Black apple extracts for preparing a composition for improving skin condition

Abstract

One use of black diamond apple extract for preparing a skin conditioning composition, wherein the black diamond apple extract is obtained by extracting the fruit of apple Malus pumila using water as a solvent.

Description

Technical field

[0001] The present invention relates to a black diamond apple extract, and in particular to the use of the black diamond apple extract in preparing a composition for improving skin condition. [Prior Art] The Black Diamond apple originated in Nyingchi, Tibet, at an altitude of 3,100 meters. High levels of UV radiation during the day and the large temperature swings between day and night have led to variations in the apple's appearance to adapt to the region's extreme climate. The Black Diamond apple's unique coloration has evolved in response to these dramatic changes in the external environment. [Summary of the invention] The outer surface of the Black Diamond apple variant changes from red to purple-black, and its active ingredients also change. In light of this, and to explore more diverse applications for Black Diamond apples, a method for preparing a skin conditioning composition using a Black Diamond apple extract is proposed.

[0004] In some embodiments, the present invention provides a use of a black diamond apple extract for preparing a skin conditioning composition. The black diamond apple extract is obtained by water extraction of the whole fruit of the apple plant Malus pumila.

[0005] In some embodiments, black diamond apple extract is used to promote mitochondrial activity in skin cells.

[0006] In some embodiments, black diamond apple extract is used to promote skin fibroblast proliferation.

[0007] In some embodiments, black diamond apple extract is used to promote skin wound healing.

[0008] In some embodiments, black diamond apple extract is used to promote the increase of skin collagen content.

[0009] In some embodiments, black diamond apple extract is used to promote the increase of skin elastin content.

[0010] In some embodiments, black diamond apple extract is used to promote the increase of hyaluronic acid content in the skin.

[0011] In some embodiments, black diamond apple extract is used to reduce the amount of skin wrinkles.

[0012] In some embodiments, black diamond apple extract is used to increase skin moisture content.

[0013] In some embodiments, the black diamond apple extract is a food composition, and the food composition contains at least 3 grams of black diamond apple extract per day. In summary, the black diamond apple extract of any embodiment can be used to prepare a composition for conditioning skin. In some embodiments, the black diamond apple extract can have at least one of the following effects: promoting mitochondrial activity in skin cells, promoting proliferation of skin fibroblasts, promoting skin wound healing, increasing skin collagen content, increasing skin elastin content, increasing skin hyaluronic acid content, reducing skin wrinkles, and increasing skin hydration. [Implementation Method]

[0016] As used herein, "Black Diamond Apple" refers to the fruit of an apple plant grown at an altitude of 3,000 meters. The fruit has a distinct dark purple to black appearance. The scientific name of the apple plant is Malus pumila.

[0017] In some embodiments, the fruit is a whole fruit. In some embodiments, the whole fruit includes the peel, flesh, core (ovary wall) and seeds. In some embodiments, the Black Diamond apples used to extract the Black Diamond apple extract can be fresh Black Diamond apples, dried Black Diamond apples, or frozen Black Diamond apples. In some embodiments, the drying can be air-dried, sun-dried, shade-dried, or freeze-dried.

[0019] In some embodiments, the black diamond apples used to extract the black diamond apple extract may be whole black diamond apples, or black diamond apples that have been subjected to physical processing procedures such as chopping, dicing, slicing, grinding, grinding, or other methods that change the size and physical integrity of the raw material.

[0020] In some embodiments, the black diamond apple extract is obtained by a water extraction step. The water extraction step uses water as a solvent and extracts at a specific temperature for a specific time to obtain the black diamond apple extract. In some embodiments, the specific temperature is between 90°C and 80°C. In one embodiment, the specific temperature is 85±5°C. In one embodiment, the specific temperature is 85°C. In some embodiments, the specific time is between 60 minutes and 80 minutes. In some embodiments, the specific time is 60 minutes. In some embodiments, during the water extraction step, the weight ratio of water to black diamond apples is 15:5:1. For example, the weight ratio of water to black diamond apples is 10:1. However, if the amount of solvent is too low or the extraction time is too short, the extraction efficiency will be significantly reduced. If the extraction time is too long, the active ingredients in the extract may be degraded. In some embodiments, the black diamond apple extract is obtained by water extraction and filtration. The filtration step involves filtering the black diamond apple extract after the water extraction step through a sieve or centrifuge to remove solids from the black diamond apple extract. For example, the black diamond apple extract is filtered through a 400 mesh sieve to obtain the black diamond apple extract. In some embodiments, the black diamond apple extract is obtained by water extraction, filtration, and concentration. The concentration step refers to the step of removing excess water from the black diamond apple extract after the water extraction step or the water extraction and filtration steps, thereby reducing the storage volume of the black diamond apple extract. For example, a concentrator (brand / model: BUCHI – Rotavapor R-100) can be used to perform vacuum concentration at 60°C until the solution has a Brix value of 10±0.5, and then stop the concentration to obtain the black diamond apple extract. In other embodiments, vacuum concentration can be performed at 50-82°C. In some embodiments, a black diamond apple extract is prepared by water extraction, filtration, concentration, and adjustment. The adjustment step comprises adding malic acid to adjust the pH of the black diamond apple extract to 2.7 ± 1.0. In some embodiments, the malic acid is DL-malic acid (hydroxysuccinic acid).

[0025] In some embodiments, the effective dosage of Black Diamond Apple extract is 3 grams per day. In some embodiments, the present invention provides a use of a black diamond apple extract for preparing a composition for regulating skin condition. Herein, regulating skin condition refers to at least one of promoting mitochondrial activity in skin cells, promoting proliferation of skin fibroblasts, promoting wound healing, increasing skin collagen content, increasing skin elastin content, increasing skin hyaluronic acid content, reducing skin wrinkles, and increasing skin moisture content. In some embodiments, black diamond apple extract is used to promote mitochondrial activity in skin cells. Here, JC-1 aggregation capacity is used as an indicator of mitochondrial activity. In healthy mitochondria with normal membrane potential, JC-1 exists as a polymer. When the mitochondrial membrane potential decreases, JC-1 becomes a monomer, which can be used as an indicator for assessing mitochondrial activity. Mitochondria are the energy production factories of cells. Mitochondrial activity can decrease due to external environmental damage. For example, long-term exposure to UV light can cause mitochondrial DNA mutations, reducing its activity. Promoting mitochondrial activity can increase cell metabolism and growth rates, thereby repairing the skin. In some embodiments, black diamond apple extract is used to promote the proliferation of skin fibroblasts. The proliferation of skin fibroblasts helps maintain epidermal thickness and UV barrier function, replenishes the composition of the skin's extracellular matrix, and maintains dermal renewal. In some embodiments, black diamond apple extract is used to reduce the amount of skin wrinkles. The amount of skin wrinkles is measured by capturing high-resolution skin images using visible light (white light) and analyzing and calculating the length and depth of the wrinkles using software. In some embodiments, black diamond apple extract is used to increase skin hydration. Here, the skin hydration is measured based on the principle of capacitance. As the moisture content changes, the capacitance of the skin also changes. Therefore, by measuring the skin capacitance, the moisture content of the skin surface can be analyzed. In some embodiments, black diamond apple extract is used to promote an increase in skin elastin content. In some embodiments, black diamond apple extract increases elastin content by promoting the expression of genes associated with elastin synthesis. In some embodiments, genes associated with elastin synthesis include the elastin (ELN) gene and the human fibroblast fibrillin-1 (FBN1) gene. The ELN gene is the gene for elastin (elastin). Elastin (ELN protein) binds to elastin. Therefore, by observing the expression of the ELN gene, we can measure the amount of protein in the skin. Furthermore, when the protein content increases, it helps improve skin elasticity. FBN1 is a glycoprotein present in the extracellular matrix that forms microfilaments, which contribute to the elasticity of connective tissue. When FBN1 protein expression decreases in the dermis, it affects the number of microfilaments in the dermis. Furthermore, because microfilaments provide tracks for the assembly of elastic fibers, a decrease in FBN1 protein levels can affect the assembly and synthesis of elastic fibers, thereby affecting skin elasticity.

[0034] In some embodiments, black diamond apple extract is used to increase the content of hyaluronic acid. In some embodiments, black diamond apple extract achieves the effect of improving skin moisturizing by increasing the expression of genes related to hyaluronic acid synthesis. In some embodiments, the gene related to hyaluronic acid synthesis may be the hyaluronan synthase (HAS) gene. Among them, the hyaluronan synthase gene includes the hyaluronan synthase 2 (HAS2) gene, the hyaluronan synthase 3 (HAS3) gene, or a combination thereof. Hereinafter referred to as the HAS2 gene and the HAS3 gene. Hyaluronic acid may also be referred to as hyaluronic acid. In some embodiments, black diamond apple extract is used to improve the moisturizing feel of the skin. In some embodiments, the aforementioned composition can be a health product or health food. In some embodiments, the aforementioned composition is a health product or health food for non-medical purposes. In other words, the health product or health food comprises an effective amount of Black Diamond Apple extract. In some embodiments, the aforementioned health care composition can be manufactured into a dosage form suitable for enteral or oral administration using techniques well known to those skilled in the art. Such dosage forms include, but are not limited to, tablets, troches, lozenges, pills, capsules, dispersible powders or granules, solutions, suspensions, emulsions, syrups, elixirs, slurries, and the like. In some embodiments, the aforementioned health care composition can be manufactured into a dosage form suitable for parenteral or topical administration using techniques well known to those skilled in the art. Such dosage forms include, but are not limited to, injections, sterile powders, external preparations, and the like. In some embodiments, the health care composition can be administered parenterally via a route selected from the group consisting of subcutaneous injection, intraepidermal injection, intradermal injection, and intralesional injection. In some embodiments, the health care composition may further include a pharmaceutically acceptable carrier widely used in food manufacturing technology. For example, the pharmaceutically acceptable carrier may include one or more of the following agents: solvent, buffer, emulsifier, suspending agent, decomposer, disintegrating agent, dispersing agent, binding agent, excipient, stabilizing agent, chelating agent, diluent, gelling agent, preservative, wetting agent, lubricant, absorption delaying agent, liposome, and the like. The selection and amount of these agents are within the professional knowledge and routine skills of those skilled in the art.

[0039] In some embodiments, the food-acceptable carrier comprises a solvent selected from the group consisting of: water, normal saline, phosphate buffered saline (PBS), and an aqueous solution containing alcohol. In some embodiments, the aforementioned health care composition may be an edible composition. In some embodiments, the edible composition may be prepared as a food product or a food additive, meaning that the edible composition is added to food ingredients during food preparation using conventional methods or during the production process of the food product. In this context, the food product may be a product formulated with edible materials for human or animal consumption.

[0041] In some embodiments, the food product may be, but is not limited to, beverages, fermented foods, bakery products, health foods, and dietary supplements.

[0042] Example 1: Preparation of Black Diamond Apple Extract

[0043] First, the whole fruit of sliced ​​and air-dried Black Diamond apples produced in China is used as raw material. The whole fruit includes peel, flesh, core (ovary wall) and seeds. Next, a water extraction step is performed. Water is heated to 85±5°C (the specified temperature) and then the black diamond apple raw material is added. The black diamond apple raw material and water are mixed in a weight ratio of 1:10. This means that the black diamond apples and water are mixed and extracted at 85±5°C for 60 minutes (the specified time) to obtain a primary extract.

[0045] Subsequently, a filtration step is performed. After the primary extract is cooled to room temperature, the primary extract is sieved through a 400-mesh sieve and the filtrate is taken.

[0046] After that, a concentration step is performed. The filtrate is taken and concentrated under reduced pressure using a concentrator (brand / model: BUCHI – Rotavapor R-100) at a set temperature of 60±5°C until the Brix value of the solution is 10±0.5, and then the concentration is stopped to obtain a concentrated solution.

[0047] Finally, an adjustment step is performed. The concentrated solution is taken and an appropriate amount of DL-malic acid is added to adjust the pH to 2.7 to obtain the black diamond apple extract.

[0048] Example 2: Black Diamond Apple Extract Promotes Skin Fibroblast Proliferation Test

[0049] In this example, flow cytometry was used to evaluate the changes in mitochondrial activity of human skin fibroblasts CCD-966sk after treatment with black diamond apple extract.

[0050] The materials and instruments used are as follows:

[0051] Cell line: Human skin fibroblast CCD-966sk (hereinafter referred to as skin fibroblast, deposit number BCRC 60153).

[0052] Cell culture medium: Minimum essential medium (MEM medium) (purchased from Gibco, product number 11095080) was supplemented with 10 vol% fetal bovine serum (hereinafter referred to as FBS) (purchased from Gibco, product number 10437-028), 1% penicillin-streptomycin (purchased from Gibco, product number 15140122), 1 mM sodium pyruvate (purchased from Gibco, product number 11360-070), 1.5 g / L sodium bicarbonate (purchased from Sigma, product number S5761-500G) and 0.1 mM non-essential amino acid solution (purchased from Gibco, product number 11140050).

[0053] Phosphate buffered saline (PBS solution): purchased from Gibco.

[0054] Mitochondrial membrane potential detection kit (BDTM MitoScreen (JC-1) kit, model 551302). The mitochondrial membrane potential detection kit contains JC-1 dye (lyophilized) and 10X assay buffer. Before use, dilute the 10X assay buffer 10-fold with 1X PBS to form a 1X assay buffer. Add 130 μL of DMSO to the JC-1 dye (lyophilized) to form a JC-1 stock solution. Then, dilute the JC-1 stock solution with 1X assay buffer to form a JC-1 working solution (i.e., JC-1 mitochondrial-specific dye). The dilution ratio is 1:100 for the JC-1 stock solution to the 1X assay buffer.

[0055] Trypsin: 10X Trypsin-EDTA (purchased from Gibco, product number 15400-054).

[0056] Flow cytometer: purchased from BD Accuri.

[0057] CO2 incubator: purchased from ASTEC, product number SCA-165DS.

[0058] Test process: The test will be divided into two groups: an experimental group and a blank group (a group without black diamond apple extract). Each group will undergo two replicates:

[0060] Skin fibroblasts were seeded at 1×10 5 cells per well in a 6-well culture plate containing 2 mL of cell culture medium per well and cultured in a CO 2 incubator (environment containing 5% CO 2 and temperature of 37°C) for 24 hours to allow cells to attach. Next, the culture medium in each well of the culture plate was replaced with 2 mL of experimental culture medium. The experimental culture medium for the experimental group consisted of a cell culture medium containing 1 mg / mL of the Black Diamond apple extract prepared in Example 1, while the experimental culture medium for the blank group consisted of a simple cell culture medium (i.e., without the Black Diamond apple extract).

[0062] Place the culture plate in a CO2 incubator for 24 hours (the environment contains 5% CO2 and the temperature is 37°C).

[0063] Remove the experimental culture medium from the culture plate and rinse twice with 1 mL of 1X PBS solution. 200 μL of trypsin was added to each well and allowed to react in the dark for 5 minutes. After the reaction, cell culture medium was added to terminate the reaction. The skin fibroblasts and cell culture medium from each well were collected into corresponding 1.5 mL centrifuge tubes and centrifuged at 400 x g for 5 minutes.

[0065] After centrifugation, remove the supernatant, rinse once with 1X PBS solution, and then centrifuge at 400 xg for 5 minutes.

[0066] After centrifugation, remove the supernatant from each centrifuge tube and add 100 μL of JC-1 working reagent to each centrifuge tube and mix thoroughly, then let it stand in the dark for 15 minutes.

[0067] After 15 minutes, each centrifuge tube was centrifuged at 400 xg for 5 minutes.

[0068] After centrifugation, remove the supernatant from each centrifuge tube, dissolve the cell pellet in each test tube with 1 mL of 1X PBS solution, and centrifuge at 400 xg for 5 minutes.

[0069] After centrifugation, remove the supernatant from each centrifuge tube, redissolve the cell pellet in each centrifuge tube with 1 mL of 1X PBS solution, and centrifuge at 400 xg for 5 minutes.

[0070] After centrifugation, remove the supernatant from each centrifuge tube and resuspend the cells with 500 μL of 1X PBS supplemented with 2% FBS to obtain the cell fluid to be tested. Mitochondrial activity analysis was performed by measuring the membrane potential of mitochondria in the dermal fibroblast fluid from each well using a flow cytometer (excitation light: 488 nm; scattered light: 527 nm & 590 nm). Because the experiment was repeated in duplicate, the results of the duplicate experiments were averaged to obtain the mean value. The mean value of the experimental group was then converted to the relative JC-1 aggregation value, with the mean value of the blank group as 100%, as shown in Figure 1. Statistically significant differences between the measurement results of the blank group and the experimental group were determined using the Student t-test. (In the figures, "*" indicates a p-value less than 0.05 compared to the blank group, "**" indicates a p-value less than 0.01 compared to the blank group, and "***" indicates a p-value less than 0.001 compared to the blank group. The more "*" there are, the more statistically significant the difference is.)

[0073] Refer to Figure 1, which is a bar graph comparing the relative amounts of JC-1 aggregation in the experimental group treated with Black Diamond Apple extract and the untreated blank group. It can be seen that the skin fibroblasts in the blank group were not treated in any way, meaning that their mitochondrial activity was set at 100% under normal physiological metabolic conditions. Compared to the blank group, the relative JC-1 aggregation in the experimental group was approximately 176.05%. In other words, compared to the blank group, the mitochondrial activity of the skin fibroblasts in the experimental group increased by 76.05%. This indicates that Black Diamond Apple extract can increase the mitochondrial activity of skin fibroblasts, thereby achieving the effect of increasing skin fibroblast activity.

[0074] Example 3: Black Diamond Apple Extract Promotes Skin Fibroblast Proliferation Test

[0075] In this example, an ELISA reader was used to evaluate the changes in the cell number of human skin fibroblasts CCD-966sk after treatment with black diamond apple extract.

[0076] The materials and instruments used are as follows:

[0077] Cell line: human fibroblast cells (CCD-996SK) (hereinafter referred to as skin fibroblasts, deposit number BCRC 60153).

[0078] Cell culture medium: Minimum essential medium (MEM medium) (purchased from Gibco, product number 11095080) was supplemented with 10 vol% fetal bovine serum (hereinafter referred to as FBS) (purchased from Gibco, product number 10437-028), 1% penicillin-streptomycin (purchased from Gibco, product number 15140122), 1 mM sodium pyruvate (purchased from Gibco, product number 11360-070), 1.5 g / L sodium bicarbonate (purchased from Sigma, product number S5761-500G) and 0.1 mM non-essential amino acid solution (purchased from Gibco, product number 11140050).

[0079] Cell proliferation enzyme combined with immunosorbent assay related reagents (purchased from Roche, model 11647229001), including: 10µM bromide deoxyuridine reagent (Bromodeoxyuridine, hereinafter referred to as BrdU reagent), cell fixation solution (FixDenat), 1XPBS buffer, anti-BrdU-POD working solution (also known as antibody conjugate).

[0080] Test process: 3000 cells per well were plated in a 96-well plate and incubated at 37°C for 2 hours. The cells were then divided into three groups: a blank group, a positive control group, and an experimental group. 10µL of BrdU reagent and 1mg / mL of the test sample were added to each well and incubated for 24 hours to obtain the culture fluid for each group.

[0082] Among them, the blank group did not add any test sample, the experimental group was added with 1 mg / mL of the black diamond apple extract prepared in Example 1, and the positive control group was added with 10% fetal bovine serum.

[0083] After removing the supernatant from each group of culture medium, add 200µL of cell fixation solution and treat at room temperature for 30 minutes. After removing the cell fixation solution, wash once with 1X PBS. Then, add 100µL of anti-BrdU-POD working solution to each well and treat at room temperature for 90 minutes.

[0085] After removing the anti-BrdU-POD working solution, rinse thoroughly three times with 200 to 300µL of washing solution, remove the washing solution, and add 100µL of substrate solution. Treat at room temperature for 15 minutes.

[0086] Then, 25 μL of 1 M H 2 SO 4 was added to each well and treated for 10 minutes, followed by shaking on a shaker at 300 rpm for 1 minute. Finally, the absorbance of each well was read using an ELISA reader at a wavelength of 450 nm (OD450nm). After comparing and converting the absorbance values ​​and multiplying them by the dilution factor, the number of cells in the experimental group was calculated, assuming the number of cells in the blank group was 100%. The results are shown in Figure 2.

[0088] Here, the results were used to perform a student t-test using Excel software to determine whether there was a statistically significant difference between the two sample groups, as shown in Figure 2 (in the figure, "*" represents a p-value less than 0.05, "**" represents a p-value less than 0.01, and "***" represents a p-value less than 0.001. The more "*" there are, the more statistically significant the difference is).

[0089] Please refer to Figure 2. Compared to the blank group (i.e., its relative cell count is considered 100%), the relative number of skin fibroblasts in the experimental group was 225.93%. In other words, the relative number of skin fibroblasts in the experimental group was significantly more than twice that of the blank group. This shows that Black Diamond Apple extract can effectively promote the proliferation of skin fibroblasts, and skin fibroblasts secrete collagen, which further helps to improve the support and elasticity of the skin. Therefore, the expected result of normal proliferation in the positive control group can rule out any errors in the experimental operation.

[0090] Example 4: Testing of Black Diamond Apple Extract to Promote Wound Healing

[0091] Here, human dermal fibroblast monolayers were cultured and then wounded with a sharp object to measure the healing changes of the wounds after treatment with black diamond apple extract. Because traumatic injury triggers significant cell migration to repair wounds and prevent infection, a wound healing assay, a typical test for observing cell migration, was used.

[0092] The materials and instruments used are as follows:

[0093] Cell line: human skin fibroblast CCD-966sk (hereinafter referred to as skin fibroblast, deposit number BCRC 60153).

[0094] Cell culture medium: 90% minimum essential medium (Eagle) in Earle's balanced salt solution supplemented with 0.1 mM non-essential amino acid solution, 1.5 g / L sodium bicarbonate, 1 mM sodium pyruvate, and 10% fetal bovine serum (FBS) (purchased from Gibco).

[0095] Thin film cell culture dish: also known as insert cell culture dish or insert cell culture container (Culture-Insert well) (SPL®SPLInsert™).

[0096] Test process:

[0097] First, place the thin film cell culture dish into each well of a 24-well plate, then seed the skin fibroblasts into each well at a density of 1.5×10 5 cells / well. After adding cell culture medium, incubate at 37°C overnight to form a cell monolayer.

[0098] After the thin film cell culture dish was removed from each well of the 24-well plate, a cell gap of approximately the same size was observed on the cell monolayer in each well. The cell culture medium was removed and the cells were washed once with 1XPBS. After rinsing, the skin fibroblasts were divided into three groups (each group was repeated three times for the following process). Experimental culture medium was then added. Cell images were captured using a microscope (ZEISS) and a camera to observe and record the migration distance of the skin fibroblasts (i.e., the gap area at 0 hours (T0)). The cells were then cultured for an additional 6 hours at 37°C. The gap area at 0 hours (T0) was used as the initial wound area, as shown in Figure 3. This state was used as the baseline level (i.e., hour 0).

[0100] Here, the experimental culture medium for the experimental group consisted of 2 mL of cell culture medium supplemented with the Black Diamond Apple extract prepared in Example 1 (i.e., the final concentration of the Black Diamond Apple extract was 1 mg / mL). The experimental culture medium for the blank group consisted of 2 mL of simple cell culture medium (i.e., without the Black Diamond Apple extract). The experimental culture medium for the positive control group consisted of 2 mL of cell culture medium supplemented with 10% FBS (without the Black Diamond Apple extract). At the sixth hour of incubation, preliminary observations were made using a microscope to observe and record wound status images. The wound status images obtained at this time are shown in Figure 3. There was no visible difference in wound size between the 0th and 6th hours in the blank group, while the wound size in the experimental group and the positive control group was visibly reduced, indicating that experimental errors could be ruled out and continued observation was required.

[0102] After continuing to culture at 37°C for 16 hours, the wound status images were observed and recorded using a microscope. The images were analyzed using Image J software to analyze the migration area. The cell healing rate of the blank group was taken as 100% as the basis to obtain the cell healing rate of the experimental group, as shown in Figure 4.

[0103] Here, the results were used to perform a student t-test using Excel software to determine whether there was a statistically significant difference between the two sample groups, as shown in Figure 4 (in the figure, "*" represents a p-value less than 0.05, "**" represents a p-value less than 0.01, and "***" represents a p-value less than 0.001. The more "*" there are, the more statistically significant the difference is).

[0104] Please refer to Figure 4. Compared to the blank control group (i.e., its relative cell number is considered 100%), the relative dermal fibroblast healing rate in the experimental group was 148.91%. In other words, the relative dermal fibroblast proliferation in the experimental group was significantly higher than that in the blank group by 48.91%. This shows that Black Diamond Apple extract can effectively promote wound healing of dermal fibroblasts. Therefore, the expected normal healing results in the positive control group can rule out any errors in the experimental operation.

[0105] Example 5: Black Diamond Apple Extract Promotes Collagen Secretion Test

[0106] The materials and instruments used are as follows:

[0107] Cell line: Human skin fibroblast CCD-966Sk (Human skin fibroblast CCD-966Sk), obtained from the American Type Culture Collection (ATCC) with the preservation number Cat. CRL-1881, hereinafter referred to as skin fibroblasts.

[0108] Cell culture medium: Minimum essential medium (MEM, hereinafter referred to as MEM medium) (Gibco, product number 11095080) supplemented with 10% fetal bovine serum (FBS; Gibco, product number 10437-028), 1% penicillin-streptomycin (Antibiotic-Antimycotic) (Gibco, product number 15140122) and 1 mM sodium pyruvate (Gibco, product number 11360-070).

[0109] Soluble collagen detection kit (Biocolor; product number S1000).

[0110] Solvent: 1XDPBS (Gibco, product number 14200-075).

[0111] Carbon dioxide incubator (ASTEC, product number 14200-075).

[0112] Test process: First, dermal fibroblasts were seeded into a 24-well cell culture dish at a density of 2 × 10⁴ and cultured in a CO2 incubator at 37°C for 24 hours. After the fibroblasts adhered to the bottom of the dish, the dish was washed once with 1X DPBS.

[0114] Skin fibroblasts were divided into an experimental group and a blank group. 500 μL of experimental culture medium was added to each well and then cultured at 37°C for 48 hours.

[0115] The test culture medium of the experimental group was a cell culture medium containing 0.125% of the black diamond apple extract obtained in Example 1. The experimental culture medium of the blank group was a simple cell culture medium. 1 mL of each product number was collected and treated with the soluble collagen test kit to form a test solution for each group. The absorbance of each group at 555 nm was then measured using a spectrophotometer. The test results are shown in FIG5 .

[0117] The collagen secretion levels shown here are presented as relative magnifications. The standard deviation was calculated using the STDEV formula in Excel software, and a one-tailed Student t-test was used in Excel to analyze statistically significant differences. In the figure, "*" indicates a p-value less than 0.05, and "**" indicates a p-value less than 0.01. The more "*" there are, the more statistically significant the difference is.

[0118] Please refer to Figure 5. The value of the blank group is regarded as 100%. Compared with the blank group, the relative secretion of collagen in the experimental group is 468.65%, which is a statistically significant difference. It can be seen that Black Diamond Apple Extract can significantly promote the secretion of collagen by human skin fibroblasts, and significantly increase the secretion by more than four times the normal level. Therefore, it can be seen that Black Diamond Apple Extract can enable human skin cells to effectively secrete collagen, thereby improving skin condition.

[0119] Example 6: Black Diamond Apple Extract Test on Promoting Elastin Secretion

[0120] Materials and instruments:

[0121] Cell line: Human skin fibroblast CCD-966Sk (Human skin fibroblast CCD-966Sk), obtained from the American Type Culture Collection (ATCC) with the preservation number Cat. CRL-1881, hereinafter referred to as skin fibroblasts.

[0122] Cell culture medium: 90% minimum essential medium (Eagle) in Earle's balanced salt solution (BSS) supplemented with additional ingredients to contain 0.1 mM non-essential amino acid solution, 1.5 g / L sodium bicarbonate, 1 mM sodium pyruvate, and 10% fetal bovine serum (hereinafter referred to as FBS) (purchased from Gibco).

[0123] RNA extraction reagent kit, purchased from Genemark.

[0124] SuperScript® III reverse transcriptase, purchased from Invitrogene.

[0125] ABI StepOnePlusTM Real-Time PCR system, purchased from Thermo Fisher Scientific.

[0126] KAPA SYBR FAST qPCR Master Mix (2X) Kit, purchased from KAPA Biosystems, product number KK4600.

[0127] Test process:

[0128] Skin fibroblasts were seeded at a density of 1×10 5 cells per well in a 6-well culture dish containing 2 mL of culture medium per well and cultured at 37°C for 24 hours. After culture, the skin fibroblasts were divided into two groups: a blank group and an experimental group. The blank group culture medium did not contain any extract, while the experimental group culture medium contained 0.5 mg / mL of the Black Diamond Apple extract prepared in Example 1. Each group was cultured in triplicate at 37°C for 24 hours.

[0130] Remove the culture medium of the blank group and experimental group after culture and rinse with PBS.

[0131] After rinsing, the cell membrane of each group of HPEK-50 cells was broken using the cell lysis solution of the RNA extraction reagent kit to form a cell solution.

[0132] Use the RNA extraction reagent kit to extract the RNA in the cell solution of each group.

[0133] 2000 nanograms (ng) of extracted RNA was used as a template in each group, and the extracted RNA was reverse transcribed into the corresponding cDNA using SuperScript® III reverse transcriptase.

[0134] Using the ABI StepOnePlus TMReal-Time PCR system, the cDNA was subjected to quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) using the KAPA SYBR FAST qPCR Master Mix (2X) Kit and the primer combinations in Table 1. The expression levels of various target genes and their melting curves were observed in HPEK-50 cells in the blank and experimental groups. The instrument settings for the qRT-PCR were 95°C for 20 seconds, 95°C for 3 seconds, and 60°C for 30 seconds, repeated 40 times.

[0135] The relative expression level of the target gene was determined using the 2-ΔΔ Ct method. The so-called relative expression level is defined as the fold change of the RNA expression level of the target gene in the experimental group relative to the RNA expression level of the same gene in the blank group. The 2-ΔΔ Ct method uses the cycle threshold of the TBP gene as the cycle threshold (Ct) of the reference gene for the internal control, and calculates the fold change according to the following formula: ΔCt = Ct target gene in the experimental group / target gene in the blank group - Ct GAPDH ΔΔCt = ΔCt target gene in the experimental group - ΔCt fold change of target gene in the blank group = 2-ΔΔ Ct average value Table 1 Introduction Name Sequence number sequence ELN-F SEQ ID NO: 1 GCTAAGGCAGCCAAGTATGG ELN-R SEQ ID NO:2 CACCTGGGACAACTGGAATC FBN1-F SEQ ID NO:3 TTTAGCGTCCTACACGAGCC FBN1-R SEQ ID NO:4 CCATCCAGGGCAACAGTAAGC Statistically significant differences between the blank group and the experimental group were determined using the Student t-test. (In the figures, "*" indicates a p-value less than 0.05 compared to the blank group, "**" indicates a p-value less than 0.01 compared to the blank group, and "***" indicates a p-value less than 0.001 compared to the blank group. The more "*" there are, the more statistically significant the difference.)

[0138] Please refer to Figure 6 for the test results. In the blank group, skin fibroblasts were not treated in any way, meaning they were under normal physiological metabolic conditions and their gene expression was set at 1x. Compared to the blank group, the ELN gene expression in the ELN gene experimental group (Black Diamond Apple Extract) was 2.62 times higher, while the FBN1 gene expression in the FBN1 gene experimental group (Black Diamond Apple Extract) was 1.89 times higher.

[0139] From this, it can be seen that Black Diamond Apple Extract can significantly increase the expression of ELN and FBN1 genes, thereby achieving the effect of increasing the amount of elastin.

[0140] Example 7: Black Diamond Apple Extract Test on the Expression of Hyaluronic Acid-Related Genes Materials and instruments:

[0142] Human skin fibroblast CCD-966Sk (Human skin fibroblast CCD-966Sk) was obtained from the American Type Culture Collection (ATCC) with the preservation number Cat. CRL-1881, hereinafter referred to as skin fibroblasts.

[0143] Cell culture medium: 90% minimum essential medium (Eagle) in Earle's balanced salt solution (BSS) supplemented with additional ingredients to contain 0.1 mM non-essential amino acid solution, 1.5 g / L sodium bicarbonate, 1 mM sodium pyruvate, and 10% fetal bovine serum (hereinafter referred to as FBS) (purchased from Gibco).

[0144] RNA extraction reagent kit, purchased from Genemark.

[0145] SuperScript® III reverse transcriptase, purchased from Invitrogene, product number 18080-044.

[0146] ABI StepOnePlusTM Real-Time PCR system, purchased from Thermo Fisher Scientific.

[0147] KAPA SYBR FAST qPCR Master Mix (2X) Kit, purchased from KAPA Biosystems, product number KK4600.

[0148] Test process:

[0149] Skin fibroblasts were seeded at a density of 1×10 5 cells per well in a 6-well culture dish containing 2 mL of culture medium per well and cultured at 37°C for 24 hours. After incubation, HPEK-50 cells were divided into two groups: a blank group and an experimental group. The blank group culture medium did not contain any extract, while the experimental group culture medium contained 1 mg / mL of the Black Diamond apple extract prepared in Example 1. Each group was cultured in triplicate at 37°C for 24 hours.

[0151] Remove the culture medium of the blank group and experimental group after culture and rinse with PBS.

[0152] After rinsing, the cell membrane of each group of HPEK-50 cells was broken using the cell lysis solution of the RNA extraction reagent kit to form a cell solution.

[0153] Use the RNA extraction reagent kit to extract the RNA in the cell solution of each group.

[0154] 2000 nanograms (ng) of extracted RNA was used as a template in each group, and the extracted RNA was reverse transcribed into the corresponding cDNA using SuperScript® III reverse transcriptase.

[0155] Using the ABI StepOnePlus™ Real-Time PCR system, the cDNA was subjected to quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) using the KAPA SYBR FAST qPCR Master Mix (2X) Kit and the primer combinations in Table 2. The expression levels of various target genes and their melting curves were observed in HPEK-50 cells in both the control and experimental groups. The qRT-PCR instrument settings were 95°C for 20 seconds, 95°C for 3 seconds, and 60°C for 30 seconds, repeated 40 times.

[0156] The relative expression of the target gene was determined using the 2-ΔΔCt method. The relative expression is defined as the fold change in the RNA expression of the target gene in the experimental group relative to the RNA expression of the same gene in the blank group. The 2-ΔΔCt method uses the cycle threshold of the TBP gene as the cycle threshold (Ct) of the reference gene for the internal control, and calculates the fold change according to the following formula:

[0157] △Ct = Ct target gene of experimental group / Ct target gene of blank group - tGAPDH

[0158] △△Ct=△Ct target gene of experimental group - △Ct target gene of blank group

[0159] Fold change = 2-ΔΔ Ct average Table 2 Introduction Name Sequence number sequence HAS2-F SEQ ID NO:5 AAGAACAACTTCCACGAAAAGGG HAS2-R SEQ ID NO:6 GGCTGGGTCAAGCATAGTGT HAS3-F SEQ ID NO:7 CGCAGCAACTTCCATGAGG HAS3-R SEQ ID NO:8 AGTCGCACACCTGGATGTAGT Statistically significant differences between the blank group and the experimental group were determined using the Student t-test. (In the figures, "*" indicates a p-value less than 0.05 compared to the blank group, "**" indicates a p-value less than 0.01 compared to the blank group, and "***" indicates a p-value less than 0.001 compared to the blank group. The more "*" there are, the more statistically significant the difference.)

[0162] Please refer to Figure 7 for the test results. In the blank group, the skin fibroblasts were not treated in any way, meaning they were under normal physiological metabolic conditions and their gene expression was set to 1x. Compared to the blank group, the HAS2 gene expression level in the HAS2 gene experimental group (Black Diamond Apple Extract) was 4.35 times, while the HAS3 gene expression level in the HAS3 gene experimental group (Black Diamond Apple Extract) was 1.82 times.

[0163] It can be seen from this that black diamond apple extract can significantly increase the expression of HAS2 and HAS3 genes, thereby increasing the skin's hyaluronic acid content.

[0164] Example 8: Human Testing of Black Diamond Apple Extract

[0165] Subjects: 8 subjects. Each subject was an adult aged 20 or above.

[0166] Test items: skin wrinkle amount and skin moisture content.

[0167] Wrinkles: Testing was performed using a VISIA high-end digital skin analyzer sold by Canfield in the United States. A high-resolution camera was used to photograph the facial skin, particularly the area around the eyes, before and after drinking the drink. By irradiating the skin with standard white light and detecting changes in fine lines, the location of the texture was detected and a numerical value was obtained, representing the smoothness of the skin. After measurement, the wrinkle volume of the control group was used as a baseline (i.e., the relative wrinkle volume of the control group was 100%), and the relative wrinkle volume (%) of the experimental group was calculated.

[0168] Skin hydration: The facial skin of the same subjects was tested using a Corneometer® CM825 skin hydration probe (C+K Multi Probe Adapter System, Germany) purchased from Courage+Khazaka electronic. This probe measures water content based on the principle of capacitance. As the water content changes, the capacitance of the skin also changes. Therefore, measuring the skin capacitance value can be used to analyze the water content of the skin surface.

[0169] Test method:

[0170] Eight subjects consumed a drink containing 3 grams of the black diamond apple extract prepared in Example 1 daily for four consecutive weeks, with no other changes to their diet or daily routine.

[0171] The data measured before consumption (i.e., week 0) is called the blank group, and the data measured after 4 weeks of consumption (i.e., week 4) is called the experimental group.

[0172] Test results: The figures below show the mean values ​​for all subjects, with the data from week 0 considered 100%, to calculate the relative values ​​for each group. The standard deviation was calculated using the STDEV formula in Excel, and a one-tailed Student t-test was used in Excel to analyze statistically significant differences and obtain the p-values. In the figures, "*" indicates a p-value less than 0.05.

[0174] Please refer to Figure 8. After 4 weeks of daily consumption of Black Diamond Apple extract, the average skin wrinkles of the 8 experimental group subjects were reduced from 100% (blank group) at week 0 to 90.3% (experimental group).

[0175] Please refer to Figure 9. After 4 weeks of daily consumption of black diamond apple extract, the average skin moisture content of the 8 experimental group subjects increased from 100% (blank group) at week 0 to 113.4% (experimental group). In summary, the black diamond apple extract of any embodiment can be used to prepare a composition for regulating skin condition. In some embodiments, the black diamond apple extract can have at least one of the following effects: promoting mitochondrial activity in skin cells, promoting proliferation of skin fibroblasts, promoting skin wound healing, increasing skin collagen content, increasing skin elastin content, increasing skin hyaluronic acid content, reducing skin wrinkles, and increasing skin hydration.

[0177] Although the technical content of the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Any changes and modifications made by anyone skilled in the art without departing from the spirit of the present invention should be included in the scope of the present invention. Therefore, the scope of protection of the present invention shall be based on the scope of the patent application attached hereto.

Simple diagram description

[0015] Figure 1 is a graph showing the test results of a black diamond apple extract promoting mitochondrial activity according to an embodiment. Figure 2 is a graph showing the test results of a black diamond apple extract promoting skin fibroblast proliferation according to an embodiment. Figure 3 is a microphotograph showing the test results of a black diamond apple extract promoting skin wound healing according to an embodiment. Figure 4 is a graph showing the test results of a black diamond apple extract promoting skin wound healing according to an embodiment. Figure 5 is a graph showing the test results of a black diamond apple extract increasing skin collagen content according to an embodiment. Figure 6 is a graph showing the test results of a black diamond apple extract increasing skin elastin content according to an embodiment. Figure 7 is a graph showing the test results of a black diamond apple extract increasing skin hyaluronic acid content according to an embodiment. Figure 8 is a graph showing the test results of the average amount of skin wrinkles in a human body test. Figure 9 is a graph showing the test results of the average skin moisture content in a human body test.

Claims

1. The use of a black diamond apple extract for preparing a composition to enhance wound healing, wherein the black diamond apple extract is extracted from the whole fruit of the apple plant Malus pumila at a temperature of 85±5°C for 60 to 80 minutes using water as a solvent, wherein the weight ratio of water to the whole fruit is 15 to 5:

1.

2. The use as described in claim 1, wherein the black diamond apple extract promotes mitochondrial activity in skin cells.

3. The use as described in claim 1, wherein the black diamond apple extract promotes the proliferation of skin fibroblasts.

4. The use as described in claim 1, wherein the black diamond apple extract promotes an increase in skin collagen content.

5. The use as described in claim 1, wherein the black diamond apple extract promotes an increase in the content of elastin in the skin.

6. The use as described in claim 1, wherein the black diamond apple extract promotes an increase in the hyaluronic acid content of the skin.

7. The use as described in claim 1, wherein the black diamond apple extract reduces the amount of skin wrinkles.

8. The use as described in claim 1, wherein the black diamond apple extract increases skin hydration.

9. The use as claimed in any one of claims 1 to 8, wherein the composition is a food composition and the composition contains at least 3 grams of the Black Diamond Apple extract per day.

Images