Uses of passiflora edulis seeds extract in preparing composition for improving deep sleep or assisting sleep onset
Patent Information
- Application Number
- TW114141783
- Authority / Receiving Office
- TW · TW
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-12-30
- Publication Date
- 2026-09-01
- Estimated Expiration
- 2042-12-29
Smart Images

Figure TWG2TB001909084_001 
Figure TWG2TB001909084_002 
Figure TWG2TB001909084_003
Abstract
Description
[Technical Field]
[0001] This invention relates to the use of passion fruit seed extract, and particularly to the use of passion fruit seed extract in the preparation of compositions that enhance deep sleep or aid sleep. [Previous Technology]
[0002] Passion fruit (scientific name: Passiflora edulis) is a perennial vine. It belongs to the genus Passiflora of the family Passifloraceae. Also known as passion fruit or egg fruit, it originated in the Americas, including Brazil, Paraguay, and Argentina.
[0003] Passion fruit has a sweet and sour taste and a natural fruity aroma, making it very popular with the general public. The sweet and sour juice of passion fruit can be paired with various drinks, ice cream, and desserts to enhance the flavor and color of the food, stimulating consumers' desire to buy. The diverse flavors of passion fruit are also particularly popular, which has led to the expansion of passion fruit planting area year by year. The output value of passion fruit in Taiwan has grown from more than 100 million yuan in 2007 to nearly 800 million yuan in 2017, ranking among the top fruit trees in terms of output value per unit area. [Summary of the Invention]
[0004] However, the production of passion fruit juice generates many waste parts, including the peel, the aril inside the fruit, and many black seeds. These unusable parts also lead to additional waste disposal costs for juice producers. In view of this, in order to more actively promote the development and application of other aspects of passion fruit seeds, a new use for passion fruit seed extract is proposed, which is used to prepare a composition that enhances deep sleep. The passion fruit seed extract is extracted from passion fruit seeds and the aril covering the seeds using water as a solvent. The enhancement of deep sleep is achieved by increasing the content of γ-aminobutyric acid (GABA).
[0005] In some embodiments, passion fruit seed extract is used to increase the intracellular content of γ-aminobutyric acid (GABA).
[0006] In some embodiments, passion fruit seed extract is used to increase the proportion of deep sleep states.
[0007] In some embodiments, passion fruit seed extract is used to reduce the degree of sleep disturbance.
[0008] In some embodiments, passion fruit seed extract is used to help with sleep.
[0009] In some embodiments, the passion fruit seed extract includes the compound N-feruloylputrescine.
[0010] In some embodiments, asoflavone putrescine is used to promote serotonin levels.
[0011] In some embodiments, asoflavone putrescine is used to promote melatonin production.
[0012] In some embodiments, the effective amount of passion fruit seed extract is 5 grams per day.
[0013] In some embodiments, the present invention provides a method for preparing passion fruit seed extract, wherein the passion fruit seed extract is obtained by using water as a solvent and extracting passion fruit seeds at an extraction temperature of 50℃-100℃ for 1-2 hours. Passion fruit seeds are the seeds of passion fruit (Passiflora edulis) and the aril covering the seeds. The passion fruit seed extract includes at least the compound N-feruloylputrescine.
[0014] In some embodiments, the step of extracting passion fruit seeds at an extraction temperature of 50°C-100°C for 1-2 hours includes: adding 0.1% of compound fiber enzyme to water, extracting at an extraction temperature of 50°C for 1 hour, and then extracting at an extraction temperature of 85°C for 1 hour to obtain the extract.
[0015] In some embodiments, the passion fruit seed extract further comprises 4-glucosylvanillic acid, 6-butyl citrate, 1,6-dimethyl citrate, 1-butyl malate, adenosine, guanosine, (5-Hydroxymethyl-furylidene)-malonic acid, pyroglutamic acid, 1,2,3,4-tetrahydro-beta-carboline-3-carboxylic acid, protocatechuic acid, genistein, soy isoflavones, and Thunberginol C8-O-β-D-glucopyranoside.
[0016] In summary, the passion fruit seed extract of any embodiment can be used to prepare a composition that promotes sleep quality. The passion fruit seed extract of any embodiment can be used to prepare a composition that increases intracellular γ-aminobutyric acid (GABA) levels, increases blood serotonin levels, reduces sleep disturbances, and helps with falling asleep. The passion fruit seed extract obtained by the preparation method of any embodiment includes the compound N-feruloylputrescine, and N-feruloylputrescine can promote serotonin levels and melatonin production.
Implementation Method
[0018] In some embodiments, the passion fruit seed raw material comes from the variety "Tainong No. 1", which is the main commercially cultivated passion fruit variety in Taiwan. The fruit of Tainong No. 1 is spherical to oval, and turns reddish-brown when ripe. The pericarp is hard and thick, the endocarp is white, and there are many black seeds inside the fruit. The seeds are almond-shaped and covered with a white or pale yellow aril.
[0019] As used herein, “passion fruit seed raw material” refers to the seed and its aril, which may include raw, dried or otherwise physically processed seeds and their aril to facilitate processing, and may further include whole, chopped, diced, ground, milled or otherwise processed seeds and their aril to affect the size and physical integrity of the raw material.
[0020] In some embodiments, a passion fruit seed extract is obtained by extracting passion fruit seed raw material with an aqueous solvent. In some embodiments, the passion fruit seed extract is obtained by sequentially subjecting passion fruit seed raw material to a low-temperature fermentation step S10, a heated water extraction step S20, a filtration step S30, and a concentration step S40.
[0021] In some embodiments, the passion fruit seed raw material may be passion fruit seeds and their aril after the outer skin and juice have been removed. In some embodiments, the passion fruit seed raw material may be fresh, frozen, or dried passion fruit seeds and their aril. In some embodiments, the color gradation acceptance of the passion fruit seed raw material is set at Pantone 426C, with a color wavelength close to 483.04 meters.
[0022] Refer to Figure 1. In some embodiments, the low-temperature fermentation step S10 refers to heating water to 50±10°C, adding passion fruit seed raw material and compound fiber enzyme, mixing, and maintaining the temperature for a fixed period of time to obtain the fermentation liquid. In some embodiments, the fixed period of time refers to 0.5 hours to 3 hours. For example, passion fruit seed raw material, water and compound fiber enzyme are mixed and maintained at 50°C for 1 hour.
[0023] In some embodiments, the weight ratio (water:passion fruit seed raw material) in the low-temperature fermentation step S10 is 5~20:1~5. For example, the ratio of water to passion fruit seed raw material is 5:1. In some embodiments, the amount of compound cellulase added is 0.1% of the solvent. In some embodiments, compound cellulase refers to a general term for enzymes that can degrade cellulose or glucosidic bonds. In some embodiments, compound cellulase includes β-glucanase. Here, compound cellulase includes β-glucanase, which refers to an endoglucanase that can hydrolyze the (1,3)- or (1,4)- bonds in β-D-glucan.
[0024] In some embodiments, the temperature-raising water extraction step S20 refers to raising the temperature of the fermentation broth to 80°C~100°C and maintaining the temperature for a period of time to obtain the extract. For example, the temperature of the fermentation broth is raised to 85±5°C and maintained for at least 60 minutes. In some embodiments, the time period in the temperature-raising water extraction step S20 is determined by the sugar content of the extract, that is, when the sugar content of the extract is greater than 0.7 Brix°, the temperature-raising water extraction step S20 is considered complete. For example, if the temperature-raising water extraction step S20 has been running for more than 2 hours and the liquid sugar content is still less than 0.7 Brix°, the temperature-raising water extraction step S20 is considered a failure and is not continued. In some embodiments, the temperature-raising water extraction step S20 refers to raising the temperature of the fermentation broth to 80°C~100°C and measuring the sugar content of the fermentation broth to be greater than 0.7 Brix° to obtain the extract. In some embodiments, the extract is passion fruit seed extract.
[0025] In some embodiments, the filtration step S30 refers to passing the extract through a sieve to remove solids from the solvent to form a filtrate. For example, the sieve may be a 400-mesh sieve.
[0026] In some embodiments, the concentration step S40 refers to concentrating the filtrate under reduced pressure to obtain a primary extract. In some embodiments, the primary extract obtained in the concentration step S40 may be passion fruit seed extract. In some embodiments of the concentration step S40, the concentration is performed under reduced pressure between 40°C and 70°C. In some embodiments, the concentration step S40 refers to concentrating the filtrate under reduced pressure until the sugar content of the filtrate is greater than 10.0 Brix° to obtain a primary extract. For example, a BUCHI-Rotavapor R-100 vacuum concentration device is used to perform vacuum concentration at a set temperature of 60±5°C and a pressure set at 1±0.2 kg / cm².
[0027] In some embodiments, the low-temperature fermentation step S10 may be preceded by a grinding step S110, which involves grinding the passion fruit seed raw material until it is broken into powder. For example, the grinding can be performed using a juicer, blender, or homogenizer.
[0028] In some embodiments, the concentration step S40 further includes a re-filtration step S410, which refers to passing the initial extract through a 400-mesh sieve to remove solids and form passion fruit seed extract. In some embodiments, the re-filtration step S410 refers to passing the initial extract through a 400-mesh sieve to remove solids, and then filtering it again with a filter bag or filter cartridge (5µm pore size) to form passion fruit seed extract.
[0029] In some embodiments, the re-filtration step S410 may be followed by a filling or sterilization step (not shown). In some embodiments, sterilization refers to heating at 100±5°C for 120 minutes.
[0030] In some embodiments, the sugar content of the passion fruit seed extract is 10 ± 1 Brix°. In some embodiments, the pH value of the passion fruit seed extract is 3 ± 1. In some embodiments, the total flavonoids of the passion fruit seed extract are greater than 350 μg / mL. In some embodiments, the concentration of ferulic acid putrescine in the passion fruit seed extract is greater than 100 ppm.
[0031] In some embodiments, the passion fruit seed extract contains at least one of the following components: feruloylputrescin, 4-glucosylvanillic acid, 6-butyl citrate, 1,6-dimethyl citrate, 1-butyl malicate, daidzein, (5-Hydroxymethyl-furylidene)-malonic acid, genistein, Thunberginol C8-O-β-D-glucopyranoside, adenosine, guanosine, pyroglutamic acid, and protocatechuic acid. 1,2,3,4-tetrahydro-β-carboline-3-carboxylic acid.
[0032] The structural formulas of the above-mentioned components are shown in Table 1 below:
[0033] Table 1 TCI-PE-01 Ferula-nitrofuran TCI-PE-02 4-Glucosylvanillic acid TCI-PE-03 6-Butyl citrate TCI-PE-04 1,6-Dimethyl Citric Acid TCI-PE-05 1-Butyl malate TCI-PE-06 (5-Hydroxymethyl-furylidene)-malonic acid TCI-PE-07 Thunberginol C 8-O-β-D-glucopyranoside TCI-PE-08 adenosine TCI-PE-09 Guanosine TCI-PE-10 pyropronic acid TCI-PE-11 1,2,3,4-Tetrahydro-β-carboline-3-carboxylic acid TCI-PE-12 Protocatechuic acid TCI-PE-13 Gentian isoflavones TCI-PE-14 Soy isoflavones
[0034] In some embodiments, genistein can promote the expression of the TPH1 gene. In some embodiments, asoflavone, guanosine, and soy isoflavones can all promote the expression of the AANAT gene. In some embodiments, asoflavone and soy isoflavones can both promote the expression of the ASMT gene. In some embodiments, genistein and soy isoflavones can both promote the expression of the DDC gene.
[0035] In other words, passion fruit seed extract and its bioactive substances can improve sleep quality by increasing the expression of the above-mentioned genes and promoting the content of serotonin or melatonin.
[0036] In some embodiments, passion fruit seed extract is used to increase the level of intracellular γ-aminobutyric acid (GABA). In some embodiments, passion fruit seed extract is used to increase the level of serotonin in the blood. In some embodiments, passion fruit seed extract is used to increase the proportion of deep sleep. In some embodiments, passion fruit seed extract is used to reduce the degree of sleep disturbance. In some embodiments, passion fruit seed extract is used to help with falling asleep.
[0037] In some embodiments, the effective amount of passion fruit seed extract is 5 grams per day.
[0038] In some embodiments, the aforementioned composition may be a pharmaceutical product. In other words, this pharmaceutical product contains an effective amount of passion fruit seed extract.
[0039] In some embodiments, the aforementioned pharmaceutical products may be manufactured into a dosage form suitable for enteral or oral administration using techniques known to those skilled in the art. These dosage forms include, but are not limited to: tablets, troche, lozenges, pills, capsules, dispersible powders or granules, solutions, suspensions, emulsions, syrups, elixirs, slurries, and the like.
[0040] In some embodiments, the aforementioned pharmaceutical product may be manufactured using techniques known to those skilled in the art into a dosage form suitable for parenterally or topically administration, including, but not limited to, injections, sterile powders, external preparations, and the like. In some embodiments, the pharmaceutical product may be administered via a parenteral route selected from the group consisting of: subcutaneous injection, intraepidermal injection, intradermal injection, and intralesional injection.
[0041] In some embodiments, the pharmaceutical product may further comprise a pharmaceutically acceptable carrier that is widely used in pharmaceutical manufacturing techniques. For example, a pharmaceutically acceptable carrier may comprise one or more of the following agents: solvent, buffer, emulsifier, suspending agent, decomposer, disintegrating agent, dispersing agent, binding agent, excipient, stabilizing agent, chelating agent, diluent, gelling agent, preservative, wetting agent, lubricant, absorption delaying agent, liposome, and the like. The selection and quantity of these agents fall within the scope of professional competence and routine practice of those skilled in the art.
[0042] In some embodiments, the pharmaceutically acceptable carrier comprises a solvent selected from the group consisting of: water, normal saline, phosphate buffered saline (PBS), and an aqueous solution containing alcohol.
[0043] In some embodiments, the aforementioned composition may be an edible composition. In some embodiments, this edible composition may be made into a food product or may be a food additive, that is, added during the preparation of ingredients by conventional methods to obtain a food product, or added during the production of a food product. Here, the food product may be a product formulated with edible materials for human or animal consumption.
[0044] In some embodiments, the food products may be, but are not limited to: beverages, fermented foods, bakery products, health foods, and dietary supplements.
[0045] Example 1: Preparation of Passionflower Seed Extract
[0046] First, using the Tainong No. 1 variety of passion fruit produced in Taiwan, after removing the outer skin and fruit juice, the remaining dried black seeds and the white aril covering the seeds are crushed to obtain passion fruit seed raw materials. Here, an Osterizer brand 10-speed blender homogenizer is used, with the coarse grinding aperture set to 12mm for crushing.
[0047] Next, a low-temperature fermentation step S10 is performed. Using water as a solvent, the water is heated to 50±5℃, and then passion fruit seed material and β-glucanase (purchased from Hengzhou Industrial Co., Ltd.) are added. The ratio of passion fruit seed material to water is 1:5 by weight, and 0.1% β-glucanase is added (relative to water). After mixing the passion fruit seed material, water, and β-glucanase, extraction is maintained at 50±5℃ for 60 minutes to obtain the fermentation liquid.
[0048] Next, the heating water extraction step S20 is carried out. The temperature of the fermentation liquid is raised to 85±5℃ and maintained for at least 60 minutes. When the sugar content reaches greater than 0.7Brix°, the heating water extraction step S20 is considered to be completed and the extract is obtained.
[0049] Subsequently, a filtration step S30 is performed, in which the extract is passed through a 400-mesh sieve to form a filtrate. Next, a concentration step S40 is performed, in which the filtrate is concentrated under reduced pressure using a BUCHI-Rotavapor R-100 vacuum concentration device at a set temperature of 60±5℃ and a pressure of 1±0.2 kg / cm2 to obtain a primary extract.
[0050] Finally, a re-filtration step S410 is performed, in which the initial extract is passed through a 400-mesh sieve to remove solids, then filtered through a filter bag (5µm pore size), and then filtered again through a filter cartridge (5µm pore size) to obtain passion fruit seed extract.
[0051] Example 2: Passionflower seed extract promotes GABA secretion test
[0052] GABA, short for γ-aminobutyric acid, increases in the level of GABA in brain nerve cells during deep sleep. Stabilizing the brain's GABA levels also helps combat depression and promote sleep. However, due to the blood-brain barrier, the efficiency of directly consuming GABA is very low. If nerve cells can synthesize GABA themselves, it can be unaffected by the blood-brain barrier.
[0053] Materials and Equipment Specifications:
[0054] Cell line: Human neuroblastoma cell (SH-SY5Y), obtained from the American Center for Standard Biological Collections (ATCC) with preservation number Cat. CRL-2266, hereinafter referred to as neuroblastoma cell.
[0055] Cell culture medium: Dulbecco's Modified Eagle Medium (DMEM, hereinafter referred to as MEM medium) (Gibco, No. 12100-046) is a minimum essential medium supplemented with 10% fetal bovine serum (FBS; Thermo, No. 10437-028) and 1% penicillin-streptomycin (Antibiotic-Antimycotic) (Thermo, Cat. 15240062).
[0056] The ELISA Kit for GammaAminobutyric Acid (gABA) (CEA900Ge) contains GABA.
[0057] Solvents: 1X DPBS (Gibco, Cat. 14200-075), cell lysis buffer (Thermo, Cat. FNN0011).
[0058] Test Procedure:
[0059] First, fibroblasts were implanted into 24-well cell culture dishes at a density of 1:104, with each well containing 0.5 ml of cell culture medium, and cultured in a carbon dioxide incubator at 37°C for 24 hours.
[0060] Fibroblasts were divided into experimental group A, experimental group B, control group A, control group B and blank group. The cell culture medium of each group was removed and replaced with 500 μl / well test medium, and then cultured at 37°C for 24 hours.
[0061] The test culture medium for experimental group A was a cell culture medium containing 0.25% passion fruit seed extract obtained in Example 1.
[0062] The test culture medium for experimental group B was a cell culture medium containing 0.5% passion fruit seed extract obtained in Example 1.
[0063] The test culture medium for control group A was a cell culture medium containing 0.25% γ-aminobutyric acid (GABA) from the test kit.
[0064] The test culture medium for control group B was a cell culture medium containing 0.5% γ-aminobutyric acid (GABA) from the test kit.
[0065] The experimental culture medium for the blank group was a simple cell culture medium.
[0066] After removing the supernatant from each group, the culture plates were washed twice with 1XDPBS, and cell lysis buffer was added to lyse the cells. The cells were centrifuged at 13000 rpm for 5 minutes at 4°C, and the supernatant was collected and stored in 1.5 mL microcentrifuge tubes. The GABA content in each group was obtained using a γ-aminobutyric acid (GABA) assay, and the results are shown in Figure 2.
[0067] The GABA content shown in the graph is presented as a relative proportion. The standard deviation was calculated using the STDEV formula in Excel, and a one-tailed Student's t-test was used in Excel to analyze whether there was a statistically significant difference. In the graph, "*" represents a p-value less than 0.05, and "**" represents a p-value less than 0.01. The more "*" there are, the more significant the statistical difference.
[0068] Please refer to Figure 2. The values of the blank group are considered as 100%. Compared with the blank group, the GABA content of experimental group A is 126.7%, the GABA content of experimental group B is 133.7%, the GABA content of control group A is 118.1%, and the GABA content of control group B is 138.4%. All groups have statistically significant differences.
[0069] In other words, direct addition of GABA in the control group can promote the secretion of more GABA by human nerve cells, while passion fruit seed extract can also significantly promote the secretion of GABA by human nerve cells. Therefore, it can be concluded that passion fruit seed extract can improve sleep quality in humans.
[0070] Example 3: Human testing of passion fruit seed extract
[0071] Subjects: 11 subjects (5 in the placebo group and 6 in the experimental group). All subjects had sleep disorders. That is, this test selected people with sleep quality ≥8 (Pittsburgh Sleep Quality Index).
[0072] Test items: expression level of DDC gene related to tryptophan metabolism, deep sleep state, degree of sleep disorder (Pittsburgh Sleep Quality Index), self-assessment questionnaire and overall assessment.
[0073] Among them, the expression of the DDC gene can promote the conversion of tryptophan into melatonin, meaning that increased expression of the DDC gene can improve sleep disorders. Here, the expression level of the tryptophan metabolism-related gene DDC is determined by collecting blood from the subjects and sending it to a professional company, DaJiang Gene Medical Co., Ltd., for testing.
[0074] Among them, the deep sleep state is assessed based on arm activity variables and heart rate to determine the ratio of deep sleep to light sleep. During deep sleep, arm activity is low and heart rate is relatively stable. Therefore, a smart bracelet (Xiaomi Mi Band Photosensitive Edition) is used to monitor changes in arm activity variables and heart rate using its built-in accelerometer and photoelectric heart rate sensor.
[0075] The degree of sleep disorder is quantified using the final score of the Pittsburgh Sleep Quality Index. The Pittsburgh Sleep Quality Index (PSQI) is a self-report questionnaire used to assess sleep quality over a month. The test consists of 18 self-report items comprising 7 components. Each component is scored on a scale of 0 to 3, and the total score is calculated by accumulating the scores of all components. The total score ranges from 0 to 21; a higher score indicates poorer sleep quality.
[0076] Subjects completed a sensory questionnaire before the start of the test (week 0) and at the end of the test (week 4). The questionnaire surveyed the six subjects in the experimental group regarding the following sleep conditions, and the survey and scoring methods are shown in Table 2 below. Each score represents the frequency of occurrence of each condition: 0 points indicates never occurring, 1 point indicates less than once per week, 2 points indicates one to two times per week, and 3 points indicates three or more times per week. Higher scores indicate poorer sleep quality.
[0077] Table 2 Symptoms / Score 0 1 2 3 Question 1. Unable to fall asleep within 30 minutes. Question 2. Waking up in the middle of the night or early morning. Question 3. Do you need to get up to urinate during sleep? Question 4. Difficulty breathing Question 5. Coughing or loud snoring Question 6 feels very cold. Question 7 feels very hot. Question 8: Having nightmares
[0078] The overall evaluation was conducted on the six participants in the experimental group, focusing on two aspects: "feeling easier to fall asleep" and "feeling an improvement in overall sleep quality." The options were categorized into four levels: unsatisfactory, acceptable, satisfactory, and very satisfied.
[0079] Testing Method:
[0080] Six subjects in the experimental group drank a beverage containing 5 grams of passion fruit seed extract two hours before bedtime each day, while five subjects in the placebo group drank a placebo beverage without passion fruit seed extract two hours before bedtime each day, for a total of 4 weeks. Measurements were taken before drinking (i.e., week 0, also known as the control group) and after 4 weeks of drinking (i.e., week 4, also known as the experimental group).
[0081] Test Results:
[0082] The figures below show the mean values of the subjects. The standard deviation was calculated using the STDEV formula in Excel, and a one-tailed Student's t-test was used in Excel to analyze whether there was a statistically significant difference. In the figures, "*" indicates a p-value less than 0.05, "**" indicates a p-value less than 0.01, and "***" indicates a p-value less than 0.001, representing a statistically significant difference.
[0083] Please refer to Figure 3. After four weeks of daily administration of passion fruit seed extract, the average DDC gene expression level in the six experimental group subjects increased from 1 (week 0) to 3.27 (week 4). In contrast, the average DDC gene expression level in the placebo group increased from 1 to 2.07. This indicates that the experimental group showed a 3.27-fold increase compared to the control group and a 1.2-fold increase compared to the placebo group. In other words, even after adjusting for the placebo effect, daily administration of passion fruit seed extract can increase DDC gene expression, thus achieving a sleep-inducing effect.
[0084] Please refer to Figure 4. After 4 weeks of daily administration of passion fruit seed extract, the average percentage of deep sleep in the 6 subjects in the experimental group increased from 28.5% (week 0) to 39.3% (week 4). The average percentage of deep sleep in the placebo group increased slightly from 19.4% to 24.8%. It can be seen that the experimental group showed a 10.8% improvement compared to the control group, and also had a higher percentage of deep sleep. This means that even after deducting the placebo effect, daily administration of passion fruit seed extract can improve sleep quality.
[0085] Please refer to Figure 5. After 4 weeks of daily administration of passion fruit seed extract, the average sleep disturbance level of the 6 subjects in the experimental group decreased from 100% (week 0) to 46.4% (week 4). In contrast, the average sleep disturbance level in the placebo group decreased from 100% to 77.1%. This shows a significant reduction of 53.6% in the experimental group compared to the control group, and also a 30.6% reduction compared to the placebo group. In other words, even after adjusting for the placebo effect, daily administration of passion fruit seed extract can reduce sleep disturbances and disorders.
[0086] Refer to Figure 6. Regarding the situation described in question 1, where it is difficult to fall asleep within 30 minutes, the average score of the subjects decreased from 2.3 to 0.8, meaning that the subjects' self-reported difficulty falling asleep was less than once a week. Regarding the situation described in question 2, where it is easy to wake up in the middle of the night or early morning, the average score of the subjects decreased from 2.5 to 1.5. Regarding the situation described in question 3, where it is necessary to get up to urinate during sleep, the average score of the subjects decreased from 2.0 to 1.3. Regarding the situation described in question 4, where it is difficult to breathe, the average score of the subjects decreased from 1 to 0.5. Regarding the situation described in question 5, where it is coughing or snoring loudly, the average score of the subjects decreased from 1.5 to 1.2. Regarding the situation described in question 6, where it is very cold, the average score of the subjects decreased from 1.2 to 0.3. Regarding the situation described in question 7, where it is very hot, the average score of the subjects decreased from 1.0 to 0.7. In the case of nightmares described in question 8, the average score of the subjects dropped from 1.8 to 0.7.
[0087] As can be seen from the above, the average score of each item has decreased, which means that, on average, each subject has shown significant improvement in the above symptoms.
[0088] Refer to Figure 7. Regarding the self-report of "feeling easier to fall asleep," 2 out of 6 participants in the experimental group were very satisfied, and 4 were satisfied. Similarly, regarding the self-report of "feeling an overall improvement in sleep quality," 2 out of 6 participants in the experimental group were very satisfied, and 4 were satisfied. It can be seen that no participants reported being dissatisfied or satisfied, meaning that all 100% of the participants in the experimental group felt that passion fruit seed extract helped improve sleep quality, resulting in a high level of satisfaction.
[0089] Example 4: Analysis of bioactive components in passion fruit seed extract
[0090] Natural plant extracts typically contain multiple components and are not pure substances. Different compounds have different solubilities in different solvents. This experiment uses immiscible solvents to transfer a specific component from passion fruit seed extract to another solvent.
[0091] The equipment, instrumentation, setting methods, and equipment source are described below:
[0092] (1)Nuclear Magnetic Resonance Spectrometer (NMR). 1D and 2D spectra were obtained using an Ascend 400 MHz, Bruker Co., Germany, with δ representing chemical shift in ppm.
[0093] (2)Mass Spectrometer (MS) Tandem Mass Spectrometry-Two-Dimensional Ion Trap Tandem Fourier Transform Mass Spectrometry and ESI-MS / MS: Measured using Bruker amaZon SL system, unit is m / z.
[0094] (3)Medium pressure liquid chromatography (MPLC): CombiFlash® Rf+, Teledyne ISCO, Lincoln, NE; High performance liquid chromatography (HPLC): High performance liquid chromatography (HPLC) is Agilent 1200 series; Degassing device is Agilent vacuum degassing device 1322A; Extraction solvent delivery device is Agilent quaternary pump G1311A; Variable wavelength detector (MWD) is Agilent G1314B; Diode Array Detector (DAD) is Agilent 1260 Infinity DAD VL G1315D, with detection wavelengths of 210nm, 280nm, 320nm, and 365nm (Agilent Germany).
[0095] (4)Reversed-phase analytical column (RP-HPLC column): Luna® 5μm C18 (2) 100 Å (250 x 10 mm, Phenomenex, USA).
[0096] (5)The column chromatography packing materials were selected from: Sephadex LH-20 (Pharmacia, Piscataway, NJ, USA), Diaion HP-20 (Mitsubishi Chemical Co., Japan), Merck Kieselgel 60 (40-63 um, Art. 9385), and Merck LiChroprep® RP-18 (40-63 um, Art. 0250).
[0097] (6)Thin-Layer Chromatography was performed using TLC aluminum sheets (Silica gel 60 F254, 0.25 mm, Merck, Germany) and TLC aluminum sheets (RP-18 F254-S, 0.25 mm, Merck, Germany).
[0098] (7)Ultraviolet lamp: UVP UVGL-25, with wavelengths of 254nm and 365nm.
[0099] (8) Description of the solvents used and their sources: n-hexane, ethyl acetate, acetone, methanol, ethanol, acetonitrile (purchased from Merck Taiwan), chloroform-d1 (deuteration degree 99.5%), methanol-d4 (deuteration degree 99.5%), deuterium oxide (deuteration degree > 99.8%), and dimethyl sulfoxide-d6 (deuteration degree > 99.9%) (Merck Taiwan).
[0100] Refer to Figure 8. First, 10 liters (L) of passion fruit seed extract obtained in Example 1 were separated by ethyl acetate liquid phase partitioning to obtain an ethyl acetate extract and an aqueous primary extract. The aqueous primary extract was then separated by n-butanol liquid phase partitioning to obtain an n-butanol extract and an aqueous extract. Therefore, low-polarity substances are in the ethyl acetate extract, high-polarity substances are in the n-butanol extract, and water-soluble substances remain in the aqueous extract.
[0101] Next, the ethyl acetate layer extract was concentrated and dried under reduced pressure to obtain 4.6 g of ethyl acetate layer extract (EAF). The n-butanol layer extract was concentrated and dried under reduced pressure to obtain 28.4 g of n-butanol layer extract (BUF). The aqueous layer extract was concentrated and dried under reduced pressure to obtain 89.7 g of aqueous layer extract (WF).
[0102] It can be calculated that 10 liters (L) of passion fruit seed extract can be separated and extracted to obtain a total of 122.7 grams of powdered extract, of which ethyl acetate layer extract (EAF) accounts for 3.7%, n-butanol layer extract (BUF) 23.1% and water layer extract (WF) 73.2%.
[0103] Therefore, further analysis was conducted on the n-butanol layer extract and the aqueous layer extract, which accounted for a relatively high proportion.
[0104] Continue to refer to Figure 8. First, the n-butanol layer extract was subjected to macroporous resin column chromatography (Diaion HP-20 column chromatography) using a bioassay guided fractionation method with water, 50% methanol aqueous solution and methanol as the extraction solution to obtain three separation fractions: BUF1, BUF2 and BUF3.
[0105] Among them, BUF2 and BUF3 separation sections were further separated by RP-MPLC, and extracted sequentially with water to methanol. Thin-layer chromatography was then used to combine extracts with similar results. The second separation section (BUF2) yielded 8 sub-separation sections, namely BUF2-1, BUF2-2, BUF2-3, BUF2-4, BUF2-5, BUF2-6, BUF2-7 and BUF2-8. The BUF3 separation section yielded 3 sub-separation sections, namely BUF3-1, BUF3-2 and BUF3-3.
[0106] The BUF2-2 separation section was purified by reversed phase high performance liquid chromatography (RP-HPLC) (volume ratio of methanol / water = 1 / 19) to obtain the bioactive substance TCI-PE-03. After analyzing its chemical structure by hydrogen nuclear magnetic resonance spectroscopy (1H-NMR) and electrospray ionization mass spectrometry (ESIMS), it was confirmed to be 6-Butyl citrate.
[0107] The BUF2-3 separation section was purified by RP-HPLC (volume ratio of methanol / water = 1 / 9) to obtain the bioactive substances TCI-PE-06 and TCI-PE-10. After analyzing their chemical structures by hydrogen nuclear magnetic resonance spectroscopy (1H-NMR) and electrospray ionization mass spectrometry (ESIMS), it was confirmed that TCI-PE-06 is (5-Hydroxymethyl-furylidene)-malonic acid and TCI-PE-10 is pyroglutamic acid.
[0108] The BUF2-4 separation section was purified by RP-HPLC (volume ratio of methanol / water = 1 / 9) to obtain bioactive substances TCI-PE-08, TCI-PE-09 and TCI-PE-12. After analyzing their chemical structures by hydrogen nuclear magnetic resonance spectroscopy (1H-NMR) and electrospray ionization mass spectrometry (ESIMS), it was confirmed that TCI-PE-08 is adenosine, TCI-PE-09 is guanosine and TCI-PE-12 is protocatechuic acid.
[0109] The BUF2-5 separation fractions were purified by RP-HPLC (methanol / water volume ratio = 3 / 17) to obtain bioactive substances TCI-PE-02, TCI-PE-04 and TCI-PE-05. After analyzing their chemical structures by 1H-NMR and electrospray ionization mass spectrometry (ESIMS), 4-glucosyl vanillic acid was confirmed, TCI-PE-04 was 1,6-dimethyl citrate and TCI-PE-05 was 1-butyl malate.
[0110] The BUF2-6 separation section was purified by RP-HPLC (volume ratio of methanol / water = 1 / 4) to obtain the bioactive substance TCI-PE-01. After analyzing its chemical structure by hydrogen nuclear magnetic resonance spectroscopy (1H-NMR) and electrospray ionization mass spectrometry (ESIMS), TCI-PE-01 was confirmed to be feruloylputrescin.
[0111] The BUF2-7 separation section was purified by RP-HPLC (volume ratio of methanol / water = 3 / 7) to obtain the bioactive substances TCI-PE-07 and TCI-PE-011. After analyzing their chemical structures by 1H-NMR and electrospray ionization mass spectrometry (ESIMS), TCI-PE-07 was confirmed to be Thunberginol C8-O-β-D-glucopyranoside and TCI-PE-11 was 1,2,3,4-tetrahydro-β-carboline-3-carboxylic acid.
[0112] The BUF3-2 separation section was purified by RP-HPLC (volume ratio of methanol / water = 3 / 2) to obtain the bioactive substance TCI-PE-13. After analyzing its chemical structure by hydrogen nuclear magnetic resonance spectroscopy (1H-NMR) and electrospray ionization mass spectrometry (ESIMS), TCI-PE-13 was confirmed to be genistein.
[0113] The BUF3-3 separation section was purified by RP-HPLC (volume ratio of methanol / water = 7 / 3) to obtain the bioactive substance TCI-PE-14. After analyzing its chemical structure by hydrogen nuclear magnetic resonance spectroscopy (1H-NMR) and electrospray ionization mass spectrometry (ESIMS), TCI-PE-14 was confirmed to be a soybean isoflavone (Daidzein).
[0114] It is known that the passion fruit seed extract contains ferulinyl putrescine (TCI-PE-01), 4-glucosylvanillic acid (TCI-PE-02), 6-butyl citrate (TCI-PE-03), 1,6-dimethyl citrate (TCI-PE-04), 1-butyl malate (TCI-PE-05), (5-Hydroxymethyl-furylidene)-malonic acid (TCI-PE-06), and Thunberginol C8-O-β-D-glucopyranoside. Bioactive substances such as (TCI-PE-07), adenosine (TCI-PE-08), guanosine (TCI-PE-09), pyroproline (TCI-PE-10), 1,2,3,4-tetrahydro-beta-carboline-3-carboxylic acid (TCI-PE-11), protocatechuic acid (TCI-PE-12), genistein (TCI-PE-13), and soy isoflavones (TCI-PE-14).
[0115] Example 5: Test on the expression of genes related to the promotion of melatonin production by bioactive substances in passion fruit seed extract
[0116] The expression of the ASMT gene (GeneID: 438) can promote the increase of N-acetylserotonin O-methyltransferase-like protein, which is an enzyme involved in the conversion of serotonin to melatonin. The expression of the AANAT gene (GeneID: 25120) can promote the increase of aralkylamine N-acetyltransferase, which is involved in the conversion of serotonin to melatonin.
[0117] Instruments, Equipment and Materials:
[0118] Cell line: Human neuroblastoma cell (SH-SY5Y, ATCC, Cat. CRL-2266), hereinafter referred to as neuroblastoma cell.
[0119] Cell culture medium: Dulbecco's Modified Eagle Medium (DMEM, hereinafter referred to as MEM medium) (Gibco, No. 12100-046) is a minimum essential medium supplemented with 10% fetal bovine serum (FBS; Thermo, No. 10437-028) and 1% penicillin-streptomycin (Antibiotic-Antimycotic) (Thermo, Cat. 15240062).
[0120] Test Procedure:
[0121] Two x 10⁵ nerve cells were seeded into each well in a 6-well dish. After culturing for 24 hours, the cells were divided into groups. The blank group was supplemented with culture medium only. The other 14 experimental groups were each supplemented with 100 µM of the bioactive substance TCI-PE-01 to TCI-PE-14 purified from passion fruit seed extract. The cells were then cultured for 48 hours.
[0122] Neuronal cells from each group were collected separately, and RNA was collected from the cell solutions of both groups using an RNA extraction reagent kit (Geneaid, Taiwan, Lot No. FC24015-G). Then, 1000 ng of the extracted RNA from each group was used as a template, and reverse transcription was performed using SuperScript® III reverse transcriptase (Invitrogene, USA, catalog number 18080-051) with primer binding to produce the corresponding cDNA. Subsequently, the reverse transcription products from both groups were subjected to quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) using the primer combinations listed in Table 3 below, using an ABI StepOnePlus™ Real-Time PCR system (Thermo Fisher Scientific, USA) and a KAPA SYBR FAST (Sigma, USA, catalog number 38220000000) to observe the gene expression levels in the neuronal cells of the experimental and control groups. The instrument settings for quantitative real-time reverse transcription polymerase chain reaction (RTRP) were 95°C for 1 second, 60°C for 20 seconds, for a total of 40 loops, and gene quantification was performed using the 2-ΔCt method. Thus, quantitative real-time RRP using cDNA can indirectly quantify the mRNA expression level of each gene, thereby inferring the expression level of the protein encoded by each gene. Table 3
[0123] target gene Introduction Name Serial Number sequence length ASMT ASMT-F SEQID NO:1 TACGAGGAAACGAAGGTGAAGTT ASMT-R SEQ ID NO: 2 CCGTAGCCGCCAGCTTT AANAT AANAT-F SEQ ID NO: 3 AACGTCATGACCCCTCAGAAGT AANAT-R SEQ ID NO: 4 ATTCACTGTGCCTCACCCTGTA TPH1 TPH1-F SEQ ID NO: 5 AAATATTGTGGATATCGGGAGGATAA TPH1-R SEQ ID NO: 6 AGGACGGATGGAAAAACCTGTA DDC DDC-F SEQ ID NO: 7 ACCACAACATGCTGCTCCTTT DDC-R SEQ ID NO: 8 ATCAACGTGCAGCCATATGTCT
[0124] Subsequently, the relative expression level of the target gene was determined using the 2-ΔΔCT method. The relative expression level was defined as the fold change in RNA expression level of the target gene in the experimental group (containing one of the bioactive substances from passion fruit seed extract) relative to the same gene in the control group. An unpaired one-tailed Student-t test was then performed using Excel to determine the coefficient of variation and whether there was a statistically significant difference (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001). The results are shown in Figures 9 to 12. To simplify the figures, only groups with statistically significant differences are listed in each figure.
[0125] Test Results:
[0126] First, referring to Figure 9, when the expression level of the TPH1 gene in the blank group is considered as 1, the expression level of the TPH1 gene in the TCI-PE-13 experimental group is 4.64 compared to the blank group. That is to say, compared with the blank group, genistein can significantly promote the expression level of the TPH1 gene.
[0127] Referring to Figure 10, when the expression level of the AANAT gene in the blank group is considered as 1, the expression level of the AANAT gene in the TCI-PE-01 experimental group relative to the blank group is 2.94, the expression level of the AANAT gene in the TCI-PE-09 experimental group relative to the blank group is 1.69, and the expression level of the AANAT gene in the TCI-PE-14 experimental group relative to the blank group is 2.99. That is to say, compared with the blank group, asofenzyme putrescine, guanosine and soy isoflavones can all promote the increase of the expression level of the AANAT gene.
[0128] Referring to Figure 11, when the expression level of the ASMT gene in the blank group is considered as 1, the expression level of the ASMT gene in the TCI-PE-01 experimental group relative to the blank group is 1.49, and the expression level of the ASMT gene in the TCI-PE-14 experimental group relative to the blank group is 2.4. That is to say, compared with the blank group, both ferulin and soy isoflavones can promote the increase of ASMT gene expression.
[0129] Referring to Figure 12, when the expression level of the DDC gene in the blank group is considered as 1, the expression level of the DDC gene in the TCI-PE-13 experimental group relative to the blank group is 18.77, and the expression level of the DDC gene in the TCI-PE-14 experimental group relative to the blank group is 10.77. That is to say, compared with the blank group, both genistein and soy isoflavones can promote the increase of the expression level of the DDC gene.
[0130] Example 6: HPLC analysis of fingerprint chromatograms of passion fruit seed extract and passion fruit juice
[0131] Hereinafter, high performance liquid chromatography (HPLC) was used to perform quantitative and qualitative analysis on the bioactive substances in the passion fruit seed extract and passion fruit juice prepared in Example 1.
[0132] Hereinafter, passion fruit seed extract refers to the passion fruit seed extract prepared according to Example 1, the extraction source of which is the seeds of passion fruit and the aril covering the seeds. Passion fruit juice (purchased from Zhengwangle Co., Ltd., product name: Passion Fruit Seedless Juice) refers to the juice contained in the passion fruit, that is, the extraction source does not include the seeds and the aril covering the seeds.
[0133] The solvents used in this test were methanol and water, with 0.1% formic acid added to each of the methanol and water. The flow rate was set to 1 ml / min, and the extraction conditions were set as follows: methanol:water = 2:98 at 0 minutes, methanol:water = 2:98 at 10 minutes, methanol:water = 70:30 at 40 minutes, methanol:water = 100:0 at 50 minutes, and methanol:water = 100:0 at 60 minutes.
[0134] Refer to Figure 13. The peaks of bioactive substances TCI-PE-03, TCI-PE-10 and TCI-PE-05 were resolved at a time of 0 to 10 minutes; the peaks of bioactive substances TCI-PE-04, TCI-PE-02, TCI-PE-09, TCI-PE-08 and TCI-PE-12 were resolved at a time of 10 to 20 minutes; the peaks of bioactive substances TCI-PE-06, TCI-PE-01 and TCI-PE-11 were resolved at a time of 20 to 30 minutes; and the peaks of bioactive substances TCI-PE-07, TCI-PE-13 and TCI-PE-14 were resolved at a time of 30 to 40 minutes.
[0135] Meanwhile, according to the HPLC quantitative analysis results, the content of TCI-PE-01 bioactive substance in the passionflower seed extract was 222 ppm. That is, the passionflower seed extract contains at least 222 ppm of ferulic acid putrescine.
[0136] Refer to Figure 14. In this figure, the fingerprint spectra of passion fruit seed extract and passion fruit juice are placed in the upper and lower positions for comparison. First, observing the peaks of their lines reveals a clear difference; the fingerprint spectra of passion fruit juice in the lower figure do not show the peak of the TCI-PE-01 bioactive substance. That is to say, the composition of the passion fruit seed extract in this case is significantly different from that of ordinary passion fruit juice.
[0137] In summary, the passion fruit seed extract of any embodiment can be used to prepare a composition that promotes sleep quality. The passion fruit seed extract of any embodiment can be used to prepare a composition that increases intracellular γ-aminobutyric acid (GABA) levels, increases blood serotonin levels, reduces sleep disturbances, and helps with falling asleep. The passion fruit seed extract obtained by the preparation method of any embodiment includes the compound N-feruloylputrescine, and N-feruloylputrescine can promote serotonin levels and melatonin production.
[0138] Although the technical content of the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any modifications and refinements made by those skilled in the art without departing from the spirit of the present invention should be included within the scope of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims. [Simplified Explanation of the Diagram]
[0017] Figure 1 is a flowchart of a method for preparing passion fruit seed extract according to an embodiment. Figure 2 is a bar graph showing the results of promoting GABA expression with passion fruit seed extract according to an embodiment. Figure 3 is a bar graph showing the relative expression of the DDC gene in human tests. Figure 4 is a bar graph showing the percentage of deep sleep in human tests. Figure 5 is a bar graph showing the degree of sleep disorder in human tests. Figure 6 is a bar graph showing the questionnaire score results in human tests. Figure 7 is a pie chart showing the overall score results in human tests. Figure 8 is a system diagram of a bioactive guided separation method for passion fruit seed extract according to an embodiment. Figure 9 is a bar graph showing the results of promoting TPH1 gene expression. Figure 10 is a bar graph showing the results of promoting AANAT gene expression. Figure 11 is a bar graph showing the results of promoting ASMT gene expression. Figure 12 is a bar graph showing the results of promoting DDC gene expression. Figure 13 is a fingerprint analysis map of passion fruit seed extract according to an embodiment. Figure 14 is a comparison map of fingerprint analysis maps of passion fruit seed extract and passion fruit juice.
Claims
1. The use of a passion fruit seed extract for preparing a composition that enhances deep sleep, wherein the passion fruit seed extract is obtained by fermentation of passion fruit (Passiflora edulis) seeds and the aril covering the seeds, using water with added complex cellulase as a solvent, followed by heating to obtain the passion fruit seed extract. The complex cellulase is β-glucanase. The heating refers to heating the water to 80°C~100°C for at least 60 minutes to obtain the passion fruit seed extract. The enhancement of deep sleep is achieved by increasing the intracellular content of γ-aminobutyric acid (GABA).
2. The use as described in claim 1, wherein the effective dosage of the passion fruit seed extract is 5 grams per day.
3. The use as described in claim 1, wherein the passionflower seed extract is used to improve the rate of sleep interruption.
4. The use as described in claim 1, wherein the passionflower seed extract is used to reduce the degree of sleep disturbance.
5. Use of a passion fruit seed extract in the preparation of a composition to aid sleep, wherein the passion fruit seed extract is obtained by fermentation of passion fruit (Passiflora edulis) seeds and the aril covering the seeds, using water with added complex cellulase as a solvent, followed by heating to obtain the passion fruit seed extract, wherein the complex cellulase is β-glucanase, and the heating refers to heating the water to 80°C~100°C for at least 60 minutes to obtain the passion fruit seed extract, wherein the aid to sleep is achieved by increasing the intracellular content of γ-aminobutyric acid (GABA).
6. The use as described in claim 5, wherein the effective dosage of the passionflower seed extract is 5 grams per day.
7. The use as described in claim 5, wherein the passionflower seed extract is used to reduce the frequency of difficulty falling asleep.
8. The use as described in claim 5, wherein the passionflower seed extract is used to reduce the degree of sleep disturbance.
Citation Information
Patent Citations
Use of passion fruit seed extracts for upregulating gene expression of tph1, ddc, and aanat
TWI719503B