Crispr-cas system for genome editing mutant dystrophin gene and use related thereto

Abstract

This article reveals the therapeutic goals and methods of correcting the human myotensin gene through gene editing.

Description

Technical Field

[0001] This invention relates to the field of gene expression alteration, genome engineering, and genome modification using systems based on Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR-related (Cas) 9 and viral delivery systems. This invention also relates to the field of genome engineering and genome modification of genes in muscle (such as skeletal muscle and cardiac muscle). Prior Technology

[0002] CRISPR / Cas9-based gene editing systems can be used to introduce site-specific double-strand breaks at target genomic loci. This DNA cleavage stimulates the natural DNA repair mechanism, resulting in one of two possible repair pathways. In the absence of a donor template, the break will be repaired by non-homologous end joining (NHEJ), an error-prone repair pathway that results in smaller DNA insertions or deletions. This method can be used to intentionally disrupt, delete, or alter the reading frame of a target gene sequence. However, if a donor template and nuclease are provided, the cellular mechanism will repair the break by homologous recombination, which is enhanced by several orders of magnitude in the presence of DNA cleavage. This method can be used to introduce specific changes in the DNA sequence at the target site. Engineered nucleases have been used for gene editing in various human stem cells and cell lines, as well as for gene editing in mouse livers. However, a major obstacle to implementing these technologies is the efficient, effective, and genome-editing-promoting in vivo delivery to specific tissues.

[0003] Inherited genetic diseases have a devastating impact on American children. These diseases are currently incurable and can only be managed by attempting to alleviate symptoms. For decades, gene therapy has offered hope for curing these diseases. However, technical hurdles regarding the safe and efficient delivery of therapeutic genes to cells and patients limit this approach. Duchenne muscular dystrophy (DMD) is a fatal genetic disease clinically characterized by muscle atrophy, loss of walking, and death typically within the third decade of life due to the loss of functional myotrophin. DMD results from inherited or spontaneous mutations in the myotrophin gene. Most mutations causing DMD result in exon deletions, causing the translation reading frame to deviate from its frame. Most DMD mutations involve the deletion of one or more of its 79 exons (approximately 68%), causing the reading frame to shift and terminating the expression of the full-length transcript. Deletions mostly occur in two "hotspots" of the gene, covering exons 2 to 20 (approximately one-third of all deletions) and exons 45 to 55 (approximately two-thirds of all deletions). Patients with Becker muscular dystrophy (BMD) who have a naturally occurring deletion in the entire 45-55 region of the myotrophin gene exhibit delayed disease onset and minimal skeletal muscle involvement.

[0004] Myoplasmin is a key component of a protein complex responsible for regulating muscle cell integrity and function. Meningoceles (DMD) patients typically lose their ability to support their bodies in childhood, gradually become frail during adolescence, and die in their twenties. Current experimental gene therapy strategies for DMD require repeated delivery of transient gene delivery tools or rely on the permanent integration of foreign genetic material into the genomic DNA. Both methods have serious safety concerns. Furthermore, these strategies are limited by the inability to deliver large and complex myoplasmin gene sequences. More precise and efficient gene-editing tools are still needed for correcting and treating patients with myoplasmin gene mutations. Summary of the Invention

[0005] In one embodiment, the present invention relates to a CRISPR-Cas system. A CRISPR-Cas system may include one or more vectors encoding compositions comprising: (a) a first guide RNA (gRNA) molecule targeting intron 44 of a myoglobin; (b) a second gRNA molecule targeting intron 55 of a myoglobin; and (c) a Cas9 protein; and (d) one or more Cas9 gRNA backbones. In some embodiments, the system comprises a single vector. In some embodiments, the system comprises two or more vectors, wherein the two or more vectors comprise a first vector and a second vector. In some embodiments, (a) the first vector encodes a first gRNA molecule and a second gRNA molecule; and (b) the second vector encodes a Cas9 protein. In some embodiments, (a) the first vector encodes a first gRNA molecule; and (b) the second vector encodes a second gRNA molecule. In some embodiments, the first vector further encodes a Cas9 protein. In some embodiments, the second vector further encodes a Cas9 protein. In some embodiments, the expression of the Cas9 protein is driven by a constitutive promoter or a muscle-specific promoter. In some embodiments, the muscle-specific promoter comprises the MHCK7 promoter, the CK8 promoter, or the Spc512 promoter. In some embodiments, a single vector encodes a first gRNA molecule, a second gRNA molecule, and a Cas9 protein. In some embodiments, the vector comprises at least one bidirectional promoter. In some embodiments, the bidirectional promoter comprises: a first promoter driving the expression of the first gRNA molecule and / or the second gRNA molecule; and a second promoter driving the expression of the Cas9 protein. In some embodiments, the first gRNA targets the polynucleotide of SEQ ID NO: 2 or its 5' truncated form. In some embodiments, the second gRNA targets the polynucleotide of SEQ ID NO: 3 or its 5' truncated form. In some embodiments, the Cas9 protein is SpCas9, SaCas9, or St1Cas9. In some embodiments, the Cas9 gRNA backbone is the SaCas9 gRNA backbone. In some embodiments, the SaCas9 gRNA backbone comprises or is encoded by the polynucleotide of SEQ ID NO: 4. In some embodiments, the Cas9 protein is the SaCas9 protein encoded by the polynucleotide of SEQ ID NO: 11. In some embodiments, the vector comprises at least one polynucleotide selected from SEQ ID NO: 1-13 and 24. In some embodiments, the vector comprises the polynucleotide sequence of SEQ ID NO: 24.In some embodiments, the vector comprises a polynucleotide sequence selected from the following: SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:29, and SEQ ID NO:30. In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13, or AAVrh.74. In some embodiments, the vector comprises a ubiquitous promoter or a tissue-specific promoter operatively linked to a polynucleotide sequence encoding a first gRNA molecule, a second gRNA molecule, and / or the Cas9 protein. In some embodiments, the tissue-specific promoter is a muscle-specific promoter.

[0006] In another embodiment, the invention relates to a cell comprising the system described herein.

[0007] Another aspect of the present invention provides a kit comprising the system described herein.

[0008] Another aspect of the present invention provides a method for correcting mutated myotensin genes in cells. This method may include administering the system described herein to the cells.

[0009] Another aspect of the present invention provides a method for mutating the myotropic protein gene in a genome-edited individual. This method may include administering to the individual a system or cell described herein. The system or cell may be administered to the individual intramuscularly, intravenously, or a combination thereof.

[0010] Another aspect of the invention provides a method for treating an individual with a mutated myotensin gene. This method may include administering to the individual the system or cells described herein. The system or cells may be administered to the individual intramuscularly, intravenously, or a combination thereof.

[0011] The present invention provides other forms and embodiments that will be apparent from the following embodiments and accompanying drawings. Simple Explanation of the Diagram

[0012] [picture] [1] Two deletion hotspots in myoglobin are shown. The myoglobin gene (which may be called DMD) is the largest known gene in humans (2.3 Mbp). Approximately 68% of mutations are large exon deletions that lead to reading frame shift errors.

[0013] [picture] [2] Details related to the mutation hotspots in exon 45 to exon 55 are shown. Approximately 45% of all DMD mutations and many commonly deleted single exons are located in this region. Patients with deletions in exon 45 to 55 show a milder malnutrition phenotype. Skipping of exons in this region has been induced using AON (antisense oligonucleotide).

[0014] [picture] [3] Demonstrates exon 45 to 55 excision of myoglobin. This system is being tested in humanized mice carrying the human gene with exon 52 deleted.

[0015] [picture] [4] Demonstrating injection to excise exons 45 to 55 of myoglobin in newborn mice. Newborn mice were given the injection systemically 2 days postpartum (P2). Muscle was collected 8 weeks post-treatment. PCR bands showed the expected deletion.

[0016] [picture] [5] Demonstrating the expression of myoglobin in mice after systemic treatment. 10x magnification, 8 weeks after injection of dual-vector P2.

[0017] [picture] [6] This demonstrates a traditional two-vector system compared to this single-vector system. The advantages of a single-vector system include: all necessary editing components on a single vector; the ability to increase effective dosage; simplified production of other vectors (single therapeutic agent); the ability to use / incorporate muscle-specific promoters (CK8, Spc512, MHCK7); and the ability to combine targeted exons with large deletions (by altering the guide sequence).

[0018] [picture] [7] Comparison of vector designs. The all-in-one vector components (total encapsulated DNA ˂4.8 kb) include: SaCas9 (approximately 3.2 kb); a miniature polyadenylation signal (60 bp) or a bGH polyadenylation signal (232 bp); and a constitutive promoter (EFS promoter (252 bp) or a muscle-specific promoter).

[0019] [picture] [8] Demonstrates the all-in-one vector for deletion of exons 45-55 and in vitro analysis of HEK293.

[0020] [picture] [9A] is a schematic diagram of the myoblast protein gene from immortalized myoblasts isolated from a DMD patient, showing the deletion of exons 48-50. [picture] [9B] Shows the results of deletion PCR of genomic DNA and cDNA from treated DMD patients, indicating that exons 45-55 were effectively deleted using vectors as detailed herein. [picture] [9C] is a Western ink dot method for cell lysates, showing that untreated myoblasts do not produce myoglobin protein, while transfected myoblasts show smaller myoglobin protein compared to the positive control, consistent with hotspot deletion.

[0021] [picture]

[10] Image of cardiomyocytes from neonatal hDMDΔ52 / mdx mice injected with AAV-CRISPR targeting a control locus (top) or targeting exons 45-55 (bottom). Cells were collected 8 weeks after injection. Cells were stained with DAPI or myoglobin. 10x magnification, scale bar = 200 µm.

[0022] [picture]

[11] is a schematic diagram of a version of the all-in-one carrier 5.

[0023] [picture]

[12] Image of TA muscle cells at 10x magnification 8 weeks after injection with the indicated carrier.

[0024] [picture]

[13] To illustrate the in vivo expression of SaCas9 and gRNA produced by qRT-PCR 8 weeks after TA sample injection, using the indicated allotropic vector. N=3-4.

[0025] [picture]

[14] A graph illustrating the stability of the all-in-one (AIO) vector in vivo. The left graph shows the results of qPCR using TA samples 8 weeks after injection. The right graph shows the results of IFNγ EISpot analysis of SaCas9. For both, N=3-4. Implementation

[0026] [] [Cross-reference to related applications] [] This application claims priority to U.S. Provisional Patent Application No. 62 / 833,760, filed April 14, 2019, which is incorporated herein by reference in its entirety. [Statement Regarding Federally Funded Research] []

[0027] This invention was carried out with government support under license number R01AR069085 granted by the National Institutes of Health. The government holds certain rights in this invention. []

[0028] As described in this article, certain methods and engineered gRNAs have been found suitable for CRISPR / CRISPR-associated (Cas) 9-based gene editing systems to alter the expression of myoglobin gene mutations involved in genetic diseases (such as DMD), to genomically engineer and correct such mutations, or to reduce their impact. The revealed gRNAs are then directed to target sites more suitable for clinical translation. For example, the gene encoding *Streptococcus pyogenes* Cas9 (SpCas9) is too large to be delivered by adeno-associated virus (AAV), a vector used for systemic gene delivery to muscle, including all other necessary regulatory sequences. Instead, the revealed gRNAs are selected and screened for use with *Staphylococcus aureus* Cas9 (SaCas9), which is approximately 1 kb smaller than SpCas9. The gRNA revealed by targeting the human myoglobin gene sequence can be used in conjunction with a CRISPR / Cas9-based system to target exons 45 to 55 of the human myoglobin gene, thereby causing genomic deletion in this region to restore the functional expression of myoglobin in cells from DMD patients.

[0029] This document also describes gene constructs, compositions, and methods for delivering CRISPR / Cas9-based gene editing systems and multiple gRNAs targeting the myotropic protein gene. The subject matter disclosed herein also provides methods for delivering gene constructs (e.g., vectors) or compositions containing them to skeletal and cardiac muscle. Vectors may be AAVs, including modified AAV vectors. The subject matter disclosed herein describes a method for delivering active forms of this class of therapeutic agents to skeletal or cardiac muscle in an effective, efficient manner that facilitates successful genome modification, and provides a means of rewriting the human genome for therapeutic applications and target model species for fundamental scientific applications. These methods relate to the use of a single AAV vector for delivering all editing components required to excise exons 45 to 55 of the myotropic protein gene.

[0030] The chapter titles used in this chapter and throughout this document are for organizational purposes only and are not intended to be restrictive. [1.] [definition] []

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, this document (including definitions) shall prevail. Although the invention may be practiced or tested using methods and materials similar to or equivalent to those described herein, preferred methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and are not intended to be limiting.

[0032] As used herein, the terms "comprise(s)", "include(s)", "having", "has", "may", "contains", and variations thereof are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional actions or structures. Unless otherwise expressly specified in the context, the singular forms "a / an" and "the" include the plural references. Whether expressly stated or not, the invention also covers other embodiments "comprising", "consisting of", and "substantially constitutes": the embodiments or elements presented herein.

[0033] The description of numerical ranges in this article explicitly includes all interpolated values ​​with the same level of precision. For example, for the range of 6-9, the values ​​7 and 8 are included in addition to 6 and 9, and for the range of 6.0-7.0, the values ​​6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly included.

[0034] As used herein, the terms "about" or "approximately" mean within an acceptable margin of error for a particular value as determined by someone generally skilled in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" may mean within three or more standard deviations, according to practice in this art. Alternatively, "about" may mean within at most 20%, preferably at most 10%, even better at most 5%, and still even better at most 1% of a given value. In some cases, unless otherwise stated or otherwise clearly apparent from the context (other than such values ​​would clearly exceed 100% of the possible values), the term "about" refers to a range of values ​​of 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction (greater than or less than) of the stated reference value. Alternatively, particularly in relation to biological systems or methods, the term may mean within an order of magnitude of a certain value, preferably within a 5-fold range and more preferably within a 2-fold range.

[0035] As used interchangeably in this article, "adeno-associated virus" or "AAV" refers to a small virus belonging to the genus Dependent Virus in the family Parvoviridae, which infects humans and some other primate species. It is currently unclear whether AAV causes disease, and therefore, the virus elicits a very mild immune response.

[0036] As used in this article, the "binding region" refers to the region within the target region of a nuclease that is recognized and bound by the nuclease.

[0037] As used interchangeably in this document, "cardiac muscle" or "heart muscle" refers to a non-voluntary striated muscle found in the walls and histological basis of the heart and myocardium. Cardiac muscle is composed of cardiomyocytes or myocardiocytes. Cardiomyocytes exhibit striations similar to those on skeletal muscle cells, but unlike multinucleated skeletal cells, cardiomyocytes contain only a single, unique nucleus. In some embodiments, "cardiomyopathic symptoms" refers to conditions related to the myocardium, such as cardiomyopathy, heart failure, arrhythmia, and inflammatory heart disease.

[0038] As used herein, "coding sequence" or "coding nucleic acid" means a nucleic acid (RNA or DNA molecule) containing a nucleotide sequence encoding a protein. The coding sequence may further include start and stop signals operatively linked to regulatory elements, including promoters and polyadenylation signals, which guide expression in the cells of the individual or mammal to which the nucleic acid is administered. The coding sequence may be codon-optimized.

[0039] As used in this article, "complement" or "complementary" means that nucleic acids can refer to Watson-Crick (e.g., AT / U and CG) or Hoogsteen base pairings between nucleotides or nucleotide analogs of nucleic acid molecules. "Complementarity" refers to a property shared between two nucleic acid sequences such that when they are aligned antiparallel to each other, the nucleotide bases at each position will be complementary.

[0040] As used herein, "correction," "genome editing," and "restoration" refer to altering mutated genes encoding truncated or nonexistent proteins to achieve full-length or partially full-length functional protein expression. Correcting or restoring mutated genes may include replacing the mutated gene region with a copy of the mutated gene that lacks repair mechanisms (such as homologous directed repair (HDR)) or replacing the entire mutated gene. Correcting or restoring mutated genes may also include repairing frame-shifting mutations that cause premature stop codons, aberrant splice acceptor sites, or aberrant splice donor sites by generating double-strand breaks in genes subsequently repaired using non-homologous end joining (NHEJ). NHEJ can add or delete at least one base pair during repair, restoring the correct reading frame and eliminating premature stop codons. Correcting or restoring mutated genes may also include disrupting aberrant splice acceptor sites or splice donor sequences. Correcting or restoring mutated genes can also involve deleting non-essential gene segments by simultaneously acting two nucleases on the same DNA strand, so as to restore the correct reading frame by removing the DNA between the target sites of the two nucleases and repairing the DNA breaks by NHEJ.

[0041] The term "bidirectional promoter" refers to two or more promoters capable of driving transcription of two independent sequences in two directions. In one embodiment, one promoter drives transcription from 5' to 3' and another promoter drives transcription from 3' to 5'. In one embodiment, a bidirectional promoter is a double-stranded transcriptional control element that can drive the expression of at least two independent sequences (e.g., coding or non-coding sequences) in opposite directions. Such promoter sequences may consist of two individual promoter sequences acting in opposite directions, such as a nucleotide sequence linked to another (complementary) nucleotide sequence, including encapsulation structures containing two promoters in opposite directions, for example by a hybrid, chimeric, or fusion sequence containing two individual promoter sequences or at least their core sequences, or by a transcriptional regulatory sequence that can initiate transcription in both directions. In some embodiments, the two individual promoter sequences may be side-by-side or the linker sequence may be located between the first and second sequences. The promoter sequence may be inverted to combine with another promoter sequence in the opposite direction. Genes located on either side of a bidirectional promoter are operatively linked to a single transcriptional control sequence or a region that drives transcription in both directions. In other embodiments, the bidirectional promoter is not side-by-side. For example, one promoter can drive transcription at the 5' end of a nucleotide fragment, and another promoter can drive transcription of the same fragment from the 3' end. In another embodiment, a first gene can be operatively linked to a bidirectional promoter with or without other regulatory elements, such as reporter or terminator elements, and a second gene can similarly be operatively linked to a bidirectional promoter in the opposite direction and by means of a complementary promoter sequence, with or without other regulatory elements.

[0042] In this article, the terms "donor DNA," "donor template," and "repair template," which are used interchangeably, refer to a double-stranded DNA fragment or molecule that includes at least a portion of the gene of interest. Donor DNA may encode a fully functional or partially functional protein.

[0043] As used interchangeably in this article, "Duchenne muscular dystrophy" or "DMD" refers to a recessive, fatal X-linked disease that causes muscle degeneration and eventual death. DMD is a common inherited single-gene disorder, affecting approximately 1 in 3,500 males. DMD results from inherited or spontaneous mutations in the myoglobin gene that cause meaningless or frameshift mutations. Most myoglobin mutations causing DMD involve deletions of exons that disrupt the reading frame and cause premature translation termination of the myoglobin gene. DMD patients typically lose the ability to support their bodies in childhood, gradually become frail during adolescence, and die in their twenties.

[0044] As used herein, "myosin" refers to a rod-shaped cytoplasmic protein, a key component of a protein complex that connects the cytoskeleton of muscle fibers to the surrounding extracellular matrix via the cell membrane. Myosin provides structural stability to the myosin-glycan complex of the cell membrane, which is responsible for regulating muscle cell integrity and function. As used interchangeably herein, the myosin gene or "DMD gene" is 2.2 megabases at locus Xp21. Primary transcription is measured at approximately 2,400 kb, of which approximately 14 kb is mature mRNA. 79 exons encode a protein with over 3,500 amino acids.

[0045] As used in this article, "exons 45 to 55" of myoglobin refers to the region located in approximately 45% of all myoglobin mutations. Deletion of exons 45-55 is associated with very mild Becker's phenotype and has even been found in asymptomatic individuals. Skipping multiple exons 45-55 would benefit approximately 50% of all DMD patients.

[0046] As used interchangeably in this article, "frame shift" or "frame shift mutation" refers to a type of gene mutation in which the addition or deletion of one or more nucleotides causes a shift in the reading frame of a codon in mRNA. Frame shifts can cause changes in the amino acid sequence during protein translation, such as missense mutations or premature stop codons.

[0047] As used in this article, "functional" or "fully functional" describes a biologically active protein. A "functional gene" is a gene transcribed into mRNA that is translated into a functional protein.

[0048] As used herein, "fusion protein" refers to a chimeric protein resulting from the combination of two or more genes originally encoded for different proteins. The translation of the fusion gene produces a single polypeptide that has functional properties derived from each of the original proteins.

[0049] As used herein, a “gene construct” refers to a DNA or RNA molecule containing a nucleotide sequence encoding a protein. The coding sequence includes start and stop signals operatively linked to regulatory elements, including promoters and polyadenylation signals capable of guiding expression in the cells of an individual to which the nucleic acid molecule is administered. As used herein, the term “expressible form” refers to a gene construct containing the necessary regulatory elements operatively linked to the coding sequence encoding a protein, such that the coding sequence will be expressed when present in the cells of an individual.

[0050] As used herein, "genetic disease" refers to a disease caused, in part or in whole, directly or indirectly, by one or more abnormalities in the genome, especially a condition present from birth. Abnormalities can be mutations, insertions, or deletions. Abnormalities can affect the coding sequence of a gene or its regulatory sequences. Genetic diseases may include, but are not limited to, DMD, Becker's muscular dystrophy (BMD), hemophilia, cystic fibrosis, Huntington's chorea, familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, congenital hepatic porphyria, hepatic metabolic disorders, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi's anemia, retinitis pigmentosa, ataxia-telangiectasia, Bloom's syndrome, retinoblastoma, and Tay-Sachs disease.

[0051] As used interchangeably in this article, "homology-directed repair" or "HDR" refers to the mechanism of repairing double-stranded DNA defects when homologous DNA segments are present in the nucleus (primarily in the G2 and S phases of the cell cycle). HDR uses a donor DNA template to guide repair and can be used to generate specific sequence changes in the genome, including targeted addition of entire genes. If a donor template and a CRISPR / Cas9-based gene editing system are provided, cellular mechanisms will repair breaks via homologous recombination, which increases by several orders of magnitude in the presence of DNA fragmentation. When homologous DNA fragments are absent, non-homologous end joining occurs instead.

[0052] As used in this article, "genome editing" refers to altering genes. Genome editing may include correcting or restoring mutated genes. Genome editing may include gene knockout (such as mutated or normal genes). Genome editing can be used to treat diseases or enhance muscle repair by altering related genes.

[0053] As used herein, in the case of two or more nucleic acid or polypeptide sequences, "identical" or "consistent" means that the sequences have a specified percentage of residues that are identical in a specified region. This percentage can be calculated as follows: First, align the two sequences. Then, compare the two sequences in the specified region. Determine the number of positions in the two sequences where the same residues appear, obtaining the number of matching positions. Divide the number of matching positions by the total number of positions in the specified region, and multiply the result by 100 to obtain the percentage of sequence consistency. In cases where the two sequences have different lengths, or where the alignment produces one or more staggered ends, and the specified comparison region includes only a single sequence, the residues of the single sequence are included in the denominator but not in the numerator. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Consistency can be performed manually or by using computer sequence algorithms such as BLAST or BLAST 2.0.

[0054] As used interchangeably in this article, "mutated gene" or "mutant gene" refers to a gene that has undergone a detectable mutation. A mutated gene has undergone changes, such as the loss, gain, or exchange of genetic material, affecting the normal transmission and expression of the gene. As used in this article, "damaged gene" refers to a mutated gene that has a mutation that causes a premature stop codon. A damaged gene product is truncated compared to the full-length, undamaged gene product.

[0055] As used herein, the "non-homologous end joining (NHEJ) pathway" refers to a pathway for repairing double-strand breaks in DNA by directly joining the broken ends without the need for a homologous template. NHEJ's template-independent rejoining of DNA ends is a stochastic, error-prone repair method that introduces random micro-insertions and micro-deletions (insertions and deletions) at the DNA break point. This method can be used to intentionally disrupt, delete, or alter the reading frame of a target gene sequence. NHEJ typically uses short homologous DNA sequences called microhomology to guide repair. These microhomologies are usually present in the single-stranded overhangs at the ends of double-strand breaks. When the overhangs are perfectly compatible, NHEJ usually repairs the break precisely, but imprecise repair resulting in nucleotide loss can also occur, but is more common when the overhangs are incompatible.

[0056] As used in this article, "normal gene" refers to a gene that has not yet undergone changes, such as the loss, gain, or exchange of genetic material. Normal genes undergo normal gene transmission and gene expression.

[0057] As used in this article, "nuclease-mediated NHEJ" refers to NHEJ that begins after a nuclease (such as the Cas9 molecule) cleaves double-stranded DNA.

[0058] As used herein, "nucleic acid," "oligonucleotide," or "polynucleotide" means at least two nucleotides covalently linked together. The description of a single strand also defines the sequence of the complementary strand. Therefore, nucleic acid also encompasses the complementary strand of the single strand described. Many variants of nucleic acids can be used for the same purpose as a given nucleic acid. Therefore, nucleic acid also encompasses substantially the same nucleic acid and its complementary sequence. Single strands provide probes that can hybridize to a target sequence under strict hybridization conditions. Therefore, nucleic acid also encompasses probes that hybridize under strict hybridization conditions.

[0059] Nucleic acids can be single-stranded or double-stranded, or may contain portions of both single-stranded and double-stranded sequences. Nucleic acids can be DNA, genomic DNA, cDNA, RNA, or hybrid nucleic acids, and may contain combinations of deoxyribonucleotides and ribonucleotides, as well as combinations of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Nucleic acids can be obtained through chemical synthesis or recombinant methods.

[0060] As used herein, "operably linked" means that gene expression is under the control of a promoter spatially linked to it. The promoter can be located at the 5' (upstream) or 3' (downstream) of the gene it controls. The distance between the promoter and the gene can be approximately the same as the distance between the promoter and the gene it controls (the gene from which the promoter originates). As is known in this technique, variations in this distance can be modulated without loss of promoter function.

[0061] As used in this article, "partially functional" describes a protein encoded by a mutated gene that has lower biological activity than functional proteins but higher biological activity than non-functional proteins.

[0062] As used interchangeably in this article, "premature stop codon" or "out-of-frame stop codon" refers to a meaningless mutation in the DNA sequence that produces a stop codon at a location not typically found in the wild-type gene. Premature stop codons can truncate or shorten the protein compared to the full-length version.

[0063] As used herein, a "promoter" refers to a synthetic or naturally derived molecule that confers, activates, or enhances the expression of nucleic acids in a cell. A promoter may contain one or more specific transcriptional regulatory sequences to further enhance expression and / or alter its spatial and / or temporal expression. A promoter may also contain distal enhancer or repressor elements, which may be located up to several kilobase pairs from the transcription start site. Promoters can be derived from sources including viruses, bacteria, fungi, plants, insects, and animals. Promoters can constitutively or differentially regulate the expression of gene components relative to the cell, tissue, or organ in which expression occurs, or relative to the developmental stage in which expression occurs, or in response to external stimuli such as physiological stress, pathogens, metal ions, or inducers. Representative examples of promoters include the phage T7 promoter, phage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter, human U6 (hU6) promoter, and CMV IE promoter.

[0064] As used herein, "skeletal muscle" refers to a type of striated muscle that is controlled by the muscular nervous system and attached to the skeleton by bundles of collagen fibers called tendons. Skeletal muscle is composed of individual components called myocytes, or "muscle cells," sometimes referred to as "muscle fibers." Myocytes are formed by the fusion of developing myoblasts (a type of embryonic progenitor cell that produces muscle cells) during a process called myogenesis. These relatively long, cylindrical, multinucleated cells are also called muscle fibers.

[0065] As used in this article, "musculoskeletal symptoms" refers to conditions related to skeletal muscle, such as muscle malnutrition, aging, muscle degeneration, wound healing, and muscle weakness or atrophy.

[0066] As may be used interchangeably herein, the terms "individual" and "patient" refer to any vertebrate, including but not limited to mammals (e.g., cattle, pigs, camels, llamas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, and mice), non-human primates (e.g., monkeys, such as macaques or rhesus monkeys, chimpanzees, etc.) and humans). In some embodiments, the individual may be human or non-human. The individual or patient may undergo other forms of treatment.

[0067] As used herein, "target gene" refers to any nucleotide sequence that encodes a known or presumed gene product. A target gene may be a mutant gene involved in a genetic disease. In some embodiments, the target gene is the human myokinin gene. In some embodiments, the target gene is a mutant human myokinin gene.

[0068] As used in this article, "target region" refers to the target gene region designed to be bound and cleaved by the CRISPR / Cas9 gene editing system.

[0069] As used herein, "transgenic gene" refers to a gene or genetic material containing a gene sequence that has been isolated from one organism and introduced into a different organism. This non-native segment of DNA may retain the ability of the transgenic organism to produce RNA or protein, or may alter the normal function of the transgenic organism's genetic code. The introduction of transgenic genes has the potential to alter the phenotype of an organism.

[0070] In this article, the term "variant" as used for nucleic acid means (i) a portion or fragment of the nucleotide sequence mentioned; (ii) the complement of the nucleotide sequence mentioned or a portion thereof; (iii) a nucleic acid substantially identical to the nucleic acid mentioned or its complement; or (iv) a nucleic acid that hybridizes under stringent conditions to the nucleic acid mentioned, its complement, or a sequence substantially identical to it.

[0071] Regarding "variants" of peptides or polypeptides, their amino acid sequences differ due to the insertion, deletion, or conserved substitution of amino acids, but retain at least one biological activity. A variant can also mean a protein whose amino acid sequence is substantially identical to that of a reference protein that retains at least one biological activity. Conserved amino acid substitution (i.e., the replacement of an amino acid with a different amino acid having similar properties (e.g., the degree and distribution of hydrophilicity of charged regions) is generally recognized in this technique as typically involving minute variations. As understood in this technique, such minor variations can be identified in part by considering the hydrophilicity index of the amino acid. Kyte et al., J. Mol. Biol. 157:105-132 (1982) The hydrophilicity index of an amino acid is based on considerations of its hydrophobicity and charge. In this technique, it is known that amino acids with similar hydrophilicity indices can be substituted and still retain protein function. In one state, amino acids with a hydrophilicity index of ±2 are substituted. The hydrophilicity of amino acids can also be used to demonstrate substitutions that will produce proteins that retain biological function. In the case of peptides, considering the hydrophilicity of amino acids allows for the calculation of the maximum local average hydrophilicity of the peptide. Substitutions can be made using amino acids with hydrophilicity values ​​within ±2 of each other. Both the hydrophobicity index and hydrophilicity value of an amino acid are influenced by the specific side chain of that amino acid. Consistent with observations, as revealed by hydrophobicity, hydrophilicity, charge, size, and other properties, biologically compatible amino acid substitutions are understood to depend on the relative similarity of the amino acids, and especially their side chains.

[0072] As used herein, "vector" means a nucleic acid sequence containing the origin of replication. Vectors can be viral vectors, bacteriophages, bacterial artificial chromosomes, or yeast artificial chromosomes. Vectors can be DNA or RNA vectors. Vectors can be self-replicating extrachromosomal vectors, and are preferably DNA plastids.

[0073] Unless otherwise defined herein, scientific and technical terms used in connection with this invention will have the meaning commonly understood by one of ordinary skill in the art. For example, any nomenclature and techniques described herein used in conjunction with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization are well known and commonly used in the art. The meaning and scope of terms should be clear; however, in any case of potential ambiguity, the definitions provided herein take precedence over any dictionary or external definition. Furthermore, unless the context otherwise requires, singular terms shall include plural and plural terms shall include singular. [2.] [The genome-editing construct of the myopois gene] []

[0074] This article provides gene constructs for genome editing, genome alteration, and / or alteration of the gene expression of the myotensin gene. The myotensin gene may be the human myotensin gene. The gene construct includes at least one gRNA targeting the myotensin gene sequence. At least one gRNA may target the human and / or rhesus monkey myotensin gene sequence and may be a SaCas9 compatible target. The disclosed gRNA may be included in CRISPR / Cas9-based gene editing systems, including systems using SaCas9 to target exons 45 to 55 of the human myotensin gene. The disclosed gRNA, which may be included in a CRISPR / Cas9-based gene editing system, may cause genomic deletion in the region of exons 45 to 55 of the human myotensin gene in order to restore functional myotensin expression in cells from DMD patients. [a.] [Myoplasmin gene] []

[0075] Myoglobin is a rod-shaped cytoplasmic protein, part of a protein complex that connects the cytoskeleton of muscle fibers to the surrounding extracellular matrix via the cell membrane. Myoglobin provides structural stability to the myoglobin-glycan complex in the cell membrane. The myoglobin gene is 2.2 megabases long at locus Xp21. Primary transcription is approximately 2,400 kb, of which approximately 14 kb is mature mRNA. 79 exons encode a protein containing over 3,500 amino acids. Normal skeletal muscle tissue contains only small amounts of myoglobin, but this does not lead to the development of severe and incurable symptoms. Some mutations in the myoglobin gene result in defective myoglobin and a severe malnutrition phenotype in infected patients. Other mutations in the myoglobin gene result in partially functional myoglobin protein and a much milder malnutrition phenotype in infected patients.

[0076] Deletion-in-frame mutations (DMDs) are the result of inherited or spontaneous mutations that cause meaningless or frameshift mutations in the myoglobin gene. The naturally occurring mutations in DMDs and their consequences are relatively well understood. Frameshift deletions occurring in exon 45-55 are examples. [picture] [1], [picture] [2] The rod-shaped domain contains highly functional myoglobin proteins, and many carriers are asymptomatic or show mild symptoms. In addition, theoretically, more than 60% of patients can be treated by targeting this region as a whole (exons 45 to 55) or by targeting specific exons in this region of the myoglobin gene (e.g., targeting only exon 51). Efforts have been made to restore the myoglobin reading frame in DMD patients by skipping non-essential exons (e.g., skipping exon 51) during mRNA splicing, thereby producing internally deleted but functional myoglobin proteins. Deletion of internal myoglobin exons (e.g., deletion of exon 51) preserves the proper reading frame but causes a less severe form of Becker's muscular atrophy (BMD). Because the deletion is present in the myoglobin gene, the BMD genotype is similar to that of DMD. However, the deletion in BMD leaves the reading frame intact. Therefore, internally truncated but partially functional myoglobin proteins are produced. BMD exhibits a broad spectrum of phenotypes, but deletions in exons 45-55 of myoglobin often result in a milder phenotype compared to DMD. Therefore, changing the DMD genotype to the BMD genotype is a common strategy for correcting myoglobin. Several strategies exist for correcting myoglobin, many of which rely on restoring the reading frame of endogenous myoglobin. This shifts the disease genotype from DMD to Becker's muscular dystrophy. Many BMD patients have intragenic deletions that maintain the translational reading frame, producing shorter but largely functional myoglobin proteins.

[0077] In some embodiments, modifications to exons 45-55 (such as deletions or excisions of exons 45-55 via, for example, NHEJ) are made to restore reading frames, thereby improving the phenotype of DMD in individuals, including those with deletion mutations. Exons 45-55 of the myotensin gene refer to exons 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, and 55 of the myotensin gene. Mutations in the exon 45-55 region are ideally suited for permanent correction via NHEJ-based genome editing.

[0078] The gene construct of this invention can produce deletion of the myotrophin gene. The myotrophin gene may be the human myotrophin gene. In some embodiments, the vector is configured to form two double-vertical breaks (a first double-strand break and a second double-strand break) in two introns (a first intron and a second intron) flanking the target location of the myotrophin gene, thereby deleting a segment of the myotrophin gene containing the target location. As described herein, the "target location" may be a target location within a myotrophin exon or a target location within a myotrophin exon. Deletion of the target location of the myotrophin exon can optimize the myotrophin sequence in individuals with Duchenne muscular dystrophy. For example, it can increase the function or activity of the encoded myotrophin protein and / or improve the individual's disease condition. In some embodiments, the excision of the target location of the myotrophin exon restores the reading frame. The target location of the myotrophin exon may contain one or more exons of the myotrophin gene. In some embodiments, the target site for myotensin contains exon 51 of a myotensin gene (e.g., the human myotensin gene).

[0079] The gene construct of this invention can mediate efficient gene editing in the exon 45 to exon 55 region of the myoglobin gene. The gene construct of this invention can restore the expression of myoglobin protein in cells from DMD patients.

[0080] Eliminating exons 45 to 55 of the myoglobin transcript by skipping exons can treat approximately 50% of all DMD patients. Such myoglobin mutations are suitable for permanent correction via NHEJ-based genome editing and HDR. The gene constructs described herein have been developed for targeted modification of exons 45 to 55 in the human myoglobin gene. The gene constructs of this invention can be transfected into human DMD cells and mediate effective gene modification and conversion to the correct reading frame. Protein restoration is accompanied by frame restoration and is detectable in the main population of cells treated with a CRISPR / Cas9-based gene editing system. [b.] [CRISPR] [system] []

[0081] The gene construct of this invention encodes a CRISPR / Cas9-based gene editing system specific to myotropic proteins. As used interchangeably herein, "clustered regularly spaced short palindromic repeats" and "CRISPR" refer to loci containing multiple short direct repeat sequences, found in approximately 40% of the genomes of sequenced bacteria and 90% of sequenced archaea. The CRISPR system is a microbial nuclease system involved in defense against invading bacteriophages, providing a form of acquired immunity. CRISPR loci in microbial hosts contain a combination of CRISPR-associated (Cas) genes and specific non-coding RNA elements capable of programming CRISPR-mediated nucleic acid cleavage. Short fragments of foreign DNA, called spacer sequences, are incorporated into the genome between CRISPR repeat sequences and act as "memory" of past exposures. Cas9 forms a complex with the 3' end of sgRNA (also referred to interchangeably as "gRNA" in this document), and the protein-RNA pair recognizes its genomic target through complementary base pairing between the 5' end of the sgRNA sequence and a predetermined 20 bp DNA sequence called the protospacer sequence. This complex is guided to the homologous locus of the pathogen DNA via a region encoded within the crRNA, namely the protospacer sequence, and the protospacer sequence neighbor motif (PAM) within the pathogen genome. A non-coding CRISPR array transcribes and cleaves short crRNAs containing a single spacer sequence within the direct repeat sequence, which guides the Cas nuclease to its target site (the protospacer sequence). By simply exchanging the 20 bp recognition sequence of the represented sgRNA, the Cas9 nuclease can be guided to the new genomic target. The CRISPR spacer sequence is used to recognize and silence foreign genetic elements in a manner similar to RNAi in eukaryotes.

[0082] Three classes of CRISPR systems are known (type I, type II, and type III effector systems). The type II effector system uses a single effector enzyme, Cas9, in four sequential steps to target DNA double-strand breaks, resulting in dsDNA cleavage. Compared to type I and type III effector systems, which require multiple different effectors to act as a complex, the type II effector system can function in alternative scenarios such as eukaryotic cells. The type II effector system consists of long precrRNAs, transcribed from a CRISPR locus containing spacer sequences, the Cas9 protein, and tracrRNAs involved in precrRNA processing. tracrRNAs hybridize to repetitive regions of the spacer sequences separating the precrRNA, thus initiating dsRNA cleavage via endogenous RNase III. Following this cleavage, a second cleavage event within each spacer sequence, via Cas9, produces mature crRNAs that remain associated with both tracrRNA and Cas9, forming the Cas9:crRNA-tracrRNA complex.

[0083] The Cas9:crRNA-tracrRNA complex unwinds the DNA double helix and searches for a matching crRNA sequence for cleavage. Target recognition occurs during the detection of complementarity between the "protospacer" sequence in the target DNA and the remaining spacer sequence in the crRNA. If a correct protospacer neighbor motif (PAM) is also present at the 3' end of the protospacer sequence, Cas9 mediates the cleavage of the target DNA. For protospacer targeting, the sequence must immediately follow the protospacer neighbor motif (PAM), which is a short sequence recognized by the Cas9 nuclease required for DNA cleavage. Different type II systems have different PAM requirements. The Streptococcus pyogenes CRISPR system may have a PAM sequence for this Cas9 (SpCas9) as 5'-NRG-3', where R is A or G, and characterizes the system's specificity in human cells. A unique capability of CRISPR / Cas9-based gene editing systems is the simple ability to simultaneously target multiple different genomic loci by co-expressing a single Cas9 protein with two or more sgRNAs. For example, the Streptococcus pyogenes type II system naturally prefers the "NGG" sequence, where "N" can be any nucleotide, but it also accepts other PAM sequences, such as "NAG" in engineered systems (Hsu et al., Nature Biotechnology (2013) doi:10.1038 / nbt.2647). Similarly, Cas9 (NmCas9) derived from Neisseria meningitidis typically has the native NNNNGATT PAM, but exhibits activity across multiple PAMs, including the highly degraded NNNNGNNN PAM (Esvelt et al., Nature Methods (2013) doi:10.1038 / nmeth.2681).

[0084] The Staphylococcus aureus Cas9 molecular recognition sequence motif NNGRR (R=A or G) (SEQ ID NO: 25) guides the lysis of a target nucleic acid sequence 1 to 10, for example, 3 to 5 bp upstream of the target sequence. In some embodiments, the Staphylococcus aureus Cas9 molecular recognition sequence motif NNGRRN (R=A or G) (SEQ ID NO: 26) guides the lysis of a target nucleic acid sequence 1 to 10, for example, 3 to 5 bp upstream of the target sequence. In some embodiments, the Staphylococcus aureus Cas9 molecular recognition sequence motif NNGRRT (R=A or G) (SEQ ID NO: 27) guides the lysis of a target nucleic acid sequence 1 to 10, for example, 3 to 5 bp upstream of the target sequence. In some embodiments, the Staphylococcus aureus Cas9 molecular recognition sequence motif NNGRRV (R=A or G) (SEQ ID NO: 28) guides the lysis of a target nucleic acid sequence 1 to 10, for example, 3 to 5 bp upstream of the target sequence. In the foregoing embodiments, N can be any nucleotide residue, such as any one of A, G, C, or T. The Cas9 molecule can be engineered to alter its PAM specificity. [i)] [based on] [CRISPR] [ / ] [Cas9] [Gene Editing System] []

[0085] The engineered form of the type II effector system of Streptococcus pyogenes is demonstrated to function in human cells used for genome engineering. In this system, a "guide RNA" ("gRNA") synthesized from the Cas9 protein, which may also be used interchangeably herein as a chimeric single guide RNA ("sgRNA"), is directed to the genomic target site. This is a crRNA-tracrRNA fusion that generally avoids the need for treatment with RNase III and crRNA. This article provides CRISPR / Cas9-based engineered systems suitable for genome editing and the treatment of genetic diseases. CRISPR / Cas9-based engineered systems can be designed to target any gene, including those involved in genetic diseases, aging, tissue regeneration, or wound healing. CRISPR / Cas9-based gene editing systems may include a Cas9 protein or a Cas9 fusion protein and at least one gRNA. In some embodiments, the system comprises two gRNA molecules. The Cas9 fusion protein may, for example, include domains with different activities endogenous to Cas9, such as a transactivation domain.

[0086] Target genes (e.g., myokinin genes, such as human myokinin genes) may be involved in cell differentiation or gene activation, or may contain mutations such as frame-shifting mutations or meaningless mutations. If the target gene has mutations that cause premature stop codons, aberrant splice acceptor sites, or aberrant splice donor sites, CRISPR / Cas9-based gene editing systems can be designed to recognize and bind to nucleotide sequences upstream or downstream of these sites. CRISPR / Cas9-based systems can also be used to disrupt normal gene splicing by targeting splice acceptors and donors to induce skipping of premature stop codons or restore disrupted reading frames. CRISPR / Cas9-based gene editing systems may or may not mediate off-target changes in protein-coding regions of the genome. [(1)] [Cas9] [Molecules and] [Cas9] [Fusion protein] []

[0087] CRISPR / Cas9-based gene editing systems may include Cas9 proteins or Cas9 fusion proteins. Cas9 proteins are endonucleases encoded by CRISPR loci and involved in the type II CRISPR system, which cause nucleic acid cleavage. Cas9 proteins can originate from any bacterial or archaeal species, including but not limited to Streptococcus pyogenes, Staphylococcus aureus, Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., Cyclophilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., and Blastopirellula. *Maria*, *Bradyrhizobium* sp.), Brevibacillus laterosporus, Aspergillus coli, Campylobacter jejuni, Campylobacter lari, Candidatus Puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, Gamma proteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae The following bacteria are listed: parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, and Methylocystis sp.The following bacteria are listed: *Methylosinus trichosporium*, *Mobiluncus mulieris*, *Neisseria bacilliformis*, *Neisseria cinerea*, *Neisseria flavescens*, *Neisseria lactamica*, *Neisseria sp.*, *Neisseria wadsworthii*, *Nitrosomonas sp.*, *Parvibaculum lavamentivorans*, *Pasteurella multocida*, *Phascolarctobacterium succinatutens*, *Ralstonia syzygii*, and *Rhodopseudomonas palustris*. The Cas9 molecules include *Plasmustris*, *Rhodovulum* sp., *Simonsiella muelleri*, *Sphingomonas* sp., *Sporolactobacillus vineae*, *Staphylococcus lugdunensis*, *Streptococcus* sp., *Subdoligranulum* sp., *Tistrella mobilis*, *Treponema* sp., or *Verminephrobacter eiseniae*. In some embodiments, the Cas9 molecule is a *Streptococcus pyogenes* Cas9 molecule (also referred to herein as "SpCas9"). In some embodiments, the Cas9 molecule is a *Staphylococcus aureus* Cas9 molecule (also referred to herein as "SaCas9").

[0088] The Cas9 molecule or Cas9 fusion protein can interact with one or more gRNA molecules and co-localize with the gRNA molecules to a site containing the target domain, and in some embodiments, a PAM sequence. The ability of the Cas9 molecule or Cas9 fusion protein to recognize the PAM sequence can be determined, for example, using transformation analysis methods known in this art.

[0089] In some embodiments, the ability of the Cas9 molecule or Cas9 fusion protein to interact with and cleave the target nucleic acid is related to the PAM sequence. The PAM sequence is a sequence in the target nucleic acid. In some embodiments, the cleavage of the target nucleic acid occurs upstream of the PAM sequence. Cas9 molecules from different bacterial species can recognize different sequence motifs (e.g., PAM sequences). In some embodiments, the Cas9 molecule of Staphylococcus aureus recognizes the sequence motif NNGRR (R=A or G) (SEQ ID NO: 25) and guides the cleavage of the target nucleic acid sequence 1 to 10, for example, 3 to 5 bp upstream of that sequence. In some embodiments, the Cas9 molecule of Staphylococcus aureus recognizes the sequence motif NNGRRN (R=A or G) (SEQ ID NO: 26) and guides the cleavage of the target nucleic acid sequence 1 to 10, for example, 3 to 5 bp upstream of that sequence. In some embodiments, the Staphylococcus aureus Cas9 molecular recognition sequence motif NNGRRT (R=A or G) (SEQ ID NO: 27) guides the cleavage of a target nucleic acid sequence 1 to 10, for example, 3 to 5 bp upstream of the target sequence. In some embodiments, the Staphylococcus aureus Cas9 molecular recognition sequence motif NNGRRV (R=A or G; V=A or C or G) (SEQ ID NO: 28) guides the cleavage of a target nucleic acid sequence 1 to 10, for example, 3 to 5 bp upstream of the target sequence. In the foregoing embodiments, N can be any nucleotide residue, such as any of A, G, C, or T. The Cas9 molecule can be engineered to alter its PAM specificity.

[0090] In some embodiments, the vector encodes at least one Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of NNGRRT (SEQ ID NO: 27) or NNGRRV (SEQ ID NO: 28). In some embodiments, at least one Cas9 molecule is a Staphylococcus aureus Cas9 molecule. In some embodiments, at least one Cas9 molecule is a mutant Staphylococcus aureus Cas9 molecule.

[0091] Alternatively or concurrently, the nucleic acid encoding the Cas9 molecule or Cas9 polypeptide may contain a nuclear localization sequence (NLS). Nuclear localization sequences are known in this art.

[0092] The Cas9 molecule encoding Staphylococcus aureus and, where applicable, the exemplary codon-optimized nucleic acid sequences containing nuclear localization sequences (NLS) are described in SEQ ID NO: 31-37. Another exemplary codon-optimized nucleic acid sequence encoding the Cas9 molecule of Staphylococcus aureus contains nucleotides 1293-4451 of SEQ ID NO: 38.

[0093] In some embodiments, the nucleotide sequence encoding the Staphylococcus aureus Cas9 molecule includes the polynucleotide sequence of SEQ ID NO: 37. The amino acid sequence of the Staphylococcus aureus Cas9 molecule is illustrated in SEQ ID NO: 39. The amino acid sequence of the Staphylococcus aureus Cas9 molecule is illustrated in SEQ ID NO: 40.

[0094] Alternatively, CRISPR / Cas9-based gene editing systems may include fusion proteins. Fusion proteins may comprise two heterologous polypeptide domains, wherein the first polypeptide domain comprises a Cas protein and the second polypeptide domain has activities such as transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, nucleic acid binding activity, methylase activity, or demethylase activity. Fusion proteins may include Cas9 proteins or mutant Cas9 proteins fused to a second polypeptide domain having activities such as transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, nucleic acid binding activity, methylase activity, or demethylase activity. [(a)] [Transcriptional activation activity] []

[0095] The second polypeptide domain can possess transcriptional activation activity, i.e., a trans-activating domain. For example, gene expression of endogenous mammalian genes (such as human genes) can be achieved by targeting the iCas9 fusion protein and its trans-activating domain to mammalian promoters via gRNA combination. The trans-activating domain can include p300 proteins, VP16 proteins, various VP16 proteins such as the VP48 or VP64 domains, or the p65 domain with NF-κB transcriptional activator activity. For example, the fusion protein could be dCas9-VP64 or dCas9-p300. [(b)] [Transcriptional repression activity] []

[0096] The second polypeptide domain may possess transcriptional repressive activity. This second polypeptide domain may exhibit Kruppel-associated box activity, such as KRAB domain, ERF repressor domain activity, Mxil repressor domain activity, SID4X repressor domain activity, Mad-SID repressor domain activity, or TATA box-binding protein activity. For example, the fusion protein could be dCas9-KRAB. [(c)] [Transcription releasing factor activity] []

[0097] The second polypeptide domain may possess transcriptional release factor activity. The second polypeptide domain may possess eukaryotic release factor 1 (ERF1) activity or eukaryotic release factor 3 (ERF3) activity. [(d)] [Histone modification activity] []

[0098] The second polypeptide domain may possess histone modification activity. This second polypeptide domain may possess histone deacetase, histone acetyltransferase, histone demethylase, or histone methyltransferase activity. The histone acetyltransferase may be p300 or CREB-binding protein (CBP) protein or a fragment thereof. For example, the fusion protein may be dCas9-p300. [(e)] [Nuclease activity] []

[0099] The second polypeptide domain may possess nuclease activity different from that of the Cas9 protein. Nucleases, or proteins with nuclease activity, are enzymes capable of cleaving the phosphodiester bonds between nucleotide subunits of nucleic acids. Nucleases are generally further classified into endonucleases and terminal nucleases, but some enzymes can exist in both categories. Well-known nucleases include deoxyribonucleases and ribonucleases. [(f)] [Nucleic acid binding activity] []

[0100] The second polypeptide domain may possess nucleic acid binding activity or a nucleic acid-binding protease-binding domain (DBD), which is a folded protein domain containing at least one motif that recognizes double-stranded or single-stranded DNA. The DBD may recognize a specific DNA sequence (recognition sequence) or have general affinity for DNA. Nucleic acid-binding regions are selected from the following groups: helix-turn-helix region, leucine zipper region, winged helix region, winged helix-turn-helix region, helix-loop-helix region, immunoglobulin fold, B3 domain, zinc finger, HMG box, Wor3 domain, and TAL effector DNA-binding domain. [(g)] [Methylase activity] []

[0101] The second polypeptide domain may have methylase activity involving the transfer of methyl groups to DNA, RNA, proteins, small molecules, cytosine, or adenine. The second polypeptide domain may include DNA methyltransferases. [(h)] [Demethylase activity] []

[0102] The second polypeptide domain may possess demethylase activity. This domain may include enzymes that remove methyl (CH3-) groups from nucleic acids, proteins (especially histones), and other molecules. Alternatively, the second polypeptide may convert methyl groups into hydroxymethylcytosine in mechanisms that convert methyl groups into demethylated DNA. The second polypeptide may catalyze this reaction. For example, the second polypeptide catalyzing this reaction may be Tet1. [(2)] [Targeting the myopeptin gene] [gRNA] []

[0103] CRISPR / Cas9-based gene editing systems include at least one gRNA molecule, such as two gRNA molecules. The gRNA provides targeting for the CRISPR / Cas9-based gene editing system. The gRNA is a fusion of two non-coding RNAs: crRNA and tracrRNA. The sgRNA can target any desired DNA sequence by exchanging sequences encoding a 20 bp protospacer sequence, which imparts targeting specificity through complementary base pairing with the desired DNA target. The gRNA mimics the naturally occurring crRNA involved in type II effector systems: tracrRNA duplex. This double helix, which may include, for example, 42-nucleotide crRNA and 75-nucleotide tracrRNA, acts as a guide for Cas9 to cleave the target nucleic acid. The terms "target region," "target sequence," or "protospacer sequence" are used interchangeably herein and refer to a region of the target gene (e.g., the myokinin gene) targeted by the CRISPR / Cas9-based gene editing system. CRISPR / Cas9-based gene editing systems may include at least one gRNA, wherein each gRNA targets a different DNA sequence. Target DNA sequences may overlap. The target sequence or original spacer sequence is followed by the PAM sequence at the 3' end of the original spacer sequence. Different type II systems have different PAM requirements. For example, the type II Streptococcus pyogenes system uses the "NGG" sequence, where "N" can be any nucleotide. In some embodiments, the PAM sequence can be "NGG", where "N" can be any nucleotide. In some embodiments, the PAM sequence can be NNGRRT (SEQ ID NO: 27) or NNGRRV (SEQ ID NO: 28).

[0104] The number of gRNA molecules encoded by the gene construct (e.g., AAV vector) of the present invention can be at least 1 gRNA, at least 2 different gRNAs, at least 3 different gRNAs, at least 4 different gRNAs, at least 5 different gRNAs, at least 6 different gRNAs, at least 7 different gRNAs, at least 8 different gRNAs, at least 9 different gRNAs, at least 10 different gRNAs, at least 11 different gRNAs, at least 12 different gRNAs, at least 13 different gRNAs, at least 14 different gRNAs, at least 15 different gRNAs, at least 16 different gRNAs, at least 17 different gRNAs, at least 18 different gRNAs, at least 18 different gRNAs, at least 20 different gRNAs, at least 25 different gRNAs, at least 30 different gRNAs, at least 35 different gRNAs, at least 40 different gRNAs, at least 45 different gRNAs, or at least 50 different gRNAs. The number of gRNA molecules encoded by the gene construct of the present invention may be less than 50 gRNAs, less than 45 different gRNAs, less than 40 different gRNAs, less than 35 different gRNAs, less than 30 different gRNAs, less than 25 different gRNAs, less than 20 different gRNAs, less than 19 different gRNAs, less than 18 different gRNAs, less than 17 different gRNAs, less than 16 different gRNAs, less than 15 different gRNAs, less than 14 different gRNAs, less than 13 different gRNAs, less than 12 different gRNAs, less than 11 different gRNAs, less than 10 different gRNAs, less than 9 different gRNAs, less than 8 different gRNAs, less than 7 different gRNAs, less than 6 different gRNAs, less than 5 different gRNAs, less than 4 different gRNAs, or less than 3 different gRNAs.The number of gRNAs encoded by the gene construct of the present invention can be between at least 1 gRNA and at least 50 different gRNAs, between at least 1 gRNA and at least 45 different gRNAs, or between at least 1... Between gRNA and at least 40 different gRNAs, between at least 1 gRNA and at least 35 different gRNAs, between at least 1 gRNA and at least 30 different gRNAs, between at least 1 gRNA and at least 25 different gRNAs, between at least 1 gRNA and at least 20 different gRNAs, between at least 1 gRNA and at least 16 different gRNAs, between at least 1 gRNA and at least 12 different gRNAs, between at least 1 gRNA and at least 8 different gRNAs, between at least 1 gRNA and at least 4 different gRNAs, between at least 4 gRNAs and at least 50 different gRNAs, between at least 4 different gRNAs and at least 45 different gRNAs, between at least 4 different gRNAs and at least 40 different gRNAs, between at least 4 different gRNAs and at least 35 different gRNAs, between at least 4 different gRNAs and at least 30 different gRNAs, between at least 4 different gRNAs and at least 4 different gRNAs... Between RNA and at least 25 different gRNAs, between at least 4 different gRNAs and at least 20 different gRNAs, between at least 4 different gRNAs and at least 16 different gRNAs, between at least 4 different gRNAs and at least 12 different gRNAs, between at least 4 different gRNAs and at least 8 different gRNAs, between at least 8 different gRNAs and at least 50 different gRNAs, between at least 8 different gRNAs and at least 45 different gRNAs, between at least 8 different gRNAs and at least 40 different gRNAs, between at least 8 different gRNAs and at least 35 different gRNAs, between 8 different gRNAs and at least 30 different gRNAs, between at least 8 different gRNAs and at least 25 different gRNAs, between 8 different gRNAs and at least 20 different gRNAs, between at least 8 different gRNAs and at least 16 different gRNAs, or between 8 different gRNAs and at least 12 different gRNAs. In some embodiments, the gene construct (e.g., an AAV vector) encodes a gRNA molecule, i.e., a first gRNA molecule, and a Cas9 molecule, if present, as appropriate. In some embodiments, the first gene construct (e.g., a first AAV vector) encodes a gRNA molecule, i.e., a first gRNA molecule, and a Cas9 molecule, if present, as appropriate, and the second gene construct (e.g., a second AAV vector) encodes a gRNA molecule, i.e., a second gRNA molecule, and a Cas9 molecule, if present, as appropriate.

[0105] The gRNA molecule contains a targeting domain, which is a complementary polynucleotide sequence of the target DNA sequence followed by a PAM sequence. The gRNA may contain a "G" at the 5' end of the targeting domain or the complementary polynucleotide sequence. The targeting domain of the gRNA molecule may contain a complementary polynucleotide sequence of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, or 35 base pairs of the target DNA sequence (followed by the PAM sequence). The targeting domain of the gRNA molecule may comprise a complementary polynucleotide sequence of fewer than 40, 35, 25, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 base pairs of the target DNA sequence (followed by the PAM sequence). In some embodiments, the targeting domain of the gRNA molecule has a length of 19-25 nucleotides. In some embodiments, the targeting domain of the gRNA molecule is 20 nucleotides long. In some embodiments, the targeting domain of the gRNA molecule is 21 nucleotides long. In some embodiments, the targeting domain of the gRNA molecule is 22 nucleotides long. In some embodiments, the targeting domain of the gRNA molecule is 23 nucleotides long.

[0106] The gRNA can target regions of the myotensin gene (DMD). In some embodiments, the gRNA can target at least one of the following: exons, introns, promoter regions, enhancer regions, and transcriptional regions of the myotensin gene. In some embodiments, the gRNA molecule targets intron 44 of the human myotensin gene. In some embodiments, the gRNA molecule targets intron 55 of the human myotensin gene. In some embodiments, the first gRNA and the second gRNA each target introns of the human myotensin gene, such that exons 45 to 55 are deleted. The gRNA can bind to and target a polynucleotide sequence corresponding to SEQ ID NO: 2 or a fragment thereof or its complementary sequence. The gRNA can be encoded by a polynucleotide sequence comprising SEQ ID NO: 2 or a fragment thereof or its complementary sequence. The targeting sequence of the gRNA can comprise the polynucleotide of SEQ ID NO: 2 or a fragment thereof, such as its 5' truncated or its complementary sequence. The 5' truncated sequence can be, for example, 1, 2, 3, 4, 5, or 6 nucleotides shorter than SEQ ID NO: 2. In some embodiments, the gRNA can bind to and target the polynucleotide of SEQ ID NO: 2. In some embodiments, the gRNA may bind to and target a 5' truncated polynucleotide of SEQ ID NO: 2. The gRNA may bind to and target a polynucleotide sequence corresponding to SEQ ID NO: 3 or a fragment thereof or its complementary sequence. The gRNA may be encoded by a polynucleotide sequence comprising SEQ ID NO: 3 or a fragment thereof or its complementary sequence. The targeting sequence of the gRNA may comprise a polynucleotide of SEQ ID NO: 3 or a fragment thereof, such as a 5' truncated polynucleotide or its complementary sequence. The 5' truncated polynucleotide may be, for example, 1, 2, 3, 4, 5, or 6 nucleotides shorter than SEQ ID NO: 3. In some embodiments, the gRNA may bind to and target the polynucleotide of SEQ ID NO: 3. In some embodiments, the gRNA may bind to and target a 5' truncated polynucleotide of SEQ ID NO: 3. In some embodiments, the gRNA binding to and targeting a polynucleotide sequence comprising or encoded by SEQ ID NO: 2 or a polynucleotide sequence corresponding to SEQ ID NO: 2 pairs with the gRNA binding to and targeting a polynucleotide sequence comprising or encoded by SEQ ID NO: 3 or a polynucleotide sequence corresponding to SEQ ID NO: 3.

[0107] Single or multiple gRNAs can be designed to restore the myotensin reading frame by targeting mutation hotspots in exons 45-55 of myotensin. Following treatment with the vector of this invention, myotensin expression was restored in vitro in muscle cells from Duchenne schwann patients. Human myotensin was detected in vivo after transplantation of genetically corrected patient cells into immunodeficient mice. Clearly, the unique multiplex gene-editing capabilities of CRISPR / Cas9-based gene-editing systems enable the efficient generation of large deletions in these mutation hotspot regions that can correct up to 62% of patient mutations using general or patient-specific gene-editing methods. In some embodiments, candidate gRNAs are evaluated and selected based on off-target activity, such as by investigating measured off-target activity and distance from exons. [(3)] [gRNA] [skeleton] [] CRISPR / Cas9-based gene editing systems include at least one gRNA backbone. The gRNA backbone facilitates Cas9 binding to the gRNA and endonuclease activity. The gRNA backbone is a polynucleotide sequence following the gRNA. The gRNA and gRNA backbone together form a polynucleotide. In some embodiments, the gRNA backbone comprises the polynucleotide sequence of SEQ ID NO: 4 or its complementary sequence. In some embodiments, the gRNA backbone is encoded by the polynucleotide sequence of SEQ ID NO: 4 or its complementary sequence. In some embodiments, the gRNA comprises a polynucleotide targeting the sequence of SEQ ID NO: 2 or SEQ ID NO: 3 or a truncated polynucleotide thereof, and the gRNA backbone corresponding to or encoded by SEQ ID NO: 4. [3.] [DNA] [Targeted Composition] []

[0108] This article further discloses DNA-targeting compositions containing such gene constructs. The DNA-targeting composition comprises at least one gRNA molecule (e.g., two gRNA molecules) targeting a myotensin gene (e.g., the human myotensin gene), as described above. At least one gRNA molecule can bind to and recognize the target region. The target region can then be selected upstream of a possible out-of-frame stop codon, such that insertions or deletions during the repair process restore the myotensin reading frame through frame transition. The target region can also be a splice acceptor site or a splice donor site, such that insertions or deletions during the repair process disrupt splicing and restore the myotensin reading frame through splice site disruption and exon exclusion. The target region can also be an aberrant stop codon, such that insertions or deletions during the repair process restore the myotensin reading frame by eliminating or disrupting the stop codon.

[0109] In some embodiments, the DNA-targeting composition of the present invention includes a first gRNA and a second gRNA. The first gRNA molecule and the second gRNA molecule may bind to or target the polynucleotides or their complementary sequences as specified in SEQ ID NO: 2 and SEQ ID NO: 3, respectively. The first gRNA molecule and the second gRNA molecule may contain the polynucleotides or their complementary sequences as specified in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0110] The deletion efficiency of the vector of the present invention can be related to the deletion size, that is, the size of the fragment deleted by the vector. In some embodiments, the length or size of a specific deletion is determined by the distance between PAM sequences in the targeted gene (e.g., the myotensin gene). In some embodiments, the specific deletion of a fragment of the myotensin gene, defined by its length and the sequence it contains (e.g., exon 51), is the result of a break caused by a specific PAM sequence in a neighboring target gene (e.g., the myotensin gene).

[0111] In some embodiments, a size of about 50 to about 2,000 base pairs (bp) is deleted, for example, about 50 to about 1999 bp, about 50 to about 1900 bp, about 50 to about 1800 bp, about 50 to about 1700 bp, about 50 to about 1650 bp, about 50 to about 1600 bp, about 50 to about 1500 bp, about 50 to about 1400 bp, about 50 to about 1300 bp, about 50 to about 1200 bp, about 50 to about 1150 bp, about 50 to about 1100 bp, about 50 to about 1000 bp, about 50 to about 900 bp, about 50 to about 850 bp, about 50 to about 800 bp, about 50 to about 750 bp, about 50 to about 700 bp, about 50 to about 600 bp, about 50 to about 500 bp, about 50 to about 400 bp. bp, approximately 50 to 350 bp, approximately 50 to 300 bp, approximately 50 to 250 bp, approximately 50 to 200 bp, approximately 50 to 150 bp, approximately 50 to 100 bp, approximately 100 to 1999 bp, approximately 100 to 1900 bp, approximately 100 to 1800 bp, approximately 100 to 1700 bp, approximately 100 to 1650 bp, approximately 100 to 1600 bp, approximately 100 to 1500 bp, approximately 100 to 1400 bp, approximately 100 to 1300 bp, approximately 100 to 1200 bp, approximately 100 to 1150 bp, approximately 100 to 1100 bp, approximately 100 to 1000 bp, approximately 100 to 900 bp, approximately 100 to 850 bp bp, approximately 100 to approximately 800 bp, approximately 100 to approximately 750 bp, approximately 100 to approximately 700 bp, approximately 100 to approximately 600 bp, approximately 100 to approximately 1000 bp, approximately 100 to approximately 400 bp, approximately 100 to approximately 350 bp, approximately 100 to approximately 300 bp, approximately 100 to approximately 250 bp, approximately 100 to approximately 200 bp, approximately 100 to approximately 150 bp, approximately 200 to approximately 1999 bp, approximately 200 to approximately 1900 bp, approximately 200 to approximately 1800 bp, approximately 200 to approximately 1700 bp, approximately 200 to approximately 1650 bp, approximately 200 to approximately 1600 bp, approximately 200 to approximately 1500 bp, approximately 200 to approximately 1400 bp, approximately 200 to approximately 1300 bp, approximately 200 to approximately 1200 bp bp, approximately 200 to approximately 1150 bp, approximately 200 to approximately 1100 bp, approximately 200 to approximately 1000 bp, approximately 200 to approximately 900 bp, approximately 200 to approximately 850 bp, approximately 200 to approximately 800 bp, approximately 200 to approximately 750 bp, approximately 200 to approximately 700 bp, approximately 200 to approximately 600 bp, approximately 200 to approximately 2000 bpbp, approximately 200 to approximately 400 bp, approximately 200 to approximately 350 bp, approximately 200 to approximately 300 bp, approximately 200 to approximately 250 bp, approximately 300 to approximately 1999 bp, approximately 300 to approximately 1900 bp, approximately 300 to approximately 1800 bp, approximately 300 to approximately 1700 bp, approximately 300 to approximately 1650 bp, approximately 300 to approximately 1600 bp, approximately 300 to approximately 1500 bp, approximately 300 to approximately 1400 bp, approximately 300 to approximately 1300 bp, approximately 300 to approximately 1200 bp, approximately 300 to approximately 1150 bp, approximately 300 to approximately 1100 bp, approximately 300 to approximately 1000 bp, approximately 300 to approximately 900 bp, approximately 300 to approximately 850 bp, approximately 300 to approximately 800 bp, approximately 300 to approximately 750 bp The deletion size can be approximately 300 to approximately 700 bp, approximately 300 to approximately 600 bp, approximately 300 to approximately 3000 bp, approximately 300 to approximately 400 bp, or approximately 300 to approximately 350 bp. In some embodiments, the deletion size can be approximately 118 base pairs, approximately 233 base pairs, approximately 326 base pairs, approximately 766 base pairs, approximately 805 base pairs, or approximately 1611 base pairs. [4.] [A combination for genome editing in muscle] []

[0112] This document discloses a gene construct or a composition thereof for genome editing of a target gene in an individual, such as a target gene in the skeletal muscle and / or cardiac muscle of an individual. The gene construct may be a vector. The vector may be a modified AAV vector. The composition may include a polynucleotide sequence encoding a CRISPR / Cas9-based gene editing system. The composition may deliver an active form of the CRISPR / Cas9-based gene editing system to skeletal muscle or cardiac muscle. The gene construct of this invention can be used to correct or reduce the effects of mutations in myotensin genes involved in genetic diseases and / or other skeletal muscle or cardiac diseases (such as DMD). The composition may further include donor DNA or a transgenic gene. These compositions can be used for genome editing, genome engineering, and correcting or reducing the effects of mutations in genes involved in genetic diseases and / or other skeletal muscle and / or cardiac diseases. [a.] [Based on targeting myotropic proteins] [CRISPR] [ / ] [Cas9] [Of] [Gene Editing System] []

[0113] This article reveals a CRISPR / Cas9-based gene editing system specific to the myoglobin gene. The CRISPR / Cas9-based gene editing system may include Cas9 and at least one gRNA to target the myoglobin gene. The CRISPR / Cas9-based gene editing system can bind to and recognize the target region. The target region can then be selected upstream of a possible out-of-frame stop codon, allowing insertions or deletions during the repair process to restore the myoglobin reading frame through frame transition. The target region can also be a splice acceptor site or a splice donor site, allowing insertions or deletions during the repair process to disrupt splicing and restore the myoglobin reading frame through splice site disruption and exon exclusion. The target region can also be an aberrant stop codon, allowing insertions or deletions during the repair process to restore the myoglobin reading frame by eliminating or disrupting the stop codon. [b.] [Adeno-associated virus vector] []

[0114] The composition may also include a viral delivery system. In some embodiments, the vector is an adeno-associated virus (AAV) vector. AAV vectors are small viruses belonging to the genus Parvoviridae, which infect humans and some other primate species. AAV vectors can be used to deliver CRISPR / Cas9-based gene editing systems using various construct configurations. For example, the AAV vector can deliver Cas9 and gRNA expression cassettes on a separate vector or on the same vector. Alternatively, if a small Cas9 protein derived from species such as Staphylococcus aureus or Neisseria meningitidis is used, Cas9 and up to two gRNA expression cassettes can be combined within a 4.7 kb encapsulation limit in a single AAV vector.

[0115] In some embodiments, the AAV vector is a modified AAV vector. Modified AAV vectors may have enhanced cardiac and skeletal muscle tissue tropism. Modified AAV vectors may be able to deliver and express CRISPR / Cas9-based gene editing systems in mammalian cells. For example, a modified AAV vector may be an AAV-SASTG vector (Piacentino et al. (2012) Human Gene Therapy 23:635-646). Modified AAV vectors can deliver nucleases in vivo to skeletal and cardiac muscle. Modified AAV vectors may be based on one or more of several capsid types, including AAV1, AAV2, AAV5, AAV6, AAV8, and AAV9. Modified AAV vectors can be based on AAV2 pseudotypes with alternative muscular AAV capsids, such as AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, and AAV / SASTG vectors, which efficiently transduce skeletal or cardiac muscle through systemic and local delivery (Seto et al. Current Gene Therapy (2012) 12:139-151). Modified AAV vectors can be AAV2i8G9 (Shen et al. J. Biol. Chem (2013)288:28814-28823). AAV vectors can also be AAVrh74. [5.] [method] [] [a.] Methods for genome editing in muscle []

[0116] This article discloses a method for genome editing in an individual. Genome editing can be performed in the skeletal muscle and / or cardiac muscle of an individual. The method may involve administering a composition for genome editing, as described above, to the skeletal muscle and / or cardiac muscle of the individual. Genome editing may include correcting mutated genes or inserting transgenic genes. Correcting mutated genes may include deleting, rearranging, or replacing mutated genes. Correcting mutated genes may include nuclease-mediated NHEJ or HDR. [b.] [Methods for correcting mutated genes and treating individuals] []

[0117] This article discloses methods for correcting mutated genes in cells (e.g., mutated myokinin genes, such as mutated human myokinin genes) and treating individuals with genetic diseases such as DMD. The method may include delivering to cells or individuals a gene construct (e.g., a vector) or a composition containing the present invention as described above. As mentioned above, the method may include delivering to the skeletal muscle and / or cardiac muscle of an individual a gene construct (e.g., a vector) or a composition containing the present invention for genome editing of skeletal muscle and / or cardiac muscle. Delivering a CRISPR / Cas9-based gene editing system to skeletal muscle or cardiac muscle using a gene construct (e.g., a vector) or a composition containing the present invention can restore the expression of fully or partially functional proteins containing a repair template or donor DNA, which can replace an entire gene or a mutated region. CRISPR / Cas9-based gene editing systems can be used to introduce site-specific double-strand breaks at target genomic loci. When a CRISPR / Cas9-based gene editing system binds to a target DNA sequence, a site-specific double-strand break is generated, thereby allowing the target DNA to cleave. This DNA cleavage can stimulate the natural DNA repair mechanism, resulting in one of two possible repair pathways: homologous targeted repair (HDR) or non-homologous end joining (NHEJ).

[0118] This invention provides a method for genome editing using a CRISPR / Cas9-based gene editing system in the absence of a repair template, which can efficiently correct reading frames and restore the expression of functional proteins involved in genetic diseases. The CRISPR / Cas9-based gene editing system of this invention relates to a correction method using homology-directed repair or nuclease-mediated non-homologous end joining (NHEJ), enabling efficient correction in proliferation-restricted primary cell lines where homologous recombination or selection-based gene correction may be impossible. This strategy integrates the rapid and robust assembly of an active CRISPR / Cas9-based gene editing system with an efficient gene editing method for treating genetic diseases caused by mutations in non-essential coding regions that result in frameshifts, premature stop codons, aberrant splice donor sites, or aberrant splice acceptor sites. [i)] [Nuclease-mediated non-homologous end conjugation] []

[0119] Repair of protein expression in endogenous mutant genes can be achieved via template-free NHEJ-mediated DNA repair. Compared to transient methods targeting target gene RNA, correcting the target gene reading frame in the genome using a CRISPR / Cas9-based gene editing system via transient expression can permanently restore target gene expression in each modified cell and all its progeny. In some embodiments, NHEJ is nuclease-mediated NHEJ, which in some embodiments refers to NHEJ initiating Cas9 molecule cleavage of double-stranded DNA. This method may involve administering the gene constructs (e.g., vectors) of the present invention or compositions containing them to the skeletal or cardiac muscle of an individual for genome editing of skeletal or cardiac muscle.

[0120] Nuclease-mediated NHEJ gene correction can correct mutant target genes and has several potential advantages over the HDR pathway. For example, NHEJ does not require a donor template and can induce nonspecific insertional mutations. Compared to HDR, NHEJ operates efficiently in all stages of the cell cycle and is therefore effective for circulating and post-mitotic cells, such as myofibrils. This provides a robust and durable gene repair alternative to bypassing pharmacologically forced readthroughs based on oligonucleotide exons or stop codons, and theoretically may require only one drug treatment. NHEJ-based gene correction using CRISPR / Cas9-based gene editing systems, along with other engineered nucleases including a wide range of nucleases and zinc finger nucleases, can be combined with other existing in vitro and in vivo platforms for cell and gene-based therapies, in addition to the plasmoid electroporation method described herein. For example, DNA-free genome editing methods can be achieved by delivering CRISPR / Cas9-based gene editing systems via mRNA-based gene transfer or in the form of purified, cell-permeable proteins, avoiding any possibility of insertional mutation induction. [ii)] [Homologous Targeted Repair] []

[0121] Restoring protein expression from endogenous mutant genes can involve homology-directed repair. The methods described above further include delivering a donor template to the cell. The donor template may include a nucleotide sequence encoding a fully functional or partially functional protein. For example, the donor template may include a miniaturized myotensin construct, referred to as a "miniature myotensin" ("microprotein"); a fully functional myotensin construct for restoring the mutant myotensin gene; or a fragment of the myotensin gene that leads to the restoration of the mutant myotensin gene after homology-directed repair. [iii)] [use] [CRISPR] [ / ] [Cas9] [Methods for correcting mutated genes and treating individuals] []

[0122] This invention also relates to genome editing using a CRISPR / Cas9-based gene editing system to restore the expression of fully or partially functional proteins with repair templates or donor DNA, which can replace entire genes or regions containing mutations. The CRISPR / Cas9-based gene editing system can be used to introduce site-specific double-strand breaks at target genomic loci. When the CRISPR / Cas9-based gene editing system uses gRNA to bind to the target DNA sequence, site-specific double-strand breaks are generated, thereby allowing the target DNA to cleave. The CRISPR / Cas9-based gene editing system offers advantages in advanced genome editing due to its high success rate and efficient gene modification. This DNA cleavage can stimulate the natural DNA repair mechanism, resulting in one of two possible repair pathways: homologous targeted repair (HDR) or non-homologous end joining (NHEJ) pathway.

[0123] This invention relates to genome editing using a CRISPR / Cas9-based gene editing system in the absence of a repair template, which can efficiently correct reading frames and restore the expression of functional proteins involved in genetic diseases. The disclosed CRISPR / Cas9-based gene editing system and method may involve correction methods using homology-directed repair or nuclease-mediated non-homologous end joining (NHEJ), which can efficiently correct proliferation-restricted primary cell lines that may not be able to undergo gene correction based on homologous recombination or selection. This strategy integrates the rapid and robust assembly of an active CRISPR / Cas9-based gene editing system with an efficient gene editing method for treating genetic diseases caused by mutations in non-essential coding regions that result in frameshifts, premature stop codons, aberrant splice donor sites, or aberrant splice acceptor sites.

[0124] This invention provides methods for correcting mutated genes in cells and treating individuals suffering from genetic diseases such as DMD. The method may include administering to cells or individuals a CRISPR / Cas9-based gene editing system, a polynucleotide or vector encoding the CRISPR / Cas9-based gene editing system, or a composition of the CRISPR / Cas9-based gene editing system as described above. The method may include administering a CRISPR / Cas9-based gene editing system, such as a Cas9 protein or a Cas9 fusion protein containing a second domain having nuclease activity, a nucleotide sequence encoding the Cas9 protein or Cas9 fusion protein, and / or at least one gRNA wherein the sgRNA targets a different DNA sequence. The target DNA sequences may overlap. The number of gRNAs administered to the cells can be at least 1 gRNA, at least 2 different gRNAs, at least 3 different gRNAs, at least 4 different gRNAs, at least 5 different gRNAs, at least 6 different gRNAs, at least 7 different gRNAs, at least 8 different gRNAs, at least 9 different gRNAs, at least 10 different gRNAs, at least 15 different gRNAs, at least 20 different gRNAs, at least 30 different gRNAs, or at least 50 different gRNAs, as described above. This method can involve homologous targeted repair or non-homologous end conjugation. [c.] [Methods for treating diseases] []

[0125] This invention relates to a method for treating an individual in need. The method comprises administering a gene construct (e.g., a vector) of the invention as described above, or a composition containing the same, to the individual's tissues. In some embodiments, the method may comprise administering a gene construct (e.g., a vector) of the invention as described above, or a composition containing the same, to the individual's skeletal or cardiac muscle. In some embodiments, the method may comprise administering a gene construct (e.g., a vector) of the invention as described above, or a composition containing the same, to the individual's veins. In some embodiments, the individual suffers from skeletal or cardiac muscle conditions or genetic diseases that cause degeneration or weakness. For example, the individual may suffer from Duchenne muscular dystrophy, as described above. [i)] Duchenne muscular dystrophy []

[0126] As described above, this method can be used to correct myotropic protein genes and restore the full or partial functional protein expression of the mutant myotropic protein gene. In some forms and embodiments, the present invention provides a method for alleviating the effects of DMD in patients (e.g., clinical symptoms / indications). In some forms and embodiments, the present invention provides a method for treating DMD in patients. In some forms and embodiments, the present invention provides a method for preventing DMD in patients. In some forms and embodiments, the present invention provides a method for preventing the further development of DMD in patients. [6.] [Structures and Matter] []

[0127] As described above, the composition may comprise one or more gene constructs encoding CRISPR / Cas9-based gene editing systems as disclosed herein. The gene construct (such as plasmids) may comprise nucleic acids encoding CRISPR / Cas9-based gene editing systems, such as at least one of Cas9 protein and / or Cas9 fusion protein and / or gRNA. As described above, the composition may comprise a gene construct encoding a modified AAV vector and a nucleic acid sequence encoding a CRISPR / Cas9-based gene editing system as disclosed herein. The gene construct (such as plasmids) may comprise nucleic acids encoding CRISPR / Cas9-based gene editing systems. As described above, the composition may comprise a gene construct encoding a modified lentiviral vector, as disclosed herein.

[0128] Gene constructs, such as recombinant plasmids or recombinant viral particles, may contain nucleic acids encoding a Cas9 fusion protein and at least one gRNA. In some embodiments, a gene construct may contain nucleic acids encoding a Cas9 fusion protein and at least two different gRNAs. In some embodiments, a gene construct may contain nucleic acids encoding a Cas9 fusion protein and more than two different gRNAs. In some embodiments, a gene construct may contain a promoter operatively linked to a nucleotide sequence encoding at least one gRNA molecule and / or a Cas9 molecule. In some embodiments, the promoter is operatively linked to a nucleotide sequence encoding a first gRNA molecule, a second gRNA molecule, and / or a Cas9 molecule. Gene constructs may exist in cells as functional extrachromosomal molecules. Gene constructs may be linear miniature chromosomes, including centromeres, telomeres, plasmids, or viscous bodies.

[0129] Gene constructs can also be part of the genome of recombinant viral vectors, including recombinant lentiviruses, recombinant adenoviruses, and recombinant adenovirus-associated viruses. Gene constructs can be part of the genetic material of attenuated live microorganisms or recombinant microbial vectors living in cells. Gene constructs may contain regulatory elements for gene expression of nucleic acid coding sequences. Regulatory elements may be promoters, enhancers, start codons, stop codons, or polyadenylation signals.

[0130] In some embodiments, the gene construct is a vector. The vector may be an adeno-associated virus (AAV) vector encoding at least one Cas9 molecule and at least one gRNA molecule; the vector is capable of expressing at least one Cas9 molecule and at least one gRNA molecule in mammalian cells. The vector may be a plastid. The vector can be used for in vivo gene therapy. The vector may be recombinant. The vector may contain a heterologous nucleic acid encoding a fusion protein, such as a Cas9 fusion protein-based or CRISPR / Cas9-based gene editing system. The vector may be a plastid. The vector is suitable for transfecting cells with nucleic acids encoding a Cas9 fusion protein-based or CRISPR / Cas9-based gene editing system, and for culturing and maintaining the transfected host cells under conditions in which expression of a Cas9 fusion protein-based or CRISPR / Cas9-based gene editing system occurs.

[0131] It can be optimized for coding sequence stability and higher performance levels. In some cases, codons are selected to reduce the formation of RNA secondary structures, such as those formed due to intramolecular binding.

[0132] The vector may contain a heterologous nucleic acid encoding a CRISPR / Cas9-based gene editing system and may further contain a start codon upstream of the CRISPR / Cas9-based gene editing system coding sequence and a stop codon downstream of the CRISPR / Cas9-based gene editing system coding sequence. The start and stop codons may be within a frame containing the CRISPR / Cas9-based gene editing system coding sequence. The vector may also contain a promoter operatively linked to the CRISPR / Cas9-based gene editing system coding sequence. Promoters operatively linked to coding sequences of CRISPR / Cas9-based gene editing systems can be promoters derived from simian virus 40 (SV40), mouse mammary cancer virus (MMTV) promoters, human immunodeficiency virus (HIV) promoters (such as the bovine immunodeficiency virus (BIV) long terminal repeat (LTR) promoter), Moloney virus promoters, avian leukosis virus (ALV) promoters, cytomegalovirus (CMV) promoters (such as the CMV Immediate Early Promoter (CMV-IE)), Epstein-Barr virus (EBV) promoters, U6 promoters (such as the human U6 promoter), or Rous sarcoma virus (RSV) promoters. Promoters can also be derived from human genes, such as human actin C (hUbC), human myosin, human hemoglobin, human muscle creatine, or human metallothionein promoters. Promoters can also be natural or synthetic tissue-specific promoters, such as muscle or skin-specific promoters. Examples of such promoters are described in U.S. Patent Application Publication Nos. US20040175727 and US20040192593, the contents of which are incorporated herein by reference in their entirety. Examples of muscle-specific promoters include the Spc5-12 promoter (described in U.S. Patent Application Publication No. 20040192593, which is incorporated herein by reference in its entirety; Hakim et al. Mol. Ther. Methods Clin. Dev. (2014) 1:14002; and Lai et al. Hum Mol Genet. (2014) 23(12): 3189-3199); the MHCK7 promoter (described in Salva et al. Mol. Ther. (2007) 15:320-329); the CK8 promoter (described in Park et al. PLoS ONE (2015) 10(4): e0124914); and the CK8e promoter (described in Muir et al. Mol. Ther. Methods Clin. Dev. (2014) 1:14025).In some embodiments, the expression of gRNA and / or Cas9 protein is driven by tRNA.

[0133] Each of the polynucleotide sequences encoding the gRNA molecule and / or the Cas9 molecule can be operatively linked to a promoter. The promoters operatively linked to the gRNA molecule and / or the Cas9 molecule can be the same promoter. The promoters operatively linked to the gRNA molecule and / or the Cas9 molecule can be different promoters. The promoters can be constitutive promoters, inducible promoters, repressive promoters, or regulated promoters. The promoters can be tissue-specific promoters. Tissue-specific promoters can be muscle-specific promoters. The promoters can be, for example, the CK8 promoter, the Spc512 promoter, or the MHCK7 promoter.

[0134] The vector may also contain a polyadenylation signal, which can be located downstream of a CRISPR / Cas9-based gene editing system. The polyadenylation signal can be an SV40 polyadenylation signal, an LTR polyadenylation signal, a bovine growth hormone (bGH) polyadenylation signal, a human growth hormone (hGH) polyadenylation signal, or a human β-hemoglobin polyadenylation signal. The SV40 polyadenylation signal can be a polyadenylation signal derived from the pCEP4 vector (Invitrogen, San Diego, CA).

[0135] The vector may also contain an upstream enhancer of a CRISPR / Cas9-based gene editing system, namely a Cas9 protein or Cas9 fusion protein coding sequence or sgRNA, or a CRISPR / Cas9-based gene editing system. The enhancer may be essential for DNA expression. The enhancer sequence may be human actin, human myosin, human hemoglobin, human muscle creatine, or a viral enhancer, such as enhancers from CMV, HA, RSV, or EBV. Polynucleotide functional enhancers are described in U.S. Patents 5,593,972, 5,962,428, and WO94 / 016737, the contents of which are incorporated herein by reference in their entirety. The vector may also contain a mammalian origin of replication to maintain the vector extrachromosomally and produce multiple copies of the vector in the cell. The vector may also contain regulatory sequences that may be highly suitable for gene expression in mammalian or human cells to which the vector is delivered. The vector may also contain a reporter gene, such as a green fluorescent protein (“GFP”) and / or an optional marker, such as hygromycin (“Hygro”).

[0136] Vectors can be expression vectors or systems that produce proteins using conventional techniques and readily available starting materials, including Sambrook et al., Molecular Cloning and Laboratory Manual, 2nd ed., Cold Spring Harbor (1989), which is incorporated herein by reference in its entirety. In some embodiments, the vector may contain nucleic acid sequences encoding a CRISPR / Cas9-based gene editing system, including nucleic acid sequences encoding a Cas9 protein or a Cas9 fusion protein and nucleic acid sequences encoding at least one gRNA. [7.] [Pharmaceutical Compositions] []

[0137] The subject of this invention provides compositions comprising the aforementioned gene constructs. Pharmaceutical compositions as detailed herein can be formulated according to the administration method to be used. In the case of injectable pharmaceutical compositions, they are sterile, pyrogen-free, and particulate-free. Isotonic formulations are preferred. Generally, isotonic additives may include sodium chloride, dextran, mannitol, sorbitol, and lactose. In some cases, isotonic solutions, such as phosphate-buffered saline, are preferred. Stabilizers include gelatin and albumin. In some embodiments, a vasoconstrictor is added to the formulation.

[0138] The composition may further comprise pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients may be functional molecules in the form of mediators, adjuvants, carriers, or diluents. Pharmaceutically acceptable excipients may be transfection promoters, which may include surfactants such as immunostimulatory complexes (ISCOMS), Freunds incomplete adjuvants, LPS analogs including monophosphatidyllipid A, cell wall acetyl peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanionic, polycationic, or nanoparticles, or other known transfection promoters.

[0139] Transfection promoters are polyanionic or polycationic, including poly-L-glutamic acid (LGS) or lipids. More preferably, the poly-L-glutamic acid is present in the composition for genome editing in skeletal or cardiac muscle at a concentration of less than 6 mg / ml. Transfection promoters may also include surfactants such as immunostimulatory complexes (ISCOMS), Freund's incomplete adjuvants, LPS analogs including monophosphatidyllipid A, cell wall acetyl peptides, quinone analogs, and vesicles (such as squalene and squalene), which may also be bound to the gene construct for administration. In some embodiments, the DNA vector encoding the composition may also include transfection promoters such as lipids, liposomes (including liposomes known in the art or other liposomes), in the form of a DNA-liposome mixture (see, for example, International Patent Publication No. WO9324640), calcium ions, viral proteins, polyanionic, polycationic, or nanoparticles or other known transfection promoters. Preferably, the transfection promoter is a polyanionic or polycationic agent, including poly-L-glutamic acid (LGS) or lipids. [8.] [Delivery Method] []

[0140] This document provides a method for delivering gene constructs (e.g., vectors) or compositions thereof of the present invention into cells. Delivery of the composition may be by transfection or electroporation of the composition as a nucleic acid molecule expressed in the cell and delivered to the cell surface. The nucleic acid molecule may be electroporated using a BioRad gene pulse generator or an Amaxa nuclear transfection IIb device. Several different buffers may be used, including BioRad electroporation solution, Sigma phosphate-buffered saline product #D8537 (PBS), Invitrogen OptiMEM I (OM), or Amaxa Nucleofector solution V (NV). Transfection may include transfection reagents such as lipoamine 2000.

[0141] After the gene construct or composition of the present invention is delivered to a tissue and the vector is subsequently delivered to mammalian cells, the transfected cells will express gRNA molecules and Cas9 molecules. The gene construct or composition can be administered to mammals to alter gene expression or reengineer or modify the genome. For example, the gene construct or composition can be administered to mammals to correct myotropic protein genes in mammals. Mammals can be humans, non-human primates, cows, pigs, sheep, goats, antelopes, bison, buffalo, cattle, deer, hedgehogs, elephants, llamas, alpacas, mice, rats, or chickens, and are preferably humans, cows, pigs, or chickens.

[0142] Gene constructs (e.g., vectors) encoding gRNA and Cas9 molecules can be delivered to mammals via DNA injection (also known as DNA vaccination), with or without in vivo electroporation, liposome-mediated delivery, nanoparticle-assisted delivery, and / or recombinant vectors. Recombinant vectors can be delivered using any viral modality. Viral modalities may include recombinant lentiviruses, recombinant adenoviruses, and / or recombinant adeno-associated viruses.

[0143] The gene constructs (e.g., vectors) or compositions comprising them of the present invention can be introduced into cells to genetically correct myotrophin genes (e.g., human myotrophin genes). In some embodiments, the gene constructs (e.g., vectors) or compositions comprising them of the present invention are introduced into myoblasts derived from DMD patients. In some embodiments, the gene constructs (e.g., vectors) or compositions comprising them are introduced into fibroblasts derived from DMD patients, and the genetically corrected fibroblasts can be treated with MyoD to induce differentiation into glioblasts, which can be implanted into an individual, such as in damaged muscle, to verify the functionality of the corrected myotrophin protein and / or to treat the individual. The modified cells can also be stem cells, such as induced pluripotent stem cells, bone marrow-derived progenitor cells, skeletal muscle progenitor cells, human skeletal myoblasts derived from DMD patients, CD133+ cells, angiogenic cells, and MyoD- or Pax7-transduced cells or other myogenic progenitor cells. For example, CRISPR / Cas9-based gene editing systems can induce neuronal or myogenic differentiation in induced pluripotent stem cells. [9.] [Investment method] []

[0144] The gene constructs (e.g., vectors) of the present invention, or compositions comprising them, can be administered to individuals via various routes, including oral, non-enteral, sublingual, percutaneous, transrectal, mucosal, surface, via inhalation, via buccal administration, intrapleural, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal sheath, and intra-articular, or combinations thereof. In some embodiments, the gene constructs (e.g., vectors) or compositions of the present invention are administered to individuals (e.g., individuals with DMD) via intramuscular, intravenous, or combinations thereof. For veterinary use, the gene constructs (e.g., vectors) or compositions of the present invention can be administered as suitable and acceptable formulations according to normal veterinary practice. Veterinarians can easily determine the dosing regimen and route of administration most suitable for a particular animal. The compositions can be administered by conventional syringes, needle-free injection devices, microprojectile bombardment-gone guns, or other physical methods (such as electroporation (“EP”), hydrodynamic methods), or ultrasound.

[0145] The gene constructs (e.g., vectors) or compositions of the present invention can be delivered to mammals using several techniques, including DNA injection (also known as DNA vaccination), with or without in vivo electroporation, liposome-mediated delivery, nanoparticle-assisted delivery, and / or recombinant vectors (such as recombinant lentiviruses, recombinant adenoviruses, and recombinant adenovirus-associated viruses). The compositions can be injected into skeletal or cardiac muscle. For example, the compositions can be injected into the anterior tibialis muscle or tail.

[0146] In some embodiments, the gene constructs (e.g., vectors) or combinations thereof of the present invention are administered by: 1) intravenous injection (systemic) into adult mice via the tail vein; 2) intramuscular injection, for example, local injection into the gastrocnemius muscle of TA or adult mice; 3) intraperitoneal injection into P2 mice; or 4) intravenous injection (systemic) into P2 mice via the face vein. [10.] [Cell type] []

[0147] Any of these delivery methods and / or administration routes can be used with a variety of cell types. Cell types may include, but are not limited to, immortalized myoblasts, such as wild-type and DMD patient-derived lines, such as Δ48-50 DMD cells, DMD 6594 (Δ48-50 cells), DMD 8036 (Δ48-50 cells), C25C14 and DMD-7796 cell lines, primitive DMD dermal fibroblasts, induced pluripotent stem cells, bone marrow-derived progenitor cells, skeletal muscle progenitor cells, human skeletal myoblasts from DMD patients, CD133+ cells, angiogenesis, cardiomyocytes, hepatocytes, chondrocytes, mesenchymal progenitor cells, hematopoietic stem cells, smooth muscle cells, and cells transduced with MyoD or Pax7, or other myogenic progenitor cells. Immortification of human myoblasts can be used for the pure line derivation of genetically corrected myoblasts. Cells can be modified in vitro to isolate and expand pure populations of immortalized DMD myoblasts, including genetically corrected myoblast genes free of mutations introduced by other nucleases in the protein-coding regions of the genome. Alternatively, transient in vivo delivery of CRISPR / Cas9-based systems via non-viral or non-integrating viral gene transfer or by direct delivery of purified proteins and gRNA containing cell-penetrating motifs may enable highly specific in situ correction with minimal or no risk of exogenous DNA integration. [11.] Set []

[0148] This document provides a kit for correcting mutant myokinin genes. The kit includes at least one gRNA for correcting mutant myokinin genes and instructions for using a CRISPR / Cas9-based gene editing system. This document also provides a kit for genome editing of myokinin genes in skeletal or cardiac muscle. This kit includes a gene construct (e.g., a vector) or a composition containing the same for genome editing in skeletal or cardiac muscle as described above, and instructions for using the composition.

[0149] The instruction manual included in the kit may be attached to the packaging material or included as a pharmaceutical instruction manual. While such instruction manuals are typically written or printed materials, they are not limited thereto. This invention covers any medium capable of storing such instruction manuals and conveying them to the end user. Such media include, but are not limited to, electronic storage media (e.g., disks, tapes, cartridges, chips), optical media (e.g., CD-ROMs), and the like. As used herein, the term "instruction manual" may include the address of an internet location providing the instruction manual.

[0150] Gene constructs (e.g., vectors) or compositions comprising them for genome editing of mutant myokinin or myokinin genes in skeletal or cardiac muscle may include modified AAV vectors comprising gRNA molecules and Cas9 molecules that specifically bind to and cleave regions of the myokinin gene as described above. As mentioned above, CRISPR / Cas9-based gene editing systems may be included in a kit to specifically bind to and target specific regions of the mutant myokinin gene. The kit may further include donor DNA, different gRNAs, or transgenic genes, as described above. [12.] [Example] []

[0151] Those skilled in the art will readily recognize that other suitable modifications and adaptations to the methods of the invention described herein are readily applicable and obvious, and can be made using suitable equivalents without departing from the scope of the invention or the forms and embodiments disclosed herein. The invention has now been described in detail, and will be more clearly understood with reference to the following examples, which are intended only to illustrate some forms and embodiments of the invention and should not be considered as limiting the scope of the invention. All journal references, US patents, and publications mentioned herein are hereby incorporated by full citation.

[0152] The present invention details several embodiments and forms illustrated by the following non-limiting examples. [Example] [1] [] [Dual-carrier system] []

[0153] The conventional CRISPR / Cas9 system used to treat DMD typically includes more than one vector ( [picture] [6], [picture] [7]). For example, one vector may encode the Cas9 protein, and a second vector may encode two gRNAs. As another example, one vector may encode the Cas9 protein and a first gRNA, and a second vector may encode the Cas9 protein and a second gRNA.

[0154] A schematic diagram of an experiment using multiple vectors to excise exons 45-55 of myopoietic protein in mice is shown below. [picture] [3], where the results are shown in [picture] [4] [picture] [5] and [picture]

[10] In this study, newborn mice were treated with a dual-carrier system via systemic / transient intravenous injection. Tissues were collected 8 weeks after treatment. [picture] As shown in [4], PCR and sequencing confirmed the deletion of the mutation hotspot exons 45-55. Additional results are shown in [picture]

[10] Among them, the AAV-CRISPR target control locus ( [picture]

[10] , top image) or target exon 45-55 ( [picture]

[10] (base map) shows extensive myoglobin expression observed in the myocardium after deletion of exons 45-55, but not observed in mice treated with sham vectors. [Example] [2] [Validation of the dual-carrier system therapy] []

[0155] Immortalized myoblasts isolated from DMD patients were used for additional validation of the CRISPR-based method for restoring the functional myoblastic protein gene using a dual-vector approach as described in Example 1. The immortalized myoblasts contained deletions in exons 48-50, resulting in an out-of-frame mutation (…). [picture] [9A]). The patient's myoblasts were transfected with the same AAV plastids used in the HEK293 in vitro experiment in Example 1.

[0156] PCR analysis of deletions in genomic DNA and cDNA revealed effective deletions in exons 45-55, which was confirmed by Sanger sequencing. [picture] [9B]). Western ink dot method visualization of cell lysates showed that, compared to a positive control consistent with hotspot deletion, untreated myoblasts did not produce myoglobin protein, while transfected myoblasts exhibited smaller amounts of myoglobin protein (…). [picture] [9C]). These results also provide the following in vitro validation: the dual-vector construct can be used to edit human mutations and restore myoglobin expression. [Example] [3] [] [Components used in multi-purpose carriers]

[0157] Developing a vector CRISPR / Cas9 system for the treatment of DMD [picture] [6], [picture] [7]). The advantages of a single-vector system may include: all necessary editing components on a single vector; the ability to increase effective dosage; simplified production of other vectors (single therapeutic agent); the use / incorporation of muscle-specific promoters (CK8, Spc512, MHCK7); and the ability to combine targeted exons with large deletions (by altering the guide sequence). A schematic diagram of the developed all-in-one vector is shown in […]. [picture] [8] . Sequences included in some or all of the allotransmitters described herein are shown in [surface] [1] in. [picture]

[12] 、 [picture]

[13] and [picture]

[14] Results of testing these constructs in mdx mice are shown. The multi-construct vectors are further detailed in Examples 4-7. [surface] [1] [Components] [sequence] AAV ITR CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO:1) JCR143: The guide sequence RNA targeting the intron 44 region of human myokinin ACATTTCCTCTCTATACAAATG (SEQ ID NO:2) JCR120: The guide sequence RNA targeting the intron 55 region of human myokinin ATATAGTAATGAAATTATTGGCAC (SEQ ID NO:3) SaCas9 guide RNA backbone TCTCGCCAACAAGTTGACGAGATAAACACGGCATTTTGCCTTGTTTTAGTAGATTCTGTTTCCAGAGTACTAAAAC (SEQ ID NO:4) [] U6 Starter GGTGTTTCGTCCTTTCCACAAGATATATAAAGCCAAGAAATCGAAATACTTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAATTATTACTTTCTACGTCACGTATTTTGTACTAATATCTTTGTGTTTACAGTCAAATTAATTCCAATTATCTCTCTAACAGCCTTGTATCGTATATGCAAATATGAAGGAATCATGGGAAATAGGCCCTC (SEQ ID NO:5) H1 promoter GAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCAC (SEQ ID NO: 6) EFS promoter TCGAGTGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGACCGCGG (SEQ ID NO:7) CK8 promoter CTAGACTAGCATGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTCTAAAAATAACCCTGCATGCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCCAGCCAG (SEQ ID NO:8) Spc512 promoter GAGCTCCACCGCGGTGGCGGCCGTCCGCCTTCGGCACCATCCTCACGACACCCAAATATGGCGACGGGTGAGGAATGGTGGGGAGTTATTTTTAGAGCGGTGAGGAAGGTGGGCAGGCAGCAGGTGTTGGCGCTCTAAAAATAACTCCCGGGAGTTATTTTTAGAGCGGAGGAATGGTGGACACCCAAATATGGCGACGGTTCCTCACCCGTCGCCATATTTGGGTGTCCGCCCTCGGCCGGGGCCGCATTCCTGGGGGCCGGGCGGTGCTCCCGCCCGCCTCGATAAAAGGCTCCGGGGCCGGCGGCGGCCCACGAGCTACCCGGAGGAGCGGGAGGCGCCAAGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATAT (SEQ ID NO:9) MHCK7 promoter GTTTAAACAAGCTTGCATGTCTAAGCTAGACCCTTCAGATTAAAAATAACTGAGGTAAGGGCCTGGGTAGGGGAGGTGGTGTGAGACGCTCCTGTCTCTCCTCTATCTGCCCATCGGCCCTTTGGGGAGGAGGAATGTGCCCAAGGACTAAAAAAAGGCCATGGAGCCAGAGGGGCGAGGGCAACAGACCTTTCATGGGCAAACCTTGGGGCCCTGCTGTCTAGCATGCCCCACTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTCTAAAAATAACCCTGTCCCTGGTGGATCCCCTGCATGCGAAGATCTTCGAACAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCCAGCCAGCGGCGCGCCC (SEQ ID NO:10) SaCas9 Miniature polyadenylation signal TAGCAATAAAGGATCGTTTATTTTCATTGGAAGCGTGTGTTGGTTTTTTGATCAGGCCGG (SEQ ID NO:12) bGH polyadenylation signaling CTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGA (SEQ ID NO:13) SV40 intron TCTAGAGGATCCGGTACTCGAGGAACTGAAAAACCAGAAAGTTAACTGGTAAGTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTGTCCCTCAGTGGATGTTGCCTTTACTTCTAGGCCTGTACGGAAGTGTTAC (SEQ ID NO: 24) [Example] [4] All-in-one carrier 1 (versions 1 and 2) []

[0158] Vector 1 contains gRNA targeted by exons 45-55, in which all promoters (U6, H1 and SaCas9 driven) are in the positive direction and polyadenylation signaling is used for SaCas9.

[0159] Version 1 of vector 1 contains an EFS constitutive promoter. The sequence of version 1 of vector 1 is in SEQ ID NO: 14.

[0160] Version 2 of vector 1 contains the CK8 constitutive promoter. The sequence of version 2 of vector 1 is in SEQ ID NO: 15. [Example] [5] [] [All-in-one carrier] [2] [] [(] [Version] [1] [-] [4] [)] []

[0161] Vector 2 contains gRNA targeted by exons 45-55, wherein the U6 promoter is in the opposite direction to the SaCas9-driven promoter and the polyadenylation signal is used for SaCas9.

[0162] Version 1 of vector 2 contains an EFS constitutive promoter. The sequence of version 1 of vector 2 is in SEQ ID NO: 16.

[0163] Version 2 of vector 2 contains the CK8 constitutive promoter. The sequence of version 2 of vector 2 is as shown in SEQ ID NO: 17.

[0164] Version 3 of vector 2 contains the Spc512 promoter. The sequence of version 3 of vector 2 is the same as that in SEQ ID NO: 18.

[0165] Version 4 of vector 2 contains the MHCK7 promoter. The sequence of version 4 of vector 2 is the same as that in SEQ ID NO: 19. [Example] [6] [] [All-in-one carrier] [3] [] [(] [Version] [1] [-] [4] [)] []

[0166] Vector 3 contains gRNA targeted by exons 45-55, in which the U6 promoter is in the opposite direction to the SaCas9-driven promoter and the polyadenylation signal is used for SaCas9.

[0167] Version 1 of vector 3 contains an EFS constitutive promoter. The sequence of version 1 of vector 3 is the same as that in SEQ ID NO: 20.

[0168] Version 2 of vector 3 contains the CK8 promoter. The sequence of version 2 of vector 3 is the same as that in SEQ ID NO: 21.

[0169] Version 3 of vector 3 contains the Spc512 promoter. The sequence of version 3 of vector 3 is the same as that in SEQ ID NO: 22.

[0170] Version 4 of vector 3 contains the MHCK7 promoter. The sequence of version 4 of vector 3 is the same as that in SEQ ID NO: 23. [Example] [7] [] [All-in-one carrier] [5] [(] [Version] [1] [-] [4] [)]

[0171] After screening a set of all-in-one vector designs to determine the roles of the guiding placement, modulating elements, and Pol-III promoter, a new set of all-in-one vectors with constitutive and muscle-specific promoters was generated. [picture]

[11] ). Version 5 of the all-in-one carrier includes the SV40 intron (see SEQ ID NO: 24) and the placement of different elements.

[0172] Version 1 of vector 5 includes a constitutive promoter. The sequence of version 1 of vector 5 is as in SEQ ID NO: 41.

[0173] Version 2 of carrier 5 includes the CK8 promoter. The sequence of version 2 of carrier 5 is as shown in SEQ ID NO: 42.

[0174] Version 3 of vector 5 includes the Spc-512 promoter. The sequence of version 3 of vector 5 is as shown in SEQ ID NO: 29.

[0175] Version 4 of carrier 5 includes the MHCK7 promoter. The sequence of version 4 of carrier 5 is as shown in SEQ ID NO: 30. ***

[0176] The foregoing description of specific embodiments thus fully reveals the generality of the invention: without departing from the general concept of the invention, others can easily modify and / or adapt these specific embodiments for various applications by applying the knowledge known to those skilled in the art, without excessive experimentation. Therefore, based on the teachings and guidance presented herein, such adaptations and modifications are intended to be within the meaning and scope of equivalents of the disclosed embodiments. It should be understood that the wording or terminology used herein is for descriptive and not limiting purposes, and that the terminology or terminology in this specification is to be interpreted by those skilled in the art in accordance with the teachings and guidance.

[0177] The scope and range of this invention should not be limited by any of the above-described exemplary embodiments, but should be defined solely by the following claims and their equivalents.

[0178] All publications, patents, patent applications and / or other documents cited in this application are incorporated herein by reference in their entirety for all purposes, as if individually indicated that each publication, patent, patent application and / or other document were incorporated by reference for all purposes. []

[0179] For the sake of completeness, various embodiments of the present invention are described in the following numbered entries:

[0180] Clause 1. A CRISPR-Cas system comprising a vector encoding one or more compositions comprising: (a) a first guide RNA (gRNA) molecule targeting myoglobin intron 44; (b) a second gRNA molecule targeting myoglobin intron 55; and (c) a Cas9 protein; and (d) one or more Cas9 gRNA backbones.

[0181] Clause 2. A system as described in Clause 1, wherein the system comprises a single carrier.

[0182] Clause 3. The system of Clause 1, wherein the system comprises two or more carriers, wherein the two or more carriers comprise a first carrier and a second carrier.

[0183] Clause 4. The system of Clause 3, wherein (a) the first vector encodes a first gRNA molecule and a second gRNA molecule; and (b) the second vector encodes the Cas9 protein.

[0184] Clause 5. The system as described in Clause 3, wherein (a) the first vector encodes a first gRNA molecule; and (b) the second vector encodes a second gRNA molecule.

[0185] Section 6. The system as described in Section 5, wherein the first vector further encodes the Cas9 protein.

[0186] Section 7. The system as described in Section 5 or 6, wherein the second vector further encodes the Cas9 protein.

[0187] Item 8. The system of any of Items 1 to 7, wherein the expression of the Cas9 protein is driven by a constitutive promoter or a muscle-specific promoter.

[0188] Section 9. The system as described in Section 8, wherein the muscle-specific promoter includes the MHCK7 promoter, the CK8 promoter, or the Spc512 promoter.

[0189] Article 10. The system as described in Article 2, wherein a single vector encodes a first gRNA molecule, a second gRNA molecule, and a Cas9 protein.

[0190] Clause 11. A system as described in any of Clauses 1 to 10, wherein the carrier comprises at least one bidirectional promoter.

[0191] Clause 12. The system of Clause 11, wherein the bidirectional promoter comprises: a first promoter driving the expression of a first gRNA molecule and / or a second gRNA molecule; and a second promoter driving the expression of the Cas9 protein.

[0192] Article 13. The system of any one of Articles 1 to 12, wherein the first gRNA targets the polynucleotide of SEQ ID NO: 2 or its 5' truncated form.

[0193] Article 14. The system of any one of Articles 1 to 13, wherein the second gRNA targets the polynucleotide of SEQ ID NO: 3 or its 5' truncated form.

[0194] Article 15. The system of any one of Articles 1 to 14, wherein the Cas9 protein is SpCas9, SaCas9 or St1Cas9.

[0195] Article 16. The system of any of Articles 1 to 15, wherein the Cas9 gRNA backbone is the SaCas9 gRNA backbone.

[0196] Article 17. The system of Article 16, wherein the SaCas9 gRNA backbone comprises or is encoded by the polynucleotide of SEQ ID NO: 4.

[0197] Article 18. The system of any one of Articles 1 to 17, wherein the Cas9 protein is the SaCas9 protein encoded by the polynucleotide of SEQ ID NO: 11.

[0198] Article 19. The system of any one of Articles 1 to 18, wherein the carrier comprises at least one polynucleotide selected from SEQ ID NO: 1-13 and 24. []

[0199] Article 20. The system of any one of Articles 1 to 19, wherein the vector comprises the polynucleotide sequence of SEQ ID NO: 24.

[0200] Article 21. The system of any one of Articles 1 to 20, wherein the vector comprises a polynucleotide sequence selected from the following: SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:29 and SEQ ID NO:30.

[0201] Article 22. A system as described in any of Articles 1 to 21, wherein the vector is a virus vector.

[0202] Article 23. The system of any one of Articles 1 to 22, wherein the vector is an adeno-associated virus (AAV) vector.

[0203] Clause 24. The system of Clause 23, wherein the AAV carrier is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13 or AAVrh.74.

[0204] Article 25. The system of any one of Articles 1 to 24, wherein the vector contains a universally available promoter or a tissue-specific promoter operatively linked to a polynucleotide sequence encoding a first gRNA molecule, a second gRNA molecule and / or the Cas9 protein.

[0205] Section 26. The system as described in Section 25, wherein the tissue-specific promoter is a muscle-specific promoter.

[0206] Article 27. A cell comprising any one of the systems described in Articles 1 to 26.

[0207] Article 28. A set comprising a system as described in any one of Articles 1 to 26.

[0208] Article 29. A method for correcting a mutated myoglobin gene in a cell, the method comprising administering to the cell any one of Articles 1 to 26.

[0209] Article 30. A method for mutating the myoglobin gene in a genome-edited individual, the method comprising administering to the individual a system as described in any one of Articles 1 to 26 or a cell as described in Article 27.

[0210] Article 31. A method for treating an individual with a mutated myotensin gene, the method comprising administering to the individual a system as described in any one of Articles 1 to 26 or a cell as described in Article 27.

[0211] Article 32. The method of Article 30 or 31, wherein the system or the cell line is administered to the individual via intramuscular, intravenous or combination thereof. [sequence] [] SEQ ID NO: 1,AAV ITR SEQ ID NO: 2, JCR143: DNA target sequence for gRNA targeting the 44 region of human myokinin intron. SEQ ID NO: 3, JCR120: DNA target sequence for gRNA targeting the 55 region of human myokinin intron. SEQ ID NO: 4, SaCas9 guide RNA backbone, gRNA backbone SEQ ID NO: 5, U6 promoter SEQ ID NO: 6,H1 promoter SEQ ID NO: 7, EFS promoter SEQ ID NO: 8, CK8 promoter SEQ ID NO: 9, Spc512 promoter SEQ ID NO: 10, MHCK7 promoter SEQ ID NO: 11, encoding a polynucleotide of SaCas9 SEQ ID NO: 12, Miniature polyadenylation signal SEQ ID NO: 13, bGH polyadenylation signal SEQ ID NO:14, Version 1 of Carrier 1 SEQ ID NO:15, Version 2 of Carrier 1 SEQ ID NO: 16, Version 1 of Carrier 2 SEQ ID NO: 17, Version 2 of Carrier 2 SEQ ID NO: 18, Version 3 of Carrier 2 SEQ ID NO: 19, Version 4 of Carrier 2 SEQ ID NO: 20, Version 1 of Carrier 3 SEQ ID NO: 21, Version 2 of Carrier 3 SEQ ID NO: 22, Version 3 of Carrier 3 SEQ ID NO: 23, Version 4 of Carrier 3 SEQ ID NO: 24, encoding a polynucleotide of the SV40 intron. SEQ ID NO: 25 NNGRR (R = A or G; N can be any nucleotide residue, such as any of A, G, C or T) SEQ ID NO: 26 NNGRRN (R = A or G, N can be any nucleotide residue, such as any of A, G, C or T) SEQ ID NO: 27 NNGRRT (R = A or G, N can be any nucleotide residue, such as any of A, G, C or T) SEQ ID NO: 28 NNGRRV (R = A or G, N can be any nucleotide residue, such as any of A, G, C or T) SEQ ID NO: 29, Version 3 of Carrier 5 SEQ ID NO: 30, Version 4 of Carrier 5 SEQ ID NO: 31, encoding a codon-optimized polynucleotide of Staphylococcus aureus Cas9 SEQ ID NO: 32, encoding codon-optimized polynucleotide of Staphylococcus aureus Cas9 SEQ ID NO: 33, encoding codon-optimized polynucleotide of Staphylococcus aureus Cas9 SEQ ID NO: 34, encoding codon-optimized polynucleotide of Staphylococcus aureus Cas9 SEQ ID NO: 35, encoding codon-optimized polynucleotide of Staphylococcus aureus Cas9 SEQ ID NO: 36, encoding codon-optimized polynucleotide of Staphylococcus aureus Cas9 SEQ ID NO: 37, Polynucleotide sequence of Staphylococcus aureus Cas9 SEQ ID NO: 38,pDO242 (SaCas9 is used in all JCR89 / 91 and JCR157 / 160 programs for in vitro work, SaCas9 is capitalized) SEQ ID NO: 39, Amino acid sequence of Staphylococcus aureus Cas9 molecule SEQ ID NO: 40, Amino acid sequence of Staphylococcus aureus Cas9 SEQ ID NO: 41, Version 1 of Carrier 5 SEQ ID NO: 42, Version 2 of Carrier 5

[0212] [Supplementary sequence list] <![CDATA[ <110> Duke University, USA <![CDATA[ <120> AAV vector-mediated deletion of a large mutation hotspot for the treatment of Duchenne muscular dystrophy <![CDATA[ <130> TW109112555]]> <![CDATA[ <150> US 62 / 833,760 <![CDATA[ <151> 2019-04-14 <![CDATA[ <160> 42 ]]> <![CDATA[ <170> PatentIn version 3.5]]> <![CDATA[ <210> 1]]> <![CDATA[ <211> 130]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthesis <![CDATA[ <400> 1]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct 130 <![CDATA[ <210> 2]]> <![CDATA[ <211> 22]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthesis <![CDATA[ <400> 2]]> acatttcctc tctatacaaa tg 22 <![CDATA[ <210> 3]]> <![CDATA[ <211> 24]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthesis <![CDATA[ <400> 3]]> atatagtaat gaaattattg gcac 24 <![CDATA[ <210> 4]]> <![CDATA[ <211> 76]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthesis <![CDATA[ <400> 4]]> tctcgccaac aagttgacga gataaacacg gcattttgcc ttgttttagt agattctgtt 60 tccagagtac taaaac 76 <![CDATA[ <210> 5]]> <![CDATA[ <211> 249]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 5]]> ggtgtttcgt cctttccaca agatatataa agccaagaaa tcgaaatact ttcaagttac 60 ggtaagcata tgatagtcca ttttaaaaca taattttaaa actgcaaact acccaagaaa 120 ttattacttt ctacgtcacg tattttgtac taatatcttt gtgtttacag tcaaattaat 180 tccaattatc tctctaacag ccttgtatcg tatatgcaaa tatgaaggaa tcatgggaaa 240 taggccctc 249 <![CDATA[<210> 6]]> <![CDATA[<211> 215]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 6]]> gaacgctgac gtcatcaacc cgctccaagg aatcgcgggc ccagtgtcac taggcgggaa 60 cacccagcgc gcgtgcgccc tggcaggaag atggctgtga gggacagggg agtggcgccc 120 tgcaatattt gcatgtcgct atgtgttctg ggaaatcacc ataaacgtga aatgtctttg 180 gatttgggaa tcttataagt tctgtatgag accac 215 <![CDATA[<210> 7]]> <![CDATA[<211> 252]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthesis]]> <![CDATA[<400> 7]]> tcgagtggct ccggtgcccg tcagtgggca gagcgcacat cgcccacagt ccccgagaag 60 ttggggggag gggtcggcaa ttgaaccggt gcctagagaa ggtggcgcgg ggtaaactgg 120 gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata 180 agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggtg 240 tcgtgaccgc gg 252 <![CDATA[<210> 8]]> <![CDATA[<211> 449]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthesis]]> <![CDATA[<400> 8]]> ctagactagc atgctgccca tgtaaggagg caaggcctgg ggacacccga gatgcctggt 60 tataattaac ccagacatgt ggctgccccc ccccccccaa cacctgctgc ctctaaaaat 120 aaccctgcat gccatgttcc cggcgaaggg ccagctgtcc cccgccagct agactcagca 180 cttagtttag gaaccagtga gcaagtcagc ccttggggca gcccatacaa ggccatgggg 240 ctgggcaagc tgcacgcctg ggtccggggt gggcacggtg cccgggcaac gagctgaaag 300 ctcatctgct ctcaggggcc cctccctggg gacagcccct cctggctagt cacaccctgt 360 aggctcctct atataaccca ggggcacagg ggctgccctc attctaccac cacctccaca 420 gcacagacag acactcagga gccagccag 449 <![CDATA[<210> 9]]> <![CDATA[<211> 387]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 9]]> gagctccacc gcggtggcgg ccgtccgcct tcggcaccat cctcacgaca cccaaatatg 60 gcgacgggtg aggaatggtg gggagttatt tttagagcgg tgaggaaggt gggcaggcag 120 caggtgttgg cgctctaaaa ataactcccg ggagttattt ttagagcgga ggaatggtgg 180 acacccaaat atggcgacgg ttcctcaccc gtcgccatat ttgggtgtcc gccctcggcc 240 ggggccgcat tcctgggggc cgggcggtgc tcccgcccgc ctcgataaaa ggctccgggg 300 ccggcggcgg cccacgagct acccggagga gcgggaggcg ccaagctcta gaactagtgg 360 atcccccggg ctgcaggaat tcgatat 387 <![CDATA[<210> 10]]> <![CDATA[<211> 810]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 10]]> gtttaaacaa gcttgcatgt ctaagctaga cccttcagat taaaaataac tgaggtaagg 60 gcctgggtag gggaggtggt gtgagacgct cctgtctctc ctctatctgc ccatcggccc 120 tttggggagg aggaatgtgc ccaaggacta aaaaaaggcc atggagccag aggggcgagg 180 gcaacagacc tttcatgggc aaaccttggg gccctgctgt ctagcatgcc ccactacggg 240 tctaggctgc ccatgtaagg aggcaaggcc tggggacacc cgagatgcct ggttataatt 300 aacccagaca tgtggctgcc cccccccccc caacacctgc tgcctctaaa aataaccctg 360 tccctggtgg atcccctgca tgcgaagatc ttcgaacaag gctgtggggg actgagggca 420 ggctgtaaca ggcttggggg ccagggctta tacgtgcctg ggactcccaa agtattactg 480 ttccatgttc ccggcgaagg gccagctgtc ccccgccagc tagactcagc acttagttta 540 ggaaccagtg agcaagtcag cccttggggc agcccataca aggccatggg gctgggcaag 600 ctgcacgcct gggtccgggg tgggcacggt gcccgggcaa cgagctgaaa gctcatctgc 660 tctcaggggc ccctccctgg ggacagcccc tcctggctag tcacaccctg taggctcctc 720 tatataaccc aggggcacag gggctgccct cattctacca ccacctccac agcacagaca 780 gacactcagg agccagccag cggcgcgccc 810 <![CDATA[<210> 11]]> <![CDATA[<211> 3156]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 11]]> aagcggaact acatcctggg cctggacatc ggcatcacca gcgtgggcta cggcatcatc 60 gactacgaga cacgggacgt gatcgatgcc ggcgtgcggc tgttcaaaga ggccaacgtg 120 gaaacaacg agggcaggcg gagcaagaga ggcgccagaa ggctgaagcg gcggaggcgg 180 240 gagctgagcg gcatcaaccc ctacgaggcc agagtgaagg gcctgagcca gaagctgagc 300 gagaagagt tctctgccgc cctgctgcac ctggccaaga gaagaggcgt gcacaacgtg 360 aacgaggtgg aagagcaac cggcaacgag ctgtccacca aagagcagat cagccggaac 420 agcaaggccc tggaagagaa atacgtggcc gaactgcagc tggaacggct gaaagac 480 ggcgaagtgc ggggcagcat caacagattc aagaccagcg actacgtgaa agaagccaaa 540 cagctgctga aggtgcagaa ggcctaccac cagctgggacc agagcttcat cgacacctac 600 atcgacctgc tggaaacccg gcggacctac tatgagggac ctggcgaggg cagccccttc 660 ggctggaagg acatcaaaga atggtacgag atgctgatgg gccactgcac ctacttcccc 720 gaggaactgc ggagcgtgaa gtacgcctac aacgccgacc tgtacaacgc cctgaacgac 780 ctgaacaatc tcgtgatcac cagggacgag aacgagaagc tggaatatta cgagaagttc 840 cagatcatcg agaacgtgtt caagcagaag aagaagccca ccctgaagca gatcgccaaa 900 gaaatcctcg tgaacgaaga ggatattaag ggctacagag tgaccagcac cggcaagccc 960 gagttcacca acctgaaggt gtaccacgac atcaaggaca ttaccgcccg gaaagagatt 1020 attgagaacg ccgagctgct ggatcagatt gccaagatcc tgaccatcta ccagagcagc 1080 gaggacatcc aggaagaact gaccaatctg aactccgagc tgacccagga agagatcgag 1140 cagatctcta atctgaaggg ctataccggc acccacaacc tgagcctgaa ggccatcaac 1200 ctgatcctgg acgagctgtg gcacaccaac gacaaccaga tcgctatctt caaccggctg 1260 aagctggtgc ccaagaaggt ggacctgtcc cagcagaaag agatccccac caccctggtg 1320 gacgacttca tcctgagccc cgtcgtgaag agaagcttca tccagagcat caaagtgatc 1380 aacgccatca tcaagaagta cggcctgccc aacgacatca ttatcgagct ggcccgcgag 1440 aagaactcca aggacgccca gaaaatgatc aacgagatgc agaagcggaa ccggcagacc 1500 aacgagcgga tcgaggaat catccggacc accggcaaag agaacgccaa gtacctgatc 1560 gagagatca agctccacga catgcaggaa ggcaagtgcc tgtacagcct ggaagccatc 1620 cctctggaag atctgctgaa caaccccttc aactatgagg tggaccacat catccccaga 1680 agcgtgtcct tcgacaacag cttcaacaac aaggtgctcg tgaagcagga agaaaacagc 1740 aagaagggca accggacccc attccagtac ctgagcagca gcgacagcaa gatcagctac 1800 gaaccttca agaagcacat cctgaatctg gccaagggca agggcagaat cagcaagacc 1860 aagaaagagt atctgctgga agaacgggac atcaacaggt tctccgtgca gaagacttc 1920 atcaaccgga acctggtgga taccagatac gccaccagag gcctgatgaa cctgctgcgg 1980 agctacttca gagtgaacaa cctggacgtg aaagtgaagt ccatcaatgg cggcttcacc 2040 agctttctgc ggcggaagtg gaagtttaag aaagagcgga acaaggggta caagcaccac 2100 gccgaggacg ccctgatcat tgccaacgcc gatttcatct tcaaagagtg gaagaactg 2160 gacaaggcca aaaaagtgat ggaaaaccag atgttcgagg aaaagcaggc cgagagcatg 2220 cccgagatcg aaaccgagca ggagatcaaa gagatcttca tcacccccca ccagatcaag 2280 cacattaagg acttcaagga ctacaagtac agccaccggg tggacaagaa gcctaataga 2340 gagctgatta acgacaccct gtactccacc cgggaggacg aaagggcaa caccctgatc 2400 gtgaacaatc tgaacggcct gtacgacaag gacaatgaca agctgaaaaa gctgatcaac 2460 aagagccccg aaaagctgct gatgtaccac cacgacccccc agacctacca gaatgaag 2520 ctgattatgg aacagtacgg cgacgagaag aatcccctgt acaagtacta cgaggaacc 2580 gggaactacc tgaccaagta ctccaaaaag gacaacggcc ccgtgatcaa gaagattaag 2640 2700 aacaaggtcg tgaagctgtc cctgaagccc tacagattcg acgtgtacct ggacaatggc 2760 gtgtacaagt tcgtgaccgt gaagaatctg gatgtgatca aaaaagaaaa ctactacgaa 2820 2880 tttatcgcct ccttctacaa caacgatctg atcaagatca acggcgagct gtatagagtg 2940 atcggcgtga acaacgacct gctgaaccgg atcgaagtga acatgatcga catcacctac 3000 cgcgagtacc tggaaaacat gaacgacaag aggcccccca ggatcattaa gacaatcgcc 3060 tccaagaccc agagcattaa gaagtacagc acagacattc tgggcaacct gtatgaagtg 3120 aaatctaaga agcaccctca gatcatcaaa aagggc 3156 <![CDATA[<210> 12]]> <![CDATA[<211> 60]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Synthetic sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 12]]> tagcaataaa ggatcgttta ttttcattgg aagcgtgtgt tggttttttg atcaggcgcg 60 <![CDATA[<210> 13]]> <![CDATA[<211> 232]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 13]]> ctagagctcg ctgatcagcc tcgactgtgc cttctagttg ccagccatct gttgtttgcc 60 cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa 120 atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg 180 ggcaggacag caagggggag gattgggaag agaatagcag gcatgctggg ga 232 <![CDATA[<210> 14]]> <![CDATA[<211> 7236]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 14]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctcta gagagggcct atttcccatg attccttcat atttgcatat 180 acgatacaag gctgttagag agataattgg aattaatttg actgtaaaca caaagatatt 240 agtacaaaat acgtgacgta gaaagtaata atttcttggg tagtttgcag ttttaaaatt 300 atgttttaaa atggactatc atatgcttac cgtaacttga aagtatttcg atttcttggc 360 tttatatac ttgtggaaag gacgaaacac cgcatttgta tagagaggaa atgtgttttta 420 gtactctgga aacagaatct actaaaaacaa ggcaaaatgc cgtgtttatc tcgtcaactt 480 gttggcgaga ttttctcga gtcgagtggc tccggtgccc gtcagtgggc agagcgcaca 540 tcgcccacag tccccgagaa gttggggga ggggtcggca attgaaccgg tgcctagaga 600 aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct ttttcccgag 660 ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt tcgcaacggg 720 tttgccgcca gaacacaggt gtcgtgaccg cggccatggc cccaaagaag aagcggaagg 780 tcggtatcca cggagtccca gcagccaagc ggaactacat cctgggcctg gacatcggca 840 tcaccagcgt gggctacggc atcatcgact acgagacacg ggacgtgatc gatgccggcg 900 tgcggctgtt caaagaggcc aacgtggaaa acaacgaggg caggcggagc aagagaggcg 960 ccagaaggct gaagcggcgg aggcggcata gaatccagag agtgaagaag ctgctgttcg 1020 actacaacct gctgaccgac cacagcgagc tgagcggcat caacccctac gaggccagag 1080 tgaagggcct gagccagaag ctgagcgagg aagagttctc tgccgccctg ctgcacctgg 1140 1200 ccaccaaaga cgagatcagc gggaacagca aggccctgga agaaatac gtggccgaac 1260 tgcagctgga acggctgaag aaagacggcg aagtgcgggg cagcatcaac agattcaaga 1320 ccagcgacta cgtgaaagaa gccaaacagc tgctgaaggt gcagaaggcc taccaccagc 1380 tggaccagag cttcatcgac acctacatcg acctgctgga aacccggcgg acctactatg 1440 agggacctgg cgagggcagc cccttcggct ggaaggacat caaagaatgg tacgagatgc 1500 tgatgggcca ctgcacctac ttccccgagg aactgcggag cgtgaagtac gcctacaacg 1560 ccgacctgta caacgccctg aacgacctga acaatctcgt gatcaccagg gacgagaacg 1620 agaagctgga atattacgag aagttccaga tcatcgagaa cgtgttcaag cagaagaaga 1680 agcccaccct gaagcagatc gccaaagaaa tcctcgtgaa cgaagaggat attaagggct 1740 acagagtgac cagcaccggc aagcccgagt tcaccaacct gaaggtgtac cacgacatca 1800 aggacattac cgcccggaaa gagattattg agaacgccga gctgctggat cagattgcca 1860 agatcctgac catctaccag agcagcgagg acatccagga agaactgacc aatctgaact 1920 ccgagctgac ccaggaagag atcgagcaga tctctaatct gaagggctat accggcaccc 1980 acaacctgag cctgaaggcc atcaacctga tcctggacga gctgtggcac accaacgaca 2040 accagatcgc tatcttcaac cggctgaagc tggtgcccaa gaaggtggac ctgtcccagc 2100 agaaagagat ccccaccacc ctggtggacg acttcatcct gagccccgtc gtgaagagaa 2160 gcttcatcca gagcatcaaa gtgatcaacg ccatcatcaa gaagtacggc ctgcccaacg 2220 acatcattat cgagctggcc cgcgagaaga actccaagga cgcccagaaa atgatcaacg 2280 2340 cgaaagagaa cgccaagtac ctgatcgaga agatcaagct gcacgacatg caggaaggca 2400 agtgcctgta cagcctggaa gccatccctc tggagaatct gctgaacaac cccttcaact 2460 atgaggtgga ccacatcatc cccagaagcg tgtccttgga caacagcttc aacaacaagg 2520 tgctcgtgaa ccaggaaaa aacagcaaga agggcaaccg gaccccattc cagatacctga 2580 gcagcagcga cagcaagatc agctacgaaa ccttcaagaa gcacatcctg aatctggcca 2640 agggcaaggg cagaatcagc aagaccaaga aagagtatct gctggagaa cgggacatca 2700 acaggttctc cgtgcagaaa gacttcatca accggaacct ggtggatacc agatacgcca 2760 ccagaggcct gatgaacctg ctgcggagct acttcagagt gaacaacctg gacgtgaaag 2820 tgaagtccat caatggcggc ttcaccagct ttctgcggcg gaagtggaag tttaagaaag 2880 agggaacaa ggggtacaag caccacgccg aggacgccct gatcattgcc aacgccgatt 2940 3000 tcgagaaaa ccaggccgag agcatgccg agatcgaaac cgagcaggag tacaaaga 3060 tcttcatcac ccccaccacag atcaagcaca ttaaggactt caaggactac aagtacagcc 3120 accgggtgga caagaagcct aatatagagc tgattaacga caccctgtac tccacccgga 3180 agcacgacaa gggcaacacc ctgatcgtga acaatctgaa cggcctgtac gacaaggaca 3240 atgacaagct gaaaaagctg atcaacaaga gccccgaaaa gctgctgatg taccaccacg 3300 acccccagac ctaccagaaa ctgaagctga ttatggaaca gtacggcgac gagagaatc 3360 3420 acggccccgt gatcaagaag attaagtatt acggcaacaa actgaacgcc catctggaca 3480 tcaccgacga ctaccccaac agcagaaaca aggtcgtgaa gctgtccctg aagccctaca 3540 gattcgacgt gtacctggac aatggcgtgt acaagttcgt gaccgtgaag aatctggatg 3600 3660 tgaagaagat cagcaaccag gccgagttta tcgctccctt ctacaacaac gatctgatca 3720 agatcaacgg cgagctgtat agagtgatcg gcgtgaacaa cgacctgctg aaccggatcg 3780 aagtgaacat gatcgacatc acctaccgcg agtacctgga aaacatgaac gacaagaggc 3840 cccccaggat cattaagaca atcgcctcca agacccagag cattaagaag tacagcacag 3900 acattctggg caacctgtat gaagtgaaat ctaagaagca ccctcagatc atcaaaaagg 3960 gcaaaaggcc ggcggccacg aaaaaggccg gccaggcaaa aaagaaaaag ggatcctacc 4020 catacgatgt tccagattac gcttacccat acgatgttcc agattacgct tacccatacg 4080 atgttccaga ttacgcttaa gaattctagc aataaaggat cgtttatttt cattggaagc 4140 gtgtgttggt tttttgatca ggcgcgggta ccgaacgctg acgtcatcaa cccgctccaa 4200 ggaatcgcgg gcccagtgtc actaggcggg aacacccagc gcgcgtgcgc cctggcagga 4260 agatggctgt gagggacagg ggagtggcgc cctgcaatat ttgcatgtcg ctatgtgttc 4320 tgggaaatca ccataaacgt gaaatgtctt tggatttggg aatcttataa gttctgtatg 4380 4440 aaaacaaggc aaaatgccgt gtttatctcg tcaacttgtt ggcgagattt ttggtaccag 4500 gaaccctag tgatggagtt ggccactccc tctctgcgcg ctcgctcgct cactgaggcc 4560 gggcgaccaa aggtcgcccg acgccccgggc tttgcccggg cggcctcagt gagcgagcga 4620 gcgcgcagct gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 4680 atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 4740 cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg 4800 ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 4860 taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 4920 aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 4980 ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 5040 tcaaccctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggcctatt 5100 ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 5160 ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 5220 cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 5280 cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 5340 caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 5400 tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 5460 ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 5520 gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 5580 cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 5640 tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 5700 tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 5760 cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 5820 tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 5880 agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 5940 ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 6000 ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 6060 aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 6120 gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 6180 tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 6240 ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 6300 cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 6360 atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 6420 cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 6480 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 6540 cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 6600 ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 6660 tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 6720 taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 6780 caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 6840 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 6900 gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 6960 gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 7020 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 7080 acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 7140 tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 7200 ggttcctggc cttttgctgg ccttttgctc acatgt 7236 <![CDATA[<210> 15]]> <![CDATA[<211> 7444]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 15]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctcta gagaggcct atttcccatg attccttcat atttgcatat 180 acgatacaag gctgttagag agataattgg aattaatttg actgtaaaca caaagatatt 240 agtacaaaat acgtgacgta gaaagtaata atttcttggg tagttgcag ttttaaaatt 300 atgttttaaa atggactatc atatgcttac cgtaacttga aagtatttcg atttcttggc 360 tttatatatc ttgtggaaag gacgaaacac cgcatttgta tagagaggaa atgtgtttta 420 gtactctgga aacagaatct actaaaacaa ggcaaaatgc cgtgttatc tcgtcaactt 480 gttggcgaga ttttctcga gctagactag catgctgccc atgtaaggag gcaaggcctg 540 gggacacccg agatgcctgg ttataattaa cccagacatg tggctgcccc ccccccccca 600 acacctgctg cctctaaaaa taaccctgca tgccatgttc ccggcgaagg gccagctgtc ccccgccagc tagactcagc acttagttta ggaaccagtg agcaagtcag cccttggggc 720 agcccataca aggccatggg gctgggcaag ctgcacgcct gggtccgggg tgggcacggt 780 gcccgggcaa cgagctgaaa gctcatctgc tctcaggggc ccctccctgg ggacagcccc 840 tcctggctag tcacaccctg taggctcctc fatheraccc aggggcacag gggctgccct 900 cattctacca ccacctccac caccacac cacctcagg caccggtgcc 960. cattctacca ccacctccac accatggccc caaagaagaa gcggaaggtc ggtatccacg gagtcccagc agccaagcgg aactacatcc tgggcctgga catcggcatc accagcgtgg gctacggcat catcgactac gagacacggg acgtgatcga tgccggcgtg cggctgttca aagaggccaa cgtggaaaac 1140 aacgaggca ggcggagcaa gagaggcgcc agaaggctga agcggcggag gcggcataga 1200 atccagagag tgaagaagct gctggttcgac tacaacctgc tgaccgacca cagcgagctg 1260 agcggcatca acccctacga ggccagagtg aagggcctga gccagaagct gagcgaggaa 1320 gagttctctg ccgccctgct gcacctggcc aagagaagag gcgtgcacaa cgtgaacgag 1380 gtggagaagg acaccggcaa cgagctgtcc accaaagagc agatcagccg gaacagcaag 1440 gccctggaag agaatacgt ggccgaactg cagctggaac ggctgaagaa agacggcgaa 1500 gtgcggggca gcatcaacag attcaagacc agcgactacg tgaaagaagc caaacagctg 1560 ctgaaggtgc agaaggccta ccaccagctg gaccagagct tcatcgacac ctacatcgac 1620 ctgctggaaa cccggcggac ctactatgag ggacctggcg agggcagccc cttcggctgg 1680 aaggacatca aagaatggta cgagatgctg atgggccact gcacctactt ccccgaggaa 1740 ctgcggagcg tgaagtacgc ctacaacgcc gacctgtaca acgccctgaa cgacctgaac 1800 aatctcgtga tcaccaggga cgagaacgag aagctggaat attacgagaa gttccagatc 1860 atcgagaacg tgttcaagca gaagaagaag cccaccctga agcagatcgc caaagaaatc 1920 ctcgtgaacg aagaggatat taagggctac agagtgacca gcaccggcaa gcccgagttc 1980 accaacctga aggtgtacca cgacatcaag gacattaccg cccggaaaga gattattgag 2040 aacgccgagc tgctggatca gattgccaag atcctgacca tctaccagag cagcgaggac 2100 atccaggaag aactgaccaa tctgaactcc gagctgaccc aggaagagat cgagcagatc 2160 tctaatctga agggctatac cggcacccac aacctgagcc tgaaggccat caacctgatc 2220 ctggacgagc tgtggcacac caacgacaac cagatcgcta tcttcaaccg gctgaagctg 2280 gtgcccaaga aggtggacct gtcccagcag aaagagatcc ccaccaccct ggtggacgac 2340 ttcatcctga gccccgtcgt gaagagaagc ttcatccaga gcatcaaagt gatcaacgcc 2400 atcatcaaga agtacggcct gcccaacgac atcattatcg agctggcccg cgagaagaac 2460 tccaaggacg cccagaaaat gatcaacgag atgcagaagc ggaaccggca gaccaacgag 2520 cggatcgagg aaatcatccg gaccaccggc aaagagaacg ccaagtacct gatcgagaag 2580 atcaagctgc acgacatgca ggaaggcaag tgcctgtaca gcctggaagc catccctctg 2640 gaagatctgc tgaacaaccc cttcaactat gaggtggacc acatcatccc cagaagcgtg 2700 tccttcgaca acagcttcaa caacaaggtg ctcgtgaagc aggaagaaaa cagcaagaag 2760 ggcaaccgga ccccattcca gtacctgagc agcagcgaca gcaagatcag ctacgaaacc 2820 ttcaagaagc acatcctgaa tctggccaag ggcaagggca gaatcagcaa gaccaagaaa 2880 gagtatctgc tggaagaacg ggacatcaac aggttctccg tgcagaaaga cttcatcaac 2940 cggaacctgg tggataccag atacgccacc agaggcctga tgaacctgct gcggagctac 3000 3060 ctgcggcgga agtggaagtt taagaaagag cggaacaagg ggtacaagca ccacgccgag 3120 gacgccctga tcattgccaa cgccgatttc atcttcaaag agtggagaa actggacaag 3180 gccaaaaaag tgatggaaaa ccagatgttc gaggaaaagc aggccgagag catgcccgag 3240 atcgaaaccg aggaggagat caaagagatc ttcatcaccc cccaccagat caagcacatt 3300 areacttca aggactacaa gtacagccac cgggtggaca agaagcctaa tagagagctg 3360 3420 aatctgaacg gcctgtacga caaggacaat gacaagctga aaaagctgat caacaagagc 3480 cccgaaaagc tgctgatgta ccaccacgac ccccagacct accagaaact gaagctgatt 3540 atggaacagt acggcgacga gaagaatccc ctgtacaagt actacgagga aaccgggaac 3600 tacctgacca agtactccaa aaaggacaac ggccccgtga tcaagaagat taagtattac 3660 ggcaacaaac tgaacgccca tctggacatc accgacgact accccaacag cagaaacaag 3720 gtcgtgaagc tgtccctgaa gccctacaga ttcgacgtgt acctggacaa tggcgtgtac 3780 aagttcgtga ccgtgaagaa tctggatgtg atcaaaaaag aaaactacta cgaagtgaat 3840 agcaagtgct atgaggaagc taagaagctg aagaagatca gcaaccaggc cgagtttatc 3900 gcctccttct acaacga tctgatcaag atcaacggcg agctcttatag agtgatcggc 3960 gtgaacaacg acctgctgaa ccggatcgaa gtgaacatga tcgacatcac ctaccgcgag 4020 tacctggaaa acatgaacga caagaggccc cccaggatca ttaagacaat cgcctccaag 4080 acccagagca ttaagaagta cagcacagac attctgggca acctgtatga agtgaaatct 4140 aagaagcacc ctcagatcat caaaaagggc aaaaggccgg cggccacgaa aaaggccggc 4200 caggcaaaaa agaaaaaggg atcctaccca tacgatgttc cagattacgc ttacccatac 4260 gatgttccag attacgctta cccatacgat gttccagatt acgcttaaga attctagcaa 4320 taaaggatcg tttattttca ttggaagcgt gtgttggttt tttgatcagg cgcgggtacc 4380 gaacgctgac gtcatcaacc cgctccaagg aatcgcgggc ccagtgtcac taggcgggaa 4440 cacccagcgc gcgtgcgccc tggcaggaag atggctgtga gggacagggg agtggcgccc 4500 tgcaatattt gcatgtcgct atgtgttctg ggaaatcacc ataaacgtga aatgtctttg 4560 gatttgggaa tcttataagt tctgtatgag accacatata gtaatgaaat tattggcacg 4620 ttttagtact ctggaaacag aatctactaa aacaaggcaa aatgccgtgt ttatctcgtc 4680 aacttgttgg cgagattttt ggtaccagga acccctagtg atggagttgg ccactccctc 4740 tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag gtcgcccgac gcccgggctt 4800 tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc ctgcaggggc gcctgatgcg 4860 gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atacgtcaaa gcaaccatag 4920 tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc 4980 gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc 5040 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt 5100 agtgctttac ggcacctcga ccccaaaaaa cttgatttgg gtgatggttc acgtagtggg 5160 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt 5220 ggactcttgt tccaaactgg aacaacactc aaccctatct cgggctattc ttttgattta 5280 taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt 5340 aacgcgaatt ttaacaaaat attaacgttt acaattttat ggtgcactct cagtacaatc 5400 tgctctgatg ccgcatagtt aagccagccc cgacacccgc caacacccgc tgacgcgccc 5460 tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt ctccgggagc 5520 tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgagacgaaa gggcctcgtg 5580 atacgcctat ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc 5640 acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat 5700 atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag 5760 agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt 5820 cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt 5880 gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga gagttttcgc 5940 cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta 6000 tcccgtattg acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac 6060 ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa 6120 ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg 6180 atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc 6240 cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg 6300 atgcctgtag caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta 6360 gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg accacttctg 6420 cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtgga 6480 agccgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc 6540 tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt 6600 gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt 6660 gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc 6720 atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag 6780 atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa 6840 aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg 6900 aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag 6960 ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg 7020 ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga 7080 tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc 7140 ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc 7200 acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga 7260 gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt 7320 cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg 7380 aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac 7440 atgt 7444 <![CDATA[<210> 16]]> <![CDATA[<211> 7236]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 16]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggctcta gaaaaaatct cgccaacaag ttgacgagat aaacacggca 180 ttttgccttg ttttagtaga ttctgtttcc aagtactaa aacacatttc ctctctatac 240 aaatgcggtg tttcgtcctt tccacaagat atataaagcc aagaaatcga aatactttca 300 agttaacggta agcatatgat agtccatttt aaaacataat tttaaaactg caaactaccc 360 aagaaattat tactttctac gtcacgtatt ttgtactaat atctttgtgt ttacagtcaa 420 attaattcca attatctctc taacagcctt gtatcgtata tgcaaatatg aaaggaatcat 480 gggaaatagg ccctcctcga gtcgagtggc tccggtgccc gtcagtgggc agagcgcaca 540 tcgcccacag tccccgagaa gttgggggga ggggtcggca attgaaccgg tgcctagaga 600 aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct ttttccccgag 660 ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt tcgcaacggg 720 tttgccgcca gaacacaggt gtcgtgaccg cggccatggc cccaaagaag aagcggaagg 780 tcggtatcca cggagtccca gcagccaagc ggaactacat cctgggcctg gacatcggca 840 tcaccagcgt gggctacggc atcatcgact acgagacacg ggacgtgatc gatgccggcg 900 tgcggctgtt caaagaggcc aacgtggaaa acaacgaggg caggcggagc aagagaggcg 960 ccagaaggct gaagcggcgg aggcggcata gaatccagag agtgaagaag ctgctgttcg 1020 actacaacct gctgaccgac cacagcgagc tgagcggcat caacccctac gaggccagag 1080 tgaagggcct gagccagaag ctgagcgagg aagagttctc tgccgccctg ctgcacctgg 1140 1200 ccaccaaaga cgagatcagc gggaacagca aggccctgga agaaatac gtggccgaac 1260 tgcagctgga acggctgaag aaagacggcg aagtgcgggg cagcatcaac agattcaaga 1320 ccagcgacta cgtgaaagaa gccaaacagc tgctgaaggt gcagaaggcc taccaccagc 1380 tggaccagag cttcatcgac acctacatcg acctgctgga aacccggcgg acctactatg 1440 agggacctgg cgagggcagc cccttcggct ggaggacat caaagaatgg tacgagatgc 1500 tgatgggcca ctgcacctac ttccccgagg aactgcggag cgtgaagtac gcctacaacg 1560 ccgacctgta caacgccctg aacgacctga acaatctcgt gatcaccagg gacgagaacg 1620 agaagctgga atattacgag aagttccaga tcatcgagaa cgtgttcaag cagaagaaga 1680 agcccaccct gaagcagatc gccaaagaaa tcctcgtgaa cgaagaggat attaagggct 1740 acagagtgac cagcaccggc aagcccgagt tcaccaacct gaaggtgtac cacgacatca 1800 aggacattac cgcccggaaa gagattattg agaacgccga gctgctggat cagattgcca 1860 agatcctgac catctaccag agcagcgagg acatccagga agaactgacc aatctgaact 1920 ccgagctgac ccaggaagag atcgagcaga tctctaatct gaagggctat accggcaccc 1980 acaacctgag cctgaaggcc atcaacctga tcctggacga gctgtggcac accaacgaca 2040 accagatcgc tatcttcaac cggctgaagc tggtgcccaa gaaggtggac ctgtcccagc 2100 agaaagagat ccccaccacc ctggtggacg acttcatcct gagccccgtc gtgaagagaa 2160 gcttcatcca gagcatcaaa gtgatcaacg ccatcatcaa gaagtacggc ctgcccaacg 2220 acatcattat cgagctggcc cgcgagaaga actccaagga cgcccagaaa atgatcaacg 2280 agatgcagaa gcggaaccgg cagaccaacg agcggatcga ggaaatcatc cggaccaccg 2340 gcaaagagaa cgccaagtac ctgatcgaga agatcaagct gcacgacatg caggaaggca 2400 agtgcctgta cagcctggaa gccatccctc tggaagatct gctgaacaac cccttcaact 2460 atgaggtgga ccacatcatc cccagaagcg tgtccttcga caacagcttc aacaacaagg 2520 tgctcgtgaa ccaggaaaa aacagcaaga agggcaaccg gaccccattc cagatacctga 2580 gcagcagcga cagcaagatc agctacgaaa ccttcaagaa gcacatcctg aatctggcca 2640 agggcaaggg cagaatcagc aagaccaaga aagagtatct gctggagaa cgggacatca 2700 acaggttctc cgtgcagaaa gacttcatca accggaacct ggtggatacc agatacgcca 2760 ccagaggcct gatgaacctg ctgcggagct acttcagagt gaacaacctg gacgtgaaag 2820 tgaagtccat caatggcggc ttcaccagct ttctgcggcg gaagtggaag tttaagaaag 2880 agggaacaa ggggtacaag caccacgccg aggacgccct gatcattgcc aacgccgatt 2940 3000 tcgagaaaa ccaggccgag agcatgccg agatcgaaac cgagcaggag tacaaaga 3060 tcttcatcac ccccaccacag atcaagcaca ttaaggactt caaggactac aagtacagcc 3120 accgggtgga caagaagcct aatatagagc tgattaacga caccctgtac tccacccgga 3180 agcacgacaa gggcaacacc ctgatcgtga acaatctgaa cggcctgtac gacaaggaca 3240 atgacaagct gaaaaagctg atcaacaaga gccccgaaaa gctgctgatg taccaccacg 3300 acccccagac ctaccagaaa ctgaagctga ttatggaaca gtacggcgac gagagaatc 3360 3420 acggccccgt gatcaagaag attaagtatt acggcaacaa actgaacgcc catctggaca 3480 tcaccgacga ctaccccaac agcagaaaca aggtcgtgaa gctgtccctg aagccctaca 3540 gattcgacgt gtacctggac aatggcgtgt acaagttcgt gaccgtgaag aatctggatg 3600 tgatcaaaaa agaaaactac tacgaagtga atagcaagtg ctatgaggaa gctaagaagc 3660 tgaagaagat cagcaaccag gccgagttta tcgcctcctt ctacaacaac gatctgatca 3720 agatcaacgg cgagctgtat agagtgatcg gcgtgaacaa cgacctgctg aaccggatcg 3780 aagtgaacat gatcgacatc acctaccgcg agtacctgga aaacatgaac gacaagaggc 3840 cccccaggat cattaagaca atcgcctcca agacccagag cattaagaag tacagcacag 3900 acattctggg caacctgtat gaagtgaaat ctaagaagca ccctcagatc atcaaaaagg 3960 gcaaaaggcc gggcggccacg aaaaaggccg gccaggcaaa aaagaaaag ggatcctacc 4020 catacgatgt tccagattac gcttacccat acgatgttcc agattacgct tacccatacg 4080 atgttccaga ttacgcttaa gattctagc aaaaggat cgtttatttt cattggaagc 4140 gtgtgttggt ttttgatca ggcggggta ccgaacgctg acgtcatcaa cccgctccaa 4200 ggaatcgcgg gcccagtgtc actaggcggg aacacccagc gcgcgtgcgc cctggcagga 4260 agatggctgt gagggacagg ggagtggcgc cctgcaatat ttgcatgtcg ctatgtgttc 4320 tgggaaatca ccataaacgt gaatgtctt tggattggg aatcttataa gttctgtatg 4380 agaccacata tagtaatgaa attattggca cgttttagta ctctggaaac agaatctact 4440 aaaacaaggc aaaatgccgt gtttatctcg tcaacttgtt ggcgagattt ttggtaccag 4500 gaacccctag tgatggagtt ggccactccc tctctgcgcg ctcgctcgct cactgaggcc 4560 gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg cggcctcagt gagcgagcga 4620 gcgcgcagct gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 4680 atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 4740 cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg 4800 ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 4860 taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 4920 aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 4980 ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 5040 tcaaccctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggcctatt 5100 ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 5160 ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 5220 cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 5280 cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 5340 caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 5400 tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 5460 ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 5520 gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 5580 cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 5640 tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 5700 tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 5760 cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 5820 tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 5880 agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 5940 ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 6000 ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 6060 aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 6120 gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 6180 tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 6240 ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 6300 cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 6360 atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 6420 cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 6480 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 6540 cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 6600 ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 6660 tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 6720 taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 6780 caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 6840 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 6900 gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 6960 gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 7020 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 7080 acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 7140 tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 7200 ggttcctggc cttttgctgg ccttttgctc acatgt 7236 <![CDATA[<210> 17]]> <![CDATA[<211> 7444]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 17]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctcta gaaaaaatct cgccaacaag ttgacgagat aaacacggca 180 ttttgccttg ttttagtaga ttctgtttcc agagtactaa aacacatttc ctctctatac 240 aaatgcggtg tttcgtcctt tccacaagat atataaagcc aagaaatcga aatactttca 300<![CDATA[ ]]><![CDATA[ ]]><![CDATA[ ]]><![CDATA[ ]]>agttacggta agcatatgat agtccatttt aaaacataat tttaaaactg caaactaccc 360 aagaaattat tactttctac gtcacgtatt ttgtactaat atctttgtgt ttacagtcaa 420 attaattcca attatctctc taacagcctt gtatcgtata tgcaaatatg aaaggaatcat 480 gggaaatagg ccctcctcga gctagactag catgctgccc atgtaaggag gcaaggcctg 540 gggacacccg agatgcctgg ttataattaa cccagacatg tggctgcccc cccccccccca 600 acacctgctg cctctaaaaa taaccctgca tgccatgttc ccggcgaagg gccagctgtc 660 ccccgccagc tagactcagc acttagttta ggaaccagtg agcaagtcag cccttggggc 720 agcccataca aggccatggg gctgggcaag ctgcacgcct gggtccgggg tgggcacggt 780 gcccgggcaa cgagctgaaa gctcatctgc tctcaggggc ccctccctgg ggacagcccc 840 tcctggctag tcacaccctg taggctcctc fatheraccc aggggcacag gggctgccct 900 cattctacca ccacctccac caccacac cacctcagg caccggtgcc 960. cattctacca ccacctccac accatggccc caaagaagaa gcggaaggtc ggtatccacg gagtcccagc agccaagcgg aactacatcc tgggcctgga catcggcatc accagcgtgg gctacggcat catcgactac gagacacggg acgtgatcga tgccggcgtg cggctgttca aagaggccaa cgtggaaaac aacgagggca ggcggagcaa gagaggcgcc agaaggctga agcggcggag gcggcataga atccagagag tgaagaagct gctgttcgac tacaacctgc tgaccgacca cagcgagctg agcggcatca acccctacga ggccagagtg aagggcctga gccagaagct gagcgagga gagttctctg ccgccctgct gcacctggcc aagagaagag gcgtgcacaa cgtgaacgag 1380 gtggaagagg acaccggcaa cgagctgtcc accaaagagc agatcagccg gaacagcaag 1440 gccctggaag agaaatacgt ggccgaactg cagctgggaac ggctgaagaa agacggcgaa 1500 gtgcggggca gcatcaacag attcaagacc agcgactacg tgaaagaagc caaacagctg 1560 ctgaaggtgc agaaggccta ccaccagctg gaccagagct tcatcgacac ctacatcgac 1620 ctgctggaaa cccggcggac ctactatgag ggacctggcg agggcagccc cttcggctgg 1680 aaggacatca aagaatggta cgagatgctg atgggccact gcacctactt ccccgaggaa 1740 ctgcggagcg tgaagtacgc ctacaacgcc gacctgtaca acgccctgaa cgacctgaac 1800 aatctcgtga tcaccaggga cgagaacgag aagctggaat attacgagaa gttccagatc 1860 atcgagaacg tgttcaagca gaagagaag cccaccctga agcagatcgc caaagaaatc 1920 ctcgtgaacg aagaggattat taagggctac agagtgacca gcaccggcaa gcccgagttc 1980 accaacctga aggtgtacca cgacatcaag gacattaccg cccgggaaaga gattattgag 2040 aacgccgagc tgctggatca gattgccaag atcctgacca tctaccagag cagcgaggac 2100 atccaggaag aactgaccaa tctgaactcc gagctgaccc aggaagagat cgagcagatc 2160 tctaatctga agggctatac cggcacccac aacctgagcc tgaaggccat caacctgatc 2220 ctggacgagc tgtggcacac caacgacaac cagatcgcta tcttcaaccg gctgaagctg 2280 gtgcccaaga aggtggacct gtcccagcag aaagagatcc ccaccaccct ggtggacgac 2340 ttcatcctga gccccgtcgt gaagagaagc ttcatccaga gcatcaaagt gatcaacgcc 2400 atcatcaaga agtacggcct gcccaacgac atcattatcg agctggcccg cgagaagaac 2460 tccaaggacg cccagaaaat gatcaacgag atgcagaagc ggaaccggca gaccaacgag 2520 cggatcgagg aaatcatccg gaccaccggc aaagagaacg ccaagtacct gatcgagaag 2580 atcaagctgc acgacatgca ggaaggcaag tgcctgtaca gcctggaagc catccctctg 2640 gaagatctgc tgaacaaccc cttcaactat gaggtggacc acatcatccc cagaagcgtg 2700 tccttcgaca acagcttcaa caacaaggtg ctcgtgaagc aggaagaaaa cagcaagaag 2760 ggcaaccgga ccccattcca gtacctgagc agcagcgaca gcaagatcag ctacgaaacc 2820 ttcaagaagc acatcctgaa tctggccaag ggcaagggca gaatcagcaa gaccaagaaa 2880 gagtatctgc tggaagaacg ggacatcaac aggttctccg tgcaagaaga cttcatcaac 2940 cggaacctgg tggataccag atacgccacc agaggcctga tgaacctgct gcggagctac 3000 3060 ctgcggcgga agtggaagtt taagaaagag cggaacaagg ggtacaagca ccacgccgag 3120 gacgccctga tcattgccaa cgccgatttc atcttcaaag agtggagaa actggacaag 3180 gccaaaaaag tgatggaaaa ccagatgttc gaggaaaagc aggccgagag catgcccgag 3240 atcgaaaccg aggaggagat caaagagatc ttcatcaccc cccaccagat caagcacatt 3300 areacttca aggactacaa gtacagccac cgggtggaca agaagcctaa tagagagctg 3360 3420 aatctgaacg gcctgtacga caaggacaat gacaagctga aaaagctgat caacaagagc 3480 cccgaaaagc tgctgatgta ccaccacgac ccccagacct accagaaact gaagctgatt 3540 atggaacagt acggcgacga gaagaatccc ctgtacaagt actacgagga aaccgggaac 3600 tacctgacca agtactccaa aaaggacaac ggccccgtga tcaagaagat taagtattac 3660 ggcaacaaac tgaacgccca tctggacatc accgacgact accccaacag cagaaacaag 3720 gtcgtgaagc tgtccctgaa gccctacaga ttcgacgtgt acctggacaa tggcgtgtac 3780 aagttcgtga ccgtgaagaa tctggatgtg atcaaaaaag aaaactacta cgaagtgaat 3840 agcaagtgct atgaggaagc taagaagctg aagaagatca gcaaccaggc cgagtttatc 3900 gcctccttct acaacga tctgatcaag atcaacggcg agctcttatag agtgatcggc 3960 gtgaacaacg acctgctgaa ccggatcgaa gtgaacatga tcgacatcac ctaccgcgag 4020 tacctggaaa acatgaacga caagaggccc cccaggatca ttaagacaat cgcctccaag 4080 acccagagca ttaagaagta cagcacagac attctgggca acctgtatga agtgaaatct 4140 aagaagcacc ctcagatcat caaaaagggc aaaaggccgg cggccacgaa aaaggccggc 4200 caggcaaaaa agaaaaaggg atcctaccca tacgatgttc cagattacgc ttacccatac 4260 gatgttccag attacgctta cccatacgat gttccagatt acgcttaaga attctagcaa 4320 taaaggatcg tttattttca ttggaagcgt gtgttggttt tttgatcagg cgcgggtacc 4380 gaacgctgac gtcatcaacc cgctccaagg aatcgcgggc ccagtgtcac taggcgggaa 4440 cacccagcgc gcgtgcgccc tggcaggaag atggctgtga gggacagggg agtggcgccc 4500 tgcaatattt gcatgtcgct atgtgttctg ggaaatcacc ataaacgtga aatgtctttg 4560 gatttgggaa tcttataagt tctgtatgag accacatata gtaatgaaat tattggcacg 4620 ttttagtact ctggaaacag aatctactaa aacaaggcaa aatgccgtgt ttatctcgtc 4680 aacttgttgg cgagattttt ggtaccagga acccctagtg atggagttgg ccactccctc 4740 tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag gtcgcccgac gcccgggctt 4800 tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc ctgcaggggc gcctgatgcg 4860 gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atacgtcaaa gcaaccatag 4920 tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc 4980 gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc 5040 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt 5100 agtgctttac ggcacctcga ccccaaaaaa cttgatttgg gtgatggttc acgtagtggg 5160 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt 5220 ggactcttgt tccaaactgg aacaacactc aaccctatct cgggctattc ttttgattta 5280 taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt 5340 aacgcgaatt ttaacaaaat attaacgttt acaattttat ggtgcactct cagtacaatc 5400 tgctctgatg ccgcatagtt aagccagccc cgacacccgc caacacccgc tgacgcgccc 5460 tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt ctccgggagc 5520 tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgagacgaaa gggcctcgtg 5580 atacgcctat ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc 5640 acttttcggg gaaatgtgcg cggaacccct atttgttat ttttctaaat acattcaaat 5700 atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag 5760 agtatgagta ttcaacattt ccgtgtcgcc cttattccct ttttgcggc attttgcctt 5820 cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt 5880 gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga gagttttcgc 5940 cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta 6000 tcccgtattg acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac 6060 ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa 6120 ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg 6180 atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc 6240 cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg 6300 atgcctgtag caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta 6360 gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg accacttctg 6420 cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtgga 6480 agccgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc 6540 tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt 6600 gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt 6660 gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc 6720 atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag 6780 atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa 6840 aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg 6900 aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag 6960 ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg 7020 ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga 7080 tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc 7140 ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc 7200 acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga 7260 gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt 7320 cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg 7380 aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac 7440 atgt 7444 <![CDATA[<210> 18]]> <![CDATA[<211> 7381]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthesis]]> <![CDATA[<400> 18]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctcta gaaaaaatct cgccaacaag ttgacgagat aaacacggca 180 ttttgccttg ttttagtaga ttctgtttcc agagtactaa aacacatttc ctctctatac 240 aaatgcggtg tttcgtcctt tccacaagat atataaagcc aagaaatcga aatactttca 300 agttacggta agcatatgat agtccatttt aaaacataat tttaaaactg caaactaccc  360 aagaaattat tactttctac gtcacgtatt ttgtactaat atctttgtgt ttacagtcaa 420 attaattcca attatctctc taacagcctt gtatcgtata tgcaaatatg aaaggaatcat 480 gggaaatagg ccctcctcga ggagctccac cgcggtggcg gccgtccgcc ttcggcacca 540 tcctcacgac acccaaatat ggcgacgggt gaggaatggt ggggagttat tttagagcg 600 gtgaggaagg tgggcaggca gcaggtgttg gcgctctaaaa aataactccc gggagttatt 660 tttagagcgg aggaatggtg gacacccaaa tatggcgacg gttcctcacc cgtcgccata 720 tttgggtgtc cgccctcggc cggggccgca ttcctgggg ccgggcggtg ctcccgcccg 780 cctcgataaa aggctccggg gccggcggcg gcccacgagc tacccggagg agcgggaggc 840 gccaagctct agaactagtg gatccccccgg gctccaggaa ttcgatatac cggtgccacc 900 atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc caagcggaac 960 tacatcctgg gcctggacat cggcatcacc agcgtgggct acggcatcat cgactacgag 1020 acacggggacg tgatcgatgc cggcgtgcgg ctgttcaaag aggccaacgt ggaaaacaac 1080 gagggcaggc ggagcaagag aggcgccaga aggctgaagc ggcggaggcg catagaatc 1140 cagagagtga agaagctgct gttcgactac aacctgctga ccgaccacag cgagctgagc 1200 ggcatcaacc cctacgaggc cagagtgaag ggcctgagcc agaagctgag cgaggaagag 1260 ttctctgccg ccctgctgca cctggccaag agaagaggcg tgcacaacgt gaacgaggtg 1320 gaagaggaca ccggcaacga gctgtccacc aaagagcaga tcagccggaa cagcaaggcc 1380 ctggaagaga aatacgtggc cgaactgcag ctggaacggc tgaagaaaga cggcgaagtg 1440 cggggcagca tcaacagatt caagaccagc gactacgtga aagaagccaa acagctgctg 1500 aaggtgcaga aggcctacca ccagctggac cagagcttca tcgacaccta catcgacctg 1560 ctggaaaccc ggcggaccta ctatgaggga cctggcgagg gcagcccctt cggctggaag 1620 gacatcaaag aatggtacga gatgctgatg ggccactgca cctacttccc cgaggaactg 1680 cggagcgtga agtacgccta caacgccgac ctgtacaacg ccctgaacga cctgaacaat 1740 ctcgtgatca ccagggacga gaacgagaag ctggaatatt acgagaagtt ccagatcatc 1800 gagaacgtgt tcaagcagaa gagaagcccc accctgaagc agatcgccaa agaatccctc 1860 gtgaacgaag aggattaa gggctacaga gtgaccagca ccggcaagcc cgagttcacc 1920 aacctgaagg tgtaccacga catchaggac attaccgccc ggaagagat tattgagac 1980 gccgagctgc tggatcagat tgccagatc ctgaccagatc accagagcag cgaggacatc 2040 caggagaac tgaccaatct gaacccgag ctgacccagg aagagatcga gcagatctct 2100 aatctgaagg gctataccgg cacccacac ctgagcctga agccatca cctgatcctg 2160 gacgagctgt ggcaccaa cgacaccag atcgctatct tcaccggct gaagctggtg 2220 cccaagaagg tggacctgtc ccagcagaaa gagatcccca ccaccctggt ggacgacttc 2280 atcctgagcc ccgtcgtgaa gagaagcttc atccagagca tcaaagtgat caacgccatc 2340 atcaagaagt acggcctgcc caacgacatc attatcgagc tggcccgcga gaagaactcc 2400 aaggaacgccc agaaaatgat caacgagatg cagaagcgga accggcagac caacgagcgg 2460 atcgagaaa tcatccggac caccggcaaa gagaacgcca agtacctgat cgagaagatc 2520 aagctgcacg acatgcagga aggcaagtgc ctgtacagcc tggaagccat ccctctggaa 2580 gatctgctga acaacccctt caactatgag gtggaccaca tcatccccag aagcgtgtcc 2640 ttcgacaaca gcttcaacaa caaggtgctc gtgaagcagg aagaaaacag caagaagggc 2700 aaccggaccc cattccagta cctgagcagc agcgacagca agatcagcta cgaaaccttc 2760 aagagcaca tcctgaatct ggccaagggc aagggcagaa tcagcagac ggcaagag 2820 tatctgctgg agaacggga catchacagg ttctccgtgc agaagactt catchaccgg 2880 aacctggtgg ataccagata cgccaccaga ggcctgatga acctgctgcg gagctacttc 2940 agagtgaaca acctggacgt gaagtgaag tccatcaatg gcggcttcac cagctttctg 3000 cggcggaagt ggaagtttta gaagagcgg aaaaggggt acaagcacca cgccgaggac 3060 gccctgatca ttgccaacgc cgatttcatc ttcaagagt ggaagaact ggacaaggcc 3120 aaaaaagtga tggaaaacca gatgttcgag gaaaagcagg ccgagagcat gcccgagatc 3180 gaaaccgagc aggagtacaa agagatctc atcacccccc accagatcaa gcacattaag 3240 gacttcaagg actacaagta cagccaccgg gtggacaaga agcctaatag agagctgatt 3300 aacgacaccc tgtactccac ccggaaggac gacaagggca acaccctgat cgtgaacaat 3360 ctgaacggcc tgtacgacaa ggacaatgac aagctgaaaa agctgatcaa caagagcccc 3420 gaaaagctgc tgatgtacca ccacgacccc cagacctacc agaaactgaa gctgattatg 3480 gaacagtacg gcgacgagaa gaatcccctg tacaagtact acgagaaac cgggaactac 3540 ctgaccaagt actccaaaaa ggacaacggc cccgtgatca agaattaa gtattacggc 3600 aaaactga acgcccatct ggacatcacc gacgactacc ccaacagcag aaacaaggttc 3660 gtgaagctgt ccctgaagcc ctacagattc gacgtgtacc tggacaatgg cgtgtacaag 3720 ttcgtgaccg tgaagaatct ggatgtgatc aaaaaagaaa actactacga agtgaatagc 3780 aagtgctatg aggaagctaa gaagctgaag aagatcagca accaggccga gtttatcgcc 3840 tccttctaca acaacgatct gatcaagatc aacggcgagc tgtatagagt gatcggcgtg 3900 aacaacgacc tgctgaaccg gatcgaagtg aacatgatcg acatcaccta ccgcgagtac 3960 ctggaaaaca tgaacgacaa gaggcccccc aggatcatta agacaatcgc ctccaagacc 4020 cagagcatta agaagtacag cacagacatt ctgggcaacc tgtatgaagt gaaatctaag 4080 aagcaccctc agatcatcaa aaagggcaaa aggccggcgg ccacgaaaaa ggccggccag 4140 gcaaaaaaga aaaagggatc ctacccatac gatgttccag attacgctta cccatacgat 4200 gttccagatt acgcttaccc atacgatgtt ccagattacg cttaagaatt ctagcaataa 4260 aggatcgttt attttcattg gaagcgtgtg ttggtttttt gatcaggcgc gggtaccgaa 4320 cgctgacgtc atcaacccgc tccaaggaat cgcgggccca gtgtcactag gcgggaacac 4380 ccagcgcgcg tgcgccctgg caggaagatg gctgtgaggg acaggggagt ggcgccctgc 4440 aatatttgca tgtcgctatg tgttctggga aatcaccata aacgtgaaat gtctttggat 4500 ttgggaatct tataagttct gtatgagacc acatatagta atgaaattat tggcacgttt 4560 tagtactctg gaaacagaat ctactaaaac aaggcaaaat gccgtgttta tctcgtcaac 4620 ttgttggcga gatttttggt accaggaacc cctagtgatg gagttggcca ctccctctct 4680 gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggctttgc 4740 ccgggcggcc tcagtgagcg agcgagcgcg cagctgcctg caggggcgcc tgatgcggta 4800 ttttctcctt acgcatctgt gcggtatttc acaccgcata cgtcaaagca accatagtac 4860 gcgccctgta gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct 4920 acacttgcca gcgccctagc gcccgctcct ttcgctttct tcccttcctt tctcgccacg 4980 ttcgccggct ttccccgtca agctctaaat cgggggctcc ctttagggtt ccgatttagt 5040 gctttacggc acctcgaccc caaaaaactt gatttgggtg atggttcacg tagtgggcca 5100 tcgccctgat agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga 5160 ctcttgttcc aaactggaac aacactcaac cctatctcgg gctattcttt tgatttataa 5220 gggattttgc cgatttcggc ctattggtta aaaaatgagc tgatttaaca aaaatttaac 5280 gcgaatttta acaaaatatt aacgtttaca attttatggt gcactctcag tacaatctgc 5340 tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga 5400 cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc 5460 atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata 5520 cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact 5580 tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg 5640 tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaagaagagt 5700 atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct 5760 gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca 5820 cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 5880 gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 5940 cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg 6000 gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta 6060 tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc 6120 ggaggaccga aggagctaac cgctttttg cacaacatgg gggatcatgt aactcgcctt 6180 gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 6240 cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct 6300 tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc 6360 tcggcccttc cggctggctg gttattgct gataaatctg gagccggtga gcgtggaagc 6420 cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac 6480 acgacgggga gtcaggcaac tatggatgaa cgaatagac agatcgctga gataggtgcc 6540 tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat 6600 ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg 6660 accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc 6720 aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa 6780 ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag 6840 gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta 6900 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta 6960 ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag 7020 ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg 7080 gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg 7140 cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag 7200 cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc 7260 cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa 7320 aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg 7380 t 7381 <![CDATA[<210> 19]]> <![CDATA[<211> 7804]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 19]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctcta gaaaaaatct cgccaacaag ttgacgagat aaacacggca 180 ttttgccttg ttttagtaga ttctgtttcc agagtactaa aacacatttc ctctctatac 240 aaatgcggtg tttcgtcctt tccacaagat atataaagcc aagaaatcga aatactttca 300 agttacggta agcatatgat agtccatttt aaaacataat tttaaaactg caaactaccc 360 aagaaattat tactttctac gtcacgtatt ttgtactaat atctttgtgt ttacagtcaa 420 attaattcca attatctctc taacagcctt gtacgtata tgcaatatg aaggaatcat 480 gggaaatagg ccctcctcga ggtttaaca agcttgcatg tctaagctag acccttcaga 540 ttaaaaataa ctgaggtaag ggcctgggta ggggaggtgg tgtgagacgc tcctgtctct 600 cctctatctg cccatcggcc ctttggggag gaggaatgtg cccaggact aaaaaaggc 660 catggagcca gaggggcgag ggcacagac cttcatggg caaccttgg ggccctgctg 720 tctagcatgc cccactacgg gtctaggctg cccatgtaag gaggcaaggc ctggggacac 780 ccgagatgcc tggttaat taacccagac atgtggctgc cccccccccc ccacacctg 840 ctgcctctaa aaataccct gtccctgtg gatcccctgc atgcgaagat cttcgaacaa 900 ggctgtgggg gactgagggc aggctgtaac aggcttgggg gccagggctt atacgtgcct 960 gggactccca aagtattact gttccatgtt cccggcgaag ggccagctgt cccccgccag 1020 ctagactcag cacttagttt aggaaccagt gagcaagtca gcccttgggg cagcccatac 1080 aaggccatgg ggctgggcaa gctgcacgcc tgggtccggg gtgggcacgg tgcccgggca 1140 acgagctgaa agctcatctg ctctcagggg cccctccctg gggacagccc ctcctggcta 1200 gtcacaccct gtaggctcct ctatataacc caggggcaca ggggctgccc tcattctacc 1260 accacctcca cagcacagac agacactcag gagccagcca gcggcgcgcc caccggtgcc 1320 accatggccc caaagaagaa gcggaaggtc ggtatccacg gagtcccagc agccaagcgg 1380 aactacatcc tgggcctgga catcggcatc accagcgtgg gctacggcat catcgactac 1440 gagacacggg acgtgatcga tgccggcgtg cggctgttca aagaggccaa cgtggaaaac 1500 aacgaggca ggcggagcaa gagaggcgcc agaaggctga agcggcggag gcggcataga 1560 atccagagag tgaagaagct gctggttcgac tacaacctgc tgaccgacca cagcgagctg 1620 agcggcatca acccctacga ggccagagtg aagggcctga gccagaagct gagcgaggaa 1680 gagttctctg ccgccctgct gcacctggcc aagagaagag gcgtgcacaa cgtgaacgag 1740 gtggagaagg acaccggcaa cgagctgtcc accaaagagc agatcagccg gaacagcaag 1800 gccctggaag agaatacgt ggccgaactg cagctggaac ggctgaagaa agacggcgaa 1860 gtgcggggca gcatcaacag attcaagacc agcgactacg tgaaagaagc caaacagctg 1920 ctgaaggtgc agaaggccta ccaccagctg gaccagagct tcatcgacac ctacatcgac 1980 ctgctggaaa cccggcggac ctactatgag ggacctggcg agggcagccc cttcggctgg 2040 2100 ctgcggagcg tgaagtacgc ctacaacgcc gacctgtaca acgccctgaa cgacctgaac 2160 aatctcgtga tcaccaggga cgagaacgag aagctggaat attacgagaa gttccagatc 2220 atcgagaacg tgttcaagca gaagagaag cccaccctga agcagatcgc caaagaaatc 2280 ctcgtgaacg aagaggattat taagggctac agagtgacca gcaccggcaa gcccgagttc 2340 accaacctga aggtgtacca cgacatcaag gacattaccg cccggaaaga gattattgag 2400 aacgccgagc tgctggatca gattgccaag atcctgacca tctaccagag cagcgaggac 2460 atccaggaag aactgaccaa tctgaactcc gagctgaccc aggaagagat cgagcagatc 2520 tctaatctga agggctatac cggcacccac aacctgagcc tgaaggccat caacctgatc 2580 ctggacgagc tgtggcacac caacgacaac cagatcgcta tcttcaaccg gctgaagctg 2640 gtgcccaaga aggtggacct gtcccagcag aaagagatcc ccaccaccct ggtggacgac 2700 ttcatcctga gccccgtcgt gaagagaagc ttcatccaga gcatcaaagt gatcaacgcc 2760 atcatcaaga agtacggcct gcccaacgac atcattatcg agctggcccg cgagaagaac 2820 tccaaggacg cccagaaaat gatcaacgag atgcagaagc ggaaccggca gacaacgag 2880 cggatcgagg aaatcatccg gaccaccggc aaagagaacg ccaagtacct gatcgagaag 2940 atcaagctgc acgacatgca ggaaggcaag tgcctgtaca gcctggaagc catccctctg 3000 gaagatctgc tgaacaaccc cttcaactat gaggtggacc acatcatccc cagaagcgtg 3060 tccttcgaca acagcttcaa caacaaggtg ctcgtgaagc aggaaaaaa cagcaagaag 3120 ggcaaccgga ccccattcca gtacctgagc agcagcgaca gcaagatcag ctacgaaacc 3180 ttcaagaagc acatcctgaa tctggccaag ggcaagggca gaatcagcaa gaccaagaaa 3240 gagtatctgc tggaagaacg ggacatcaac aggttctccg tgcaagaaaga cttcatcaac 3300 cggaacctgg tggataccag atacgccacc agaggcctga tgaacctgct gcggagctac 3360 ttcagagtga acaacctgga cgtgaaagtg aagtccatca atggcggctt caccagcttt 3420 ctgcggcgga agtgaagtt taagaagg cggaacaagg ggtacaagca ccacgccgag 3480 gacgccctga tcattgccaa cgccgatttc atctcaag agtggaagaa actggacaag 3540 gccaaaaaag tgatggaaaa ccagatgttc gaggaaaagc aggccgag catgcccgag 3600 atcgaaaccg agcaggagta caagagatc ttcatcaccc cccaccagat caagcacatt 3660 aaggacttca aggactaca gtacagccac cgggtggaca agaagcctaa tagagagctg 3720 attack ccctgtactc caccccgaag gacgacaagg gcacaccct gatcgtgac 3780 aatctgaacg gcctgtacga caaggacaat gacaagctga aaaagctgat caacaagagc 3840 cccgaaaagc tgctgatgta ccaccacgac ccccagacct accagaaact gaagctgatt 3900 atggaacagt acggcgacga gaagaatccc ctgtacaagt actacgagga aaccgggaac 3960 tacctgacca agtactccaa aaaggacaac ggccccgtga tcaagaagat taagtattac 4020 ggcaacaaac tgaacgccca tctggacatc accgacgact accccaacag cagaaacaag 4080 gtcgtgaagc tgtccctgaa gccctacaga ttcgacgtgt acctggacaa tggcgtgtac 4140 aagttcgtga ccgtgaagaa tctggatgtg atcaaaaaag aaaactacta cgaagtgaat 4200 agcaagtgct atgaggaagc taagaagctg aagaagatca gcaaccaggc cgagtttatc 4260 gcctccttct acaacga tctgatcaag atcaacggcg agctcttatag agtgatcggc 4320 gtgaacaacg acctgctgaa ccggatcgaa gtgaacatga tcgacatcac ctaccgcgag 4380 tacctggaaa acatgaacga caagaggccc cccaggatca ttaagacaat cgcctccaag 4440 acccagagca ttaagaagta cagcacagac attctgggca acctgtatga agtgaaatct 4500 aagaagcacc ctcagatcat caaaaagggc aaaaggccgg cggccacgaa aaaggccggc 4560 caggcaaaaa agaaaaaggg atcctaccca tacgatgttc cagattacgc ttacccatac 4620 gatgttccag attacgctta cccatacgat gttccagatt acgcttaaga attctagcaa 4680 taaaggatcg tttattttca ttggaagcgt gtgttggttt tttgatcagg cgcgggtacc 4740 gaacgctgac gtcatcaacc cgctccaagg aatcgcgggc ccagtgtcac taggcgggaa 4800 cacccagcgc gcgtgcgccc tggcaggaag atggctgtga gggacagggg agtggcgccc 4860 tgcaatattt gcatgtcgct atgtgttctg ggaaatcacc ataaacgtga aatgtctttg 4920 gatttgggaa tcttataagt tctgtatgag accacatata gtaatgaaat tattggcacg 4980 ttttagtact ctggaaacag aatctactaa aacaaggcaa aatgccgtgt ttatctcgtc 5040 aacttgttgg cgagattttt ggtaccagga acccctagtg atggagttgg ccactccctc 5100 tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag gtcgcccgac gcccgggctt 5160 tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc ctgcaggggc gcctgatgcg 5220 gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atacgtcaaa gcaaccatag 5280 tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc 5340 gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc 5400 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt 5460 agtgctttac ggcacctcga ccccaaaaaa cttgatttgg gtgatggttc acgtagtggg 5520 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt 5580 ggactcttgt tccaaactgg aacaacactc aaccctatct cgggctattc ttttgattta 5640 taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt 5700 aacgcgaatt ttaacaaaat attaacgttt acaattttat ggtgcactct cagtacaatc 5760 tgctctgatg ccgcatagtt aagccagccc cgacacccgc caacacccgc tgacgcgccc 5820 tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt ctccgggagc 5880 tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgagacgaaa gggcctcgtg 5940 atacgcctat ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc 6000 acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat 6060 atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag 6120 agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt 6180 cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt 6240 gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga gagttttcgc 6300 cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta 6360 tcccgtattg acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac 6420 ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa 6480 ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg 6540 atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc 6600 cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg 6660 atgcctgtag caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta 6720 gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg accacttctg 6780 cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtgga 6840 agccgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc 6900 tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt 6960 gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt 7020 gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc 7080 atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag 7140 atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa 7200 aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg 7260 aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag 7320 ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg 7380 ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga 7440 tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc 7500 ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc 7560 acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga 7620 gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt 7680 cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg 7740 aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac 7800 atgt 7804 <![CDATA[<210> 20]]> <![CDATA[<211> 7408]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 20]]>[[ID=I]] cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgccccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggctcta gaaaaaatct cgccaacaag ttgacgagat aaacacggca 180 ttttgccttg ttttagtaga ttctgtttcc aagtactaa aacacatttc ctctctatac 240 aaatgcggtg tttcgtcctt tccacaagat atataaagcc aagaaatcga aatactttca 300 agttaacggta agcatatgat agtccatttt aaaacataat tttaaaactg caaactaccc 360 aagaaattat tactttctac gtcacgtatt ttgtactaat atctttgtgt ttacagtcaa 420 attaattcca attatctctc taacagcctt gtatcgtata tgcaaatatg aaaggaatcat 480 gggaaatagg ccctcctcga gtcgagtggc tccggtgccc gtcagtgggc agagcgcaca 540 tcgcccacag tccccgagaa gttgggggga ggggtcggca attgaaccgg tgcctagaga 600 aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct ttttccccgag 660 ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt tcgcaacggg 720 tttgccgcca gaacacaggt gtcgtgaccg cggccatggc cccaaagaag aagcggaagg 780 tcggtatcca cggagtccca gcagccaagc ggaactacat cctgggcctg gacatcggca 840 tcaccagcgt gggctacggc atcatcgact acgagacacg ggacgtgatc gatgccggcg 900 tgcggctgtt caaagaggcc aacgtggaaa acaacgaggg caggcggagc aagagaggcg 960 ccagaaggct gaagcggcgg aggcggcata gaatccagag agtgaagaag ctgctgttcg 1020 actacaacct gctgaccgac cacagcgagc tgagcggcat caacccctac gaggccagag 1080 tgaagggcct gagccagaag ctgagcgagg aagagttctc tgccgccctg ctgcacctgg 1140 1200 ccaccaaaga cgagatcagc gggaacagca aggccctgga agaaatac gtggccgaac 1260 tgcagctgga acggctgaag aaagacggcg aagtgcgggg cagcatcaac agattcaaga 1320 ccagcgacta cgtgaaagaa gccaaacagc tgctgaaggt gcagaaggcc taccaccagc 1380 tggaccagag cttcatcgac acctacatcg acctgctgga aacccggcgg acctactatg 1440 agggacctgg cgagggcagc cccttcggct ggaggacat caaagaatgg tacgagatgc 1500 tgatgggcca ctgcacctac ttccccgagg aactgcggag cgtgaagtac gcctacaacg 1560 ccgacctgta caacgccctg aacgacctga acaatctcgt gatcaccagg gacgagaacg 1620 agaagctgga atattacgag aagttccaga tcatcgagaa cgtgttcaag cagaagaaga 1680 agcccaccct gaagcagatc gccaaagaaa tcctcgtgaa cgaagaggat attaagggct 1740 acagagtgac cagcaccggc aagcccgagt tcaccaacct gaaggtgtac cacgacatca 1800 aggacattac cgcccggaaa gagattattg agaacgccga gctgctggat cagattgcca 1860 agatcctgac catctaccag agcagcgagg acatccagga agaactgacc aatctgaact 1920 ccgagctgac ccaggaagag atcgagcaga tctctaatct gaagggctat accggcaccc 1980 acaacctgag cctgaaggcc atcaacctga tcctggacga gctgtggcac accaacgaca 2040 accagatcgc tatcttcaac cggctgaagc tggtgcccaa gaaggtggac ctgtcccagc 2100 agaaagagat ccccaccacc ctggtggacg acttcatcct gagccccgtc gtgaagagaa 2160 gcttcatcca gagcatcaaa gtgatcaacg ccatcatcaa gaagtacggc ctgcccaacg 2220 acatcattat cgagctggcc cgcgagaaga actccaagga cgcccagaaa atgatcaacg 2280 agatgcagaa gcggaaccgg cagaccaacg agcggatcga ggaaatcatc cggaccaccg 2340 gcaaagagaa cgccaagtac ctgatcgaga agatcaagct gcacgacatg caggaaggca 2400 agtgcctgta cagcctggaa gccatccctc tggaagatct gctgaacaac cccttcaact 2460 atgaggtgga ccacatcatc cccagaagcg tgtccttgga caacagcttc aacaacaagg 2520 tgctcgtgaa ccaggaaaa aacagcaaga agggcaaccg gaccccattc cagatacctga 2580 gcagcagcga cagcaagatc agctacgaaa ccttcaagaa gcacatcctg aatctggcca 2640 agggcaaggg cagaatcagc aagaccaaga aagagtatct gctggagaa cgggacatca 2700 acaggttctc cgtgcagaaa gacttcatca accggaacct ggtggatacc agatacgcca 2760 ccagaggcct gatgaacctg ctgcggagct acttcagagt gaacaacctg gacgtgaaag 2820 tgaagtccat caatggcggc ttcaccagct ttctgcggcg gaagtggaag tttaagaaag 2880 agggaacaa ggggtacaag caccacgccg aggacgccct gatcattgcc aacgccgatt 2940 3000 tcgagaaaa ccaggccgag agcatgccg agatcgaaac cgagcaggag tacaaaga 3060 tcttcatcac ccccaccacag atcaagcaca ttaaggactt caaggactac aagtacagcc 3120 accgggtgga caagaagcct aatatagagc tgattaacga caccctgtac tccacccgga 3180 agcacgacaa gggcaacacc ctgatcgtga acaatctgaa cggcctgtac gacaaggaca 3240 atgacaagct gaaaaagctg atcaacaaga gccccgaaaa gctgctgatg taccaccacg 3300 acccccagac ctaccagaaa ctgaagctga ttatggaaca gtacggcgac gagagaatc 3360 3420 acggccccgt gatcaagaag attaagtatt acggcaacaa actgaacgcc catctggaca 3480 tcaccgacga ctaccccaac agcagaaaca aggtcgtgaa gctgtccctg aagccctaca 3540 gattcgacgt gtacctggac aatggcgtgt acaagttcgt gaccgtgaag aatctggatg 3600 tgatcaaaaa agaaaactac tacgaagtga atagcaagtg ctatgaggaa gctaagaagc 3660 tgaagaagat cagcaaccag gccgagttta tcgcctcctt ctacaacaac gatctgatca 3720 agatcaacgg cgagctgtat agagtgatcg gcgtgaacaa cgacctgctg aaccggatcg 3780 aagtgaacat gatcgacatc acctaccgcg agtacctgga aaacatgaac gacaagaggc 3840 cccccaggat cattaagaca atcgcctcca agacccagag cattaagaag tacagcacag 3900 acattctggg caacctgtat gaagtgaat ctaagaagca ccctcagatc atcaaaaagg 3960 gcaaaaggcc ggcggccacg aaaaaggccg gccaggcaaa aaagaaaaag ggatcctacc 4020 catacgatgt tccagattac gcttacccat acgatgttcc agattacgct tacccatacg 4080 atgttccaga ttacgcttaa gaattcctag agctcgctga tcagcctcga ctgtgccttc 4140 tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc 4200 cactccact gtcctttcct ataaatga ggaaattgca tcgcattgtc tgagtaggtg 4260 tcattctatt ctggggggtg gggtggggca ggagagcaag gggggaggatt gggaagaagaa 4320 tagcaggcat gctggggagg taccgaacgc tgacgtcatc aacccgctcc aaaggaatcgc 4380 gggcccagtg tcactaggcg ggaacaccca gcgcgcgtgc gccctggcag gaagatggct 4440 gtgagggaca ggggagtggc gccctgcaat atttgcatgt cgctatgtgt tctgggaaat 4500 caccataaac gtgaaatgtc tttggatttg ggaatcttat aagttctgta tgagaccaca 4560 tatagtaatg aaattattgg cacgttttag tactctggaa acagaatcta ctaaaacaag 4620 gcaaaatgcc gtgtttatct cgtcaacttg ttggcgagat ttttggtacc aggaacccct 4680 agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc 4740 aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag 4800 ctgcctgcag gggcgcctga tgcggtattt tctccttacg catctgtgcg gtatttcaca 4860 ccgcatacgt caaagcaacc atagtacgcg ccctgtagcg gcgcattaag cgcggcgggt 4920 gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc cgctcctttc 4980 gctttcttcc cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg 5040 gggctccctt tagggttccg atttagtgct ttacggcacc tcgaccccaa aaaacttgat 5100 ttgggtgatg gttcacgtag tgggccatcg ccctgataga cggtttttcg ccctttgacg 5160 ttggagtcca cgttctttaa tagtggactc ttgttccaaa ctggaacaac actcaaccct 5220 atctcgggct attcttttga tttataaggg attttgccga tttcggccta ttggttaaaa 5280 aatgagctga tttaacaaaa atttaacgcg aattttaaca aaatattaac gtttacaatt 5340 ttatggtgca ctctcagtac aatctgctct gatgccgcat agttaagcca gccccgacac 5400 ccgccaacac ccgctgacgc gccctgacgg gcttgtctgc tcccggcatc cgcttacaga 5460 caagctgtga ccgtctccgg gagctgcatg tgtcagaggt tttcaccgtc atcaccgaaa 5520 cgcgcgagac gaaagggcct cgtgatacgc ctatttttat aggttaatgt catgataata 5580 atggtttctt agacgtcagg tggcactttt cggggaaatg tgcgcggaac ccctatttgt 5640 ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc ctgataaatg 5700 cttcaataat attgaaaaag gaagagtatg agtattcaac atttccgtgt cgcccttatt 5760 cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta 5820 aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga tctcaacagc 5880 ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag cacttttaaa 5940 gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca actcggtcgc 6000 cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga aaagcatctt 6060 acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag tgataacact 6120 gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc ttttttgcac 6180 aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa tgaagccata 6240 ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg caacaacgtt gcgcaaacta 6300 ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg gatggaggcg 6360 gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt tattgctgat 6420 aaatctggag ccggtgagcg tggaagccgc ggtatcattg cagcactggg gccagatggt 6480 aagccctccc gtatcgtagt tatctacacg acggggagagtc aggcaactat ggatgaacga 6540 aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact gtcagaccaa 6600 gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa aaggatctag 6660 gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt ttcgttccac 6720 tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt ttttctgcgc 6780 gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg tttgccggat 6840 caagagctac caactctttt tccgaaggta actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt agcaccgcct 6960 acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga tagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact gagataccta 7140 cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggac aggagagcgc acgagggagc ttccaggggg aaacgcctgg 7260 tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc 7320 tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt acggttcctg 7380 gccttttgct ggccttttgc tcacatgt 7408 <![CDATA[<210> 21]]> <![CDATA[<211> 7616]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Synthetic sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 21]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggctcta gaaaaaatct cgccaacaag ttgacgagat aaacacggca 180 ttttgccttg ttttagtaga ttctgtttcc aagtactaa aacacatttc ctctctatac 240 aaatgcggtg tttcgtcctt tccacaagat atataaagcc aagaaatcga aatactttca 300 agttaacggta agcatatgat agtccatttt aaaacataat tttaaaactg caaactaccc 360 aagaaattat tactttctac gtcacgtatt ttgtactaat atctttgtgt ttacagtcaa 420 attaattcca attatctctc taacagcctt gtatcgtata tgcaaatatg aaaggaatcat 480 gggaaatagg ccctcctcga gctagactag catgctgccc atgtaaggag gcaaggcctg 540 gggacacccg agatgcctgg ttataattaa cccagacatg tggctgcccc cccccccccca 600 acacctgctg cctctaaaaa taaccctgca tgccatgttc ccggcgaagg gccagctgtc ccccgccagc tagactcagc acttagttta ggaaccagtg agcaagtcag cccttggggc 720 agcccataca aggccatggg gctgggcaag ctgcacgcct gggtccgggg tgggcacggt 780 gcccgggcaa cgagctgaaa gctcatctgc tctcaggggc ccctccctgg ggacagcccc 840 tcctggctag tcacaccctg taggctcctc fatheraccc aggggcacag gggctgccct 900 cattctacca ccacctccac caccacac cacctcagg caccggtgcc 960. cattctacca ccacctccac accatggccc caaagaagaa gcggaaggtc ggtatccacg gagtcccagc agccaagcgg aactacatcc tgggcctgga catcggcatc accagcgtgg gctacggcat catcgactac gagacacggg acgtgatcga tgccggcgtg cggctgttca aagaggccaa cgtggaaaac 1140 aacgaggca ggcggagcaa gagaggcgcc agaaggctga agcggcggag gcggcataga 1200 atccagagag tgaagaagct gctggttcgac tacaacctgc tgaccgacca cagcgagctg 1260 agcggcatca acccctacga ggccagagtg aagggcctga gccagaagct gagcgaggaa 1320 gagttctctg ccgccctgct gcacctggcc aagagaagag gcgtgcacaa cgtgaacgag 1380 gtggagaagg acaccggcaa cgagctgtcc accaaagagc agatcagccg gaacagcaag 1440 gccctggaag agaatacgt ggccgaactg cagctggaac ggctgaagaa agacggcgaa 1500 gtgcggggca gcatcaacag attcaagacc agcgactacg tgaaagaagc caaacagctg 1560 ctgaaggtgc agaaggccta ccaccagctg gaccagagct tcatcgacac ctacatcgac 1620 ctgctggaaa cccggcggac ctactatgag ggacctggcg agggcagccc cttcggctgg 1680 aaggacatca aagaatggta cgagatgctg atgggccact gcacctactt ccccgaggaa 1740 ctgcggagcg tgaagtacgc ctacaacgcc gacctgtaca acgccctgaa cgacctgaac 1800 aatctcgtga tcaccaggga cgagaacgag aagctgggaat attacgagaa gttccagatc 1860 atcgagaacg tgttcaagca gaagaagaag cccaccctga agcagatcgc caaagaaatc 1920 ctcgtgaacg aagaggatat taagggctac agagtgacca gcaccggcaa gcccgagttc 1980 accaacctga aggtgtacca cgacatcaag gacattaccg cccggaaaga gattattgag 2040 aacgccgagc tgctggatca gattgccaag atcctgacca tctaccagag cagcgaggac 2100 atccaggaag aactgaccaa tctgaactcc gagctgaccc aggaagagat cgagcagatc 2160 tctaatctga agggctatac cggcacccac aacctgagcc tgaaggccat caacctgatc 2220 ctggacgagc tgtggcacac caacgacaac cagatcgcta tcttcaaccg gctgaagctg 2280 gtgcccaaga aggtggacct gtcccagcag aaagagatcc ccaccaccct ggtggacgac 2340 ttcatcctga gccccgtcgt gaagagaagc ttcatccaga gcatcaaagt gatcaacgcc 2400 atcatcaaga agtacggcct gcccaacgac atcattatcg agctggcccg cgagaagaac 2460 tccaaggacg cccagaaaat gatcaacgag atgcagaagc ggaaccggca gaccaacgag 2520 cggatcgagg aaatcatccg gaccaccggc aaagagaacg ccaagtacct gatcgagaag 2580 atcaagctgc acgacatgca ggaaggcaag tgcctgtaca gcctggaagc catccctctg 2640 gaagatctgc tgaacaaccc cttcaactat gaggtggacc acatcatccc cagaagcgtg 2700 tccttcgaca acagcttcaa caacaaggtg ctcgtgaagc aggaagaaaa cagcaagaag 2760 ggcaaccgga ccccattcca gtacctgagc agcagcgaca gcaagatcag ctacgaaacc 2820 ttcaagaagc acatcctgaa tctggccaag ggcaagggca gaatcagcaa gaccaagaaa 2880 gagtatctgc tggaagaacg ggacatcaac aggttctccg tgcagaaaga cttcatcaac 2940 cggaacctgg tggataccag atacgccacc agaggcctga tgaacctgct gcggagctac 3000 3060 ctgcggcgga agtggaagtt taagaaagag cggaacaagg ggtacaagca ccacgccgag 3120 gacgccctga tcattgccaa cgccgatttc atcttcaaag agtggagaa actggacaag 3180 gccaaaaaag tgatggaaaa ccagatgttc gaggaaaagc aggccgagag catgcccgag 3240 atcgaaaccg aggaggagat caaagagatc ttcatcaccc cccaccagat caagcacatt 3300 areacttca aggactacaa gtacagccac cgggtggaca agaagcctaa tagagagctg 3360 3420 aatctgaacg gcctgtacga caaggacaat gacaagctga aaaagctgat caacaagagc 3480 cccgaaaagc tgctgatgta ccaccacgac ccccagacct accagaaact gaagctgatt 3540 atggaacagt acggcgacga gaagaatccc ctgtacaagt actacgagga aaccgggaac 3600 tacctgacca agtactccaa aaaggacaac ggccccgtga tcaagaagat taagtattac 3660 ggcaacaaac tgaacgccca tctggacatc accgacgact accccaacag cagaaacaag 3720 gtcgtgaagc tgtccctgaa gccctacaga ttcgacgtgt acctggacaa tggcgtgtac 3780 aagttcgtga ccgtgaagaa tctggatgtg atcaaaaaag aaaactacta cgaagtgaat 3840 agcaagtgct atgaggaagc taagaagctg aagaagatca gcaaccaggc cgagtttatc 3900 gcctccttct acaacga tctgatcaag atcaacggcg agctcttatag agtgatcggc 3960 gtgaacaacg acctgctgaa ccggatcgaa gtgaacatga tcgacatcac ctaccgcgag 4020 tacctggaaa acatgaacga caagaggccc cccaggatca ttaagacaat cgcctccaag 4080 acccagagca ttaagaagta cagcacagac attctgggca acctgtatga agtgaaatct 4140 aagaagcacc ctcagatcat caaaaagggc aaaaggccgg cggccacgaa aaaggccggc 4200 caggcaaaaa agaaaaaggg atcctaccca tacgatgttc cagattacgc ttacccatac 4260 gatgttccag attacgctta cccatacgat gttccagatt acgcttaaga attcctagag 4320 ctcgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 4380 ccgtgccctt cttgaccctg gaaggtgcca ctccactgt cctttcctaa taaaatgagg 4440 aaattgcatc gcattgtctg agtaggtgtc attctattct gggggtggg gtggggcagg 4500 acagcaaggg ggaggattgg gagagata gcaggcatgc tgggaggta ccgaacgctg 4560 acgtcatcaa cccgctccaa ggaatcgcgg gcccagtgtc actaggcggg aacacccagc 4620 gcgcgtgcgc cctggcagga agatggctgt gagggacagg ggtggcgc cctgcaat 4680 ttgcatgtcg ctatgtgttc tgggaatca ccataaacgt gaaatgtctt tggattttgg 4740 aatcttataa gttctgtatg agaccacata tagtaatgaa attattggca cgttttagta 4800 ctctggaaac agaatctact aaaacaggc aaatgccgt gtttatctcg tcaacttgtt 4860 ggcgagattt ttggtaccag gaaccctag tgatggatt ggccactccc tctctgcgcg 4920 ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 4980 cggcctcagt gagcgagcga gcgcgcagct gcctgcaggg gcgcctgatg cggtattttc 5040 tccttacgca tctgtgcggt atttcacacc gcatacgtca aagcaaccat agtacgcgcc 5100 ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga ccgctacact 5160 tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg ccacgttcgc 5220 cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat ttagtgcttt 5280 acggcacctc gaccccaaaa aacttgattt gggtgatggt tcacgtagtg ggccatcgcc 5340 ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata gtggactctt 5400 gttccaaact ggaacaacac tcaaccctat ctcgggctat tcttttgatt tataagggat 5460 tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa 5520 ttttaacaaa atattaacgt ttacaatttt atggtgcact ctcagtacaa tctgctctga 5580 tgccgcatag ttaagccagc cccgacaccc gccaacaccc gctgacgcgc cctgacgggc 5640 ttgtctgctc ccggcatccg cttacagaca agctgtgacc gtctccggga gctgcatgtg 5700 tcagaggtt tcaccgtcat caccgaaacg cgcgagacga aagggcctcg tgatacgcct 5760 atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg gcacttttcg 5820 gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa atatgtatcc 5880 gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga agagtatgag 5940 tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt 6000 tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt 6060 gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc gccccgaaga 6120 acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat tatcccgtat 6180 tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg acttggttga 6240 gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag 6300 tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg 6360 accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc gccttgatcg 6420 ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca cgatgcctgt 6480 agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc tagcttcccg 6540 gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc 6600 ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg 6660 tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta tctacacgac 6720 ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag gtgcctcact 6780 gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttaaa 6840 acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc tcatgaccaa 6900 aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg 6960 atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc 7020 gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac 7080 tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca 7140 ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt 7200 ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc 7260 ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg 7320 aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc 7380 cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac 7440 gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct 7500 ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc 7560 cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgt 7616 <![CDATA[<210> 22]]> <![CDATA[<211> 7553]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 22]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgccccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggctcta gaaaaaatct cgccaacaag ttgacgagat aaacacggca 180 ttttgccttg ttttagtaga ttctgtttcc aagtactaa aacacatttc ctctctatac 240 aaatgcggtg tttcgtcctt tccacaagat atataaagcc aagaaatcga aatactttca 300 agttaacggta agcatatgat agtccatttt aaaacataat tttaaaactg caaactaccc 360 aagaaattat tactttctac gtcacgtatt ttgtactaat atctttgtgt ttacagtcaa 420 attaattcca attatctctc taacagcctt gtatcgtata tgcaaatatg aaaggaatcat 480 gggaaatagg ccctcctcga ggagctccac cgcggtggcg gccgtccgcc ttcggcacca 540 tcctcacgac acccaataat ggcgacgggt gaggaatggt ggggagttat ttttagagcg 600 gtgaggaagg tgggcaggca gcaggtgttg gcgctctaaa aaactccc gggagttatt 660 tttagagcgg aggaatggtg ugaracccaaa tattggcgacg gttcctcacc cgtcgccata 720 ttgggtgtc cgccctcggc cggggccgca tcctggggg ccggcggtg ctcccgccg 780 cctcgataaa aggctccgggg gccggcggcg gcccacgaggc tacccggagg agcgggaggc 840 gccaagctct agaactagtg gatcccccgg gctgcaggaa ttcgatatac cggtgccacc 900 atggccccaa agagaagcg gaaggtcggt atccacggag tcccagcagc agacggaac 960 tacatcctgg gcctggacat cggcatcacc agcgtgggct acggcatcat cgactacgag 1020 acacggggacg tgatcgatgc cggcgtgcgg ctgttcaaag aggccaacgt ggaaaacaac 1080 gagggcaggc ggagcaagag aggcgccaga aggctgaagc ggcggaggcg catagaatc 1140 cagagagtga agaagctgct gttcgactac aacctgctga ccgaccacag cgagctgagc 1200 ggcatcaacc cctacgaggc cagagtgaag ggcctgagcc agaagctgag cgaggaagag 1260 ttctctgccg ccctgctgca cctggccaag agaagaggcg tgcacaacgt gaacgaggtg 1320 gaagaggaca ccggcaacga gctgtccacc aaagagcaga tcagccggaa cagcaaggcc 1380 ctggaagaga aatacgtggc cgaactgcag ctggaacggc tgaagaaaga cggcgaagtg 1440 cggggcagca tcacagatt caaccagc gactacgtga aagaagccaa acagctgctg 1500 aaggtgcaga aggcctacca ccagctggac cagagcttca tcgacaccta catcgacctg 1560 ctggaaaccc ggcggaccta cttggcgagg gcagcccctt cggctggaag 1620 gatacaag aatggtacga gatgctgatg ggccactgca cctactcccc cgaggaactg 1680 cggagcgtga agtacgccta caacgccgac ctgtacaacg ccctgaacga cctgaacat 1740 ctcgtgatca ccaggacga gaacgagaag ctggaatatt acggaagtt ccagatcatc 1800 gagaacgtgt tcaagcagaa gagaagcccc accctgaagc agatcgccaa agaatccctc 1860 gtgaacgaag aggattaa gggctacaga gtgaccagca ccggcaagcc cgagttcacc 1920 1980 gccgagctgc tggatcagat tgccaagatc ctgaccatct accagagcag cgaggacatc 2040 caggaaac tgaccaatct gaactccgag ctgacccagg aagagatcga ccagatctct 2100 aatctgaagg gctataccgg cacccacaac ctgagcctga aggccatcaa cctgatcctg 2160 gacgagctgt ggcacaccaa cgacaaccag atcgctatct tcaaccggct gaagctgggtg 2220 cccaagaagg tggacctgtc ccagcagaaa gagatcccca ccaccctggt ggacgacttc 2280 atcctgagcc ccgtcgtgaa gagaagcttc atccagagca tcaaagtgat caacgccatc 2340 atcaagaagt acggcctgcc caacgacatc attatcgagc tggcccgcga gaagaactcc 2400 aaggaacgccc agaaaatgat caacgagatg cagaagcgga accggcagac caacgagcgg 2460 atcgagaaa tcatccggac caccggcaaa gagaacgcca agtacctgat cgagaagatc 2520 aagctgcacg acatgcagga aggcaagtgc ctgtacagcc tggaagccat ccctctggaa 2580 gatctgctga acaacccctt caactatgag gtggaccaca tcatccccag aagcgtgtcc 2640 ttcgacaaca gcttcaacaa caaggtgctc gtgaagcagg aagaaaacag caagaagggc 2700 aaccggaccc cattccagta cctgagcagc agcgacagca agatcagcta cgaaaccttc 2760 aagaagcaca tcctgaatct ggccaagggc aagggcagaa tcagcaagac caagaaagag 2820 tatctgctgg aagaacggga catcaacagg ttctccgtgc agaaagactt catcaaccgg 2880 aacctggtgg ataccagata cgccaccaga ggcctgatga acctgctgcg gagctacttc 2940 agagtgaaca acctggacgt gaaagtgaag tccatcaatg gcggcttcac cagctttctg 3000 cggcggaagt ggaagtttaa gaaagagcgg aacaaggggt acaagcacca cgccgaggac 3060 gccctgatca ttgccaacgc cgatttcatc ttcaaagagt ggaagaaact ggacaaggcc 3120 aaaaaagtga tggaaaacca gatgttcgag gaaaagcagg ccgagagcat gcccgagatc 3180 gaaaccgagc aggagtacaa agagatcttc atcacccccc accagatcaa gcacattaag 3240 gacttcaagg actacaagta cagccaccgg gtggacaaga agcctaatag agagctgatt 3300 aacgacaccc tgtactccac ccggaaggac gacaagggca acaccctgat cgtgaacaat 3360 ctgaacggcc tgtacgacaa ggacaatgac aagctgaaaa agctgatcaa caagagcccc 3420 gaaaagctgc tgatgtacca ccacgacccc cagacctacc agaaactgaa gctgattatg 3480 gaacagtacg gcgacgagaa gaatcccctg tacaagtact acgagaaac cgggaactac 3540 ctgaccaagt actccaaaaa ggacaacggc cccgtgatca agaattaa gtattacggc 3600 aaaactga acgcccatct ggacatcacc gacgactacc ccaacagcag aaacaaggttc 3660 gtgaagctgt ccctgaagcc ctacagattc gacgtgtacc tggacaatgg cgtgtacaag 3720 ttcgtgaccg tgaagaatct ggatgtgatc aaaaaagaaa actactacga agtgaatagc 3780 aagtgctatg aggaagctaa gaagctgaag aagatcagca accaggccga gtttatcgcc 3840 tccttctaca acaacgatct gatcaagatc aacggcgagc tgtatagagt gatcggcgtg 3900 aacaacgacc tgctgaaccg gatcgaagtg aacatgatcg acatcaccta ccgcgagtac 3960 ctggaaaaca tgaacgacaa gaggcccccc aggatcatta agacaatcgc ctccaagacc 4020 cagagcatta agaagtacag cacagacatt ctgggcaacc tgtatgaagt gaaatctaag 4080 aagcaccctc agatcatcaa aaagggcaaa aggccggcgg ccacgaaaaa ggccggccag 4140 gcaaaaaaga aaaagggatc ctacccatac gatgttccag attacgctta cccatacgat 4200 gttccagatt acgcttaccc atacgatgtt ccagattacg cttaagaatt cctagagctc 4260 gctgatcagc ctcgactgtg ccttctagtt gccagccatc tgttgtttgc ccctcccccg 4320 tgccttcctt gaccctggaa ggtgccactc ccactgtcct ttcctaataa aatgaggaaa 4380 ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg gggtggggtg gggcaggaca 4440 gcaaggggga ggattgggaa gagaatagca ggcatgctgg ggaggtaccg aacgctgacg 4500 tcatcaaccc gctccaagga atcgcgggcc cagtgtcact aggcgggaac acccagcgcg 4560 cgtgcgccct ggcaggaaga tggctgtgag ggacagggga gtggcgccct gcaatatttg 4620 catgtcgcta tgtgttctgg gaaatcacca taaacgtgaa atgtctttgg atttgggaat 4680 cttataagtt ctgtatgaga ccacatatag taatgaaatt attggcacgt tttagtactc 4740 tggaaacaga atctactaaa acaaggcaaa atgccgtgtt tatctcgtca acttgttggc 4800 gagatttttg gtaccaggaa cccctagtga tggagttggc cactccctct ctgcgcgctc 4860 gctcgctcac tgaggccggg cgaccaaagg tcgcccgacg cccgggcttt gcccgggcgg 4920 cctcagtgag cgagcgagcg cgcagctgcc tgcaggggcg cctgatgcgg tattttctcc 4980 ttacgcatct gtgcggtatt tcacaccgca tacgtcaaag caaccatagt acgcgccctg 5040 tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc 5100 cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg 5160 ctttccccgt caagctctaa atcgggggct ccctttaggg ttccgattta gtgctttacg 5220 gcacctcgac cccaaaaaac ttgatttggg tgatggttca cgtagtgggc catcgccctg 5280 atagacggtt tttcgccctt tgacgttgga gtccacgttc tttaatagtg gactcttgtt 5340 ccaaactgga acaacactca accctatctc gggctattct tttgatttat aagggatttt 5400 gccgatttcg gcctattggt taaaaaatga gctgatttaa caaaaattta acgcgaattt 5460 taacaaaata ttaacgttta caattttatg gtgcactctc agtacaatct gctctgatgc 5520 cgcatagtta agccagcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg 5580 tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca 5640 gaggttttca ccgtcatcac cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt 5700 tttataggtt aatgtcatga taataatggt ttcttagacg tcaggtggca cttttcgggg 5760 aaatgtgcgc ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct 5820 catgagacaa taaccctgat aaatgcttca samaattga aaaaggaaga gtatgagtat 5880 tcaacatttc cgtgtcgccc ttatccctt ttttgcggca ttttgccttc ctgtttttgc 5940 tcacccagaa acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg 6000 ttacatcgaa ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg 6060 ttttccaatg atgagcactt ttaaaagttct gctatgtggc gcggtattat cccgtattga 6120 cgccgggcaa gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta 6180 ctcaccagtc acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc 6240 tgccataacc atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc 6300 gaaggagcta accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg 6360 ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc 6420 aatggcaaca acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca 6480 acaattaata gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct 6540 tccggctggc tggtttattg ctgataaatc tggagccggt gagcgtggaa gccgcggtat 6600 cattgcagca ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg 6660 gagtcaggca actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat 6720 taagcattgg taactgtcag accaagttta ctcatatata ctttagattg atttaaaact 6780 tcatttttaa tttaaaagga tctaggtgaa gatcctttt gataatctca tgaccaaaat 6840 cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc 6900 ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct 6960 accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg 7020 cttcagcaga gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca 7080 cttcaagaac tctgtagcac cgctcatata cctcgctctg ctaatcctgt taccagtggc 7140 tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga 7200 taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac 7260 gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga 7320 agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag 7380 ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg 7440 acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag 7500 caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca tgt �553 <![CDATA[<210> 23]]> <![CDATA[<211> 7976]]> [[ID=第37]] <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<22۰>]]> It should be noted that there may be some inaccuracies in the translation due to the complexity and potential ambiguity of the original text, especially in the handling of some special tags and sequences. The above translation is for reference only. <![CDATA[<223> Synthesis]]> <![CDATA[<400> 23]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctcta gaaaaaatct cgccaacaag ttgacgagat aaacacggca 180 ttttgccttg ttttagtaga ttctgtttcc agagtactaa aacacatttc ctctctatac 240 aaatgcggtg tttcgtcctt tccacaagat atataaagcc aagaaatcga aatactttca 300 agttacggta agcatatgat agtccatttt aaaacataat tttaaaactg caaactaccc 360 aagaaattat tactttctac gtcacgtatt ttgtactaat atctttgtgt ttacagtcaa 420 attaattcca attatctctc taacagcctt gtacgtata tgcaatatg aaggaatcat 480 gggaaatagg ccctcctcga ggtttaaca agcttgcatg tctaagctag acccttcaga 540 ttaaaaataa ctgaggtaag ggcctgggta ggggaggtgg tgtgagacgc tcctgtctct 600 cctctatctg cccatcggcc ctttggggag gaggaatgtg cccaggact aaaaaaggc 660 catggagcca gaggggcgag ggcacagac cttcatggg caaccttgg ggccctgctg 720 tctagcatgc cccactacgg gtctaggctg cccatgtaag gaggcaaggc ctggggacac 780 ccgagatgcc tggttaat taacccagac atgtggctgc cccccccccc ccacacctg 840 ctgcctctaa aaataccct gtccctgtg gatcccctgc atgcgaagat cttcgaacaa 900 ggctgtgggg gactgagggc aggctgtaac aggcttgggg gccagggctt atacgtgcct 960 gggactccca aagtattact gttccatgtt cccggcgaag ggccagctgt cccccgccag 1020 ctagactcag cacttagttt aggaaccagt gagcaagtca gcccttgggg cagcccatac 1080 aaggccatgg ggctgggcaa gctgcacgcc tgggtccggg gtgggcacgg tgcccgggca 1140 acgagctgaa agctcatctg ctctcagggg cccctccctg gggacagccc ctcctggcta 1200 gtcacaccct gtaggctcct ctatataacc caggggcaca ggggctgccc tcattctacc 1260 accacctcca cagcacagac agacactcag gagccagcca gcggcgcgcc caccggtgcc 1320 accatggccc caaagaagaa gcggaaggtc ggtatccacg gagtcccagc agccaagcgg 1380 aactacatcc tgggcctgga catcggcatc accagcgtgg gctacggcat catcgactac 1440 gagacacggg acgtgatcga tgccggcgtg cggctgttca aagaggccaa cgtggaaaac 1500 aacgaggca ggcggagcaa gagaggcgcc agaaggctga agcggcggag gcggcataga 1560 atccagagag tgaagaagct gctggttcgac tacaacctgc tgaccgacca cagcgagctg 1620 agcggcatca acccctacga ggccagagtg aagggcctga gccagaagct gagcgaggaa 1680 gagttctctg ccgccctgct gcacctggcc aagagaagag gcgtgcacaa cgtgaacgag 1740 gtggagaagg acaccggcaa cgagctgtcc accaaagagc agatcagccg gaacagcaag 1800 gccctggaag agaatacgt ggccgaactg cagctggaac ggctgaagaa agacggcgaa 1860 gtgcggggca gcatcaacag attcaagacc agcgactacg tgaaagaagc caaacagctg 1920 ctgaaggtgc agaaggccta ccaccagctg gaccagagct tcatcgacac ctacatcgac 1980 ctgctggaaa cccggcggac ctactatgag ggacctggcg agggcagccc cttcggctgg 2040 2100 ctgcggagcg tgaagtacgc ctacaacgcc gacctgtaca acgccctgaa cgacctgaac 2160 aatctcgtga tcaccaggga cgagaacgag aagctggaat attacgagaa gttccagatc 2220 atcgagaacg tgttcaagca gaagagaag cccaccctga agcagatcgc caaagaaatc 2280 ctcgtgaacg aagaggattat taagggctac agagtgacca gcaccggcaa gcccgagttc 2340 accaacctga aggtgtacca cgacatcaag gacattaccg cccggaaaga gattattgag 2400 aacgccgagc tgctggatca gattgccaag atcctgacca tctaccagag cagcgaggac 2460 atccaggaag aactgaccaa tctgaactcc gagctgaccc aggaagagat cgagcagatc 2520 tctaatctga agggctatac cggcacccac aacctgagcc tgaaggccat caacctgatc 2580 ctggacgagc tgtggcacac caacgacaac cagatcgcta tcttcaaccg gctgaagctg 2640 gtgcccaaga aggtggacct gtcccagcag aaagagatcc ccaccaccct ggtggacgac 2700 ttcatcctga gccccgtcgt gaagagaagc ttcatccaga gcatcaaagt gatcaacgcc 2760 atcatcaaga agtacggcct gcccaacgac atcattatcg agctggcccg cgagaagaac 2820 tccaaggacg cccagaaaat gatcaacgag atgcagaagc ggaaccggca gacaacgag 2880 cggatcgagg aaatcatccg gaccaccggc aaagagaacg ccaagtacct gatcgagaag 2940 atcaagctgc acgacatgca ggaaggcaag tgcctgtaca gcctggaagc catccctctg 3000 gaagatctgc tgaacaaccc cttcaactat gaggtggacc acatcatccc cagaagcgtg 3060 tccttcgaca acagcttcaa caacaaggtg ctcgtgaagc aggaaaaaa cagcaagaag 3120 ggcaaccgga ccccattcca gtacctgagc agcagcgaca gcaagatcag ctacgaaacc 3180 ttcaagaagc acatcctgaa tctggccaag ggcaagggca gaatcagcaa gaccaagaaa 3240 gagtatctgc tggaagaacg ggacatcaac aggttctccg tgcaagaaaga cttcatcaac 3300 cggaacctgg tggataccag atacgccacc agaggcctga tgaacctgct gcggagctac 3360 ttcagagtga acaacctgga cgtgaaagtg aagtccatca atggcggctt caccagcttt 3420 ctgcggcgga agtgaagtt taagaagg cggaacaagg ggtacaagca ccacgccgag 3480 gacgccctga tcattgccaa cgccgatttc atctcaag agtggaagaa actggacaag 3540 gccaaaaaag tgatggaaaa ccagatgttc gaggaaaagc aggccgag catgcccgag 3600 atcgaaaccg agcaggagta caagagatc ttcatcaccc cccaccagat caagcacatt 3660 aaggacttca aggactaca gtacagccac cgggtggaca agaagcctaa tagagagctg 3720 attack ccctgtactc caccccgaag gacgacaagg gcacaccct gatcgtgac 3780 aatctgaacg gcctgtacga caaggacaat gacaagctga aaaagctgat caacaagagc 3840 cccgaaaagc tgctgatgta ccaccacgac ccccagacct accagaaact gaagctgatt 3900 atggaacagt acggcgacga gaagaatccc ctgtacaagt actacgagga aaccgggaac 3960 tacctgacca agtactccaa aaaggacaac ggccccgtga tcaagaagat taagtattac 4020 ggcaacaaac tgaacgccca tctggacatc accgacgact accccaacag cagaaacaag 4080 gtcgtgaagc tgtccctgaa gccctacaga ttcgacgtgt acctggacaa tggcgtgtac 4140 aagttcgtga ccgtgaagaa tctggatgtg atcaaaaaag aaaactacta cgaagtgaat 4200 agcaagtgct atgaggaagc taagaagctg aagaagatca gcaaccaggc cgagtttatc 4260 gcctccttct acaacga tctgatcaag atcaacggcg agctcttatag agtgatcggc 4320 gtgaacaacg acctgctgaa ccggatcgaa gtgaacatga tcgacatcac ctaccgcgag 4380 tacctggaaa acatgaacga caagaggccc cccaggatca ttaagacaat cgcctccaag 4440 acccagagca ttaagaagta cagcacagac attctgggca acctgtatga agtgaaatct 4500 aagaagcacc ctcagatcat caaaaagggc aaaaggccgg cggccacgaa aaaggccggc 4560 caggcaaaaa agaaaaaggg atcctaccca tacgatgttc cagattacgc ttacccatac 4620 gatgttccag attacgctta cccatacgat gttccagatt acgcttaaga attcctagag 4680 ctcgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 4740 ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaatgagg 4800 aaattgcatc gcattgtctg agtaggtgtc attctattct gggggtggg gtggggcagg 4860 acagcaaggg ggaggattgg gagagata gcaggcatgc tggggaggta ccgaacgctg 4920 acgtcatcaa cccgctccaa ggaatcgcgg gcccagtgtc actaggcggg aacacccagc 4980 gcgcgtgcgc cctggcagga agatggctgt gagggacagg ggtggcgc cctgcaat 5040 ttgcatgtcg ctatgtgttc tgggaatca ccataaacgt gaaatgtctt tggattggg 5100 aatcttataa gttctgtatg agaccacata tagtaatgaa attattggca cgttttagta 5160 ctctggaaac agaatctact aaaacaggc aaaatgccgt gtttatctcg tcaacttgtt 5220 ggcgagattt ttggtaccag gaacccctag tgatggagtt ggccactccc tctctgcgcg 5280 ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 5340 cggcctcagt gagcgagcga gcgcgcagct gcctgcaggg gcgcctgatg cggtattttc 5400 tccttacgca tctgtgcggt atttcacacc gcatacgtca aagcaaccat agtacgcgcc 5460 ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga ccgctacact 5520 tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg ccacgttcgc 5580 cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat ttagtgcttt 5640 acggcacctc gaccccaaaa aacttgattt gggtgatggt tcacgtagtg ggccatcgcc 5700 ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata gtggactctt 5760 gttccaaact ggaacaacac tcaaccctat ctcgggctat tcttttgatt tataagggat 5820 tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa 5880 ttttaacaaa atattaacgt ttacaatttt atggtgcact ctcagtacaa tctgctctga 5940 tgccgcatag ttaagccagc cccgacaccc gccaacaccc gctgacgcgc cctgacgggc 6000 ttgtctgctc ccggcatccg cttacagaca agctgtgacc gtctccggga gctgcatgtg 6060 tcagaggttt tcaccgtcat caccgaaacg cgcgagacga aagggcctcg tgatacgcct 6120 atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg gcacttttcg 6180 gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa atatgtatcc 6240 gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga agagtatgag 6300 tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt 6360 tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt 6420 gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc gccccgaaga 6480 acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat tatcccgtat 6540 tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg acttggttga 6600 gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag 6660 tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg 6720 accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc gccttgatcg 6780 ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca cgatgcctgt 6840 agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc tagcttcccg 6900 gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc 6960 ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg 7020 tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta tctacacgac 7080 ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag gtgcctcact 7140 gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttaaa 7200 acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc tcatgaccaa 7260 aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg 7320 atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc 7380 gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac 7440 tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca 7500 ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt 7560 ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc 7620 ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg 7680 aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc 7740 cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac 7800 gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct 7860 ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc 7920 cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgt 7976 <![CDATA[<210> 24]]> <![CDATA[<211> 164]]> <![CDATA[<212> DNA]]> <![CDATA[<213 artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthesis]]> <![CDATA[<400> 24]]> tctagaggat ccggtactcg aggaactgaa aaaccagaaa gttaactggt aagtttagtc 60 [[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​ <![CDATA[ <222> (1)..(2)]]> <![CDATA[ <223> n is a, g, c, or t. <![CDATA[ <220> ]]> <![CDATA[ <221> r]]> <![CDATA[ <222> (4)..(4)]]> <![CDATA[ <223> r is a or g]]> <![CDATA[ <220> ]]> <![CDATA[ <221> r]]> <![CDATA[ <222> (5)..(5)]]> <![CDATA[ <223> r is a or g]]> <![CDATA[ <400> 25]]> nngrr 5 <![CDATA[ <210> 26]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthesis <![CDATA[<2]]> 20>]]> <![CDATA[ <221> misc_feature]]> <![CDATA[ <222> ]]> <![CDATA[(1)..(2) <![CDATA[ <223> n is a, c, g, or t. <![CDATA[ <220> ]]> <![CDATA[ <221> r]]> <![CDATA[ <222> (4)..(4)]]> <![CDATA[ <223> r is a or g]]> <![CDATA[ <220> ]]> <![CDATA[ <221> r]]> <![CDATA[ <222> (5)..(5)]]> <![CDATA[ <223> r is a or g]]> <![CDATA[ <220> ]]> <![CDATA[ <221> misc_feature]]> <![CDATA[ <222> (6)..(6)]]> <![CDATA[ <223> n is a, g, c, or t. <![CDATA[ <400> 26]]> nngrrn 6 <![CDATA[ <210> 27]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthesis <![CDATA[ <220> ]]> <![CDATA[ <221> misc_feature]]> <![CDATA[ <222> (1)..(2)]]> <![CDATA[ <223> n is a, g, c, or t. <![CDATA[ <220> ]]> <![CDATA[ <221> r]]> <![CDATA[ <222> (4)..(4)]]> <![CDATA[ <223> r is a or g]]> <![CDATA[ <220> ]]> <![CDATA[ <221> r]]> <![CDATA[ <222> (5)..(5)]]> <![CDATA[ <223> r is a or g]]> <![CDATA[ <400> 27]]> nngrrt 6 <![CDATA[ <210> 28]]> <![CDATA[ <211> 6]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthesis <![CDATA[ <220> ]]> <![CDATA[ <221> misc_feature]]> <![CDATA[ <222> (1)..(2)]]> <![CDATA[ <223> n is a, g, c, or t. <![CDATA[ <220> ]]> <![CDATA[ <221> r]]> <![CDATA[ <222> (4)..(4)]]> <![CDATA[ <223> r is a or g]]> <![CDATA[ <220> ]]> <![CDATA[ <221> r]]> <![CDATA[ <222> (5)..(5)]]> <![CDATA[ <223> r is a or g]]> <![CDATA[ <400> 28]]> nngrrv 6 <![CDATA[ <210> 29]]> <![CDATA[ <211> 7508]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthesis <![CDATA[ <400> 29]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctcta gactcgagga gctccaccgc ggtggcggcc gtccgccttc 180 ggcaccatcc tcacgacacc caaatatggc gacgggtgag gaatggtggg gagttatttt 240 tagagcggtg aggaaggtgg gcaggcagca ggtgttggcg ctctaaaaat aactcccggg 300 agttattttt agagcggagg aatggtggac acccaaatat ggcgacggtt cctcacccgt 360 cgccatattt gggtgtccgc cctcggccgg ggccgcattc ctgggggccg ggcggtgctc 420 ccgcccgcct cgataaaagg ctccggggcc ggcggcggcc cacgagctac ccggaggagc 480 gggaggcgcc aagctctaga actagtggat cccccgggct gcaggaattc gatatccatg 540 gtctagagga tccggtactc gaggaactga aaaaccagaa agttaactgg taagtttagt 600 cttttgtct tttatttcag gtcccggatc cggtggtggt gcaaatcaaa gaactgctcc 660 tcagtggatg ttgccttac ttctaggcct gtacggaagt gttacgccac catggcccca 720 aagaagaagc ggaaggtcgg tatccacgga gtcccagcag ccaagcggaa ctacatcctg 780 ggcctggaca tcggcatcac cagcgtgggc tacggcatca tcgactacga gacacgggac 840 gtgatcgatg ccggcgtgcg gctgttcaaa gaggccaacg tggaaaacaa cgagggcagg 900 cggagcaaga gaggcgccag aaggctgaag cggcggaggc ggcatagaat ccagagagtg 960 aagaagctgc tgttcgacta caacctgctg accgaccaca gcgagctgag cggcatcaac 1020 ccctacgagg ccagagtgaa gggcctgagc cagaagctga gcgaggaaga gttctctgcc 1080 gccctgctgc acctggccaa gagagaggc gtgcacaacg tgaacgaggt ggagaggac 1140 accggcaacg agctgtccac caaagagcag atcagccgga acagcaaggc cctggaagag 1200 aaatacgtgg ccgaactgca gctgggaacgg ctgaagaaag acggcgaagt gcggggcagc 1260 atcaacagat tcaagaccag cgactacgtg aaagaagcca aacagctgct gaaggtgcag 1320 aaggcctacc accagctgga ccagagcttc atcgacacct acatcgacct gctggaaacc 1380 cggcggacct actatgaggg acctggcgag ggcagcccct tcggctggaa ggacatcaaa 1440 gaatggtacg agatgctgat gggccactgc acctacttcc ccgaggaact gcggagcgtg 1500 aagtacgcct acaacgccga cctgtacaac gccctgaacg acctgaacaa tctcgtgatc 1560 accagggacg agaacgagaa gctggaatat tacgagaagt tccagatcat cgagaacgtg 1620 ttcaagcaga agaagaagcc caccctgaag cagatcgcca aagaaatcct cgtgaacgaa 1680 gaggatatta agggctacag agtgaccagc accggcaagc ccgagttcac caacctgaag 1740 gtgtaccacg acatcaagga cattaccgcc cggaaagaga ttattgagaa cgccgagctg 1800 ctggatcaga ttgccaagat cctgaccatc taccagagca gcgaggacat ccaggaagaa 1860 ctgaccaatc tgaactccga gctgacccag gaagagatcg agcagatctc taatctgaag 1920 ggctataccg gcacccacaa cctgagcctg aaggccatca acctgatcct ggacgagctg 1980 tggcacacca acgacaacca gatcgctatc ttcaaccggc tgaagctggt gcccaagaag 2040 gtggacctgt cccagcagaa agagatcccc accaccctgg tggacgactt catcctgagc 2100 cccgtcgtga agagaagctt catccagagc atcaaagtga tcaacgccat catcaagaag 2160 tacggcctgc ccaacgacat cattatcgag ctggcccgcg agaagaactc caaggacgcc 2220 cagaaaatga tcaacgagat gcagaagcgg aaccggcaga ccaacgagcg gatcgagaa 2280 atcatccgga ccaccggcaa agagaacgcc aagtacctga tcgagaagat caagctgcac 2340 gacatgcagg aaggcaagtg cctgtacagc ctggaagcca tccctctgga agatctgctg 2400 aacaacccct tcaactatga ggtggaccac atcatcccca gaagcgtgtc cttcgcaac 2460 agcttcaaca acaaggtgct cgtgaagcag gaaaaaca ccaagaaggg caaccggacc 2520 ccattccagt acctgagcag cagcgacagc aagatcagct acgaaacctt caagaagcac 2580 atcctgaatc tggccaaggg caagggcaga atcagcaaga ccaagaaaga gtatctgctg 2640 gaaacggg acatcaacag gttctccgtg cagaaagact tcatcaaccg gaacctggtg 2700 gataccagat acgccaccag aggcctgatg aacctgctgc ggagctactt cagagtgaac 2760 aacctggacg tgaagtgaa gtccatcaat ggcggcttca ccagctttct gcggcggaag 2820 tggaagttta agaaagagcg gaacaagggg tacaagcacc acgccgagga cgccctgatc 2880 attgccaacg ccgatttcat cttcaaagag tggaagaaac tggacaaggc caaaaaagtg 2940 atggaaaacc agatgttcga ggaaaagcag gccgagagca tgcccgagat cgaaaccgag 3000 caggagtaca aagagatctt catcaccccc caccagatca agcacattaa ggactcag 3060 gactacaagt acagccaccg ggtggacaag aagcctaata gagagctgat taacgacacc 3120 ctgtactcca cccggaagga cgacaagggc aacaccctga tcgtgacaa tctgaacggc 3180 ctgtacgaca aggacaatga caagctgaaa aagctgatca acagagccc cgaaaagctg 3240 ctgatgtacc accacgaccc ccagacctac cagaaactga agcttat ggacagtac 3300 ggcgacgaga agaatcccct gtacaagtac tacgaggaaa ccgggaacta cctgaccaag 3360 tactccaaaa aggacaacgg cccgtgatc aagagatta agtattacgg siaaactg 3420 aacgcccatc tggacatcac cgacgactac cccaacagca gaacaaggt cgtgaagctg 3480 tccctgaagc cctacagatt cgacgtgtac ctggacaatg gcgtgtacaa gttcgtgacc 3540 gtgaagaatc tggatgt caaaaagaa actactacg aagtgaatg caagtgctat 3600 gaggaagcta agaagctgaa gagatcagc aaccaggccg agtttatcgc ctccttctac 3660 aacaacgatc tgatcagat caacggcgag ctgtatagag tgatcggcgt gaacacgac 3720 ctgctgaacc ggatcgaagt gaacatgatc gatcacct accgcgagta cctggaaaac 3780 atgaacgaca agaggccccc caggacatt agacaatcg cctccagac ccagagcatt 3840 aagaagtaca gcacacac tctgggcaac ctgtatgaag tgaaatctaa gaagcaccct 3900 cagatcatca aaaagggcaa aaggccggcg gccacgaaaa aggccggcca ggcaaaaaag 3960 aaaaagggat ccgaattcta gcaataaagg atcgtttatt ttcattggaa gcgtgtgttg 4020 gttttttgat caggcgcggg taccaaaaat ctcgccaaca agttgacgag ataaacacgg 4080 cattttgcct tgttttagta gattctgttt ccagagtact aaaacacatt tcctctctat 4140 acaaatgcgg tgtttcgtcc tttccacaag atatataaag ccaagaaatc gaaatacttt 4200 caagttacgg taagcatatg atagtccatt ttaaaacata attttaaaac tgcaaactac 4260 ccaagaaatt attactttct acgtcacgta ttttgtacta atatctttgt gtttacagtc 4320 aaattaattc caattatctc tctaacagcc ttgtatcgta tatgcaaata tgaaggaatc 4380 atgggaaata ggccctcctc gactagtag aaaatctcgc caacaagttg acgagataa cacggcattt tgccttgttt tagtagttc tgtttccaga gtactaaaac gtgccaata tttcattact atatcggtgt ttcgtccttt 4560. tttcattact atatcggtgt ttcgtccttt atactttcaa gttacggtaa gcatatgata gtccatttta aaacataatt ttaaaactgc aaactaccca agaaattatt actttctacg tcacgtattt tgtactaata tctttgtgtt 4740. ttacgtcaaa ttaattccaa ttatctctct aacagccttg tatcgtatat gcaaatatga aggaatcatg ggaaataggc cctcggtacc aggaacccct agtgatggag ttggccactc 4800 cctctctgcg cgctcgctcg ctcactgagg ccggggcgacc aaaggtcgcc cgacgcccgg 4860 gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag ctgcctgcag gggcgcctga 4920 tgcggtattt tctccttacg catctgtgcg gtatttcaca ccgcatacgt caaagcaacc 4980 atagtacgcg ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt 5040 gaccgctaca cttgccagcg ccctagcgcc cgctcctttc gctttcttcc cttcctttct 5100 cgccacgttc gccggctttc cccgtcaagc tctaaatcgg gggctccctt tagggttccg 5160 atttagtgct ttacggcacc tcgaccccaa aaaacttgat ttgggtgatg gttcacgtag 5220 tgggccatcg ccctgataga cggtttttcg ccctttgacg ttggagtcca cgttctttaa 5280 tagtggactc ttgttccaaa ctggaacaac actcaaccct atctcgggct attcttttga 5340 tttataaggg attttgccga tttcggccta ttggttaaaa aatgagctga tttaacaaaa 5400 atttaacgcg aattttaaca aaatattaac gtttacaatt ttatggtgca ctctcagtac 5460 aatctgctct gatgccgcat agttaagcca gccccgacac ccgccaacac ccgctgacgc 5520 gccctgacgg gcttgtctgc tcccggcatc cgcttacaga caagctgtga ccgtctccgg 5580 gagctgcatg tgtcagaggt tttcaccgtc atcaccgaaa cgcgcgagac gaaagggcct 5640 cgtgatacgc ctatttttat aggttaatgt catgataata atggtttctt agacgtcagg 5700 tggcactttt cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc 5760 aaatatgtat ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag 5820 gaagagtatg agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg 5880 ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt 5940 gggtgcacga gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt 6000 tcgccccgaa gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt 6060 attatcccgt attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa 6120 tgacttggtt gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag 6180 agaattatgc agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac 6240 aacgatcgga ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac 6300 tcgccttgat cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac 6360 cacgatgcct gtagcaatgg caacaacgtt gcgcaacta ttaactggcg aactacttac 6420 tctagcttcc cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact 6480 tctgcgctcg gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg 6540 tggaagccgc ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt 6600 tatctacacg acggggagagtc aggcaactat ggatgaacga aatagacaga tcgctgagat 6660 aggtgcctca ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta 6720 gattgattta aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa 6780 tctcatgacc aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga 6840 aaagatcaaa ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac 6900 aaaaaaacca ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt 6960 tccgaaggta actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc 7020 gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat 7080 cctgttacca gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag 7140 acgatagtta ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc 7200 cagcttggag cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag 7260 cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac 7320 aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg 7380 gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct 7440 atggaaaaac gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc 7500 tcacatgt 7508 <![CDATA[<210> 30]]> <![CDATA[<211> 7913]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 30]]> cctgcaggca gctgcgcgct cgctcgctca ctgaggcgc cgggcgtcg ggcgacctt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctcta gactcgagag cttgcatgtc taagctagac ccttcagatt 180 aaaaataact gaggtaaggg cctgggtagg ggaggtggtg tgagacgctc ctgtctctcc 240 tctatctgcc catcggccct ttggggagga ggaatgtgcc caaggactaa aaaaaggcca 300 tggagccaga ggggcgaggg caacagacct ttcatgggca aaccttgggg ccctgctgtc 360 tagcatgcc cactacgggt ctaggctgcc catgtaagga ggcaaggcct ggggacaccc 420 gagatgcctg gttataatta acccagacat gtggctgccc cccccccccc aacacctgct 480 gcctctaaaa ataaccctgt ccctggtgga tcccctgcat gcgaagatct tcgaacaagg 540 ctgtggggga ctgagggcag gctgtaacag gcttgggggc cagggcttat acgtgcctgg 600 gactcccaaa gtattactgt tccatgttcc cggcgaaggg ccagctgtcc cccgccagct 660 agactcagca cttagtttag gaaccagtga gcaagtcagc ccttggggca gcccatacaa 720 ggccatgggg ctgggcaagc tgcacgcctg ggtccggggt gggcacggtg cccgggcaac 780 gagctgaaag ctcatctgct ctcaggggcc cctccctggg gacagcccct cctggctagt 840 cacaccctgt aggctcctct atataaccca ggggcacagg ggctgccctc attctaccac 900 cacctccaca gcacagacag acactcagga gccagccagc ccatggtcta gaggatccgg 960 tactcgagga actgaaaaac cagaaagtta actggtaagt ttagtctttt tgtcttttat 1020 ttcaggtccc ggatccggtg gtggtgcaaa tcaaagaact gctcctcagt ggatgttgcc 1080 tttacttcta ggcctgtacg gaagtgttac gccaccatgg ccccaaagaa gaagcggaag 1140 gtcggtatcc acggagtccc agcagccaag cggaactaca tcctgggcct ggacatcggc 1200 atcaccagcg tgggctacgg catcatcgac tacgagacac gggacgtgat cgatgccggc 1260 gtgcggctgt tcaaagaggc caacgtggaa aacaacgagg gcaggcggag caagagaggc 1320 gccagaaggc tgaagcggcg gaggcggcat agaatccaga gagtgaagaa gctgctgttc 1380 gactacaacc tgctgaccga ccacagcgag ctgagcggca tcaaccccta cgaggccaga 1440 gtgaagggcc tgagccagaa gctgagcgag gaagagttct ctgccgccct gctgcacctg 1500 1560 tccaccaaag agcagatcag ccggaacagc aaggccctgg aagagaaata cgtggccgaa 1620 ctgcagctgg aacggctgaa gaagacggc gaagtgcggg gcagcatcaa cagattcaag 1680 accagcgact acgtgaaaga agccaaacag ctgctgaagg tgcagaaggc ctaccaccag 1740 ctggaccaga gcttcatcga cacctacatc gacctgctgg aaacccggcg gacctactat 1800 gagggacctg gcgagggcag ccccttcggc tggaggaca tcaaagaatg gtacgagatg 1860 1920 gccgacctgt acaacgccct gaacgacctg aacaatctcg tgatcaccag ggacgagaac gagaagctgg aatattacga gaagttccag atcatcgaga acgtgttcaa gcagaagaag aagcccaccc tgaagcagat cgccaaaga atcctcgtga acgaagga tattaagggc 2160. ttcaccaacc tgaaggtgta ccacgacatc aaggacatta ccgcccgga agagattatt gagacgccg agctgctgga tcagattgcc aagatcctga ccatctacca gagcagcgag gacatccagg aagaactgac caatctgaac tccgagctga cccaggaaga gatcgagcag atctctaatc tgaagggcta taccggcacc cacaacctga gcctgaaggc catcaacctg atcctggacg agctgtggca caccaacgac aaccagatcg ctatcttcaa ccggctgaag ctggtgccca agaaggtgga cctgtcccag 2460 cagaaagaga tccccaccac cctggtggac gacttcatcc tgagccccgt cgtgaagaga 2520 agcttcatcc agagcatcaa agtgatcaac gccatcatca agaagtacgg cctgcccaac 2580 gacatcatta tcgagctggc ccgcgagaag aactccaagg acgcccagaa aatgatcaac 2640 gagatgcaga agcggaaccg gcagaccaac gagcggatcg aggaaatcat ccggaccacc 2700 ggcaaagaga acgccaagta cctgatcgag aagatcaagc tgcacgacat gcaggaaggc 2760 aagtgcctgt acagcctgga agccatccct ctggaagatc tgctgaacaa ccccttcaac 2820 tatgaggtgg accacatcat ccccagaagc gtgtccttcg acaacagctt caacaacaag 2880 gtgctcgtga aaacagcaag aagggcaacc ggaccccatt ccagtacctg agcagcagcg agcagcg agcctcga accttcaaga agcacatcct gaatctggcc aagggcaagg gcagaatcag caagaccaag aaagagtatc tgctggaaga acgggacatc aacaggttct ccgtgcagaa agacttcatc aaccggaacc tggtggatac cagatacgcc accagaggcc tgatgaacct gctgcggagc tacttcagag tgaacaacct ggacgtgaaa gtgaagtcca tcaatggcgg cttcaccagc tttctgcggc gtttaagaaa gagcggaca aggggtacaa gcaccacgcc gaggacgcc tgatcattgc caacgccgat ttcatcttca aagagtgga gaaactggac aaggccaaaa aagtgatgga aaaccagatg ttcgaggaaa agcaggccga gagcatgccc gagatcgaaa ccgagcagga gtacaaagag 3420 3480 3540 aaggacgaca agggcaacac cctgatcgtg aacaatctga acggcctgta cgacaaggac 3600 aatgacaagc tgaaaaagct gatcaacaag agccccgaaa agctgctgat gtaccaccac 3660 gacccccaga cctaccagaa actgaagctg attatggaac agtacggcga cgagaagaat 3720 cccctgtaca agtactacga ggaaaccggg aactacctga ccaagtactc caaaaaggac 3780 aacggccccg tgatcaagaa gattaagtat tacggcaaca aactgaacgc ccatctggac 3840 atcaccgacg actaccccaa cagcaagaac aaggtcgtga agctgtccct gaagccctac 3900 3960 4020 your ctgcaacca ggccgagttt atcgcctcct tctacaacaa cgatctgatc 4080 aagatcaacg gcgagctgta tagagtgatc ggcgtgaaca acgacctgct gaaccggatc 4140 gaagtgaaca tgatcgacat cacctaccgc gagtaccctgg aaaacatgaa cgacaagagg 4200 ccccccagga tcattaagac aatcgcctcc aagacccaga gcattaagaa gtacagcaca 4260 gacattctgg gcaacctgta tgaagtgaaa tctaagaagc accctcagat catcaaaaaag 4320 ggcaaaaggc cggcggccac gaaaaaggcc ggccaggca aaaagaaaaa gggatccga ttctagcaat aaaggatcgt ttattttcat tggaagcgtg tgttggtttt ttgatcaggc gcgggtacca aaaatctcgc caacaagttg acgagataa cacggcattt tgccttgttt tagtagttc tgtttccaga gtactaaaac acattcctc tctatacaaa tgcggtgttt cgtcctttcc acaagatata taaagccaag aaatcgaaat actttcaagt tacggtaagc atatgatagt ccattttaa aacataatttt aaaactgcaa actacccaag aaattattac tttctacgtc acgtattttg tactatatc tttgtgttta cagtcaaatt aattccaatt atctctctaa cagccttgta tcgtatatgc aatatgaag gaatcatggg aaataggccc tcctcgacta gtagaaaaat ctcgccaaca agttgacgag ataaacacgg cattttgcct 4860 tgttttagta gattctgttt ccagagtact aaaacgtgcc aataatttca ttactatatc 4920 ggtgttcgt cctttccaca agatatataa agccaagaaa tcgaaatact ttcaagttac 4980 ggtaagcata tgatagtcca ttttaaaaca taattttaaa actgcaaact acccaagaaa 5040 ttattacttt ctacgtcacg tattttgtac tatatcttt gtgtttacag tcaaattaat 5100 tccaattatc tctctaacag ccttgtatcg tatatgcaaa tatgaaggaa tcatgggaaa 5160 taggccctcg gtaccaggaa ccctagtga tggagttggc cactccctct ctgcgcgctc 5220 gctcgctcac tgaggccggg cgaccaaagg tcgcccgacg cccgggcttt gccgggcgg 5280 cctcagtgag cgagcgagcg cgcagctgcc tgcaggggcg cctgatgcgg tattttctcc 5340 ttacgcatct gtgcggtatt tcacaccgca tacgtcaaag caaccatagt acgcgccctg 5400 tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc 5460 cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg 5520 ctttccccgt caagctctaa atcgggggct ccctttaggg ttccgattta gtgctttacg 5580 gcacctcgac cccaaaaaac ttgatttggg tgatggttca cgtagtgggc catcgccctg 5640 atagacggtt tttcgccctt tgacgttgga gtccacgttc tttaatagtg gactcttgtt 5700 ccaaactgga acaacactca accctatctc gggctattct tttgatttat aagggatttt 5760 gccgatttcg gcctattggt taaaaaatga gctgatttaa caaaaattta acgcgaattt 5820 taacaaaata ttaacgttta caattttatg gtgcactctc agtacaatct gctctgatgc 5880 cgcatagtta agccagcccc gacacccgcc aaacccgct gacgcgccct gacgggcttg 5940 tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca 6000 gaggttttca ccgtcatcac cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt 6060 tttataggtt aatgtcatga tataatggt ttcttagacg tcaggtggca cttttcgggg 6120 aaatgtgcgc ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct 6180 catgagacaa taaccctgat aaatgcttca ataatttga aaaaggaaga gtatgagtat 6240 tcaacatttc cgtgtcgccc ttatccctt ttttgcggca ttttgccttc ctgtttttgc 6300 tcacccagaa acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtgggg 6360 ttacatcgaa ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg 6420 ttttccaatg atgagcactt ttaaaagttct gctatgtggc gcggtattat cccgtattga 6480 cgccgggcaa gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta 6540 ctcaccagtc acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc 6600 tgccataacc atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc 6660 gaaggagcta accgcttttt tgcacaacat ggggatcat gtaactcgcc ttgatcgttg 6720 ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc 6780 aatggcaaca acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca 6840 acaattaata gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct 6900 tccggctggc tggtttattg ctgataaatc tggagccggt gagcgtggaa gccgcggtat 6960 cattgcagca ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg 7020 gagtcaggca actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat 7080 taagcattgg taactgtcag accaagttta ctcatatata ctttagattg atttaaaact 7140 tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat 7200 cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc 7260 ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct 7320 accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg 7380 cttcagcaga gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca 7440 cttcaagaac tctgtagcac cgctcatata cctcgctctg ctaatcctgt taccagtggc 7500 tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga 7560 taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac 7620 gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga 7680 agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag 7740 ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg 7800 acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag 7860 caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca tgt 7913 <![CDATA[<210> 3]]>1 <![CDATA[<211> 3158]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 31]]> atgaaaagga actacattct ggggctggac atcgggatta caagcgtggg gtatgggatt 60 attgactatg aaacaaggga cgtgatcgac gcaggcgtca gactgttcaa ggaggccaac 120 gtggaaaaca atgagggacg gagaagcaag aggggagcca ggcgcctgaa acgacggaga 180 aggcacagaa tccagagggt gaagaaactg ctgttcgatt acaacctgct gaccgaccat 240 tctgagctga gtggaattaa tccttatgaa gccagggtga aaggcctgag tcagaagctg 300 tcagaggaag agttttccgc agctctgctg cacctggcta agcgccgagg agtgcataac 360 gtcaatgagg tggaagagga caccggcaac gagctgtcta caaaggaaca gatctcacgc 420 aatagcaaag ctctggaaga gaagtatgtc gcagagctgc agctggaacg gctgaagaaa 480 gatggcgagg tgagagggtc aattaatagg ttcaagacaa gcgactacgt caaagaagcc 540 aagcagctgc tgaagtgca gaagcttac caccagctgg atcagagctt catcgatact 600 tatatcgacc tgctggagac tcggagacc tactatgagg gaccaggaga agggagcccc 660 ttcggatgga agacatca ggaatggtac gagatgctga tgggacattg cacctattt 720 ccagaagagc tgagaagcgt caagtacgct tataacgcag atctgtacaa cgccctgaat 780 gacctgaaca acctggtcat caccagggat gaaaacgaga aactggaata ctatgagaag 840 ttccagatca tcgaaaacgt gtttaagcag aagaaaaagc ctacactgaa acagattgct 900 aaggagatcc tggtcaacga agaggacatc aagggctacc gggtgacaag cactggaaaa 960 ccagagttca ccaatctgaa agtgtatcac ggattaagg acatcacagc acggaaagaa 1020 atcattgaga acgccgaact gctggatcag attgctaaga tcctgactat ctaccagagc 1080 tccgaggaca tccaggaaga gctgactac ctgaacagcg agctgaccca ggaagagatc 1140 gaacagatta gtaatctgaa ggggtacacc ggaacacaca acctgtccct gaaagctatc 1200 aatctgattc tggatgagct gtggcataca aacgacaatc agattgcaat ctttaaccgg 1260 ctgaagctgg tcccaaaaaa ggtggacctg agtcagcaga aagagatccc aaccacactg 1320 gtggacgatt tcattctgtc acccgtggtc aagcggagct tcatccagag catcaaagtg 1380 atcaacgcca tcatcaagaa gtacggcctg cccaatgata tcattatcga gctggctagg 1440 gagaaca caaaggacgc acagaagatg atcaatgaga tgcagaaacg aaccggcag 1500 accaatgaac gcattgaaga gattatccga actaccggga aagagaacgc aaagtacctg 1560 attgaaaaaa tcaagctgca cgatatgcag gaggaaaagt gtctgtattc tctggaggcc 1620 tccccctgga ggacctgctg aacaatccat tcaactacga ggtcgatcat attatcccca 1680 gaagcgtgtc cttcgacaat tcctttaaca acaaggtgct ggtcaagcag gaagagaact 1740 ctaaaaaaggg caataggact cctttccagt acctgtctag ttcagattcc aagatctctt 1800 acgaaacctt taaaaagcac attctgaatc tggccaaagg aaagggccgc atcagcaaga 1860 ccaaaaaagga gtacctgctg gaagagcggg acatcaacag attctccgtc cagaaggatt 1920 ttattaaccg gaatctggtg gacacaagat acgctactcg cggcctgatg aatctgctgc 1980 gatcctattt ccgggtgaac aatctggatg tgaagtca gtccatcac ggcggttca 2040 catctttctt gaggcggcaaa tggagtttta aaaaggagcg caaaaggg tacaaccacc 2100 atgccgaaga tgctctgatt atcgcaatg ccgacttcat ctttaaggag tggaaaaagc 2160 tggacaagc caagaagtg atggagacc nagatgttcga agagaagcag gccgaatcta 2220 tgcccgaaat cgagacagaa caggagtaca aggatttt catcactcct caccagatca 2280 agcatatcaa ggatttcaag gactacaagt actctcaccg ggtggataaa agccccaaca 2340 gagagctgat caatgacacc ctgtatagta caagaaaga cgatagggg ataccctga 2400 ttgtgaacaa tctgaacgga ctgtacgaca aagataatga caagctgaaa aagctgatca 2460 aaaaagtcc cgagaagctg ctgatgtacc accatgatcc tcagacatat cagaaactga 2520 agctgattat ggagcagtac ggcgacgaga agaacccact gtataagtac ttgaagaga 2580 ctgggaacta cctgaccaag tatagcaaa aggataatgg ccccgtgatc aagagatca 2640 agtactatgg gaacaagctg aatgcccatc tggacatcac agacgattac cctacagtc 2700 gcaacaggt gtcaagctg tcactgaagc catacagatt cgatgtctat ctggacaacg 2760 gcgtgtataa atttgtgact gtcaagaatc tggatgtcat caaaaggag aactactatg 2820 aagtgaatag caagtgctac gagaggcta aaagctga aaagattagc aaccaggcag 2880 agttcatcgc ctccttttac aacaacgacc tgatttagat caatggcgaa ctgtatagg 2940 tcatcggggt gaacaatgat ctgctgaacc gcattgaagt gaatatgatt gacatcactt 3000 accgagagta tctggaaaac atgaatgata agcgcccccc tcgaattatc aaaacaattg 3060 cctctaagac tcagagtatc aaaaagtact caaccgacat tctgggaaac ctgtatgagg 3120 tgaagagcaa aaagcaccct cagattatca aaaagggc 3158 <![CDATA[<210> 32]]> <![CDATA[<211> 3159]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 32]]> atgaagcgga actacatcct gggcctggac atcggcatca ccagcgtggg ctacggcatc 60 atcgactacg agacacggga cgtgatcgat gccggcgtgc ggctgttcaa agaggccaac 120 gtggaaaaca acgagggcag gcggagcaag agaggcgcca gaaggctgaa gcggcgagg 180 cggcatagaa tccagagagt gaaagctg ctgttcgact acaacctgct gaccgaccac 240 agcgagctga gcggcatcaa cccctacgag gccagagtga agggcctgag ccagaagctg 300 agcgaggaag agttctctgc cgccctgctg cacctggcca agagaagagg cgtgcacaac 360 gtgaacgagg tggaagaga caccggcaac gagctgtcca ccaaagagca gatcagccgg 420 aacagcaagg ccctggaaga gaatacgtg gccgaactgc agctgggaacg gctgaagaaa 480 gacggcgaag tgcggggcag catcaacaga ttcaagacca gcgactacgt gaagaagcc 540 aaacagctgc tgaaggtgca gaaggcctac caccagctgg accagagctt catcgacacc 600 tacatcgacc tgctggaaac ccggcggacc tactatgagg gacctggcga gggcagcccc 660 ttcggctgga aggacatcaa agaatggtac gagatgctga tgggccactg cacctacttc 720 cccgaggaac tgcggagcgt gaagtacgcc tacaacgccg acctgtacaa cgccctgaac 780 gacctgaaca atctcgtgat caccagggac gagaacgaga agctggaata ttacgagaag 840 ttccagatca tcgagaacgt gttcaagcag aagaagaagc ccaccctgaa gcagatcgcc 900 aaagaaatcc tcgtgaacga agaggatatt aagggctaca gagtgaccag caccggcaag 960 cccgagttca ccaacctgaa ggtgtaccac gacatcaagg acattaccgc ccggaaagag 1020 attattgaga acgccgagct gctggatcag attgccaaga tcctgaccat ctaccagagc 1080 agcgaggaca tccaggaaga actgaccaat ctgaactccg agctgaccca ggaagagatc 1140 gagcagatct ctaatctgaa gggctatacc ggcacccaca acctgagcct gaaggccatc 1200 aacctgatcc tggacgagct gtggcacacc aacgacaacc agatcgctat cttcaaccgg 1260 ctgaagctgg tgcccaagaa ggtggacctg tcccagcaga aagagatccc caccaccctg 1320 gtggacgact tcatcctgag ccccgtcgtg aagagaagct tcatccagag catcaaagtg 1380 atcaacgcca tcatcaagaa gtacggcctg cccaacgaca tcattatcga gctggcccgc 1440 gagaagaact ccaaggacgc ccagaaaatg atcaacgaga tgcagaagcg gaacggcag 1500 accaacgagc ggatcgagga aatcatccgg accacggca aagagaacgc caagtacctg 1560 atcgagaaga tcaagctgca cgacatgcag gaaggcaagt gcctgtacag cctggaagcc 1620 atccctctgg aagatctgct gaacaacccc ttcaactatg aggtggacca catcatcccc 1680 agaagcgtgt ccttcgacaa cagcttcaac aacaaggtgc tcgtgaagca ggaaaaaac 1740 agcaagaagg gcaaccggac cccattccag tacctgagca gcagcgacag caagatcagc 1800 tacgaaacct tcaagaagca catcctgaat ctggccaagg gcaagggcag aatcagcaag 1860 accaagaaag agtatctgct ggagaacgg gacatcaaca ggttctccgt gcagaaagac 1920 ttcatcaacc ggaacctggt ggataccaga tacgccacca gaggcctgat gaacctgctg 1980 cggagctact tcagagtgaa caacctggac gtgaaagtga agtccatcaa tggcggcttc 2040 accagctttc tgcggcggaa gtggaagttt aagaaagagc ggaacaaggg gtacaagcac 2100 cacgccgagg acgccctgat cattgccaac gccgatttca tcttcaaaga gtggagaaa 2160 ctggacaagg ccaaaaaagt gatggaaaac cagatgttcg aggaaaagca ggccgagagc 2220 atgcccgaga tcgaaaccga gcaggagtac aaagagatct tcatcacccc ccaccagatc 2280 aagcacatta aggacttcaa ggactacaag tacagccacc gggtggacaa gaagcctaat 2340 agagagctga ttaacgacac cctgtactcc accccggaagg acgacaaggg caacaccctg 2400 atcgtgaaca atctgaacgg cctgtacgac aaggaacaatg acaagctgaa aaagctgatc 2460 aacaagagcc ccgaaaagct gctgatgtac caccacgacc cccagaccta ccagaaactg 2520 aagctgatta tggaacagta cggcgacgag aagaatcccc tgtacaagta ctacgaggaa 2580 accgggaact acctgaccaa gtactccaaa aaggacaacg gccccgtgat caagaagatt 2640 aagtattacg gcaacaaact gaacgcccat ctggacatca ccgacgacta ccccaacagc 2700 agaaacaagg tcgtgaagct gtccctgaag ccctacagat tcgacgtgta cctggacaat 2760 ggcgtgtaca agttcgtgac cgtgaagaat ctggatgtga tcaaaaaaga aaactactac 2820 gaagtgaata gcaagtgcta tgaggaagct aagaagctga agaagatcag caaccaggcc 2880 gagtttatcg cctcttcta caacaacgat ctgatcaaga tcaacggcga gctctataga 2940 gtgatcggcg tgaacaacga cctgctgaac cggatcgaag tgaacatgat cgacatcacc 3000 taccgcgagt acctggaaaa catgaacgac aagaggcccc ccaggatcat taagacaatc 3060 gcctccaaga cccagagcat taagaagtac agcacagaca ttctgggcaa cctgtatgaa 3120 gtgaaatcta agaagcaccc tcagatcatc aaaaagggc 3159 <![CDATA[<210> 33]]> <![CDATA[<211> 3159]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 33]]> atgaagcgca actacatcct cggactggac atcggcatta cctccgtggg atacggcatc 60 atcgattacg aaactagga tgtgatcgac gctgggagtca ggctgttcaa agaggcgaac 120 gtggagaaca acgaggggcg gcgctcaaag aggggggccc gccggctgaa gcgccgccgcg 180 agacatagaa tccagcgcgt gaagaagctg ctgttcgact acaaccttct gaccgaccac 240 tccgaacttt ccggcatcaa cccatatgag gctagagtga agggattgtc ccaaaagctg 300 tccgaggaag agttctccgc cgcgttgctc cacctcgcca agcgcagggg agtgcacaat 360 gtgaacgaag tggaaaga taccggaaac gagctgtcca ccaaggagca gatcagccgg 420 480 gacggagaag tgcgcggctc gatcaaccgc ttcaagacct cggactacgt gaaggaggcc 540 aagcagctcc tgaaagtgca aaagcctat caccaacttg accagctcctt tatcgatacc 600 tacatcgatc tgctcgagac tcggcggact tactacgagg gtccagggga gggctcccca 660 tttggttgga agatattaa ggagtggtac gaatgctga tgggacactg cacatacttc 720 cctgaggagc tgcggagcgt gaatacgca tacaacgcag acctgtacaa cgcgctgaac 780 gacctgaaca atctcgtgat cacccgggac gagaacgaaa agctcgagta ttacgaaaag 840 ttccagatta ttgagaacgt gttcaacag aagaagaagc cgacactgaa gcagattgcc 900 aaggaaatcc tcgtgaacga agaggacatc aagggctatc gagtgaccctc aacgggaaag 960 ccggagttca ccaatctgaa ggtctaccac gatacaag acattaccgc ccggaggag 1020 atcattgaga acgcggagct gttgaccag attgcgaga ttctgaccat ctaccaatcc 1080 tccgaggata ttcaggaga actcaccac ctcacagcg aactgaccca ggaggagata 1140 gagcaatct ccaacctgaa gggctacacc ggaactcata acctgagcct gaggccac 1200 aacttgatcc tggacgagct gtgcacacc aacgatacc agatcgctt ttcaatcgg 1260 ctgaagctgg tcccagaa agtggacctc tcacacaaa aggagatccc tacccctt 1320 gtggacgatt tcattctgtc cccgtggtc agagaagct tcatacagtc atcaagtg 1380 atcaatgcca ttatcaagaa atacggtctg cccaacgaca ttcattga gctcgcccgc 1440 gagagaact cgaaggacgc cgaagaactg attackaa tggagaact gaaccgaact 1500 actaacgaac ggatcgaaga atcatccgg accaccggga aggaaacgc gaagtaccctg 1560 atcgaaaaga tcaagctcca tgacatgcag gaaggaagt gtctgtactc gctggaggcc 1620 attccgctgg aggacttgct gacaaccct ttactacg aagtggatca tatcattccg 1680 aggagcgtgt cattcgacaa ttccttcaac aaaaggtcc tcgtgagca ggaggaaaac 1740 tcgaagaagg gaaccgcac gccgttccag tacctgagca gcagcgactc cagatttcc 1800 tacgaaacct tcagaagca catcctcaac ctggcaagg ggaagggtcg catctccaag 1860 accaaagg atatctgct ggaagaaga gatcaca gattctccgt gcaaaggac 1920 ttcatcaacc gcaacctcgt ggatactga taccctc ggggtgat gaacctcctg 1980 2040 acctccttcc tgcggcgcaa gtggaagttc aagaaggaac ggaacaaggg ctacaagcac 2100 cacgccgagg acgccctgat cattgccaac gccgacttca tcttcaaaga atggagaaa 2160 cttgacaagg ctaagaaggt catggaaaac cagatgttcg aagaaaagca ggccgagtct 2220 atgcctgaaa tcgagactga acaggagtac aaaggaaatct ttattacgcc acaccagatc 2280 aaacacatca aggatttcaa ggattacaag tactcacatc gcgtggacaa aaagccgaac 2340 agggaactga tcaacgacac cctctactcc accccggaagg atgacaaagg gaataccctc 2400 atcgtcaaca accttaacgg cctgtacgac aaggacaacg ataagctgaa gaagctcatt 2460 aacaagtcgc ccgaaaagtt gctgatgtac caccacgacc ctcagactta ccagaagctc 2520 aagctgatca tggagcagta tggggacgag aaaaacccgt tgtacaagta ctacgaaa 2580 actgggaatt atctgactaa gtactccaag aaagataacg gccccgtgat taagaagatt 2640 aagtactacg gcaacaagct gaacgcccat ctggacatca ccgatgacta ccctaattcc 2700 cgcaacaagg tcgtcaagct gagcctcaag ccctaccggt ttgatgtgta ccttgacaat 2760 2820 gaagtcaact ccaagtgcta cgagaagca aagaagttga aagaatctc gaaccaggcc 2880 2940 gtcattggcg tgaacaacga tctcctgaac cgcatcgaag tgaacatgat cgacatcact 3000 taccgggaat acctggagaa tatgaacgac aagcgcccgc cccggatcat taagactatc 3060 gcctcaaaga cccagtcgat caagaagtac agcaccgaca tcctgggcaa cctgtacgag 3120 gtcaaatcga agaagcaccc ccagatcatc aagaaggga 3159 <![CDATA[<210> 34]]> <![CDATA[<211> 3255]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 34]]> atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc caagcggaac 60 tacatcctgg gcctggacat cggcatcacc agcgtgggct acggcatcat cgactacgag 120 acacggggacg tgatcgatgc cggcgtgcgg ctgttcaaag aggccaacgt ggaaaacaac 180 gagggcaggc ggagcaagag aggcgccaga aggctgaagc ggcggaggcg catagaatc 240 cagagagtga agaagctgct gttcgactac aacctgctga ccgaccacag cgagctgagc 300 ggcatcaacc cctacgaggc cagagtgaag ggcctgagcc agaagctgag cgaggaagag 360 ttctctgccg ccctgctgca cctggccaag agaagaggcg tgcacaacgt gaacgaggtg 420 gaagaggaca ccggcaacga gctgtccacc agagagcaga tcagccggaa cagcaaggcc 480 ctggaagaga aatacgtggc cgaactgcag ctggaacggc tgaagaaaga cggcgaagtg 540 cggggcagca tcacagatt caaccagc gactacgtga aagaagccaa acagctgctg 600 aaggtgcaga aggcctacca ccagctggac cagagcttca tcgacaccta catcgacctg 660 ctggaaaccc ggcggaccta cctggcgagg gcagcccctt cggctggaag 720 gatacaag aatggtacga gatgctgatg ggccactgca cctacttccc cgaggaactg 780 cggagcgtga agtacgccta caacgccgac ctgtacaacg ccctgaacga cctgaacat 840 ctcgtgatca ccagggacga gaacgagaag ctggaatatt acgagaagtt ccagatcatc 900 gagaacgtgt tcaagcagaa gagaagcccc accctgaagc agatcgccaa agaatccctc 960 gtgaacgaag aggattaa gggctacaga gtgaccagca ccggcaagcc cgagttcacc 1020 1080 gccgagctgc tggatcagat tgccaagatc ctgaccatct accagagcag cgaggacatc 1140 caggaaac tgaccaatct gaactccgag ctgacccagg aagagatcga ccagatctct 1200 aatctgaagg gctataccgg cacccacaac ctgagcctga aggccatcaa cctgatcctg 1260 gacgagctgt ggcacaccaa cgacaaccag atcgctatct tcaaccggct gaagctgggtg 1320 cccaagaagg tggacctgtc ccagcagaaa gagatcccca ccaccctggt ggacgacttc 1380 atcctgagcc ccgtcgtgaa gagaagcttc atccagagca tcaaagtgat caacgccatc 1440 atcaagaagt acggcctgcc caacgacatc attatcgagc tggcccgcga gaagaactcc 1500 aaggaacgccc agaaaatgat caacgagatg cagaagcgga accggcagac caacgagcgg 1560 atcgagaaa tcatccggac caccggcaaa gagaacgcca agtacctgat cgagaagatc 1620 aagctgcacg acatgcagga aggcaagtgc ctgtacagcc tggaagccat ccctctggaa 1680 gatctgctga acaacccctt caactatgag gtggaccaca tcatccccag aagcgtgtcc 1740 ttcgacaaca gcttcaacaa caaggtgctc gtgaagcagg aagaaaacag caagaagggc 1800 aaccggaccc cattccagta cctgagcagc agcgacagca agatcagcta cgaaaccttc 1860 aagaagcaca tcctgaatct ggccaagggc aagggcagaa tcagcaagac caagaaagag 1920 tatctgctgg aagaacggga catcaacagg ttctccgtgc agaaagactt catcaaccgg 1980 aacctggtgg ataccagata cgccaccaga ggcctgatga acctgctgcg gagctacttc 2040 agagtgaaca acctggacgt gaaagtgaag tccatcaatg gcggcttcac cagctttctg 2100 cggcggaagt ggaagtttaa gaaagagcgg aacaaggggt acaagcacca cgccgaggac 2160 gccctgatca ttgccaacgc cgatttcatc ttcaaagagt ggaagaaact ggacaaggcc 2220 aaaaaagtga tggaaaacca gatgttcgag gaaaggcagg ccgagagcat gcccgagatc 2280 gaaaccgagc aggagtacaa agagatcttc atcacccccc accagatcaa gcacattaag 2340 gacttcaagg actacaagta cagccaccgg gtggacaaga agcctaatag agagctgatt 2400 aacgacaccc tgtactccac ccggaaggac gacaagggca acaccctgat cgtgaacaat 2460 ctgaacggcc tgtacgacaa ggacaatgac aagctgaaaa agctgatcaa caagagcccc 2520 gaaaagctgc tgatgtacca ccacgacccc cagacctacc agaaactgaa gctgattatg 2580 gaacagtacg gcgacgagaa gaatcccctg tacaagtact acgagaaac cgggaactac 2640 ctgaccaagt actccaaaaa ggacaacggc cccgtgatca agaattaa gtattacggc 2700 aaaactga acgcccatct ggacatcacc gacgactacc ccaacagcag aaacaaggttc 2760 gtgaagctgt ccctgaagcc ctacagattc gacgtgtacc tggacaatgg cgtgtacaag 2820 ttcgtgaccg tgaagaatct ggatgtgatc aaaaaagaaa actactacga agtgaatagc 2880 aagtgctatg aggaagctaa gaagctgaag aagatcagca accaggccga gtttatcgcc 2940 tccttctaca acaacgatct gatcaagatc aacggcgagc tgtatagagt gatcggcgtg 3000 aacaacgacc tgctgaaccg gatcgaagtg aacatgatcg acatcaccta ccgcgagtac 3060 ctggaaaaca tgaacgacaa gaggcccccc aggatcatta agacaatcgc ctccaagacc 3120 cagagcatta agaagtacag cacagacatt ctgggcaacc tgtatgaagt gaaatctaag 3180 [[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​​<![CDATA[<223> Synthesis]]> <![CDATA[<400> 35]]> accggtgcca ccatgtaccc atacgatgtt ccagattacg cttcgccgaa gaaaaagcgc 60 aaggtcgaag cgtccatgaa aaggaactac attctggggc tggacatcgg gattacaagc 120 gtggggtatg ggattattga ctatgaaaca agggacgtga tcgacgcagg cgtcagactg 180 ttcaaggagg ccaacgtgga aaacaatgag ggacggagaa gcaagagggg agccaggcgc 240 ctgaaacgac ggagaaggca cagaatccag agggtgaaga aactgctgtt cgattacaac 300 ctgctgaccg accattctga gctgagtgga attaatcctt atgaagccag ggtgaaaggc 360 ctgagtcaga agctgtcaga ggaagagttt tccgcagctc tgctgcacct ggctaagcgc 420 cgaggagtgc ataacgtcaa tgaggtggaa gaggacaccg gcaacgagct gtctacaaag 480 gaacagatct cacgcaatag caaagctctg gaagagaagt atgtcgcaga gctgcagctg 540 gaacggctga agaaagatgg cgaggtgaga gggtcaatta ataggttcaa gacaagcgac 600 tacgtcaaag aagccaagca gctgctgaaa gtgcagaagg cttaccacca gctggatcag 660 agcttcatcg atacttatat cgacctgctg gagactcgga gaacctacta tgagggacca 720 ggagaggga gccccttcgg atggaaagac atcaaggaat ggtacgagat gctgatggga 780 cattgcacct attttccaga agagctgaga agcgtcaagt acgctttaaa cgcagatctt 840 acaacgccct gaatgacctg aacaacctgg tcatcaccag ggatgaaaac gagaaactgg 900 aatactatga gaagttccag atcatcgaaa acgtgtttaa gcagagaaa aagcctacac 960 tgaaacagat tgctaaggag atcctggtca aggaagga catcaagggc taccgggtga 1020 1080 1140 ctatctacca gagctccgag gacatccagg aagagctgac taacctgaac agcgagctga 1200 cccaggagaa gatcgaacag attagtaatc tgaaggggta caccggaaca cacaacctgt 1260 ccctgaaagc tatcaatctg attctggatg agctgtggca tacaacgac aatcagattg 1320 1380 tcccaaccac actggtggac gatttcattc tgtcacccgt ggtcaagcgg agcttcatcc 1440 you are buying gccatcat you are buying cctgcccaat you are buying tcgagctggc tagggagaag aacagcaagg acgcacaga gatgatcaat gagatgcaga aacgaaccg gcagaccaat gaacgcattg aagagattat ccgaactacc gggaagaga acgcaaagta cctgattgaa aaaatcaagc tgcacgatat gcaggaggga aagtgtctgt attctctgga ggccatcccc ctggaggacc tgctgaacaa tccattcaac tacgaggtcg atcatattat ccccagaagc gtgtccttcg acaattcctt taacaacaag gtgctggtca agcaggaga gaactctaaa agggcaata ggactccttt ccagtacctg tctagttcag attccagat ctcttacgaa acctttaaaa agcacattct gatctggcc aaggaaagg 1920 gccgcatcag aacaccaaaaggagtacc tgctggaag gcggcacatc aacagattct 1980 ccgtccagaa ggattttatt aaccggaatc tggtggacac agatacgct actcgcggcc 2040 tgatgaatct gctgcgatcc tattccggg tgaacaatct ggatgtgaaa gtcaagtcca 2100 tcaacggcgg gttcacatct ttctgaggc gcaatggaa gtttaaaag gagcgcaaca 2160 aagggtacaa gcaccatgcc gaagatgctc tgattcgc aaatgccgac ttcatcttta 2220 aggagtggaa aaagctggac aaagccaaga aagtgatgga gaaccagatg ttcgaagaga 2280 agcaggccga atctatgccc gaatcgaga cagaacagga gtacaggg atttcatca 2340 ctcctcacca gatcaagcat atcaaggatt tcaaggacta caagtactct caccgggtgg 2400 ataaaaagcc caacagagag ctgatcaatg acaccctgta tagtacaaga aaagacgata 2460 aggggaatac cctgattgtg aacaatctga acggactgta cgacaaagat aatgacaagc 2520 tgaaaaagct gatcaacaaa agtcccgaga agctgctgat gtaccaccat gatcctcaga 2580 catatcagaa actgaagctg attatggagc agtacggcga cgagaagaac ccactgtata 2640 agtactatga agagactggg aactacctga ccaagtatag caaaaaggat aatggccccg 2700 tgatcaagaa gatcaagtac tatgggaaca agctgaatgc ccatctggac atcacagacg 2760 attaccctaa cagtcgcaac aaggtggtca agctgtcact gaagccatac agattcgatg 2820 tctatctgga caacggcgtg fatherttg tgactgtcaa gaatctggat gtcatcaaaa aggagaacta ctatgaagtg aatagcaagt gctacgaaga ggctaaaaag ctgaaaaaga ttagcaacca ggcagagttc atcgcctcct tttacaacca cgacctgatt aagatcaatg gcgaactgta tagggtcatc ggggtgaaca atgatctgct gaaccgcatt gaagtgaata tgattgacat cacttaccga gagtatctgg aaaacatga tgataagcgc ccccctcga ttatcaaaac aattgcctct aagactcaga gtatcaaaaa gtactcaacc gacattctgg gaaacctgta tgaggtgaag agcaaaagc accctcagat tatcaaaag ggctaagaat tc 3242 <![CDATA[ <210> 36]]> <![CDATA[<211> 3255]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Synthetic]]> <![CDATA[<400> 36]]> atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc caagcggaac 60 tacatcctgg gcctggacat cggcatcacc agcgtgggct acggcatcat cgactacgag 120 acacgggacg tgatcgatgc cggcgtgcgg ctgttcaaag aggccaacgt ggaaaacaac 180 gagggcaggc ggagcaagag aggcgccaga aggctgaagc ggcggaggcg gcatagaatc 240 cagagagtga agaagctgct gttcgactac aacctgctga ccgaccacag cgagctgagc 300 ggcatcaacc cctacgaggc cagagtgaag ggcctgagcc agaagctgag cgaggaagag 360 ttctctgccg ccctgctgca cctggccaag agaagaggcg tgcacaacgt gaacgaggtg 420 gaagaggaca ccggcaacga gctgtccacc aaagagcaga tcagccggaa cagcaaggcc 480 ctggaagaga aatacgtggc cgaactgcag ctggaacggc tgaagaaaga cggcgaagtg 540 cggggcagca tcaacagatt caagaccagc gactacgtga aagaagccaa acagctgctg 600 aaggtgcaga aggcctacca ccagctggac cagagcttca tcgacaccta catcgacctg 660 ctggaaaccc ggcggaccta ctatgaggga cctggcgagg gcagcccctt cggctggaag 720 gacatcaaag aatggtacga gatgctgatg ggccactgca cctacttccc cgaggaactg 780 cggagcgtga agtacgccta caacgccgac ctgtacaacg ccctgaacga cctgaacat 840 ctcgtgatca ccagggacga gaacgagaag ctggaatatt acgagaagtt ccagatcatc 90...

Claims

1. A CRISPR-Cas system comprising a single vector comprising: (a) a nucleotide sequence encoding a first guide RNA (gRNA) molecule that targets intron 44 of a myotropic protein, wherein the first gRNA molecule targets a polynucleotide comprising SEQ ID NO: 2; (b) a nucleotide sequence encoding a second gRNA molecule that targets intron 55 of a myotropic protein, wherein the second gRNA molecule targets a polynucleotide comprising SEQ ID NO: 3; and (c) a nucleotide sequence encoding a SaCas9 protein; (d) a nucleotide sequence encoding one or more SaCas9 gRNA backbones; (e) a first promoter driving the expression of the first gRNA molecule and / or the second gRNA molecule; and (f) a second promoter driving the expression of the SaCas9 protein, wherein the expression of the SaCas9 protein is driven by a muscle-specific promoter comprising the CK8 promoter.

2. The system of claim 1, wherein the SaCas9 gRNA backbone comprises or is encoded by the polynucleotide of SEQ ID NO:

4.

3. The system of claim 1, wherein the SaCas9 protein is encoded by the polynucleotide of SEQ ID NO:

11.

4. The system of claim 1, wherein the carrier comprises at least one polynucleotide selected from SEQ ID NO: 1-13 and 24.

5. The system of claim 1, wherein the vector comprises the polynucleotide sequence of SEQ ID NO:

24.

6. The system of claim 1, wherein the vector comprises a polynucleotide sequence selected from the following: SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 29 and SEQ ID NO:

30.

7. The system of request item 1, wherein the vector is an adeno-associated virus (AAV) vector.

8. The system of request item 7, wherein the AAV carrier is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13 or AAVrh.

74.

9. The system of claim 1, wherein the vector comprises a ubiquitous promoter or a tissue-specific promoter operatively linked to a polynucleotide sequence encoding the first gRNA molecule, the second gRNA molecule, and / or the SaCas9 protein.

10. The system of claim 9, wherein the tissue-specific promoter is a muscle-specific promoter.

11. A cell comprising a system as claimed in any one of claims 1 to 10.

12. A suite comprising a system as claimed in any one of claims 1 to 10.

13. Use of a system as claimed in any one of claims 1 to 10, for preparing a pharmaceutical preparation for correcting mutated myotensin genes in cells.

14. Use of a system as claimed in any one of claims 1 to 10 or a cell as claimed in claim 11, for the preparation of a medicine for use in genome editing individuals of a mutant myotensin gene.

15. As claimed in claim 14, wherein the system or the cell line is administered to the individual via intramuscular, intravenous, or combination thereof.

16. Use of a system as claimed in any one of claims 1 to 10 or a cell as claimed in claim 11, for the preparation of a medicament for the treatment of a mutant myotensin gene in an individual.

17. As claimed in claim 16, wherein the system or the cell line is administered to the individual via intramuscular, intravenous, or combination thereof.

Images