The extraction method as described in claim 1, wherein in step 2, the liquid culture medium comprises, according to the final concentration: 2,4-D, 1.5–2.5 mg / L; sucrose, 25–35 g / L; The basal medium was MS liquid medium; the pH was adjusted to 5.7-5.

8.

6. A natural exosome obtained by the extraction method according to any one of claims 1 to 5.

7. The natural exosomes as described in claim 6, wherein the natural exosomes have a bilayer membrane spherical structure and a particle size range of 20 to 1000 nm.

8. The natural exosomes as described in claim 7, wherein the particle size range of the natural exosomes is 30 to 500 nm.

9. The natural exosomes as claimed in any one of claims 6 to 8, wherein the rice is non-GMO rice.

10. A method for preparing a freeze-dried powder of natural exosomes derived from rice stem cells, wherein the exosome stock solution obtained by the extraction method described in any one of claims 1 to 4 is mixed with mannitol and water and then freeze-dried.

11. The preparation method as described in claim 10, wherein the mass percentages of exosome stock solution, mannitol, and water are 60-80%, 3-5%, and 24-28%, respectively; and / or, the control parameters for freeze-drying are as follows: pre-freezing the exosome stock solution at -20±1℃ for 550-650 min; then drying sequentially at -20±1℃ for 150-250 min, at -15±1℃ for 250-350 min, and at 0±1℃ for 250-350 min; finally drying sequentially at 10±1℃ for 250-350 min, at 25±1℃ for 150-250 min, and at 36±1℃ for 200-280 min.

12. A lyophilized exosome powder obtained by the preparation method described in claim 10 or 11.

13. A delivery carrier encapsulating an active ingredient, comprising: The natural exosomes described in any one of claims 6 to 9, or the lyophilized exosome powder described in claim 12.

14. A skincare composition comprising: The natural exosomes described in any one of claims 6 to 9, or the lyophilized exosome powder described in claim 12, or the delivery vector described in claim 13.