Use of RNA interference agents and pharmaceutical composition

Abstract

The use of an RNA interference agent in the preparation of a medicament for the prevention or treatment of joint diseases is disclosed, wherein the RNAi agent comprises RNA selected from a specific sequence or a precursor thereof. Furthermore, this disclosure also provides a pharmaceutical composition for the prevention or treatment of joint diseases.

Description

Use of RNA interference agents and pharmaceutical compositions The present disclosure relates to an RNA interference (RNAi) agent, and particularly to the use of an RNA interference (RNAi) agent in the preparation of a drug for preventing or treating joint diseases. Osteoarthritis (OA), also known as degenerative arthritis, is characterized by the degeneration and damage of articular cartilage, such as changes in subchondral bone and the formation of osteophytes. It is a common chronic degenerative joint disease that mainly affects weight-bearing joints, such as the knees and hips of the elderly. According to statistics, more than 10% of American adults are clinically diagnosed with osteoarthritis, which is the fourth most common cause of hospitalization and the most common cause of total knee and hip replacement surgeries. Systemic factors predisposing to osteoarthritis include age, gender, ethnicity, bone density, estrogen replacement, genetics, and nutrition, while local biomechanical factors include obesity, joint injury, joint deformity, exercise, and muscle weakness, which will lead to the exacerbation of osteoarthritis. Osteoarthritis is not just a simple degenerative disease. Recent studies have found that low-grade inflammation not only increases the symptoms of the disease but also accelerates the disease process. For example, activated macrophages and other innate immune cells release inflammatory cytokines that promote cartilage damage, and an increased number of immune cells are found in synovial tissues taken from osteoarthritis patients, which is associated with the expression of pro-inflammatory cytokines including TNF-α, IL1β, IL6, IL8, and IL22. On the other hand, MMP1, 3, and 13 are directly responsible for the remodeling of the extracellular matrix. Current treatments and management for osteoarthritis include drug therapy, non-drug therapy, and surgical treatment, etc. Drug therapies for relieving osteoarthritis symptoms include acetaminophen, non-steroidal anti-inflammatory drugs, opioid drugs, topical analgesics, corticosteroid injections, and hyaluronic acid injections, while glucosamine and chondroitin sulfate have certain protective effects. It has also been found that the combination of drug therapy and non-drug intervention therapy is more effective in pain control. In addition, exercise is not only an effective intervention therapy but also a method for preventing osteoarthritis, and other physical therapies include braces and foot orthotics, etc. Nevertheless, total joint replacement of the knee, hip, and glenohumeral joints remains the most effective treatment method, which can restore joint function to near normal. However, due to the usually excessive cartilage defects in osteoarthritis, osteochondral transplantation, autologous perichondrium, peritoneum transplantation, and chondrocyte transplantation may all be inapplicable. Recent studies have shown that the newly discovered kartogenin (KGN) can stimulate mesenchymal stem cells (MSCs) in cartilage tissue to differentiate into chondrocytes, and locally administering KGN in the early stage of osteoarthritis can thus improve the damaged joint. In addition, tissue engineering and stem cell therapy have also been applied to the research of osteoarthritis. Stem cell therapy involves introducing stem cells into the joint and guiding the differentiation of stem cells into chondrocytes, thereby providing a permanent biological treatment. However, stem cell therapy has risks such as the formation of teratomas during treatment, contamination during the culture process, and / or immune reactions during treatment. Moreover, culturing stem cells is cumbersome and costly, resulting in expensive treatment costs. In recent years, there have also been studies on treating osteoarthritis with exosomes secreted by stem cells. However, although using exosomes can reduce the risk of teratomas, it does not help solve the risks of contamination and / or immune reactions and the problem of high costs. In addition, catabolic factors such as IL1α or TNF-α present in osteoarthritic joints will inhibit the chondrocyte differentiation of stem cells, thus reducing chondrogenesis. Therefore, in addition to introducing chondrocytes, reducing inflammatory cytokines is equally important for the repair of the patient's joint. In summary, the treatment of osteoarthritis still有待突破, and there is an urgent need to further develop safe, effective, simple, and low-cost therapies. The present disclosure provides the use of an RNA interference (RNAi) agent in the preparation of a drug for preventing or treating joint diseases, wherein the RNAi agent comprises at least one RNA or its precursor selected from the group consisting of an RNA having SEQ ID NO.: 1 or its precursor, an RNA having SEQ ID NO.: 2 or its precursor, an RNA having SEQ ID NO.: 3 or its precursor, an RNA having SEQ ID NO.: 4 or its precursor, an RNA having SEQ ID NO.: 5 or its precursor, an RNA having SEQ ID NO.: 6 or its precursor, an RNA having SEQ ID NO.: 7 or its precursor, an RNA having SEQ ID NO.: 8 or its precursor, an RNA having SEQ ID NO.: 9 or its precursor, and an RNA having SEQ ID NO.: 10 or its precursor. In one aspect of the present disclosure, the RNA selected from SEQ ID NO.: 1 to SEQ ID NO.: 10 is derived from exosomes of mesenchymal stem cells. For example, the mesenchymal stem cells are selected from at least one of the group consisting of umbilical cord mesenchymal stem cells, umbilical cord blood mesenchymal stem cells, placental mesenchymal stem cells, amniotic fluid mesenchymal stem cells, bone marrow mesenchymal stem cells, and adipose mesenchymal stem cells. In another aspect of the present disclosure, the mesenchymal stem cells are human umbilical cord mesenchymal stem cells. In one aspect of the present disclosure, the RNA or its precursor selected from SEQ ID NO.: 1 to SEQ ID NO.: 10 is selected from at least one of the group consisting of microRNA (miRNA) or its precursor and short interfering RNA (siRNA) or its precursor. In one aspect of the present disclosure, the RNAi agent is selected from at least one of the group consisting of hsa-miR-4484, hsa-miR-1273g-3p, hsa-miR-4497, hsa-miR-6087, hsa-miR-3960, hsa-miR-7704, hsa-miR-6089, hsa-miR-3665, hsa-miR-6090, and hsa-miR-6126. In another aspect of the present disclosure, the RNAi agent is hsa-miR-4484, hsa-miR-7704, or a combination thereof. In one aspect of the present disclosure, the joint disease is joint cartilage defect, osteoarthritis, chronic articular rheumatism, degenerative arthritis, periarthritis of shoulder, cartilage degeneration, or anterior cruciate ligament injury. In another aspect of the present disclosure, the joint disease is osteoarthritis. In one aspect of the present disclosure, the RNAi agent is an injection. In one aspect of the present disclosure, the injection is administered by intra-articular injection of an effective amount of RNA or its precursor to an individual in need. In one aspect of the present disclosure, the effective amount of RNA or its precursor administered is between 10 μg and 100 μg per joint. In one aspect of the present disclosure, the effective amount of RNA or its precursor administered is between 0.1 OD and 10 OD per joint. In one aspect of the present disclosure, a single administration of the RNAi agent can maintain the therapeutic effect for more than 4 weeks to 16 weeks. In one aspect of the present disclosure, there is further provided a pharmaceutical composition for preventing or treating joint diseases, which comprises at least one RNA or its precursor selected from the group consisting of the RNA having SEQ ID NO.: 1 or its precursor, the RNA having SEQ ID NO.: 2 or its precursor, the RNA having SEQ ID NO.: 3 or its precursor, the RNA having SEQ ID NO.: 4 or its precursor, the RNA having SEQ ID NO.: 5 or its precursor, the RNA having SEQ ID NO.: 6 or its precursor, the RNA having SEQ ID NO.: 7 or its precursor, the RNA having SEQ ID NO.: 8 or its precursor, the RNA having SEQ ID NO.: 9 or its precursor, and the RNA having SEQ ID NO.: 10 or its precursor. In one aspect of the present disclosure, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant, carrier or excipient. The present disclosure treats osteoarthritis by administering an RNAi agent with a specific sequence or a pharmaceutical composition comprising the RNAi agent, and finds that the RNA or its precursor or synthetic RNA, which constitutes the RNAi agent, is inexpensive, easily obtained, and easy to operate, not only has good therapeutic effects, but also surprisingly finds that a single administration can maintain a long-term therapeutic effect. Figure 1 is a bar graph of ADAMTS5 gene expression in IL1β-stimulated osteocytes after treatment with exosomes or hsa-miR-4484. Figure 2 is a Western blot of MMP13 protein expression in IL1β-stimulated osteocytes after treatment with exosomes or hsa-miR-4484. Figure 3 is a bar graph of ADAMTS5 and MMP13 gene expression in IL1β-stimulated osteocytes after treatment with exosomes or hsa-miR-7704. Figure 4 is a comparison graph of the Rotarod test between the experimental group and the control group of osteoarthritis model mice treated with hsa-miR-4484. Figure 5 is a comparison graph of the Rotarod test between the experimental group and the control group of osteoarthritis model mice treated with hsa-miR-7704. The technical solutions described in the embodiments of the present disclosure will be described more clearly and completely below. Obviously, the described embodiments are only a part of the many embodiments covered by the present disclosure and are not intended to limit the scope of the present disclosure. The present disclosure can also be implemented or applied in similar or different embodiments. Other embodiments obtained by those of ordinary skill in the art without creative efforts, such as modifications, changes, substitutions of certain elements or combinations thereof, are all included in the scope of the present disclosure. Note further that, in this disclosure, the singular forms "a" and "the" mean including plural referents unless clearly and unambiguously limited to one referent. Additionally, unless the context clearly indicates otherwise, the term "or" is interchangeable with the term "and / or". The term "about" as used in this disclosure refers to an error or range of the numerical value, numerical range, or ratio within 20% of that numerical value, numerical range, or ratio, preferably within 10%, more preferably within 5% floating. The quantified numerical values described herein are approximate values, meaning they can also be inferred if the term "about" is not used. The numerical ranges described herein cover all numerical values falling within that numerical range. For example, the numerical range of 3 to 7 covers numerical values such as 3, 3.01, 3.1, 3.5, etc., and also covers all sub-ranges falling within that numerical range. The sub-ranges are enclosed by the respective numerical values falling within that numerical range. For example, the numerical range of 3 to 7 covers sub-ranges such as 3 to 6, 4 to 7, 4 to 6, etc. The terms "comprising", "including", "containing", "having", etc. as used herein mean that there is a certain element (such as a component or step, etc.) in the things, methods, uses, etc. of this disclosure, and unless the context clearly indicates otherwise, those unrecorded and unspecified elements are also open to exist in the things, methods, uses of this disclosure, whether necessary or not. That is, those unrecorded and unspecified elements are not restrictively excluded. This disclosure provides a use of an RNA interference (RNAi) agent in the preparation of a drug for preventing or treating joint diseases, wherein the RNAi agent includes an RNA or its precursor selected from those having the specific sequences described in this disclosure. The RNA contained in the RNAi agent of this disclosure can be single-stranded, double-stranded, or hairpin-form RNA, which can induce the RNA interference phenomenon and regulate target genes, and the RNA includes microRNA (miRNA), short interfering RNA (siRNA), and their precursors. Examples of the precursors include, but are not limited to, pri-miRNA and pre-miRNA, etc. Among the RNAs having SEQ ID NO.: 1 to SEQ ID NO.: 10 described in this disclosure, taking the RNA having SEQ ID NO.: 1 as an example, it refers to an RNA such as SEQ ID NO.: 1, for example, an unmodified natural RNA molecule, or a natural RNA molecule modified with a specific functional group or ligand, and non-natural synthetic RNA-like molecules, etc. Therefore, the RNA or its precursor having SEQ ID NO.: 1 refers to an RNA or its precursor having a similarity of about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% to SEQ ID NO.: 1. As used herein, the term "exosome" refers to an extracellular vesicle, which is an important medium for intercellular communication and is involved in not only normal physiological functions but also the occurrence and development of diseases. Exosomes can be isolated from all types of body fluids by centrifugation. In one aspect of the present disclosure, the RNA or its precursor included in the RNAi agent has the following sequences: AAAAAGGCGGGAGAAGCCCCA (SEQ ID NO.: 1), ACCACUGCACUCCAGCCUGAG (SEQ ID NO.: 2), CUCCGGGACGGCUGGGC (SEQ ID NO.: 3), UGAGGCGGGGGGGCGAGC (SEQ ID NO.: 4), GGCGGCGGCGGAGGCGGGGG (SEQ ID NO.: 5), CGGGUGCGGCGGCGACGUG (SEQ ID NO.: 6), GGAGGCCGGGGUGGGGCGGGGCGG (SEQ ID NO.: 7), CGCCGCCCCGCACCUGCU (SEQ ID NO.: 8), GGGAGCGAGGGGCGGGGC (SEQ ID NO.: 9), or UCUCCGCCGGGCCUUCAC (SEQ ID NO.: 10). In some aspects of the present disclosure, the RNA or its precursor selected from those having SEQ ID NO.: 1 refers to an RNA or its precursor having a similarity of about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% to SEQ ID NO.: 1; the RNA or its precursor selected from those having SEQ ID NO.: 2 refers to an RNA or its precursor having a similarity of about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% to SEQ ID NO.: 2; the RNA or its precursor selected from those having SEQ ID NO.: 3 refers to an RNA or its precursor having a similarity of about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% to SEQ ID NO.: 3; similarly, each RNA or its precursor selected from those having SEQ ID NOs.: 4 to 10 refers to an RNA or its precursor having a similarity of about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% to the corresponding SEQ ID NOs.: 4 to 10. In one aspect of the present disclosure, the RNAi agent includes the RNA having SEQ ID NO.: 1 and SEQ ID NO.: 6 or its precursor. In another aspect of the present disclosure, the RNAi agent includes the RNA of SEQ ID NO.: 1 or its precursor. In another aspect of the present disclosure, the RNAi agent includes the RNA of SEQ ID NO.: 6 or its precursor. In one aspect of the present disclosure, the RNA or its precursor selected from the group consisting of SEQ ID NO.: 1 to SEQ ID NO.: 10 is at least one selected from the group consisting of miRNA or its precursor and siRNA or its precursor. In another aspect of the present disclosure, the RNA or its precursor selected from the group consisting of SEQ ID NO.: 1 to SEQ ID NO.: 10 is miRNA or its precursor. In another aspect of the present disclosure, the RNA or its precursor selected from the group consisting of SEQ ID NO.: 1 to SEQ ID NO.: 10 is siRNA or its precursor. In one aspect of the present disclosure, the RNAi agent includes at least one selected from the group consisting of hsa-miR-4484, hsa-miR-1273g-3p, hsa-miR-4497, hsa-miR-6087, hsa-miR-3960, hsa-miR-7704, hsa-miR-6089, hsa-miR-3665, hsa-miR-6090 and hsa-miR-6126. In one aspect of the present disclosure, the RNA selected from the group consisting of SEQ ID NO.: 1 to SEQ ID NO.: 10 is derived from mesenchymal stem cell exosomes, wherein the mesenchymal stem cells are at least one selected from the group consisting of umbilical cord mesenchymal stem cells, umbilical cord blood mesenchymal stem cells, placental mesenchymal stem cells, amniotic fluid mesenchymal stem cells, bone marrow mesenchymal stem cells and adipose mesenchymal stem cells. In one aspect of the present disclosure, the RNA sequence of the RNAi agent is derived from human umbilical cord mesenchymal stem cell exosomes. In one aspect of the present disclosure, the RNAi agent is used to preserve cartilage tissue and / or promote cartilage regeneration to prevent or treat joint diseases. In one aspect of the present disclosure, the RNAi agent is used to prevent or treat joint diseases including articular cartilage defects, osteoarthritis, chronic articular rheumatism, degenerative arthritis, scapulohumeral periarthritis, cartilage degeneration or anterior cruciate ligament injury. In another aspect of the present disclosure, the RNAi agent is used to prevent or treat osteoarthritis. In one aspect of the present disclosure, the RNAi agent inhibits the expression level of the target protein in the joint disease. Specifically, the RNAi agent inhibits the expression level of MMP13 protein and / or ADAMTS-5 protein. The RNAi agents of the present disclosure may also include the RNA polymers of the present disclosure and one or more pharmaceutically acceptable adjuvants, carriers or excipients. In one aspect of the present disclosure, the excipient may be a non-buffered solution such as water for injection. In one aspect of the present disclosure, the excipient may be a buffered solution such as phosphate buffered solution. In one aspect of the present disclosure, there is further provided a pharmaceutical composition for preventing or treating joint diseases, which comprises an RNA or its precursor selected from at least one of the group consisting of the RNA having SEQ ID NO.: 1 or its precursor, the RNA having SEQ ID NO.: 2 or its precursor, the RNA having SEQ ID NO.: 3 or its precursor, the RNA having SEQ ID NO.: 4 or its precursor, the RNA having SEQ ID NO.: 5 or its precursor, the RNA having SEQ ID NO.: 6 or its precursor, the RNA having SEQ ID NO.: 7 or its precursor, the RNA having SEQ ID NO.: 8 or its precursor, the RNA having SEQ ID NO.: 9 or its precursor, and the RNA having SEQ ID NO.: 10 or its precursor. In one aspect of the present disclosure, the drug or pharmaceutical composition may be an injection. In one aspect of the present disclosure, the drug or pharmaceutical composition may be for topical use. In one aspect of the present disclosure, the drug or pharmaceutical composition is administered by intra-articular injection with an effective amount of RNA or its precursor to an individual in need. In one aspect of the present disclosure, an effective amount of RNA or its precursor between 10 μg and 100 μg per joint is administered to an individual in need. In one aspect of the present disclosure, an effective amount of RNA or its precursor between 20 μg and 50 μg per joint is administered to an individual in need. In one aspect of the present disclosure, the effective amount of RNA or its precursor administered is about 10, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90 or about 100 μg per joint. In another aspect of the present disclosure, the effective amount of RNA or its precursor administered is about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39 or about 40 μg per joint. In one aspect of the present disclosure, an effective amount of RNA or its precursor between 0.1 OD and 10 OD per joint is administered to an individual in need thereof. In one aspect of the present disclosure, an effective amount of RNA or its precursor between 0.5 OD and 5 OD per joint is administered to an individual in need thereof. In one aspect of the present disclosure, the effective amount of RNA or its precursor administered is about 0.5, about 1, about 1.5, about 2, about 2.5, about 3, about 3.5, about 4, about 4.5, about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 8.5, about 9, about 9.5 or about 10 OD per joint. In one aspect of the present disclosure, a single administration of the drug or pharmaceutical composition can maintain a long-term therapeutic effect. In one aspect of the present disclosure, a single administration of the drug or pharmaceutical composition can maintain a therapeutic effect for more than 2 weeks, more than 4 weeks, more than 8 weeks, or more than 16 weeks. In one aspect of the present disclosure, the administration interval of the drug or pharmaceutical composition can be 2 weeks or longer, 3 weeks or longer, 4 weeks or longer, 5 weeks or longer, 6 weeks or longer, 7 weeks or longer, 8 weeks or longer, 9 weeks or longer, 10 weeks or longer, 11 weeks or longer, 12 weeks or longer, 13 weeks or longer, 14 weeks or longer, 15 weeks or longer, or 16 weeks or longer. The following specific embodiments are used to further illustrate the present disclosure, but should not be regarded as a limitation on the scope of the present disclosure. Example 1: miRNA Expressed in Mesenchymal Stem Cell Exosomes Isolation and identification of exosomes. Human umbilical cord mesenchymal stem cell (HUCMSC) exosomes were purified from the cell culture medium (CM) of HUCMSCs using high performance liquid chromatography. The CM was prepared by washing 80% concentrated HUCMSC cell culture medium three times with phosphate buffered saline (PBS) and culturing overnight in DMEM without phenol red (Invitrogen), supplemented with insulin, transferrin, and selenium (ITS; Invitrogen), 5 ng / ml FGF2 (Invitrogen), 5 ng / ml PDGF AB (Peprotech, Rocky Hill, NJ), glutamine - penicillin - streptomycin, and β - mercaptoethanol. Then it was washed three times with PBS and fresh aforementioned medium was added. Three days later, the medium was collected and centrifuged at 500 g, and the supernatant was collected and filtered using a 0.2 μm filter. No serum was used during the preparation of the CM and the cells were not stimulated. The serum - free CM from MSCs culture was concentrated 50 - fold by tangential flow filtration using a membrane with a 100 kDa molecular weight cut - off (Sartorius, Goettingen, Germany). Then, the CM was passed through a chromatographic column (TSK Guard column SWXL, 6×40 mm and TSK gel G4000 SWXL, 7.8×300 mm, Tosoh Corp., Tokyo, Japan). Exosomes were collected from the first eluted peak and concentrated using a 3 kDa MWCO filter (Sartorius). The collected exosomes were filtered using a 0.22 μm filter before storage at - 80 °C. Analysis of HUCMSC exosomes using miRNA array. Array analysis of all collected RNA was performed according to the manufacturer's recommendations. Briefly, 100 ng of RNA was labeled using the microRNA Complete Labelling and Hyb kit (Agilent, Santa Clara, CA, USA) and then hybridized with the Agilent Human miRNA Microarray V21.0 (8×60K) for 2549 human miRNAs. After hybridization, the microarray was washed using the Gene Expression Wash Buffer kit (Agilent). The array signals were analyzed using the Agilent Microarray Scanner (Agilent) and Agilent scan control software Version A7.0 (Agilent). After miRNA array analysis, the top 10 miRNAs with the highest expression levels in the exosomes of human umbilical cord mesenchymal stem cells are listed in Table 1 below. Table 1 Example 2: miRNA treatment of IL1β-stimulated osteocytes Human cartilage culture and IL1β stimulation experiment. By adding IL1β, human chondrocytes were induced to exhibit a rheumatoid arthritis (OA)-like phenotype. Chondrocytes were cultured in DMEM containing 10% fetal bovine serum, 100 μg / mL penicillin / streptomycin, and 2 mmol / mL glutamine. OA-like chondrocytes were chondrocytes co-cultured with pretreatment of IL1β (1 ng / mL) for 24 hours. The RNA for treating OA-like chondrocytes was synthetic RNA, including miRNA hsa-miR-4484 (SEQ ID NO.1) and hsa-miR-7704 (SEQ ID NO.6) and the antagomir of the above miRNA. The treatment methods for each chondrocyte experimental group were as follows: Negative control group: Normal chondrocytes without pretreatment; Positive control group: OA-like chondrocytes without further experimental treatment; Post-induced OA group: Normal chondrocytes without pretreatment were treated with IL1β (1 ng / mL) combined with a transfect reagent (TR); Exosome treatment group: OA-like chondrocytes were treated with HUCMSCs (umbilical cord mesenchymal stem cell) exosomes (50 μg / ml); miRNA treatment group: OA-like chondrocytes were treated with transfected target miRNA (50 nM); miRNA and antagomir (anta) treatment group: OA-like chondrocytes were treated with co-transfection of the target miRNA and its antagomir (50 nM each). After the above groups were treated and cultured for 48 hours, qRT-PCR or Western blot analysis was performed. The chondrocytes treated with the above-mentioned IL1β were used as a model to simulate the inflammation of osteocytes in joint diseases. Figure 1 shows the gene expression map of ADAMTS5 under the treatment of hsa-miR-4484. Taking the normal chondrocytes of the negative control group without pretreatment as the benchmark, the gene expression of ADAMTS5 in both the OA-like chondrocytes with IL1β pretreatment (positive control group) and the normal chondrocytes induced by IL1β after the start of the experiment (post-induced OA group) increased significantly (both p<0.001). Compared with the above two IL1β treatment groups (positive control group and post-induced OA group), the gene expression of ADAMTS5 in the OA-like chondrocytes treated with exosomes (exosome treatment group) decreased significantly (p<0.001) to a level close to that of the negative control group. The gene expression of ADAMTS5 in the OA-like chondrocytes treated with hsa-miR-4484 (miR4484 treatment group) decreased further, not only lower than that of the exosome treatment group (p<0.01), but even lower than that of the negative control group (p<0.05). Figure 2 shows the Western blot of collagenase MMP13 protein under the treatment of hsa-miR-4484. Taking the MMP13 protein expression of the negative control group without pretreatment as the benchmark, it can be seen that the MMP13 protein expression in the positive control group with IL1β pretreatment increased by about 1.16 times. Under the same benchmark, the MMP13 protein expression in the exosome treatment group decreased by 0.6 times, and the MMP13 protein expression in the miR4484 treatment group decreased by 0.5 times. Therefore, both exosomes and hsa-miR-4484 isolated from exosomes can effectively reduce the expression of joint disease markers ADAMTS5 and MMP13, and the effect of hsa-miR-4484 is better than that of exosomes. Figure 3 shows the gene expression of ADAMTS5 and MMP13 under the treatment of hsa-miR-7704. Using normal chondrocytes in the negative control group without pretreatment as the benchmark, the gene expressions of ADAMTS5 and MMP13 in OA-like chondrocytes with IL1β pretreatment (positive control group) or normal chondrocytes induced with OA by IL1β treatment after the start of the experiment (post-induced OA group) were significantly increased (both p<0.001). Figure 3B shows that compared with the positive control group and the post-induced OA group, the gene expressions of ADAMTS5 and MMP13 in OA-like chondrocytes treated with exosomes (exosome treatment group) were significantly decreased (p<0.001). Moreover, the gene expression of ADAMTS5 in OA-like chondrocytes treated with hsa-miR-7704 (miR7704 treatment group) was further decreased, not only lower than that in the exosome treatment group (p<0.01), but even lower than that in the negative control group (p<0.05). Figure 3A shows that compared with the positive control group and the post-induced OA group, the gene expressions of MMP13 in the exosome treatment group and the miR7704 treatment group were significantly decreased (p<0.001). Therefore, both exosomes and hsa-miR-7704 isolated from exosomes can effectively reduce the expressions of the joint disease marker genes ADAMTS5 and MMP13, and in reducing the expression of ADAMTS5, the effect of hsa-miR-7704 is better than that of exosomes. Example 3: miRNA treatment of osteoarthritis Mice with collagenase-induced arthritis were used as a model to simulate osteoarthritis. Ten-week-old C57BL / 6 mice were intra-articularly injected with 12 U of collagenase VII (Collagenase VII; Clostridium histolyticum; Sigma-Aldrich) dissolved in 8 μl of saline into the knee joint ligament. The injection day was day 0, and on day 7, the mice were divided into a control group (6 mice) and a treatment group (6 mice). Among them, the control group was mice with collagenase-induced arthritis that did not receive any treatment. The mice with collagenase-induced arthritis in the treatment group received intra-articular injection of miRNA. The injection solution used for intra-articular injection of miRNA was 1 OD (33 μg) of synthetic hsa-miR-4484 (SEQ ID NO.1) or synthetic hsa-miR-7704 (SEQ ID NO.6) dissolved in phosphate buffer solution. As shown in the control groups of FIGS. 4 and 5, the locomotor ability of mice with collagenase-induced arthritis on the rotarod gradually declined over time. Compared with before collagenase-induced arthritis, 28 days after collagenase-induced arthritis, the locomotor ability of mice in the control group decreased by more than 50%. In contrast, as shown in FIG. 4, the locomotor ability of mice treated with an injection of 1 OD (33 μg) of hsa-miR-4484 did not significantly decline, and 28 days after collagenase-induced arthritis, their locomotor ability was significantly higher than that of the untreated control group (p < 0.05). Similarly, as shown in FIG. 5, the locomotor ability of mice treated with an injection of 1 OD (33 μg) of hsa-miR-7704 also did not significantly decline, and 14 days and 28 days after collagenase-induced arthritis, their locomotor ability was significantly higher than that of the untreated control group (both p < 0.01). It can be seen from this that miRNA can effectively treat osteoarthritis, and a single injection can achieve long-term therapeutic effects. Although some specific embodiments of the present disclosure have been described in detail above, those of ordinary skill in the art can make various modifications and changes to the illustrated embodiments without substantially departing from the teachings and advantages of the present disclosure. Therefore, such modifications and changes should still be included within the scope of the present disclosure as set forth in the appended claims.

Claims

1. The use of an RNA interference (RNAi) agent in the preparation of a medicament for the prevention or treatment of joint diseases, wherein, The RNAi preparation comprises RNA or its precursor selected from at least one of the group consisting of RNA having SEQ ID NO.: 1 or RNA or its precursor having SEQ ID NO.: 6; wherein the precursor is pri-miRNA or pre-miRNA; wherein the RNA selected from RNA having SEQ ID NO.: 1 and SEQ ID NO.: 6 is derived from exosomes of mesenchymal stem cells; and wherein the joint disease is articular cartilage defect, osteoarthritis, chronic rheumatoid arthritis, osteoarthritis, periarthritis of the shoulder, cartilage degeneration, or anterior cruciate ligament injury.

2. The use as described in claim 1, wherein, The mesenchymal stem cells were selected from at least one of the groups consisting of umbilical cord mesenchymal stem cells, umbilical cord blood mesenchymal stem cells, placental mesenchymal stem cells, amniotic fluid mesenchymal stem cells, bone marrow mesenchymal stem cells, and adipose mesenchymal stem cells.

3. The use as described in claim 1, wherein, The RNA or its precursor containing SEQ ID NO.: 1 and SEQ ID NO.: 6 is selected from at least one of the groups consisting of microRNA or its precursor and short interfering RNA or its precursor.

4. The use as described in claim 1, wherein, The RNAi formulation is hsa-miR-4484, hsa-miR-7704, or a combination thereof.

5. The use as described in claim 1, wherein, This RNAi preparation is an injectable formulation.

6. The use as described in claim 5, wherein, This injectable is intended for intra-articular administration of an effective amount of the RNA or its precursor to an individual in need.

7. The use as described in claim 6, wherein, The effective amount of RNA or its precursor applied is between 10 μg and 100 μg per joint.

8. The use as described in claim 6, wherein, The effective amount of RNA or its precursor applied is between 0.1 OD and 10 OD per joint.

9. The use as described in claim 1, wherein, This RNAi agent can maintain efficacy for more than 4 to 16 weeks with a single administration.

Images