Site-specific recombinases for efficient and specific genome editing

Abstract

This invention relates to the field of genome editing and provides a method for producing DNA recombinase or provides a DNA recombinase that, as an obligate DNA recombinase enzyme, can efficiently and specifically recombine genomic target sequences. This invention provides a genetically engineered DNA recombinase enzyme comprising a complex of first and second recombinase enzymes, wherein the first and second recombinase enzymes specifically recognize a first and a second half-site of an upstream target site and / or a downstream target site of the DNA recombinase, wherein each of the first and second recombinase enzymes contains at least one mutation at its catalytic site, wherein the first and second recombinase enzymes carrying the at least one mutation at their respective catalytic sites, when acted alone, do not exhibit DNA recombinase catalytic activity, and wherein the first and second DNA recombinase enzymes carrying the at least one mutation at their respective catalytic sites, when acted together and forming a complex, exhibit DNA recombinase catalytic activity. This invention further relates to the encoding of the genetically engineered DNA recombinase and the complex nucleic acid molecule, and pharmaceutical compositions comprising them. This invention further provides the medical use of the genetically engineered DNA recombinase, complex, nucleic acid molecule, and pharmaceutical composition, particularly for the treatment of hereditary diseases such as hemophilia A.

Description

Location-specific recombinases for efficient and specific genome editing This invention generally relates to the field of genome editing and provides a DNA recombinase that efficiently and specifically recombines target sequences of the genome as an obligate DNA recombinase. More specifically, this invention provides a genetically engineered DNA recombinase for efficient and specific genome editing, the DNA recombinase comprising an obligate recombinase complex, wherein the complex comprises at least one first recombinase enzyme and at least one second recombinase enzyme, wherein the first recombinase enzyme and the second recombinase enzyme specifically recognize a first half-site and a second half-site of an upstream target site and / or a downstream target site of a DNA recognition site of the DNA recombinase; wherein each of the first recombinase enzyme and the second recombinase enzyme contains at least one mutation at a catalytic site, wherein the first recombinase enzyme and the second recombinase enzyme carrying the at least one mutation at the catalytic site do not exhibit the same catalytic activity of the DNA recombinase when acted alone; and wherein, in the obligate recombinase complex, the catalytic activities of the DNA recombinase are complementary. This invention also discloses a specific recombinase complex that catalyzes the recombination of a DNA sequence located in the int1h region of the human X chromosome. The invention further relates to a nucleic acid molecule encoding the genetically engineered DNA recombinase and the specific complex, and the use of the genetically engineered DNA recombinase, the specific complex, and the nucleic acid molecule in genome editing. Furthermore, the invention provides a method for producing the specific DNA recombinase. The project that produced this application was funded by the European Research Council (ERC) under the EU's Outlook 2020 research and innovation program (Funding Agreement No. 742133). Genome engineering is becoming an increasingly important technology in biomedical research. Currently, the main approach in gene editing is nuclease-mediated introduction of double-stranded breaks (DSBs) at loci of interest, which are subsequently corrected by cellular repair pathways. There are four types of programmable nucleases, which can be divided into two groups based on their target DNA sequence recognition patterns. Macronucleases, zinc finger nucleases (ZFNs), and activator-of-transcriptional nucleases (TALENs) use protein-DNA interactions to guide the nuclease to specific loci, while clustered, regularly spaced, short palindromic repeat-related (CRISPR) endonucleases use RNA-DNA interactions for guidance (34, 35). Programmable nucleases are candidates for therapeutic applications, and several of them are already in clinical trials (36, 37, 38). However, one of the main challenges of programmable nucleases is the risk of unpredictable sequence rearrangements. The introduced DSBs are primarily repaired by cells using non-homologous end joining (NHEJ) or homologous directed repair (HDR). HDR repair is precise and maintains genome stability because the sequence is copied from the second allele or a donor sequence that matches the target. However, HDR is primarily active during DNA replication, and in most cells, NHEJ events outnumber HDR. NHEJ is a fallible repair mechanism that results in insertions and deletions (indels) in the repaired DNA fragment. This can lead to adverse events due to changes in gene sequence (34; 39, 40). Alternative tools widely used for genome engineering include site-specific recombinases (SSRs) from the tyrosine recombinase family. Tyrosine recombinases have a significant advantage over programmable nucleases because they are independent of cellular DNA repair pathways, as they perform the entire recombination reaction without cofactors (2). This results in highly specific, predictable, and precise genome editing events, making them attractive for therapeutic applications. One of the most commonly used SSRs is Cre, a tyrosine site-specific recombinase (SSR) that forms a homotetramer and rigorously catalyzes DNA recombination between loxP target sites (1). The loxP sequence consists of two 13 bp palindromic halves, flanked by an 8 bp spacer region where recombination occurs (Fig. 1A). The Cre / loxP system is commonly used for genome modification because of its precision and robustness in orthologous hosts (2). However, cross-organismal applications of Cre / loxP require the pre-introduction of the loxP target sequence into the host genome, which can be time-consuming and cumbersome (3, 4).To overcome this limitation and expand the use of SSRs, directed molecular evolution has been used to create Cre variants with altered DNA specificity to predefined (pseudo)symmetric DNA targets naturally present in the host genome (5-10). The practicality of this approach was first demonstrated with the production of Tre, an evolved Cre-type enzyme, to specifically identify and excise HIV-1 proviral DNA from the human genome (7). Tre and other evolved SSRs represent site-specific recombinases with the potential to be adapted for a wide range of therapeutic applications (8, 11, 12). Significant progress has been made in the engineering of novel SSRs capable of recombination at a range of DNA substrates, including asymmetric sites (5, 9, 10) (13–15). Recombination at asymmetric targets was first demonstrated by co-expressing wild-type and mutant Cre molecules that together catalyze recombination between artificially asymmetric loxP-loxM7 sites, demonstrating the concept of engineered heterospecific SSRs (5). This general principle has recently been extended to achieve recombination between naturally occurring asymmetric target sequences in the human genome by combining two evolved Cre variants (9). Cre molecules, each with unique half-site specificity, are first generated through directed evolution at their respective symmetric sites. Then, the different variants are expressed together to form a functional heterotetramer, which can specifically excise DNA fragments at desired asymmetric human target sites on both sides (9). More recently, this method has been shown to be applicable to correcting chromosome inversions that cause hereditary human diseases (10). By combining two designer-recombinases targeting asymmetric loxF8 sequences on the human X chromosome, Lansing et al. showed that the heterotetramer (D7) can efficiently correct genomic int1h inversions to re-establish factor VIII expression in patient-derived cells (10). The D7 SSR is composed of two distinct Cre-type subunits, D7L and D7R, each of which has evolved to bind to its corresponding half-sites (loxF8L and loxF8R, respectively). However, the use of more than one recombinase with different target specificities inherently carries risks. By using several Cre-derived recombinases with different specificities, the likelihood of subunits assembling into undesirable functional complexes increases, including homotetramers that may cause recombination events at off-target sites. Methods to mitigate these potential off-target effects and ensure the formation of only heterotetramers are crucial for improving their safety in therapeutic applications (10). Previously, prevention of homotetramer formation has been achieved through structure-guided redesign of several residues at the protein-protein interaction interface between different recombinase monomers (16).Therefore, this method for generating specific SSR systems is limited to enzymes with available crystal structures and is thus not readily adaptable to engineered or distantly related recombinases. WO 2021 / 110846 discloses fusion proteins for efficient and specific genome editing, comprising recombinase complexes containing at least a first recombinase enzyme and a second recombinase enzyme, wherein the first and second recombinase enzymes are interconnected via oligopeptide linkers. The efficiency of these fusion proteins depends on the characteristics of the linkers. US 10,017,832 B2 discloses DNA recombinases manufactured by introducing several mutations at the protein-protein interface between DNA recombinase monomers to form so-called specific heterotetrameric complexes. However, a drawback of this method is that it requires considerable effort to introduce several mutations into each recombinase enzyme, which also results in a decrease in their recombinase activity compared to wild-type enzymes without mutations, allowing for the formation of specific heterotetrameric complexes. Furthermore, because the target residues are not well preserved in the relevant recombinases, it is not easy to produce specific versions of other naturally occurring enzymes. Therefore, the objective problem of the present invention is to overcome the shortcomings of the prior art and to provide a recombinase complex with improved properties, particularly catalytic activity that allows for efficient recombination events, increased specificity, and / or reduced activity at off-target sites. This problem is solved by providing a genetically engineered DNA recombinase for efficient and specific genome editing, the DNA recombinase comprising a specific recombinase complex, wherein the complex comprises at least one first recombinase enzyme and at least one second recombinase enzyme, wherein the first and second recombinase enzymes specifically recognize a first and a second half-site of an upstream and / or downstream target site of the DNA recombinase; wherein each of the first and second recombinase enzymes contains at least one mutation in their respective catalytic regions; wherein the first and second recombinase enzymes carrying the at least one mutation, when acted alone, do not exhibit the catalytic activity of the DNA recombinase; and wherein, in the specific recombinase complex, the catalytic activities as DNA recombinases are complementary. This invention is not based on the redesign of the protein-protein interface between DNA recombinase monomers, as disclosed in, for example, US 10,017,832 B2. Compared to prior art, the mutation in at least one of the catalytic regions of the first and second recombinase enzymes is absent from the regions responsible for protein-protein interactions or DNA binding regions between recombinases, thereby avoiding any unintended interference with protein-protein complex formation and target identification. Advantageously, the recombinase complex of this invention is active at the desired target site only when the correct subunits come together, complement each other's catalytic activities, and thus form an active complex. Preferably, the at least one mutation is a point mutation in the form of an amino acid substitution, resulting in an amino acid substitution in the protein sequence of the first recombinase enzyme and in the amino acid sequence of the second recombinase enzyme. Most preferably, the at least one point mutation is a single amino acid substitution in the catalytic region of the respective recombinase. According to the preferred embodiment, the first recombinase enzyme and the second recombinase enzyme do not have point mutations at the same position or of the same type. The absence of point mutations of the same type means that if the mutation is at the same position in the first and second recombinases, the first amino acid replacing the amino acid at that position in the first recombinase is a different second amino acid replacing the amino acid at that position in the second recombinase. Tyrosine site-specific recombinases represent a versatile genome editing tool with considerable therapeutic potential. Recent developments in engineering and evolving SSRs into heterotetramers to improve target site flexibility represent a key step towards their broad application in genome editing. However, monomers of tyrosine site-specific recombinases tend to form different homotetramer and heterotetramer combinations in cells, increasing their off-target potential. Therefore,This invention provides a specific system of simple tyrosine site-specific recombinases, resulting from pairwise mutations targeting two residues involved in catalysis. Only when the pairwise mutations are applied as single mutations to each recombinase subunit (e.g., the first and second recombinase enzymes) can the engineered tyrosine site-specific recombinase effectively recombine the desired target sequence; the monomer carrying the point mutation alone is inactive. The application of this specific system of tyrosine site-specific recombinases to improve the recombination specificity of therapeutically designed recombinases in human cells is demonstrated herein. Furthermore, it is shown that these mutations make certain naturally occurring tyrosine site-specific recombinases, such as Cre, Vika, Panto, and Dre, specific, providing a simple method to improve their application properties. This invention contributes to the development of safe and effective therapeutically designed recombinases and advances the understanding of the catalytic mechanisms of tyrosine site-specific recombinases. Undesired side reactions, i.e., off-target recombination events, can thus be effectively avoided. Compared to methods known in the prior art, the target specificity of genetically engineered DNA recombinases is further improved. A drawback of monomer-monomer interface mutations (e.g., disclosed in US 10,017,832 B2) is the reduced recombination activity of engineered recombinases compared to wild-type enzymes. In contrast, the engineered recombinases of the present invention, containing at least a single mutation at the catalytic site, do not exhibit this loss of recombination activity. It is demonstrated herein that the recombination activity of the engineered recombinases of the present invention is comparable to that of wild-type enzymes, accompanied by the aforementioned significant improvement in target specificity. According to one embodiment, the present invention provides a method for generating a specific DNA recombinase for genome editing, wherein the method comprises the following steps: i. providing a nucleic acid molecule encoding a first recombinase enzyme and a nucleic acid molecule encoding a second recombinase enzyme, wherein the first recombinase enzyme binds to a first half-site of an asymmetric recombinase target site, and the second recombinase enzyme binds to a second half-site of the asymmetric recombinase target site, wherein the first recombinase enzyme and the second recombinase enzyme form a heterodimer capable of inducing specific DNA recombination at a position of interest in the DNA sequence at the asymmetric recombinase target site, wherein the asymmetric recombinase target site comprises a first half-site and a second half-site of an upstream target site and / or a downstream target site of the DNA recombinase, wherein the first half-site and the second half-site are distinct and not palindromic; ii. iii. Mutations are induced to create nucleic acid libraries encoding a mutant first recombinase enzyme and a mutant second recombinase enzyme, wherein the mutations are introduced into the first and second recombinase enzymes; iii. Expression vectors are created by selecting and colonizing the nucleic acid libraries encoding the first and second mutant recombinase enzymes into expression vectors, wherein the expression vectors carry the DNA sequence of interest.The DNA sequence of interest is to be recombined; iv. Transfect cells with the expression vectors of step iii) and express a library of the mutant first recombinase enzyme and the mutant second recombinase enzyme in the same cells, resulting in the formation of a recombinase heterodimer containing the mutant first recombinase enzyme and the mutant second recombinase enzyme; v. Positively select the heterodimers obtained in step iv that can induce position-specific DNA recombination of the sequence of interest at an asymmetric recombinase target site in DNA; vi. Negatively select the heterodimers obtained in steps iv or v that cannot induce position-specific DNA recombination of the sequence of interest at an off-target, preferably symmetric, recombinase target site in DNA; and vii. A specific DNA recombinase is selected, which is capable of recombinating the DNA sequence of interest at a recombinase target site in DNA. The recombinase target site includes a first half-site and a second half-site of an upstream target site and / or a downstream target site of the DNA recombinase, wherein the first half-site and the second half-site are distinct and not palindromic. Furthermore, the specific DNA recombinase cannot recombine the DNA sequence of interest at an off-target, preferably symmetrical, recombinase target site in DNA. In the specific DNA recombinase obtained in step vii, both the first mutant recombinase enzyme and the second mutant recombinase enzyme contain at least one mutation at their catalytic sites, rendering them inactive when used alone. According to a preferred embodiment, the specific DNA recombinase is used for DNA sequence recombination. According to one embodiment, the first recombinase enzyme and the second recombinase enzyme of steps ii to vi evolve via substrate-dependent directed evolution (SLiDE) or directed evolution. According to a further embodiment, the selection in steps v and vi is repeatedly performed between selecting a specific heterodimer with catalytic activity at an asymmetric target site (positive selection) and selecting a heterodimer without catalytic activity at an off-target site, preferably a symmetric target site. According to a further embodiment, the present invention provides a genetically engineered DNA recombinant enzyme for genome editing, wherein the DNA recombinant enzyme comprises a specific recombinase complex, wherein the complex comprises at least one first recombinase enzyme and at least one second recombinase enzyme, wherein the first recombinase enzyme and the second recombinase enzyme specifically recognize a first half-site and a second half-site of an upstream target site and / or a downstream target site of a DNA recombinase; wherein each of the first recombinase enzyme and the second recombinase enzyme contains at least one mutation at the catalytic site; wherein the first recombinase enzyme and the second recombinase enzyme carrying the at least one mutation at the catalytic site, when acted alone, do not exhibit the catalytic activity of a DNA recombinase; and wherein, in the specific recombinase complex,The catalytic activity of the DNA recombinase is complementary. According to a preferred embodiment, the first and second halves are distinct and not palindromic. According to a further preferred embodiment, the genetically engineered DNA recombinase is obtained by a method for producing a specific DNA recombinase for genome editing according to the present invention. According to one embodiment, the at least one first recombinase and the at least one second recombinase are of the same type. Preferably, both the at least one first recombinase and the at least one second recombinase are Cre recombinase, Dre recombinase, VCre recombinase, SCre recombinase, Vika recombinase, λ-Int recombinase, Flp recombinase, R recombinase, Kw recombinase, Kd recombinase, B2 recombinase, B3 recombinase, Nigri recombinase, or Panto recombinase. According to a further embodiment, the DNA recombinase is a heterotetrameric recombinase complex. According to another embodiment, the at least one mutation is a single amino acid substitution in the catalytic region of the recombinase. Preferably, the single amino acid substitution in the at least one first and the at least one second recombinase enzyme is at the position of the retained amino acid in the catalytic region. According to a preferred embodiment, the present invention provides a genetically engineered DNA recombinase enzyme comprising a complex of at least one first DNA recombinase enzyme and at least one second DNA recombinase enzyme, wherein the first DNA recombinase enzyme and the second DNA recombinase enzyme specifically recognize a first half-site and a second half-site of an upstream target site and / or a downstream target site of a DNA recombinase, wherein each of the first DNA recombinase enzyme and the second DNA recombinase enzyme contains a single amino acid substitution in their respective catalytic regions, wherein the first DNA recombinase enzyme and the second DNA recombinase enzyme carrying the single amino acid substitution, when acted alone, do not exhibit DNA recombinase catalytic activity, and wherein the first DNA recombinase enzyme and the second DNA recombinase enzyme carrying the single amino acid substitution, when acted together and forming a complex, exhibit DNA recombinase catalytic activity. According to one embodiment, the at least one mutation or the single mutation in the catalytic region of the first DNA recombinase is different from the at least one mutation or the single mutation in the catalytic region of the second DNA recombinase. According to another embodiment, the present invention provides a DNA recombinase enzyme, wherein (i) the first recombinase enzyme comprises Cre recombinase and the second recombinase enzyme comprises Cre recombinase, wherein each Cre recombinase comprises a single amino acid substitution in an amino acid region selected from the group consisting of SEQ ID NO: 109 to SEQ ID NO: 114; (ii) the first recombinase enzyme comprises Vika recombinase and the second recombinase enzyme comprises Vika recombinase.Each Vika recombinase comprises a single amino acid substitution within an amino acid region selected from the group consisting of SEQ ID NO: 115 to SEQ ID NO: 120; (iii) the first recombinase enzyme comprises Dre recombinase and the second recombinase enzyme comprises Dre recombinase, wherein each Dre recombinase enzyme comprises a single amino acid substitution within an amino acid region selected from the group consisting of SEQ ID NO: 121 to SEQ ID NO: 126; or (iv) the first recombinase enzyme comprises Panto recombinase and the second recombinase enzyme comprises Panto recombinase, wherein each Panto recombinase comprises a single amino acid substitution within an amino acid region selected from the group consisting of SEQ ID NO: 127 to SEQ ID NO: 132. According to one embodiment, the first recombinase enzyme and the second recombinase enzyme do not contain monomer-monomer-interface mutations. According to another embodiment, the genetically engineered DNA recombinase is a mutant of a naturally occurring position-specific recombinase or a mutant of a specially designed DNA recombinase. According to a preferred embodiment,The at least one mutation or single amino acid substitution in the at least one first recombinant enzyme and the at least one second recombinant enzyme is selected from the group consisting of: E129R, Q133H, R173A, R173C, R173D, R173E, R173F, R173G, R173I, R173K, R173L, R173M, R173N, R173P, R173Q, R173S, R173T, R173V, R173W, R173Y, E176H, E176I, E176L, E176M, E176V, E176I ... 6W, E176Y, K201A, K201C, K201C, K201D, K201F, K201G, K201H, K201I, K201L, K201M, K201N, K2 01P, K201Q, K201R, K201S, K201T, K201V, K201W, K201Y, H289D, H289E, H289I, H289K, H289R, H2 89W, R292A, R292C, R292E, R292F, R292G, R292H, R292I, R292L, R292M, R292N, R292P, R292Q, R 292S, R292T, R292V, R292W, R292Y, Q311R, W315C, W315E, W315G, W315I, W315K, W315L, W315M, W 315N, W315Q, W315R, W315S, W315T, W315V, Y324A, Y324C, Y324E, Y324F, Y324H, Y324I, Y324K, Y324L, Y324M, Y324N, Y324Q, Y324R, Y324S, Y324T, Y324V, and Y324W, or in the corresponding amino acid position of another recombinase, preferably in the corresponding position of SEQ ID NO: 14, SEQ ID NO: 17, or SEQ ID NO: 20. According to further preferred embodiments,The mutation or single amino acid substitution in the at least one first recombinant enzyme and the at least one second recombinant enzyme is located in a position selected from the group consisting of: (i) E129, Q133, R173, E176, K201, H289, R292, Q311, W315 and Y324 of SEQ ID NO: 1; (ii) E146, Q151, R191, N194, K219, H308, R311, Q330, W334 and Y343 of SEQ ID NO: 14; (iii) E130, Q134, R174, E177, K202, H290, R293, Q312, W316 and Y325 of SEQ ID NO: 17; (iv) SEQ ID NO: The amino acid positions of SEQ ID NO: 1 are: E131, Q135, R175, E178, K202, H290, R293, Q312, W316, and Y325; or (v) at an amino acid position of another recombinase, wherein the amino acid position of the other recombinase corresponds to position E129, Q133, R173, E176, K201, H289, R292, Q311, W315, or Y324. According to one embodiment, the first and second recombinase enzymes do not contain monomer-monomer-interface mutations. According to another embodiment, the genetically engineered DNA recombinase enzyme is a mutant of a naturally occurring position-specific recombinase or a mutant of a designer DNA recombinase. According to a preferred embodiment, the first recombinase enzyme comprises mutations selected from the group consisting of: mutation K201R of SEQ ID NO: 1, 2 or 7; K202R of SEQ ID NO: 18 or 21; mutation K219R of SEQ ID NO: 15; and mutation K221R of SEQ ID NO: 24; and the second recombinase enzyme comprises mutations selected from the group consisting of: mutation Q311K of SEQ ID NO: 4 or 11; mutation Q311R of SEQ ID NO: 5 or 12; mutation Q312R of SEQ ID NO: 19 or 22; mutation Q330R of SEQ ID NO: 16; and mutation Q336R of SEQ ID NO: 25. According to one embodiment, the recombinase target site is the target site of a tyrosine site-specific recombinase, such as Cre recombinase, Dre recombinase, VCre recombinase, SCre recombinase, Vika recombinase, λ-Int recombinase, Flp recombinase, R recombinase, Kw recombinase, Kd recombinase, B2 recombinase, B3 recombinase, Nigri recombinase, and Panto recombinase.Furthermore, the genetically engineered DNA recombinant enzyme is selected from the group consisting of: • A genetically engineered DNA recombinant enzyme comprising a first recombinase enzyme and a second recombinase enzyme, wherein the first recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7 and containing a single mutation K201R at the catalytic site; and wherein the second recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7 and containing a single mutation at position Q311R at the catalytic site; • A genetically engineered DNA recombinant enzyme comprising a first recombinase enzyme and a second recombinase enzyme, wherein the first recombinase enzyme has an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7 and contains a single mutation at position Q311R at the catalytic site; The second recombinase comprises a polypeptide having at least 70%, preferably 80%, and more preferably 90% sequence identity with the amino acid sequence of SEQ ID NO: 12 and containing a single mutant K201R at the catalytic site; and wherein the second recombinase enzyme has an amino acid sequence having at least 70%, preferably 80%, and more preferably 90% sequence identity with the amino acid sequence of SEQ ID NO: 12 and contains a single mutant Q311K at the catalytic site; • Cre recombinase, comprising a first recombinase enzyme and a second recombinase enzyme, the first recombinase enzyme having a single mutant K201R at its catalytic site and having an amino acid sequence having at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence of SEQ ID NO: 2; and the second recombinase enzyme having a single mutant Q311R at its catalytic site and having an amino acid sequence having at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence of SEQ ID NO: 5; Cre recombinase, comprising a first recombinase enzyme and a second recombinase enzyme, the first recombinase enzyme having a single mutation K201R at its catalytic site and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to a polypeptide having the sequence according to SEQ ID NO: 2; and the second recombinase enzyme having a single mutation Q311K at its catalytic site and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to a polypeptide having the sequence according to SEQ ID NO: 4; • Vika recombinase, comprising a first recombinase enzyme and a second recombinase enzyme,The first recombinase enzyme has a single mutation K219R at its catalytic site and has an amino acid sequence that is at least 70%, preferably 80%, and more preferably 90% identical to the polypeptide having the sequence according to SEQ ID NO: 15; and the second recombinase enzyme has a single mutation Q330R at its catalytic site and has an amino acid sequence that is at least 70%, preferably 80%, and more preferably 90% identical to the polypeptide having the sequence according to SEQ ID NO: 16; • Panto recombinase, the Panto recombinase comprising the first recombinase enzyme and the second recombinase enzyme, the first recombinase enzyme having a single mutation K202R at its catalytic site and having an amino acid sequence that is at least 70%, preferably 80%, and more preferably 90% identical to the polypeptide having the sequence according to SEQ ID NO: 18; and the second recombinase enzyme having a single mutation Q312R at its catalytic site and having an amino acid sequence that is at least 70%, preferably 80%, and more preferably 90% identical to the polypeptide having the sequence according to SEQ ID NO: 15. The following are considered amino acid sequences: • Dre recombinase comprising a first recombinase enzyme and a second recombinase enzyme, the first recombinase enzyme having a single mutation K202R at its catalytic site and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO: 21; and the second recombinase enzyme having a single mutation Q312R at its catalytic site and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO: 22; and • Vcre recombinase comprising a first recombinase enzyme and a second recombinase enzyme, the first recombinase enzyme having a single mutation K221R at its catalytic site and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO: 22. The polypeptide sequence of SEQ ID NO: 24 has at least 70%, preferably 80%, and more preferably 90% identical amino acid sequence; and the second recombinase enzyme has a single mutation Q336R at its catalytic site and has an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identical amino acid sequence to the polypeptide sequence of SEQ ID NO: 25. According to another embodiment, the genetically engineered DNA recombinase enzyme specifically recognizes the upstream recombinase target sequence of the loxF8 target site, having the nucleic acid sequence ATAAATCTGTGGA. AACGCTGC CACACAATCT TAG (SEQ ID NO: 65) or its reverse complementary sequence; and identify the downstream recombinase target sequence of the loxF8 target site, which has the nucleic acid sequence CTAAGATTGTGTGGCAGCGTTTCCACAGATTTAT (SEQ ID NO: 66) or its reverse complementary sequence; and catalyze the recombination of the gene sequence between the upstream recombinase target sequence of SEQ ID NO: 65 and the downstream recombinase target sequence of SEQ ID NO: 66 of the loxF8 recombinase target site; and wherein the ability to catalyze the recombination of the gene sequence between the upstream recombinase target sequence of SEQ ID NO: 65 and the downstream recombinase target sequence of SEQ ID NO: 66 of the loxF8 recombinase target site is tested by a method comprising the following steps: a) expressing the genetically engineered DNA recombinase enzyme containing the first recombinase enzyme and the second recombinase enzyme in cells; and b) The analysis determines whether the genetically engineered DNA recombinant enzyme expressed in step a) can recombine DNA sequences on the human chromosome of the cell. According to a further embodiment, the present invention provides a nucleic acid molecule or a plurality of nucleic acid molecules, each comprising or composed of a nucleic acid sequence encoding a genetically engineered DNA recombinant enzyme or its subunit according to the present invention. According to yet another embodiment, the present invention provides an expression vector comprising a nucleic acid molecule or a plurality of nucleic acid molecules according to the present invention and an expression control element operatively linked to the nucleic acid to drive its expression. According to a further embodiment, the present invention provides a mammalian, insect, plant, or bacterial host cell comprising a nucleic acid molecule or a plurality of nucleic acid molecules according to the present invention or an expression vector comprising a nucleic acid molecule according to the present invention. According to yet another embodiment, the present invention provides a pharmaceutical composition comprising a genetically engineered DNA recombinant enzyme according to the present invention, or a nucleic acid molecule or a plurality of nucleic acid molecules according to the present invention, or an expression vector according to the present invention, or a cell according to the present invention. If desired, the pharmaceutical composition further comprises one or more therapeutically acceptable diluents or carriers. According to a further embodiment, the present invention provides a genetically engineered DNA recombinant enzyme according to the present invention, or a nucleic acid molecule or plurality of nucleic acid molecules according to the present invention, or an expression vector according to the present invention, or a pharmaceutical composition according to the present invention, which is used for pharmaceutical purposes. According to yet another embodiment, the present invention provides a genetically engineered DNA recombinant enzyme according to the present invention, or a nucleic acid molecule or plurality of nucleic acid molecules according to the present invention, or an expression vector according to the present invention, or a pharmaceutical composition according to the present invention, which is used for treating hemophilia A. According to a preferred embodiment, this treatment is for treating severe hemophilia A.According to a further embodiment, the present invention provides a method for reverse DNA sequencing at the genomic level in vitro within cells, the cells comprising a genetically engineered DNA recombinant enzyme according to the present invention, wherein the method comprises the following steps: i. providing a nucleic acid molecule encoding a first recombinase enzyme of the present invention, wherein the first recombinase enzyme comprises at least one mutation that activates the catalytic activity of the first recombinase enzyme as a DNA recombinase, and wherein the first recombinase monomer specifically recognizes a first half-site of the recombinase target site; ii. providing a nucleic acid molecule encoding a second recombinase enzyme of the present invention, wherein the second recombinase enzyme comprises at least one mutation that activates the catalytic activity of the second recombinase enzyme as a DNA recombinase, and wherein the second recombinase monomer specifically recognizes a second half-site of the recombinase target site; iii. creating an expression vector by selecting and implanting the nucleic acid molecule encoding the first recombinase enzyme and the nucleic acid molecule encoding the second recombinase enzyme into an expression vector; iv. The expression vector is delivered to a cell containing the DNA sequence to be reversed, the expression vector of step iii, or an RNA molecule encoding the genetically engineered DNA recombinant enzyme of the present invention; v. Expression of the genetically engineered DNA recombinant enzyme of the present invention; vi. Reversal of the DNA sequence to be reversed on the human chromosome of the cell using the genetically engineered DNA recombinant enzyme of the present invention. According to a preferred embodiment, the cell is not a human germ cell. According to a further embodiment, the present invention provides a method for treating or preventing disease, comprising administering to an individual in need the genetically engineered DNA recombinant enzyme of the present invention, or a nucleic acid molecule or plurality of nucleic acid molecules of the present invention, or the expression vector of the present invention, or a host cell of the present invention, or a pharmaceutical composition of the present invention. According to a further embodiment, the present invention provides a method for treating or preventing hemophilia A, the method comprising administering to an individual in need a genetically engineered DNA recombinant enzyme according to the present invention, or a nucleic acid molecule or plurality of nucleic acid molecules according to the present invention, or an expression vector according to the present invention, or a host cell according to the present invention, or a pharmaceutical composition according to the present invention, as needed, wherein the hemophilia A is severe hemophilia A. According to a further embodiment, the present invention provides a method for recombinating a targeted DNA sequence in cells, comprising introducing the following into the cells: (a) a nucleic acid molecule encoding the first recombinase enzyme and a nucleic acid molecule encoding the second recombinase enzyme according to the present invention; and / or (b) the first recombinase enzyme and the second recombinase enzyme according to the present invention, thereby recombinating the targeted DNA sequence of the cells. According to a preferred embodiment, the nucleic acid molecule encoding the first recombinase enzyme and / or the nucleic acid molecule encoding the second recombinase enzyme is mRNA.According to the embodiments, the nucleic acid molecules encoding the first recombinant enzyme and / or the nucleic acid molecules encoding the second recombinant enzyme are expression vectors. Further embodiments and embodiments of the present invention will become clear from the appended claims and the following detailed description. List 1 below provides an illustrative overview of the recombinase sequences used in this invention. SEQ ID NO, representing a nucleic acid sequence, is quoted in parentheses; for example, SEQ ID NO: 1 represents the amino acid sequence of the wt Cre recombinase monomer, while SEQ ID NO: 26 (quoted in parentheses) represents the corresponding nucleic acid sequence encoding the Cre recombinase protein of SEQ ID NO: 1. Generally, the terminology used herein is defined as follows: "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", Leuenberger, HGW, Nagel, B. and Klbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland. In this specification and the appended claims, unless the context otherwise requires, the word "comprise," and variations such as "comprises" and "comprising," will be understood to mean including the stated integer or step or a group of integers or steps, but not excluding any other integer or step or a group of integers or steps. As used herein, the terms "cell," "cell line," and "cell culture" are used interchangeably, and all of these names include progeny. Therefore, "transformed" and "transformed cell" include the primary host cell and the cultures derived from it, regardless of the number of transfections. It is also understood that all progeny may not be identical in DNA content due to intentional or unintentional mutations. Mutant progeny with the same function or biological activity as those selected from the initially transformed cells are also included. If a different name is desired, it will be clearly indicated from the context. The terms "polypeptide," "peptide," and "protein" used herein are used interchangeably and are defined as biomolecules composed of amino acids linked by peptide bonds. When referring to peptides or amino acid sequences herein, each amino acid residue is represented by a one-letter or three-letter name, corresponding to the conventional names of amino acids, following the conventional list below: Amino Acid One-letter Symbol Three-letter Symbol Alanine A Ala Arginine R Arg Aspartic Acid N Asn Aspartic Acid D Asp Cysteine ​​C Cys Glutamic acid Q Gln Glutamic acid E Glu Glycine G Gly Histamine H His Isoleucine I Ile Leucine L Leu Lysine K Lys Methionine M Met Phenylalanine F Phe Proline P Pro Serine S Ser Threonine T Thr Tryptophan W Trp Tyrosine Y Tyr Valine V Val The terms "a" and "an" as used herein are defined as "one or more" and include the plural unless the context is inappropriate. The term "approximately" when used in relation to a numerical value refers to a value within a range having a lower limit of 5% less than the specified value and an upper limit of 5% greater than the specified value.As used herein, the term "and / or" means that it refers to one or both / all of the options referenced in the context of this term. The term "at least one" as used herein refers to one or more representative items, such as two, three, four, five, six, seven, eight, nine, ten, or more than ten. Depending on the preferred embodiment, the term "at least one" refers to only one. In a particularly preferred embodiment relating to the number of mutations in the catalytic region, the term "at least one mutation" preferably refers to a single mutation (especially a single amino acid substitution) and no further mutations in the catalytic region. The term "subject" as used herein refers to an animal, preferably a mammal, and most preferably a human, as a subject of treatment, observation, or experimentation. The term "therapeuticly effective amount" as used herein refers to the amount of an active compound or agent that elicits a biological or pharmaceutical response sought by researchers, veterinarians, physicians, or other clinicians in an tissue system, animal, or human, including the reduction of symptoms of the treated disease or condition. The term "pharmaceutical composition" as used herein refers to a substance and / or combination of substances used to identify, prevent, or treat a disease or tissue condition. Pharmaceutical compositions are formulated to be administered to patients for the prevention and / or treatment of disease. Furthermore, a pharmaceutical composition refers to a combination of an active agent and an inert or active carrier, making the composition suitable for therapeutic use. This carrier is also referred to as a pharmaceutically acceptable agent. Pharmaceutical compositions can be formulated for oral, parenteral, topical, inhalation, rectal, sublingual, transdermal, subcutaneous, or vaginal administration routes, depending on their chemical and physical properties. Pharmaceutical compositions include solid, semi-solid, liquid, and transdermal therapeutic systems (TTS). Solid compositions are selected from the group consisting of tablets, coated tablets, powders, granules, pills, capsules, effervescent tablets, or transdermal therapeutic systems. Liquid compositions are also included, selected from the group consisting of solutions, syrups, infusions, extracts, solutions for intravenous administration, infusion solutions, or solutions of the carrier systems of the present invention. Semi-solid compositions suitable for use in the context of the present invention include emulsions, suspensions, creams, lotions, gels, globules, buccal tablets, and suppositories. As used herein, the term "medically acceptable" includes both human and veterinary use: for example, the term "medically acceptable" includes compounds that are veterinarily acceptable or human medically and health care acceptable. The "percentage of sequences identity" is determined by comparing two optimally aligned sequences in a comparison window, wherein the sequence portion in the comparison window may include additions or deletions (i.e., gaps) relative to a reference sequence (excluding additions or deletions) to optimize the alignment of the two sequences.The percentage is calculated as follows: determine the number of identical nucleic acid bases or amino acid residues in the two sequences, obtain the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window, and then multiply the result by 100 to obtain the percentage of sequence identity. The term "identical" is used in the context of two or more nucleic acid or polypeptide sequences to refer to two or more sequences or subsequences that are identical, i.e., contain the same nucleotide or amino acid sequence. If a certain proportion of nucleotide or amino acid residues are identical in the sequences, then they are considered "identical" to each other. According to the present invention, at least 70% identity includes at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity when compared with a comparison window for maximum correspondence relative to a specified sequence, or when measured within a defined region using one of the sequence comparison algorithms listed below, or by manual sequence alignment and visual inspection. These definitions also refer to the complementarity of the test sequences. Therefore, throughout the specification, the term "at least 70% sequence identity" is used with respect to the sequence comparison of peptides and polynucleotides. This representation preferably refers to sequence identity with the respective reference polypeptide or reference polynucleotide at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. Sequence identity as disclosed herein preferably refers to amino acid sequences or positions outside the catalytic region of the recombinase, excluding amino acids or positions within the catalytic region identified herein. The term "sequence comparison" as used herein refers to the process of comparing a sequence as a reference sequence with a test sequence. When using a sequence comparison algorithm, the test sequence and a reference sequence are input into the computer. If necessary, the subsequence coordinates are specified, along with the sequence algorithm program parameters. Default program parameters are typically used, or alternative parameters can be specified. The sequence comparison algorithm then calculates the percentage of sequence identity between the test sequence and the reference sequence based on the program parameters.If two sequences are compared and no reference sequence is specified for calculating the percentage of sequence identity, then sequence identity is calculated with reference to the longer of the two sequences being compared, unless otherwise specified. If a reference sequence is specified, then unless otherwise specified, sequence identity is determined based on the full length of the reference sequence specified in SEQ ID. In sequence alignment, the term "comparison window" refers to a segment of consecutive positions of a sequence compared to a reference segment of consecutive positions of a sequence having the same number of positions. Typically, the number of consecutive positions ranges from approximately 20 to 100, from approximately 25 to 90, from approximately 30 to 80, from approximately 40 to approximately 70, and from approximately 50 to approximately 60. According to the invention, if the reference sequence has the same length or is longer than SEQ ID NO of the invention, when comparing the percentage identity of a sequence with a sequence of the invention, such as SEQ ID NO:1, it is preferable to compare the entire length of SEQ ID NO, such as the 106 amino acids of SEQ ID NO:1, with the reference sequence. If the reference sequence is shorter than the SEQ ID NO of the present invention, then the entire length of the reference sequence must be compared with the entire length of the SEQ ID NO of the present invention. Sequence alignment methods are well known in the art. For example, optimal sequence alignment can be achieved through Smith and Waterman’s local homology algorithm (Adv. Appl. Math. 2:482, 1970), Needleman and Wunsch’s homology alignment algorithm (J. Mol. Biol. 48:443, 1970), Pearson and Lipman’s search similarity method (Proc. Natl. Acad. Sci. USA 85:2444, 1988), through computerized implementations of these algorithms (e.g. GAP, BESTFIT, FASTA, and TFASTA, in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or through manual alignment and visual inspection (see, for example, Ausubel et al., Current Protocols in Molecular Biology (1995 supplement)).Suitable algorithms for determining sequence identity and sequence similarity percentages are BLAST and BLAST 2.0, described by Altschul et al. (Nuc. Acids Res. 25:3389-402, 1977) and Altschul et al. (J. Mol. Biol. 215:403-10, 1990), respectively. Software for performing BLAST analysis is available to the public from the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). This algorithm involves first identifying high-scoring sequence pairs (HSPs) in the query sequence by recognizing short words of length W that match or satisfy a positive threshold score T when aligned with words of the same length in the database sequence. T is called the neighborhood word score threshold (Altschul et al., ibid.). These initial neighboring word matches act as seeds to initiate the search for longer HSPs containing them. The word matches are then extended in both directions along each sequence, increasing the cumulative alignment score as much as possible. For nucleotide sequences, the cumulative score is calculated using parameters M (reward score for matching residue pairs; always > 0) and N (penalty score for mismatched residues; always < 0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of word matches in each direction stops when: the cumulative alignment score drops by X from its maximum value; the cumulative score becomes zero or below due to the accumulation of one or more negative residue matches; or the end of any sequence is reached. The parameters W, T, and X of the BLAST algorithm determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses the following preset values: word length (W) 11, expected value (E) 10, M=5, N=-4, and two-way comparison. For amino acid sequences, the BLASTP program uses the following preset values: word length (W) of 3, expected value (E) of 10, and BLOSUM62 score matrix (see Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915, 1989) alignment (B) of 50, expected value (E) of 10, M=5, N=-4, and a comparison of two sequences. The BLAST algorithm also performs statistical analysis on the similarity between two sequences (see, for example, Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-87, 1993).One similarity measure provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides the probability of a chance match between two nucleotide or amino acid sequences. For example, if the minimum sum probability in a comparison of a test nucleic acid with a reference nucleic acid is less than about 0.2, typically less than about 0.01, and more often less than about 0.001, the nucleic acid is considered similar to the reference sequence. The nucleic acid in the context of this invention may comprise one nucleic acid molecule or may be separable into two or more nucleic acid molecules, wherein each nucleic acid molecule contains at least one of one or more sequences encoding a polypeptide or protein of the present invention. In some embodiments, one nucleic acid molecule encodes a portion or monomer of the DNA recombinase enzyme of the present invention, and another nucleic acid molecule encodes another portion or monomer of the DNA recombinase enzyme of the present invention. In some embodiments, the nucleic acid encodes two or more DNA recombinase polypeptides. The nucleic acid encoding the plurality of DNA recombinases of the present invention may include a nucleic acid cleavage site between two sequences encoding the DNA recombinase polypeptide, may include a transcription start site or translation start site (such as an internal ribosome entry site (IRES)) between two sequences encoding the DNA recombinase polypeptide, and / or may encode a proteolytic target site between two or more DNA recombinase polypeptides. If two or more DNA recombinase polypeptides are encoded on a single nucleic acid molecule, these two or more DNA recombinase polypeptides may be under the control of the same promoter or under the control of separate promoters. The term "nucleic acid" in the context of this invention refers to a single-stranded or double-stranded oligomer or polymer of a deoxyribonucleotide or ribonucleotide base or both. A nucleotide monomer consists of a nucleobase, a pentose sugar (such as, but not limited to, ribose or 2'-deoxyribose), and one to three phosphate groups. Typically, nucleic acids are formed via phosphodiester bonds between individual nucleotide monomers. In the context of this invention, the term nucleic acid includes, but is not limited to, ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) molecules, and also includes synthetic forms of nucleic acids containing other bonds (e.g., peptide nucleic acids as described in Nielsen et al.'s article (Science 254:1497-1500)). (1991). Typically, nucleic acids are single-stranded or double-stranded molecules composed of naturally occurring nucleotides. The description of a single-stranded nucleic acid also defines (at least partially) the sequence of the complementary strands. Nucleic acids can be single-stranded or double-stranded, or may contain portions of both single-stranded and double-stranded sequences. For example, a double-stranded nucleic acid molecule may have a 3' or 5' overhang, and thus does not need to or is assumed to be entirely double-stranded along its entire length. The term nucleic acid includes chromosomes or chromosome segments, vectors (e.g., expression vectors), expression cassettes, naked DNA or RNA polymers, primers, probes, cDNA, genomic DNA, recombinant DNA, cRNA, mRNA, tRNA, microRNA, or short interfering RNA (siRNA). Nucleic acids can be, for example, single-stranded, double-stranded, or triple-stranded, and are not limited to any particular length.Unless otherwise indicated, a particular nucleic acid sequence contains or encodes a complementary sequence, except for any explicitly indicated sequence. Nucleic acids can be isolated nucleic acids or recombinant nucleic acids. Nucleic acids can be present throughout the cell, in cell lysates, or in partially purified or substantially pure forms. When nucleic acids are purified from other cellular components or other contaminants (such as other cellular nucleic acids or proteins) using standard techniques, the nucleic acid is referred to as "isolated" or "substantially purified." The terms "vector," "selective vector," and "expression vector" refer to a vector that can introduce a DNA or RNA sequence (e.g., a foreign gene) into a host cell to transform the host and promote the expression (e.g., transcription and translation) of the introduced sequence. Various expression vectors can be used to express polynucleotides encoding the DNA recombinases and DNA recombinases of the present invention. Both viral and non-viral expression vectors can be used, for example, in mammalian host cells to produce DNA recombinases and DNA recombinases as described herein. Non-viral vectors and systems include plastids, plastidocytes, cohesive plastidocytes, episomes, artificial chromosomes, bacteriophages, or viral vectors. Such vectors may contain regulatory elements, such as promoters, enhancers, terminators, etc., to cause or direct the expression of the polypeptide upon administration to an individual. Examples of promoters and enhancers in expression vectors for animal cells include the early promoter and enhancer of SV40 (Mizukami T. et al., 1987), the LTR promoter and enhancer of Moloney mouse leukemia virus (Kuwana Y et al., 1987), and the promoter (Mason JO et al., 1985) and enhancer (Gillies SD et al., 1983) of antibody heavy chains. For example, non-viral vectors that can be used to express polynucleotides and polypeptides as described herein in mammalian (e.g., human or non-human) cells include all vectors known in the art suitable for expressing proteins. Other examples of plasmids include replicative plasmids containing the origin of replication, or integrative plasmids, such as pUC, pcDNA, pBR, etc. The term "viral vector" refers to a nucleic acid vector construct that includes at least one viral-derived element, is capable of being packaged into viral vector particles, and at least encodes a foreign nucleic acid. This vector and / or particles can be used for the purpose of transferring the nucleic acid of interest into cells, either in vitro or in vivo. Many forms of viral vectors are known in the art. Available viral vectors include retrovirus-based vectors, lentiviruses, adenoviruses, adeno-associated viruses, herpesviruses, SV40-based vectors, papillomaviruses, Epstein-Barr viruses, vaccinia virus vectors, and Semliki forest virus (SFV). Recombinant viruses can be manufactured using techniques known in the art, such as by transfecting packaging cells or by transient transfection with helper plastids or viruses.Common examples of viral packaging cells include PA317 cells, PsiCRIP cells, GPenv+ cells, and 293 cells. Detailed experimental procedures for producing such replication-deficient recombinant viruses can be found, for example, in WO 95 / 14785, WO 96 / 22378, US 5,882,877, US 6,013,516, US 4,861,719, US 5,278,056, and WO 94 / 19478. The terms "recombinase," "DNA recombinase," "DNA recombinase enzyme," and "recombinase enzyme" are used interchangeably herein and each refers to a monomer of a protein complex that is understood in this art to allow for gene recombination. This term includes monomeric subunits of site-specific recombinases (SSRs), particularly those from the tyrosine recombinase family. Functional complexes containing at least two DNA recombinases or monomers are also referred to as "DNA recombining enzymes." Naturally occurring DNA recombinase enzymes, particularly position-specific recombinase (SSR) systems (such as tyrosine-type SSRs), typically consist of four identical monomeric subunits or monomers. This complex is called a homotetramer. As used herein, the term DNA recombinase "complex" or "recombinase complex" refers to a combination of at least two monomeric recombinase subunits, also known as a recombinase enzyme. A complex with two subunits is called a dimer, and a complex with four subunits is called a tetramer. Naturally occurring recombinase complexes consist of identical recombinase monomers or subunits; in the case of two identical subunits, the complex is called a homodimer, and in the case of four identical subunits, the complex is called a homotetramer. According to a preferred embodiment of the invention, the recombinase complex contains at least two distinct recombinase subunits and is therefore present as a heterodimer or heterotetramer. Typically, this recombinase complex modifies DNA between two specific target sequences. These sequences are typically between 30 and 200 base pairs in length and contain two inverted repeat recombinase-binding regions flanked by a central spacer sequence where DNA breakage and replication occur (Meinke et al., 2016). Figure 11 shows an example of this targeting sequence—also referred to herein as the target site—depicting the SSR Cre / loxP binding complex in which the Cre recombinase binds to a 34-base-pair loxP target sequence. The loxP site consists of two 13-base-pair inverted repeat Cre binding elements flanked by an 8-base-pair spacer region. The binding elements are distinguished by their position within the spacer sequence. The left half-site is the 13-base-pair binding element located to the left of the spacer, and the right half-site is the 13-base-pair binding element located to the right of the spacer.Depending on the number and relative orientation of the target sites and their spacers, DNA recombinases perform excision, insertion, inversion, or substitution of genetic content (Figure 12; a review by Meinke et al., 2016). For recombination to occur, the recombinase complex recognizes a first and a second target site on the DNA double strand. Target sites are also referred to as upstream and downstream recognition sites, depending on their position on the DNA double strand. Therefore, the term "half-site" as used herein refers to the left and right portions of the DNA sequence separated by spacer sequences to which the recombinase binds. Half-sites are also referred to as binding regions or binding elements. As used herein, the term "target site" or "target sequence" refers to a sequence element containing a left half-site, a spacer sequence, and a right half-site. As used in the context of recombinases, the term "type" refers to a specific recombinase subunit. Preferably, the specific recombinase system is selected from the group consisting of: Cre recombinase, Dre recombinase, VCre recombinase, SCre recombinase, Vika recombinase, λ-Int recombinase, Flp recombinase, R recombinase, Kw recombinase, Kd recombinase, B2 recombinase, B3 recombinase, Nigri recombinase, and Panto recombinase. As used herein, the term "single mutation in the catalytic region" excludes any additional mutations in the catalytic region, but does not exclude any mutations (substitution, deletion, insertion) in the remaining portion of the amino acid sequence of each recombinase enzyme. Therefore, for a recombinase that has a certain percentage of identity with a given SEQ ID NO and has a single amino acid substitution in its catalytic region, the percentage of identity refers to the region outside the catalytic region and does not allow any additional mutations in the catalytic region. As used herein, "upstream" refers to the 5' target site of a recombinase in DNA, comprising a first half-site, such as a left half-site, and a second half-site, such as a right half-site, wherein the first half-site and the second half-site are separated by a spacer sequence. As used herein, "downstream" refers to the 3' target site of a recombinase in DNA, comprising a first half-site, such as a left half-site, and a second half-site, such as a right half-site, wherein the first half-site and the second half-site are separated by a spacer sequence. In symmetric target sites, the first half-sites, such as a left half-site, and the second half-sites, such as a right half-site, are either identical or palindromic (reverse complementary). In asymmetric target sites, the first half-sites, such as a left half-site, and the second half-sites, such as a right half-site, are dissimilar and not palindromic, meaning that at least one nucleotide or nucleic acid is different from each other."Obligatory" proteins are complexes composed of multiple subunits. These subunits cannot function independently and have no catalytic activity in their individual forms. When these subunits are together, they form a functional complex. Therefore, the presence of all obligatory protein subunits is mandatory for the protein's functionality, i.e., the recombinase activity of the recombinase complex of the present invention. As used herein, the term "does not exhibit catalytic activity of DNA recombinase" or similar terms, such as "does not have catalytic activity," when used in the case of a DNA recombinase enzyme with a single-point mutation in its catalytic region, means that the mutated DNA recombinase enzyme exhibits catalytic activity that is approximately 90% lower than that of the same DNA recombinase enzyme without the mutation. The activity of the recombinase enzyme is preferably determined using a plastid-based assay in *E. coli*. The plastid DNA used in this assay contains two target sites of the given DNA recombinase enzyme (e.g., the loxP target site of Cre recombinase). If the DNA recombinase enzyme is active at the time of presentation, the DNA receptor (plastomer DNA) will be recombined by the DNA recombinase enzyme. Depending on the size and sequence of the recombined and unrecombined receptors, the recombination activity is calculated using the following formula based on the ratio of recombined to unrecombined receptors: Recombination activity (%) = 100 x (recombined receptors / (recombined + unrecombined receptors)). These unrecombined and recombined DNA fragments can be distinguished by gel electrophoresis or sequencing. Unless otherwise stated, the present invention will be practiced using methods of biochemistry, cell biology, and recombinant DNA technology, which are explained in the literature of this art (see, for example, Molecular Cloning: A Laboratory Manual, 2nd Edition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). All methods described herein may be performed in any suitable order unless otherwise stated or clearly contradicted by the context. The use of any and all embodiments or illustrative language (e.g., "such as") provided herein is merely for the purpose of better illustrating the invention and does not constitute a limitation on the scope of the invention except as described in the claims. No language in the specification should be construed as indicating an element not described in the claims that is essential to the implementation of the invention. Detailed Description of the Invention Before describing the invention in detail below, it should be understood that the invention is not limited to the specific methods, experimental procedures, and reagents described herein, as these may vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments and is not intended to limit the scope of the invention, which is limited only by the claims appended.Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In the following paragraphs, different aspects of the invention are defined in more detail. Each aspect thus defined may be combined with any other aspect unless expressly stated otherwise. In particular, any feature indicated as desirable, preferred, or advantageous may be combined with any other feature indicated as desirable, preferred, or advantageous. Numerous documents are referenced throughout the text of this specification. Every document referenced herein (including all patents, patent applications, scientific publications, manufacturers' specifications, descriptions, etc.), whether above or below, is hereby incorporated in its entirety by reference. Nothing herein should be construed as an admission that the invention is not entitled to prior disclosure by reason of prior invention. Some documents referenced herein are described as "incorporated by reference." If the definitions or teachings of these incorporated references conflict with those set forth in this specification, the text of this specification shall prevail. The elements of the invention will be described below. These elements are listed together with the specific embodiments; however, it should be understood that they can be used in any manner and in any number of combinations to create other embodiments. The various examples and preferred embodiments described should not be construed as limiting the invention solely to the explicitly described embodiments. This description should be understood to support and encompass embodiments that combine the explicitly described embodiments with any number of disclosed and / or preferred elements. Furthermore, unless the context otherwise requires, any permutation and combination of all elements described herein should be considered as disclosed in the description of this application. This invention provides a genetically engineered DNA recombinant enzyme for efficient and specific genome editing, wherein the DNA recombinant enzyme comprises a specific recombinase complex, wherein the complex comprises at least one first recombinase enzyme and at least one second recombinase enzyme, wherein the first recombinase enzyme and the second recombinase enzyme specifically recognize a first half-site and a second half-site of an upstream target site and / or a downstream target site of a DNA recombinase; wherein each of the first recombinase enzyme and the second recombinase enzyme contains at least one mutation at a catalytic site; wherein the first recombinase enzyme and the second recombinase enzyme carrying the at least one mutation at a catalytic site do not exhibit the catalytic activity of a DNA recombinase when acted alone; and wherein the catalytic activities of the DNA recombinase in the specific recombinase complex are complementary. Preferably, the first half-site and the second half-site of the upstream target site and / or the downstream target site of the DNA recombinase are different and not palindromic. The present invention further provides a genetically engineered DNA recombinant enzyme, which comprises a complex of at least one first DNA recombinase enzyme and at least one second DNA recombinase enzyme.The first and second DNA recombinase enzymes specifically recognize the first and second halves of the upstream and / or downstream target sites of a DNA recombinase. Further, each of the first and second DNA recombinase enzymes contains a single amino acid substitution in its catalytic region. The first and second DNA recombinase enzymes carrying the single amino acid substitution do not exhibit DNA recombinase catalytic activity when acted alone, but exhibit DNA recombinase catalytic activity when acted together and form a complex. According to one embodiment, the at least one first recombinase and the at least one second recombinase are of the same type. In this context, "same type" means that the first and second recombinase systems originate from the same recombinase, preferably selected from the group consisting of: Cre recombinase, Dre recombinase, VCre recombinase, SCre recombinase, Vika recombinase, λ-Int recombinase, Flp recombinase, R recombinase, Kw recombinase, Kd recombinase, B2 recombinase, B3 recombinase, Nigri recombinase, and Panto recombinase. According to this preferred embodiment, the DNA recombinase system is a complex of recombinase subunits. This complex may have the configuration described herein. A preferred configuration of this complex is a heterotetramer. Surprisingly, it has been found that to render the catalytic activity of these monomers inactive, it is sufficient to introduce only one mutation at the catalytic site of each monomer of the DNA recombinase, wherein, however, when two mutated monomers pair with each other, the catalytic activity as a DNA recombinase in the obligate recombinase complex is replenished (restored). In other words, when a first recombinase with at least one mutation at the catalytic site and a second recombinase with at least one mutation at the catalytic site coexist and form an heteroreplex, the heteroreplex system exhibits catalytic activity and shows that the catalytic region of its recombinase monomer subunit does not have the activity of the mutated DNA recombinase. Therefore, in a preferred embodiment, the present invention provides a genetically engineered DNA recombinant enzyme for efficient and specific genome editing, the DNA recombinant enzyme comprising a specific recombinase complex, wherein the complex comprises at least one first recombinase enzyme and at least one second recombinase enzyme, wherein the first recombinase enzyme and the second recombinase enzyme specifically recognize a first half-site and a second half-site of an upstream target site and / or a downstream target site of a DNA recombinase; wherein each of the first recombinase enzyme and the second recombinase enzyme contains a mutation at a catalytic site; wherein the first recombinase enzyme and the second recombinase enzyme carrying the mutation at the catalytic site do not exhibit the catalytic activity of a DNA recombinase when acted alone; and wherein, in the specific recombinase complex, the catalytic activities of the DNA recombinase are complementary.Of course, the first and second recombinase enzymes may contain further mutations that are outside the catalytic site and / or do not impair their catalytic activity. Preferably, the first and second halves of the upstream and / or downstream target sites of the DNA recombinase are distinct and not palindromic. The most surprising finding is the mutation at position 201 in the first recombinase enzyme, where arginine is present instead of lysine. This change is so interesting because lysine 201 is highly conserved throughout the tyrosine SSR family and has previously been described as essential for Cre's catalytic activity in promoting DNA cleavage during recombination. Therefore, a recombinase altered at position 201 is not expected to be functional. Mutations in the catalytic K201 residue render the SSR inactive as a monomer. Building on these observations, it is further surprising that the recombinase activity can be rescued by the presence of a paired Q311R mutation in the second recombinase enzyme. Only when a single mutation is applied to the catalytic region of each recombinase enzyme (subunit) can an engineered SSR effectively recombine the desired target sequence, while a recombinase enzyme (subunit) carrying a point mutation alone is inactive. As mentioned above, by altering the DNA specificity of Cre through engineering and directed evolution, different SSR variants can be generated, which can recombine asymmetric target sequences together as heterotetramers (6, 8-10). The generation of this heterotetramer SSR system greatly expands the potential sequences that can be targeted within the genome. However, possible combinations of different subunits may lead to active SSR byproducts capable of catalyzing off-target recombination. Previously, prevention of homotetramer formation was achieved through structure-guided redesign of several residues involving the protein-protein interaction interface between different recombinase monomers (16). Therefore, this method for generating specific SSR systems is limited to enzymes with available crystal structures and is therefore not easily adapted to engineered or distant recombinases. The present invention further relates to the specific identification of genetically engineered DNA recombinases. The loxF8 recombinase targets sequences upstream and downstream of its target site, and its catalytic activity is intermediate between these sites. The reverse of the gene sequence between the upstream and downstream target sequences of the loxF8 recombinase target site. The invention further relates to nucleic acid molecules encoding genetically engineered DNA recombinases according to the invention. In a further embodiment, the invention provides mammalian, insect, plant, or bacterial host cells containing nucleic acid molecules or multiple nucleic acid molecules encoding genetically engineered DNA recombinases according to the invention. Genetically engineered DNA recombinases or nucleic acid molecules according to the invention can be used as pharmaceuticals and can therefore be included in pharmaceutical compositions, in combination with one or more therapeutically acceptable diluents or carriers as needed. Genetically engineered DNA recombinases or pharmaceutical compositions according to the invention are suitable for treating diseases curable by genome editing, particularly hemophilia A. In a further embodiment, a method for determining recombination at the host cell culture or patient genome level is provided, comprising genetically engineered DNA recombinases according to the invention. The inventors, using directed molecular evolution, surprisingly discovered that specific SSR systems can also be generated by mutating residues related to recombination catalysis. Importantly, this novel method for generating obligate SSRs requires only the alteration of one conserved residue within each different SSR monomer. This simplified approach has the potential to be applied to many engineered or natural SSRs without prior knowledge of enzyme structure. The identified mutations that can convert naturally occurring SSRs into obligate enzymes, including the discovery of Cre recombinases, can be used to explore complex genetic and synthetic biology research. Many existing conditional gene knockout mouse models are based on the Cre / loxP system (28, 29). Typically, animals carrying the fluxed allele are crossed with mice expressing Cre from tissue-specific promoters to achieve gene inactivation in a specific organ or tissue. This method can be further refined by expressing CreK201R, CreQ311K, and CreQ311R from two different promoters. Here, gene deletion will only occur in cells where both promoters are active. In a similar manner, the precision of genetic lineage tracing studies (30) can be further enhanced by employing specific CreK201R / CreR282E and CreQ311K / CreQ311R systems. Similarly, specific SSRs may allow for the creation of more complex synthetic biology circuits, where SSRs are frequently used to build biosensors and biomachines (31, 32).For example, mutations in K201R, Q311K, and Q311R have been identified in the Cre system as providing specific recombinase complexes and have also been shown herein to lead to specific complexes of other recombinases, particularly specific complexes containing at least two recombinase enzymes, wherein the first recombinase enzyme contains at least one mutant K201R, wherein the amino acid position number refers to the amino acid sequence of the wild-type Cre recombinase monomer of SEQ ID NO: 1, and wherein the second recombinase enzyme contains at least one mutation selected from the group consisting of Q311K and Q311R, wherein the amino acid position number refers to the amino acid sequence of the wild-type Cre recombinase monomer of SEQ ID NO: 1. Preferred sequences of mutated recombinases are as follows: A mutated first recombinase enzyme containing the K201R mutation has SEQ ID NO: 2. A mutated second recombinase enzyme containing the Q311K mutation has SEQ ID NO: 4. A mutated second recombinase enzyme containing the Q311R mutation has SEQ ID NO: 5. The recombinase enzyme contained in the obligate complex is preferably a DNA recombinase and can be a naturally occurring recombinase (i.e., a recombinase isolated from any type of biological sample) or a specially designed recombinase, such as a recombinase evolved by directed molecular evolution or rational design, or any combination thereof. Methods for creating specially designed recombinases are known in the art. For example, WO 2018 / 229226 A1 teaches a vector and method for generating specially designed DNA recombinases by directed molecular evolution. WO 2008 / 083931 A1 discloses the directed molecular evolution of a custom recombinase (Tre 1.0) that uses a sequence in the HIV long terminal repeat (LTR) as a recognition site (loxLTR Tre 1.0). Further developments of this method using asymmetric target localization sites are described in WO 2011 / 147590 A2 (Tre 3.0) and WO 2016 / 034553 A1 (Tre 3.1 and Tre / Brec1), as well as in publication Karpinski J et al. 2016 (Brec1). Methods for engineering naturally occurring or specially designed recombinases through rational design are also known in the art (e.g., Abi-Ghanem et al., 2013; Karimova et al., 2016). According to a preferred embodiment of the invention, the genetically engineered DNA recombinase is a mutant of a naturally occurring position-specific recombinase or a mutant of a specially designed DNA recombinase. Naturally occurring position-specific recombinases include, but are not limited to, Cre recombinase, Dre recombinase, VCre recombinase, SCre recombinase, Vika recombinase, λ-Int recombinase, Flp recombinase, R recombinase, Kw recombinase, Kd recombinase, B2 recombinase, B3 recombinase, Nigri recombinase, or Panto recombinase.Specially designed DNA recombinase systems are disclosed, for example, in WO 2014 / 016248 and WO 2018 / 229226. According to the invention, at least one, preferably a single amino acid substitution, is located in the catalytic region of the DNA recombinase. The catalytic region of the recombinase, and particularly the catalytic region of tyrosine-type SSR recombinases, consists of six catalytic sites. These catalytic sites are shown as boxes in the comparison of Figure 19, with the position number indicating the Cre recombinase. Table 2 below identifies the amino acids belonging to the catalytic region, indicating their positions in the full sequence of each DNA recombinase, and their corresponding SEQ ID NO. By comparing different recombinases (see Figure 19 for example), the catalytic regions of other recombinases can be identified. Experienced users will easily find suitable alignment tools, such as the well-known Clustal Omega or EMBOSS Needle from the European Institute for Bioinformatics at the European Molecular Biology Laboratory. For the sequence alignment shown in Figure 19, the preset settings of Clustal Omega v1.2.4 were used. Based on this alignment, the common sequence of the catalytic region can also be determined. Therefore, according to the present invention, the catalytic region can also be defined by the following amino acid sequences: Catalytic site no. 1: ER(A,I,T)(K,E,G)QA(L,P,I,V)(A,P) (SEQ ID NO: 133); Catalytic site no. 2: (F,I)(L,V)(G,S,F)(I,L,V)AY(N,E)TL (L,M,C)R(I,K,M)(A,N,S)(E,N)(I,L)(A,E,S)(R,Q)(I,M)(R,K) (SEQ ID NO: 134); Catalytic site no. 3: (R,F,H)(T,S)KT(L,N,I,M)(V,H,T)(S,T) (T,G,A)(A,R)(G,D)(V,D,L)(E,V,D,I)(K,R) (SEQ ID NO: 135); Catalytic site no. 4: HSARVGAA(R,Q,I,M)D(M,L)(R,Q,E,A) (R,Q,E) (SEQ ID NO: 136); catalytic site no. 5: MQ(A,E)G(G,T)W(T,S,K,Q) (SEQ ID NO: 137); and catalytic site no. 6: (V,L)(M,L)(N,R)Y (SEQ ID NO: 138), where the amino acid in parentheses indicates the substituted amino acid at the corresponding position. According to a preferred embodiment, at least one mutation in the DNA recombinase, particularly a single amino acid substitution, is at a conserved amino acid position in the catalytic region of the DNA recombinase. The conserved amino acids in the catalytic region of the recombinase can be deduced from the alignment of the recombinase, as shown in Figure 19.The conserved amino acids in the catalytic region of the recombinase preferably include those at positions E129, R130, Q133, A134, A167, Y168, T170, L171, L172, R173, E176, K201, T202, H289, S290, A291, R292, V293, G294, A295, A296, R297, D298, M310, Q311, G313, W315, V321, M322, N323, and Y324 in SEQ ID NO: 1, and at corresponding positions in another recombinase, preferably at one or more of SEQ ID NO: 14, SEQ ID NO: 17, and SEQ ID NO: 20. As used in the context of this invention, the term "corresponding amino acid position..." refers to the position of the amino acid sequence of the recombinase as described herein, preferably aligned with the full-length amino acid sequence of SEQ ID NO: 1. For example, those skilled in the art can readily compare further recombinases with the alignment shown in Figure 19, allowing identification of the amino acid corresponding to the position identified in SEQ ID NO: 1, and similarly, SEQ ID NO: 14, 17, and 20. For example, from the alignment, it can be deduced that the position corresponding to E129 of SEQ ID NO: 1 is E146 of SEQ ID NO: 14, E130 of SEQ ID NO: 17, and E131 of SEQ ID NO: 20. Therefore, further corresponding amino acid positions of other recombinase enzymes can be identified by those skilled in the art without undue burden. According to the preferred embodiment, at least one mutation in the DNA recombinase, particularly a single amino acid substitution, is selected from the following positions: positions E129, Q133, R173, E176, K201, H289, R292, Q311, W315, and Y324 of SEQ ID NO: 1, or in the corresponding position of another recombinase, wherein the amino acid position in the other recombinase corresponds to position E129, Q133, R173, E176, K201, H289, R292, Q311, W315, or Y324 of SEQ ID NO: 1. Preferably, the other recombinase comprises the sequence shown in one of SEQ ID NO: 14, SEQ ID NO: 17, and SEQ ID NO: 20. The corresponding positions are shown in the alignment in Figure 19.Specifically, the corresponding positions in SEQ ID NO: 14 are E146, Q151, R191, N194, K219, H308, R311, Q330, W334, and Y343; in SEQ ID NO: 17 are E130, Q134, R174, E177, K202, H290, R293, Q312, W316, and Y325; and in SEQ ID NO: 20 are E131, Q135, R175, E178, K202, H290, R293, Q312, W316, and Y325. The alignment shown in Figure 19 enables those skilled in the art to further align the DNA recombinase and identify its catalytic region and the specific positions shown herein. According to the preferred embodiment, the single substitution line in the DNA recombinase is selected from the group consisting of the following: E129R, Q133H, R173A, R173C, R173D, R173E, R173F, R173G, R173I, R173K, R173L, R173M, R173N, R173P, R173Q, R173S, R173T, R173V, R173W, R173Y, E176H, E176I, E176L, E176M, E176V, E1 76W, E176Y, K201A, K201C, K201C, K201D, K201F, K201G, K201H, K201I, K201L, K201M, K201N, K 201P, K201Q, K201R, K201S, K201T, K201V, K201W, K201Y, H289D, H289E, H289I, H289K, H289R, H 289W, R292A, R292C, R292E, R292F, R292G, R292H, R292I, R292L, R292M, R292N, R292P, R292Q, R292S, R292T, R292V, R292W, R292Y, Q311R, W315C, W315E, W315G, W315I, W315K, W315L, W315M W315N, W315Q, W315R, W315S, W315T, W315V, Y324A, Y324C, Y324E, Y324F, Y324H, Y324I, Y324K, Y324L, Y324M, Y324N, Y324Q, Y324R, Y324S, Y324T, Y324V, and Y324W, or in the corresponding position of another recombinase, preferably in the corresponding position of SEQ ID NO: 14, SEQ ID NO: 17, or SEQ ID NO: 20.The preferred combinations of single substitutions in the catalytic regions of the first and second DNA recombinases are highlighted in Table 6 and Figure 18. The preferred combinations of single amino acid substitutions in the first and second DNA recombinases are at positions R173 and Q311, K201 and Q311, Q311 and R292, W315 and Y324 in SEQ ID NO: 1, and at positions Q311 and Y324, or at the corresponding positions in another recombinase, preferably at the corresponding positions in SEQ ID NO: 14, SEQ ID NO: 17, or SEQ ID NO: 20. In a preferred embodiment, the first recombinase enzyme contains at least one mutation selected from K201R, wherein the amino acid position number refers to the amino acid sequence of the wild-type Cre recombinase monomer of SEQ ID NO: 1; and the second recombinase enzyme contains at least one mutation selected from Q311K and Q311R, wherein the amino acid position number refers to the amino acid sequence of the wild-type Cre recombinase monomer of SEQ ID NO: 1. The present invention utilizes genetically engineered specific DNA recombinases to catalyze DNA recombination events, such as the excision, substitution, or inversion of a target sequence. The present invention particularly discloses specific recombinase complexes that catalyze the inversion of DNA sequences located in the int1h region on the human X chromosome. In a preferred embodiment, the first recombinase enzyme comprises at least one or only one mutation at position K201R, wherein the amino acid position number refers to the amino acid sequence of the wild-type Cre recombinase monomer of SEQ ID NO: 1; and the second recombinase enzyme comprises at least one or only one mutation Q311K and Q311R, wherein the amino acid position number refers to the amino acid sequence of the wild-type Cre recombinase monomer of SEQ ID NO: 1. In a preferred embodiment, the recombinase contained in the complex is produced using the methods described herein. Therefore, the features and embodiments related to the recombinase target sites and recombinases described herein are also applicable to the methods described herein. The recombinase complex, such as the DNA recombinase enzyme of the present invention, typically comprises four recombinase enzymes, i.e., four recombinase monomers. Within the scope of this invention, a composition of a recombinase complex is defined as follows: • All four recombinase monomers are different; • Three recombinase monomers are the same and one monomer is different; • Two recombinase monomers are the same and the other two monomers are different; • The complex contains two different homodimers; • The complex contains two different heterodimers; • The complex contains two identical heterodimers; • The complex contains two different monomers; or • The complex contains two identical monomers.In this context, "different" refers to the monomers being different in their primary structure because they carry at least one, preferably a single, amino acid substitution in their catalytic region, i.e., showing a difference in their amino acid sequence; and / or showing high specificity for one of the four halves of the upstream and downstream target sites of the recombinase, which advantageously leads to a remarkable increase in the specificity of the genetically engineered DNA recombinase of the present invention. When the DNA recombinase of the present invention consists of four monomers, it is preferred that at least two monomers carry a first amino acid substitution in their catalytic region, such as the K201R mutation or a corresponding mutation, and the other two monomers carry a second amino acid substitution in their catalytic region, such as the Q311K or Q311R mutation or a corresponding mutation. In a preferred embodiment, the recombinase complex is a specific dimer, more preferably a specific heterodimer, and more preferably capable of recognizing the first and second target sequences of the upstream or downstream recombinase target sites in the DNA. In a further preferred embodiment, the recombinase complex of the present invention is a tetramer, more preferably a heterotetramer for identifying upstream and downstream target sites of the recombinase in DNA, wherein the tetramer is composed of two specific heterodimers as described herein, wherein the monomers of the heterodimers are preferably bound together, for example via peptide bonds or protein-protein interactions, and the specific heterodimer exhibits DNA recombinase activity. According to a further preferred embodiment of the present invention, the monomers of the heterodimer are further evolved through directed evolution or rational design to specifically identify a first or second half-site of the recombinase target site. Therefore, in the complex of the two specific heterodimers, the first heterodimer specifically identifies the first and second half-sites of the upstream recombinase target site in DNA, and the second specific heterodimer specifically identifies the first and second half-sites of the downstream recombinase target site. More preferably, the monomers of the heterodimer are tyrosine site-specific recombinases. Therefore, a preferred embodiment of the present invention provides a genetically engineered DNA recombinase comprising a recombinase subunit that is a position-specific recombinase, and preferably a tyrosine site-specific recombinase. Preferably, the tyrosine site-specific recombinase is selected from the group consisting of: Cre recombinase, Dre recombinase, VCre recombinase, SCre recombinase, Vika recombinase, λ-Int recombinase, Flp recombinase, R recombinase, Kw recombinase, Kd recombinase, B2 recombinase, B3 recombinase, Nigri recombinase, and Panto recombinase. The target sites for these bacterial and yeast T-SSR systems have been discussed in Meinke et al., 2016, and Karimova et al., 2016, and are shown in Table 3 below. In a further preferred embodiment, the present invention provides a genetically engineered DNA recombinant enzyme, wherein the target site of the recombinase system is a tyrosine site-specific recombinase, which has evolved through directed evolution, such as Cre recombinase, Dre recombinase, VCre recombinase, SCre recombinase, Vika recombinase, λ-Int recombinase, Flp recombinase, R recombinase, Kw recombinase, Kd recombinase, B2 recombinase, B3 recombinase, Nigri recombinase, and Panto recombinase. In a more preferred embodiment, the present invention provides a genetically engineered DNA recombinant enzyme, wherein the target site of the recombinase system is a tyrosine site-specific recombinase, which has evolved through directed evolution, such as Cre recombinase, Dre recombinase, VCre recombinase, Vika recombinase, and Panto recombinase. Preferably, the corresponding single amino acid substitution system is introduced into the following positions in the catalytic regions of the first and second recombinase enzymes of Dre recombinase, VCre recombinase, Vika recombinase, and Panto recombinase: • Dre recombinase: mutant K202R in the first recombinase enzyme and mutant Q312R in the second recombinase enzyme; • VCre recombinase: mutant K221R in the first recombinase enzyme and mutant Q336R in the second recombinase enzyme; • Vika recombinase: mutant K219R in the first recombinase enzyme and mutant Q330R in the second recombinase enzyme; and • Panto recombinase: mutant K202R in the first recombinase enzyme and mutant Q312R in the second recombinase enzyme. Preferably, the genetically engineered DNA recombinant enzyme is selected from the group consisting of: • Genetically engineered DNA recombinant enzyme comprising a first recombinase enzyme and a second recombinase enzyme, wherein the first recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7 and containing a mutation at position K201R; and wherein the second recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 11 and containing a mutation at position Q311R. In this embodiment, the mutation at position K201R is introduced into the polypeptide of SEQ ID NO: 6, and the mutation at position Q311R is introduced into the polypeptide of SEQ ID NO: 10. In this context, sequence identity refers to the amino acid sequence outside the catalytic region of the recombinase, i.e., the catalytic region preferably contains only a single amino acid substitution and has no further mutations.• A genetically engineered DNA recombinant enzyme comprising a first recombinase enzyme and a second recombinase enzyme, wherein the first recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7 and containing a mutation at position K201R; and wherein the second recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 12 and containing a mutation at position Q311K. In this embodiment, the mutation at position K201R is introduced into the polypeptide of SEQ ID NO: 6, and the mutation at position Q311K is introduced into the polypeptide of SEQ ID NO: 10. In this context, sequence identity refers to the amino acid sequence outside the catalytic region of the recombinase, i.e., the catalytic region preferably contains only a single amino acid substitution without further mutations. According to a preferred embodiment, the K201R mutation is the only mutation in the catalytic region of the first recombinase, and the Q311K or Q311R mutation is the only mutation in the catalytic region of the second recombinase. In a further preferred embodiment, the genetically engineered DNA recombinase of the present invention is provided, which is a mutant of a naturally occurring position-specific recombinase selected from: ‧ Cre recombinase, which contains the K201R mutation in the first recombinase enzyme and has an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence according to SEQ ID NO: 2; and the Q311R mutation in the second recombinase enzyme, which has an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence of SEQ ID NO: 5. Wild-type Cre recombinase has the sequence of SEQ ID NO: 1, from which mutated SEQ ID NO: 2 and 5 are obtained, wherein sequence identity refers to the amino acid sequence outside the catalytic region of the recombinase, i.e., the catalytic region preferably contains only a single amino acid substitution and no further mutations; ‧ Cre recombinase comprising the K201R mutation in the first recombinase enzyme and having an amino acid sequence with at least 70%, preferably 80%, more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO: 2; and the Q311K mutation in the second recombinase enzyme, having an amino acid sequence with at least 70%, preferably 80%, more preferably 90% identity to the polypeptide having the sequence of SEQ ID NO: 4.Wild-type Cre recombinase has the sequence of SEQ ID NO: 1, from which mutated SEQ ID NO: 2 and 4 are obtained, wherein sequence identity refers to the amino acid sequence outside the catalytic region of the recombinase, i.e., the catalytic region preferably contains only a single amino acid substitution and has no further mutations; ‧ Vika recombinase, which contains the K219R mutation in the first recombinase enzyme and has an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence according to SEQ ID NO: 15; and the Q330R mutation in the second recombinase enzyme, having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence of SEQ ID NO: 16. Wild-type Vika recombinase has the sequence of SEQ ID NO: 14, from which mutated SEQ ID NO: 15 and 16 are obtained, wherein sequence identity refers to the amino acid sequence outside the catalytic region of the recombinase, i.e., the catalytic region preferably contains only a single amino acid substitution and no further mutations; Panto recombinase, comprising the K202R mutation in the first recombinase enzyme and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence according to SEQ ID NO: 18; and the Q312R mutation in the second recombinase enzyme, having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence of SEQ ID NO: 19. Wild-type Panto recombinase has the sequence of SEQ ID NO: 17, from which mutated SEQ ID NO: 18 and 19 are obtained, wherein sequence identity refers to the amino acid sequence outside the catalytic region of the recombinase, i.e., the catalytic region preferably contains only a single amino acid substitution and no further mutations; ‧ Dre recombinase, which contains the K202R mutation in the first recombinase enzyme and has an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence according to SEQ ID NO: 21; and the Q312R mutation in the second recombinase enzyme, having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence of SEQ ID NO: 22.The wild-type Dre recombinase comprises SEQ ID NO: 20, from which mutated SEQ ID NO: 21 and 22 are obtained, wherein sequence identity refers to the amino acid sequence outside the catalytic region of the recombinase, i.e., the catalytic region preferably contains only a single amino acid substitution and has no further mutations; and Vcre recombinase comprising the K221R mutation in the first recombinase enzyme and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence according to SEQ ID NO: 24; and the Q336R mutation in the second recombinase enzyme, having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence of SEQ ID NO: 25. The wild-type Vcre recombinase has SEQ ID NO: 23, from which mutated SEQ ID NO: 24 and 25 are obtained, wherein sequence identity refers to the amino acid sequence outside the catalytic region of the recombinase, i.e., the catalytic region preferably contains only a single amino acid substitution and has no further mutations. According to a further preferred embodiment, the first recombinase enzyme comprises mutations selected from the group consisting of: mutation K201R of SEQ ID NO: 1, 2, or 7; K202R of SEQ ID NO: 18 or 21; mutation K219R of SEQ ID NO: 15; and mutation K221R of SEQ ID NO: 24; and the second recombinase enzyme comprises mutations selected from the group consisting of: mutation Q311K of SEQ ID NO: 4 or 11; mutation Q311R of SEQ ID NO: 5 or 12; mutation Q312R of SEQ ID NO: 19 or 22; mutation Q330R of SEQ ID NO: 16; and mutation Q336R of SEQ ID NO: 25. Generally, it is preferred that the genetically engineered DNA recombinase enzyme of the present invention identifies recombinase target sites, wherein the upstream recombinase target site and the downstream recombinase target site are asymmetrical. Ideally, this invention utilizes genetically engineered recombinant DNA enzymes to identify the specificity of the invention. The recombinase target sequence upstream of the loxF8 target site has the following nucleic acid sequence: ATAAATCTGTGGAAACGCTGCCACACAATCTTAG (SEQ ID NO: 65) or its reverse complementary sequence; and it is identifiable. The downstream recombinase target sequence of the loxF8 target site has the nucleic acid sequence CTAAGATTGTGTGGCAGCGTTTCCACAGATTTAT (SEQ ID NO: 66) or its reverse complementary sequence. More preferably, the recombinase is catalyzed by the genetically engineered DNA recombinant enzyme according to the present invention. The loxF8 recombinase target site is the reverse of the gene sequence between the upstream recombinase target sequence of SEQ ID NO: 65 and the downstream recombinase target sequence of SEQ ID NO: 66. This catalyzes... The ability to reverse the gene sequence between the upstream recombinase target site sequence of SEQ ID NO: 65 and the downstream recombinase target site sequence of SEQ ID NO: 66 at the loxF8 recombinase target site can be tested by a method comprising the following steps: a) expressing the genetically engineered DNA recombinase enzyme comprising a first recombinase enzyme and a second recombinase enzyme in a cell; and b) analyzing whether the genetically engineered DNA recombinase enzyme expressed in step a) can reverse the DNA sequence on the human chromosome of the cell. According to a preferred genetically engineered DNA recombinase enzyme or recombinase complex of the present invention, it is capable of catalyzing… The loxF8 recombinase target site is the reverse of the gene sequence between the upstream recombinase target sequence of SEQ ID NO: 65 and the downstream recombinase target sequence of SEQ ID NO: 66, constituting a DNA recombinase enzyme. The first recombinase enzyme has an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% sequence identity to the sequence according to SEQ ID NO: 7 or SEQ ID NO: 8, and / or the second recombinase enzyme has an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% sequence identity to the sequence according to SEQ ID NO: 11 or SEQ ID NO: 12. According to the optimal genetically engineered DNA recombinase enzyme or recombinase complex of the present invention, it is capable of catalyzing… The loxF8 recombinase target site is the reverse of the gene sequence between the upstream recombinase target sequence of SEQ ID NO: 65 and the downstream recombinase target sequence of SEQ ID NO: 66, comprising a first recombinase enzyme having an amino acid sequence having at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7, and a second recombinase enzyme having an amino acid sequence having at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 11, wherein preferred sequence identity refers to amino acid sequences outside the recombinase catalytic region. To produce recombinant... DNA recombinases targeting sequences upstream and downstream of the loxF8 target site can be obtained using a plasm-ligation directed evolution method (Buchholz and Stewart 2001). In this evolved DNA recombinase, mutations are introduced at positions corresponding to the K201R, G282E, or R282E mutations in the first Cre recombinase monomer of SEQ ID NO: 1 and at positions corresponding to the Q311K or Q311R mutations in the second Cre recombinase monomer of SEQ ID NO: 1, thereby obtaining the genetically engineered recombinase monomers of SEQ ID NO: 2, 3, 4, and 5 of this invention. The genetically engineered DNA recombinase enzymes according to this invention recognize two target sites and cause deletion, insertion, inversion, or substitution of DNA sequences to recombinate nucleic acid sequences, particularly DNA sequences. Advantageously, the genetically engineered DNA recombinase enzymes according to this invention recognize sequences based on SEQ ID NO: 65 (upstream) and SEQ ID NO: 66 (downstream). The asymmetric recognition sites of the loxF8 sequence. These recognition sites are not found elsewhere in the human genome and are therefore available for specific DNA recombination. The genetically engineered DNA recombinant enzyme according to the invention advantageously eliminates the need for artificially introduced target sites into the genome. Further advantageously and preferably, the genetically engineered DNA recombinant enzyme according to the invention causes the reverse of the DNA sequence. A further advantage is that the genetically engineered DNA recombinant enzyme according to the invention allows for precise genome editing without triggering endogenous DNA repair pathways. The invention further relates to a nucleic acid molecule, such as a polynucleotide or nucleic acid, or a plurality of nucleic acid molecules, each nucleic acid molecule comprising or composed of: a nucleic acid sequence encoding a DNA recombinase, such as first and second DNA recombinases, or the genetically modified DNA recombinant enzyme or its subunit according to the invention. The coding sequence, which encodes a polypeptide, may be identical to the coding sequence of the polypeptides shown in SEQ ID NO: 27-30, 32, 33, 36, 37, 40, 41, 43, 44, 46, 47, 49, and 50, preferably SEQ ID NO: 27-30, 32, 33, 36, and 37, or may be a different coding sequence encoding the same polypeptide, as a result of redundancy, degeneracy, or single nucleotide polymorphism in the genetic code. For example, it may also be an RNA transcript of SEQ ID NO: 27-30, 32, 33, 36, 37, 40, 41, 43, 44, 46, 47, 49, and 50, comprising the entire length of the coding sequence of the polypeptide of the present invention. In a preferred embodiment, the "polynucleotide" according to the present invention is one of SEQ ID NO: 27-30, 32, 33, 36, and 37.The wild-type or original polypeptides used for genetic engineering according to the present invention are encoded by the following polynucleotides: ‧ SEQ ID NO: 26 encodes the wild-type Cre DNA recombinase monomer of SEQ ID NO: 1; ‧ SEQ ID NO: 31 encodes the evolved D7L DNA recombinase monomer of SEQ ID NO: 6; ‧ SEQ ID NO: 35 encodes the evolved D7R DNA recombinase monomer of SEQ ID NO: 10; ‧ SEQ ID NO: 39 encodes the wild-type Vika DNA recombinase monomer of SEQ ID NO: 14; ‧ SEQ ID NO: 42 encodes the wild-type Panto DNA recombinase monomer of SEQ ID NO: 17; ‧ SEQ ID NO: 45 encodes the wild-type Dre DNA recombinase monomer of SEQ ID NO: 20; and ‧ SEQ ID NO: 48 encodes the wild-type Cre DNA recombinase monomer of SEQ ID NO: 23. Nucleic acids encoding polypeptides of SEQ ID NO: 2-5, 7, 8, 11, 12, 15, 16, 18, 19, 21, 22, 24, or 25, preferably SEQ ID NO: 2-5, 7, 8, 11, or 12, may include, but are not limited to, the coding sequence of a single polypeptide; the coding sequence of a polypeptide plus additional coding sequences such as leader sequences, secretion sequences, or proprotein sequences; and the coding sequence of a polypeptide (and additional coding sequences as needed) plus non-coding sequences, such as introns of the coding sequence of the polypeptide or 5' and / or 3' of non-coding sequences. Nucleic acids encoding polypeptides of SEQ ID NO: 2-5, 7, 8, 11, 12, 15, 16, 18, 19, 21, 22, 24, or 25, preferably SEQ ID NO: 2-5, 7, 8, 11, or 12, include codon-optimized nucleic acids for expression in human cells. They may further contain nuclear localization sequences. Therefore, the term "polynucleotide encoding a polypeptide" or "nucleic acid encoding a polypeptide" should be understood to include polynucleotides or nucleic acids that include only the coding sequence of the DNA recombinase enzyme of the present invention, such as polypeptides selected from SEQ ID NO: 2-5, 7, 8, 11, 12, 15, 16, 18, 19, 21, 22, 24 or 25, preferably polypeptides of SEQ ID NO: 2-5, 7, 8, 11 or 12, as well as polypeptides that include additional coding and / or non-coding sequences.The terms polynucleotide and nucleic acid are used interchangeably. This invention also includes polynucleotides in which the coding sequence of a polypeptide can be fused within the same reading frame as a polynucleotide sequence that facilitates the expression and secretion of the polypeptide from a host cell; for example, a leader sequence, which can be fused as a secretory sequence controlling the transport of the polypeptide from the cell. A polypeptide having such a leader sequence is called a preproprotein, and the leader sequence can be cleaved by a host cell to form the mature form of the protein. These polynucleotides may have a 5' extension region so that it can encode the preproprotein, which is the mature protein plus an additional amino acid residue at the N-terminus. The expression product having such a prosequence is called a preproprotein, which is the inactive form of the mature protein; however, once the prosequence is cleaved, the active mature protein remains. Additional sequences can also be attached to proteins and become part of the mature protein. Thus, for example, the polynucleotides of this invention can encode polypeptides, proteins having a presequence, or proteins having both a presequence and a postsequence (such as a leader sequence). The polynucleotides of this invention can also have a coding sequence fused with a labeling sequence, which allows for the purification of the polypeptides of this invention. The tag sequence can be an affinity tag or an epitope tag, such as a polyhistamine tag, an avidin-streptolysin tag, an Xpress tag, a FLAG tag, a cellulose or chitin-binding tag, a glutathione S-transferase tag (GST), a hemagglutinin (HA) tag, a c-myc tag, or a V5 tag. The HA tag corresponds to an epitope derived from influenza hemagglutinin protein (Wilson et al., 1984), and the c-myc tag can be an epitope derived from human Myc protein (Evans et al., 1985). If the nucleic acid of the present invention is mRNA, particularly for use as a drug, significant progress has been made in maximizing mRNA translation and stability, preventing its immunostimulatory activity, and developing in vivo delivery technologies, thus facilitating the delivery of mRNA therapeutics. The 5′ cap and 3′ poly(A) tail are key factors in efficient translation and extended half-life of mature eukaryotic mRNA. Adding cap analogs, such as ARCA (anti-reverse cap analog) and 120-150 bp multi-(A) tails, to in vitro transcribed (IVT) mRNA significantly improves the performance of the encoded protein and the stability of the mRNA. Novel types of cap analogs, such as 1,2-dithiobisphosphate-modified caps, possess the ability to resist RNA decapping complexes, which can further improve the efficiency of RNA translation. Replacing rare codons in the mRNA protein-coding sequence with frequently occurring synonymous codons, known as codon optimization, also helps improve the efficiency of protein synthesis and limits the destabilizing effects of rare codons on mRNA, thereby preventing accelerated transcript degradation.Similarly, engineered 3′ and 5′ untranslated regions (UTRs), containing sequences responsible for recruiting RNA-binding proteins (RBPs) and miRNAs, can increase protein production. Interestingly, UTRs can be intentionally modified to encode regulatory elements (such as K-turn motifs and miRNA binding sites), providing a means to control RNA expression in a cell-specific manner. Some RNA base modifications, such as N1-methylpseudouridine, not only help mask the immunostimulatory activity of mRNA but have also been shown to increase mRNA translation by enhancing translation initiation. In addition to the observed effects on protein translation, base modifications and codon optimization also affect the secondary structure of mRNA, which in turn affects its translation. Corresponding modifications to the nucleic acid molecules of the present invention are also covered in this invention. The RNA or plurality of RNAs preferably encodes a DNA recombinant enzyme or any subunit thereof. Specific methods for delivering and expressing nucleic acids, particularly RNA, are disclosed, for example, in EP2590676 and EP3115064. The RNA can be present in particles and is preferably self-replicating. Upon in vivo delivery of the particle, RNA is released from the particle and translated within the cell to provide DNA recombinant enzymes or any monomeric subunits thereof. Self-replicating RNA molecules (replicons), upon delivery to vertebrate cells, can produce multiple daughter RNAs through transcription from themselves (via their own antisense copies), even without any proteins. These daughter RNAs, along with co-linear subgenomic transcripts, can be self-translated to provide in situ expression of the encoded polypeptide, or can be transcribed to provide further transcripts with the same meaning as the delivered RNA, which are then translated to provide in situ expression of the polypeptide. The overall result of this transcriptional sequence is a significant increase in the number of introduced replicon RNAs, thereby encoding the polypeptide as the cell's major polypeptide product. Preferably, the self-replicating RNA molecule encodes (i) an RNA-dependent RNA polymerase that can transcribe RNA from the self-replicating RNA molecule and (ii) the polypeptide of the present invention. The polymerase can be an alpha-virus replicase, for example, one or more of the alpha-virus proteins nsP1, nsP2, nsP3, and nsP4. Preferably, the self-replicating RNA molecule of the present invention does not encode alpha-virus structural proteins. Therefore, a preferred self-replicating RNA can result in the production of its own genomic RNA copies within the cell, but does not result in the production of RNA-containing viral particles. The self-replicating RNA molecule available in the context of this invention can have two open reading frames. The first (5') open reading frame encodes a replicase, and the second (3') open reading frame encodes the polypeptide of this invention. In some embodiments, the RNA may have additional (e.g., downstream) open reading frames, for example, to further encode accessory polypeptides. Such RNAs are particularly suitable for general use in gene therapy, especially for the treatment of genetic disorders or diseases.This invention is intended to further provide polynucleotides that hybridize with the sequences described herein, wherein the sequences share at least 70%, preferably at least 90%, and more preferably at least 95% identity or similarity, and thus encode proteins with similar biological activities. Furthermore, as is known in the art, "similarity" exists between two polypeptides when the amino acid sequence contains the same or conserved amino acid substitutions for individual residues in the sequence. Identity and similarity can be measured using sequence analysis software (e.g., ClustalW of PBIL (Pôle Bioinformatique Lyonnais)) (http: / / npsa-pbil.ibcp.fr). This invention particularly provides polynucleotides that hybridize with the polynucleotides described herein under harsh conditions. Suitable harsh conditions can be defined by, for example, the concentration of salt or methylamine in the pre-hybridization and hybridization solutions, or the hybridization temperature, and are well known in the art. In particular, harshness can be increased by decreasing the salt concentration, increasing the methylamine concentration, and / or increasing the hybridization temperature. For example, hybridization under high-criticality conditions can use approximately 50% methylamine at a temperature of approximately 37°C to 42°C, while hybridization under reduced-criticality conditions can use approximately 35% to 25% methylamine at a temperature of approximately 30°C to 35°C. A specific set of conditions for hybridization under high-criticality conditions is: 42°C, 50% methylamine, 5x SSPE, 0.3% SDS, and 200 µg / ml of fragmented and denatured salmon sperm DNA. For hybridization under reduced-criticality conditions, similar conditions can be used with 35% methylamine at a reduced temperature of 35°C. The temperature range corresponding to a specific criticality can be further narrowed by calculating the purine to pyrimidine ratio of the nucleic acid of interest and adjusting the temperature accordingly. Variations of the above ranges and conditions are well known in the art. Preferably, hybridization occurs only when there is at least 95%, and more preferably at least 97%, identity between sequences. In a preferred embodiment, the polynucleotide encoding a polypeptide that hybridizes with the polynucleotide described herein exhibits substantially the same biological function or activity as the mature protein in SEQ ID NO: 2-5, 7, 8, 11, 12, 15, 16, 18, 19, 21, 22, 24 or 25, and more preferably SEQ ID NO: 2-5, 7, 8, 11 or 12. As previously mentioned, a suitable polynucleotide probe may have at least 14 bases, preferably 30 bases, more preferably at least 50 bases, and will hybridize with the polynucleotide of the present invention, which, as described above, is identical to the present invention.For example, this polynucleotide can be used as a probe to hybridize with a polynucleotide encoding a polypeptide of SEQ ID NO: 2-5, 7, 8, 11, 12, 15, 16, 18, 19, 21, 22, 24 or 25, preferably SEQ ID NO: 2-5, 7, 8, 11 or 12, for example, to recover this polynucleotide, or as a diagnostic probe, or as a PCR primer. Therefore, the present invention includes polynucleotides having at least 70% identity with the polynucleotides of SEQ ID NO: 27-30, 32, 33, 36, 37, 40, 41, 43, 44, 46, 47, 49 and 50, preferably at least 90% identity, more preferably at least 95% identity, encoding polypeptides of SEQ ID NO: 2-5, 7, 8, 11, 12, 15, 16, 18, 19, 21, 22, 24 or 25, preferably polypeptides of SEQ ID NO: 2-5, 7, 8, 11 or 12, and fragments thereof, preferably having at least 30 bases, and more preferably at least 50 bases. The terms "homology" or "identity" used interchangeably herein refer to sequence similarity between two polynucleotide sequences or between two polypeptide sequences, while identity is a more stringent comparison. The phrases "percent identity or homology" and "identity or homology" refer to the percentage of sequence similarity found in a comparison of two or more polynucleotide sequences or two or more polypeptide sequences. "Sequence similarity" refers to the percentage of similarity in base pairs between two or more polynucleotide sequences (determined by any suitable method). The similarity between two or more sequences can be between 0 and 100%, or any integer value in between. Identity or similarity can be determined by comparing positions in each sequence that can be compared for the purpose of comparison. When positions in the compared sequences are occupied by the same nucleotide bases or amino acids, then the molecules are identical at that position. The degree of similarity or identity between polynucleotide sequences is a function of the number of identical or matching nucleotides at common positions in the polynucleotide sequences. The degree of identity of a polypeptide sequence is a function of the number of identical amino acids at common positions in the polypeptide sequences. The degree of homology or similarity of polypeptide sequences is a function of the number of amino acids at common positions in the polypeptide sequences. As used in this article, "substantially identical" means at least 70%, 75%, at least 80%, at least 85%, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of identity or homology.The degree of sequence identity is determined by selecting a sequence as a query sequence and comparing it with homologous sequences from GenBank using the blastp algorithm (NCBI) with the Internet-based tool ClustalW. As is well known in the art, the genetic code is redundant because certain amino acids are encoded by more than one nucleotide triplet (codon), and this invention includes polynucleotide sequences encoding the same amino acid using codons different from those specifically exemplified in the sequences herein. Such polynucleotide sequences are referred to herein as "equivalent" polynucleotide sequences. This invention further includes variants of the polynucleotides described herein, encoding fragments such as partial or complete proteins, analogs, and polypeptide derivatives of the amino acid sequences disclosed herein, preferably SEQ ID NOs: 2-5, 7, 8, 11, or 12. Variants of polynucleotides can be naturally occurring allelic variants or non-naturally occurring variants of the polynucleotides. For example, nucleic acid variants may simply be due to differences in amino acid codon sequences caused by degeneracy of the genetic code, or they may include deletion variants, substitution variants, and addition or insertion variants. As is known in the art, allelic variants are alternative forms of polynucleotide sequences that may have one or more nucleotide substitutions, deletions, or additions, but do not substantially alter the biological function of the encoded polypeptide. In a further embodiment, the polynucleotide of the present invention encodes a specific heterodimer, wherein the heterodimer comprises a first recombinase enzyme having an amino acid sequence having at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 2, 3, 7, 8, 15, 18, 21, or 24, and a second recombinase enzyme having an amino acid sequence having at least 70%, preferably 80%, and more preferably 90% sequence identity with the sequence according to SEQ ID NO: 4, 5, 11, 12, 16, 19, 22, or 25, for identifying upstream and downstream target sequences of the recombinase target site. In one embodiment, the polynucleotide of the present invention comprises the nucleic acid of SEQ ID NO: 27 and the nucleic acid of SEQ ID NO: 29. In a further embodiment, the polynucleotide of the present invention comprises the nucleic acid of SEQ ID NO: 27 and the nucleic acid of SEQ ID NO: 30. In a further embodiment, the polynucleotide of the present invention comprises the nucleic acid of SEQ ID NO: 28 and the nucleic acid of SEQ ID NO: 30. In a further embodiment, the polynucleotide of the present invention comprises the nucleic acid of SEQ ID NO: 32 and the nucleic acid of SEQ ID NO: 36. In a further embodiment, the polynucleotide of the present invention comprises the nucleic acid of SEQ ID NO: 32 and the nucleic acid of SEQ ID NO: 37.In a further embodiment, the polynucleotide of the present invention comprises the nucleic acid of SEQ ID NO: 33 and the nucleic acid of SEQ ID NO: 36. In a further embodiment, the polynucleotide of the present invention comprises the nucleic acid of SEQ ID NO: 40 and the nucleic acid of SEQ ID NO: 41. In a further embodiment, the polynucleotide of the present invention comprises the nucleic acid of SEQ ID NO: 43 and the nucleic acid of SEQ ID NO: 44. In a further embodiment, the polynucleotide of the present invention comprises the nucleic acid of SEQ ID NO: 46 and the nucleic acid of SEQ ID NO: 47. In a further embodiment, the polynucleotide of the present invention comprises the nucleic acid of SEQ ID NO: 49 and the nucleic acid of SEQ ID NO: 50. This invention also provides vectors comprising such polynucleotides, preferably expression vectors, used in genetically engineered host cells, or containing nucleic acid molecules or plurality of nucleic acid molecules according to the invention, and for producing polypeptides of the invention by recombinant technology, such as SEQ ID NO: 2-5, 7, 8, 11, 12, 15, 16, 18, 19, 21, 22, 24 or 25, preferably SEQ ID NO: 2-5, 7, 8, 11 or 12. Genetic engineering (transduction, transformation or transfection) of host cells is performed using such vectors, which can be, for example, selection vectors or expression vectors. For example, the vector can be in the form of plasmids, conjugated plasmids, viral particles, bacteriophages, etc. The vector or gene can be integrated into the chromosome at specific or unspecific sites. Genomic integration methods for recombinant DNA, such as homologous recombination or translocase-mediated integration, are well known in the art. The engineered host cells can be cultured in conventional nutrient media, modified as appropriate for activating promoters, selecting transformants, or amplifying the genes of the invention. Culture conditions, such as temperature and pH, are commonly used to select host cells for expression and are well known to those skilled in the art. Host cells can be mammalian, insect, plant, or bacterial host cells, including nucleic acid or recombinant polynucleotide molecules or the expression vectors described in this invention. The polynucleotide sequence in the expression vector is operatively linked to a suitable expression control sequence (promoter) to guide mRNA synthesis. Non-limiting and representative examples of such promoters include: LTR or SV40 promoters, *E. coli* lac, ara, rha, or trp promoters, bacteriophage λ PL promoters, and other known promoters controlling gene expression in prokaryotic or eukaryotic cells or their viruses. Those skilled in the art can select vectors based on desired characteristics, for example, producing vectors in specific cells such as mammalian or bacterial cells. Any of various inducible promoters or enhancers can be included in the vector for expressing the antibodies or regulated nucleic acids of this invention.Such induction systems include, for example, tetracycline-induced systems; heavy metal-induced metallothionein promoters; insect steroid hormones responsive to ecdysone or related steroids such as milrogstrogen; mouse mammary tumor virus (MMTV) induced by steroids such as glucocorticoids and estrogens; and heat shock promoters induced by temperature changes; rat neuron-specific enolase gene promoters; human β-actin gene promoters; human platelet-derived growth factor B (PDGF-B) chain gene promoters; rat sodium channel gene promoters; human copper-zinc superoxide dismutase gene promoters; and promoters of members of the mammalian POU-domain regulatory gene family. Regulatory elements, including promoters or enhancers, can be persistent or regulatory, depending on the nature of the regulation. The regulatory sequence or regulatory element is operatively linked to one of the polynucleotide sequences of the present invention, such that the physical and functional relationship between the polynucleotide sequence and the regulatory sequence allows for transcription of the polynucleotide sequence. Vectors that can be used for expression in eukaryotic cells may include, for example, regulatory elements including the CAG promoter, the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid-inducible promoter, Pgtf, the Moloney marine leukemia virus (MMLV) promoter, the thy-1 promoter, etc. If desired, the vector may contain selectable markers. As used herein, a "selectable marker" refers to a genetic element that provides a selectable phenotype for cells to be introduced with the selectable marker. Selectable markers are typically genes whose gene products are resistant to agents that inhibit cell growth or kill cells. Various selectable markers can be used in the DNA constructs of the present invention, including, for example, the Neo, Hyg, hisD, Gpt, and Ble genes, as described, for example, in Ausubel et al., 1999 and U.S. Patent No. 5,981,830. Drugs useful for selecting the presence of selectable markers include, for example, G418 for Neo, hygromycin for Hyg, histamine for hisD, xanthine for Gpt, and bleomycin for Ble. The DNA constructs of the present invention may contain positive selectable markers, negative selectable markers, or both. Various mammalian cell culture systems can also be used to express recombinant proteins. Examples of mammalian expression systems include the COS-7 strain of monkey kidney fibroblasts. Other cell lines capable of expressing compatible vectors include, for example, C127, 3T3, CHO, HeLa, and BHK cell lines. Mammalian expression vectors generally contain an origin of replication, a suitable promoter and enhancer, and any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcription termination sequences, and 5' flanking non-transcriptional sequences.DNA sequences from SV40 splicing and polyadenylation sites can be used to provide the desired non-transcriptional genetic elements. Peptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and lectin chromatography. Expression of the peptide on the cell surface can facilitate recovery, but this is not a prerequisite. Recovery of cleavage products from peptides expressed in longer forms may also be desirable. If necessary, protein refolding steps known in the art can be used to complete the configuration of the mature protein. The final purification step can be performed using high-performance liquid chromatography (HPLC). According to a further embodiment of the invention, a gene therapy vector is provided, for example, for systemically or locally increasing the expression of the genetically engineered protein of the invention in an individual. This gene therapy vector can be used to prevent, alleviate, improve, reduce, inhibit, and / or treat diseases that can be treated by genome editing, particularly hemophilia A. The gene therapy vector typically comprises an expression capsule containing a polynucleotide encoding the genetically engineered DNA recombinant enzyme of the present invention. In one embodiment, the vector is a viral vector. In a preferred embodiment, the viral vector is derived from a virus selected from the group consisting of: adenovirus, retrovirus, lentivirus, herpesvirus, and adeno-associated virus (AAV). In a more preferred embodiment, the vector is derived from one or more adeno-associated virus (AAV) serotypes 1-11, or any subgroup thereof, or any engineered form. In another embodiment, the viral vector is encapsulated in anionic liposomes. In yet another embodiment, the vector is a non-viral vector. In a preferred embodiment, the non-viral vector is selected from the group consisting of: naked DNA, cationic liposome complexes, cationic polymer complexes, cationic liposome-polymer complexes, and exosomes. If the vector is a viral vector, the expression box appropriately contains, in the 5' to 3' direction (from the perspective of the mRNA to be transcribed), a first inverted terminal repeat, an enhancer, a promoter, a polynucleotide encoding the genetically engineered DNA recombinant enzyme of the present invention, a 3' untranslated region, a polyadenylation (polyA) signal, and a second inverted terminal repeat. The promoter is, for example, selected from the group consisting of cytomegalovirus (CMV) promoters and chicken β-actin (CAG) promoters. The polynucleotide preferably comprises DNA, cDNA, RNA, or mRNA. In a preferred embodiment, the polynucleotide encoding the genetically engineered DNA recombinant enzyme of the present invention comprises one or more polynucleotides of SEQ ID NO: 27-30, 32, 33, 36, 37, 40, 41, 43, 44, 46, 47, 49, and 50.In a preferred embodiment, the polynucleotide encoding the genetically engineered DNA recombinant enzyme of the present invention has at least about 75%, 80%, 85%, or 90% sequence identity with one or more sequences of SEQ ID NO: 27-30, 32, 33, 36, and 37, for example, at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% sequence identity. The present invention further relates to the use of the genetically engineered DNA recombinant enzyme of the present invention, or the nucleic acid molecule or plurality of nucleic acid molecules of the present invention, or the recombinant polynucleotide, or the expression vector of the present invention as a drug. In a preferred embodiment, the present invention further relates to the use of the genetically engineered DNA recombinant enzyme of the present invention, or the nucleic acid molecule or plurality of nucleic acid molecules of the present invention, or the recombinant polynucleotide, or the expression vector of the present invention for the prevention or treatment of diseases that can be treated by genome editing, particularly hemophilia A. In a further embodiment, the invention relates to the use of the genetically engineered DNA recombinant enzyme of the invention, or the nucleic acid molecule or plurality of nucleic acid molecules of the invention, or recombinant polynucleotides, or expression vectors of the invention, for the preparation of medicaments for the prevention or treatment of diseases treatable by genome editing. According to a preferred embodiment, the disease is a hereditary disease or condition. According to a particularly preferred embodiment, the disease or condition is hemophilia A. In another embodiment, the invention relates to a method for the prevention or treatment of a disease treatable by genome editing, particularly hemophilia A, comprising administering a therapeutically effective amount of the genetically engineered DNA recombinant enzyme of the invention, or the nucleic acid molecule or plurality of nucleic acid molecules of the invention, or recombinant polynucleotides, or expression vectors to a patient in need. The genetically engineered DNA recombinant enzyme of the invention, or the nucleic acid molecule or plurality of nucleic acid molecules of the invention, or recombinant polynucleotides, or expression vectors, can be used to treat, particularly, hereditary diseases or diseases caused by hereditary conditions. A particularly preferred embodiment relates to the treatment of severe forms of hemophilia A. The invention also provides a method for producing a complex of specific DNA recombinase enzymes. According to a preferred embodiment, the method comprises the following steps: (i) introducing a single amino acid substitution into the catalytic region of a first DNA recombinase enzyme, wherein the single amino acid substitution renders the first DNA recombinase enzyme inactive; (ii) introducing a single amino acid substitution into the catalytic region of a second DNA recombinase enzyme, wherein the single amino acid substitution renders the second DNA recombinase enzyme inactive; (iii) co-expressing the mutated first and mutated second DNA recombinase enzymes in a host cell; and (iv) isolating the mutated first and mutated second DNA recombinase enzymes from the host cell.The present invention further provides a method for generating a specific DNA recombinase for genome editing, preferably for DNA sequence recombination, comprising the following steps: i. providing a nucleic acid molecule encoding a first recombinase enzyme and a nucleic acid molecule encoding a second recombinase enzyme, wherein the first recombinase enzyme binds to a first half-site of an asymmetric recombinase target site, and the second recombinase enzyme binds to a second half-site of the asymmetric recombinase target site, wherein the first recombinase enzyme and the second recombinase enzyme form a heterodimer capable of inducing specific DNA recombination at a position of interest in the DNA sequence at the asymmetric recombinase target site, wherein the asymmetric recombinase target site comprises the first and second half-sites of the recombinase target site, which are distinct and not palindromic; ii. inducing mutations to create a nucleic acid molecule library encoding a mutant first recombinase enzyme and a nucleic acid molecule library encoding a mutant second recombinase enzyme, wherein the mutation is introduced into the first recombinase enzyme and the second recombinase enzyme; iii. An expression vector is created by selecting a nucleic acid library encoding a first mutant recombinase enzyme and a nucleic acid library encoding a second mutant recombinase enzyme into an expression vector, wherein the expression vector carries the DNA sequence of interest, which is to be recombined; iv. Cells are transfected with the expression vectors of step iii, and the libraries of the first mutant recombinase enzyme and the second mutant recombinase enzyme are expressed in the same cells, resulting in the formation of a recombinase heterodimer containing the first mutant recombinase enzyme and the second mutant recombinase enzyme; v. The heterodimers obtained in step iv are positively selected to induce position-specific DNA recombination of the sequence of interest at an asymmetric recombinase target site in DNA; vi. The heterodimers obtained in steps iv or v are negatively selected to prevent the induction of position-specific DNA recombination of the sequence of interest at an off-target, and preferably symmetric, recombinase target site in DNA; vii. The selected DNA recombinase is capable of recombinating the DNA sequence of interest at the asymmetric recombinase target site within DNA, but not at the off-target recombinase target site. Surprisingly, it has been found that monomer-monomer interface mutations not only block homodimer formation but also drastically reduce the recombination activity of heterodimers at the asymmetric recombinase target site. Mutations in the catalytic regions of the first and second recombinase enzymes lead to the formation of highly active heterodimers at the asymmetric recombinase target site.Therefore, in a preferred embodiment of the method of the present invention, the first mutant recombinase enzyme and the second mutant recombinase enzyme in the obligate DNA recombinase obtained in step vii each contain at least one mutation at the catalytic site, the at least one mutation rendering the first recombinase enzyme and the second recombinase enzyme inactive when acted alone. More preferably, the first mutant recombinase enzyme and the second mutant recombinase enzyme in the obligate DNA recombinase obtained in step vii do not contain monomer-monomer interface mutations. The first recombinase enzyme and the second recombinase enzyme system according to steps ii to vi are preferably evolved by matrix-linked directed evolution (SLiDE) or directed evolution. Recombinase evolution using matrix-linked directed evolution (SLiDE) is known in the art and is described, for example, in Buchholz and Stewart, 2001; Sakara et al., 2007; Karpinski et al., 2016; and Lansing et al., 2020 and WO 2018 / 229226 A1, as described below. In a preferred embodiment, the selection of steps v and vi of the method according to the invention is performed repeatedly between selecting a specific heterodimer with catalytic activity at an asymmetric target site (forward selection) and a heterodimer without catalytic activity at an off-target site, preferably a symmetric target site. The method according to the invention includes the generation of positive selection pressure at asymmetric target sites and negative selection pressure at symmetric target sites, wherein the positive and negative selection pressures are achieved by error-prone PCR (e.g., error-prone MyTaq DNA polymerase, Bioline) by diversifying two DNA recombinase libraries and selecting mutant pairings of the first and second recombinase enzymes to make them active at the desired asymmetric target sites. This is illustrated in more detail in Working Example 2 and Figures 2 and 15. More preferably, at least 10, more preferably at least 15, and most preferably at least 20 SLiDE cycles of positive and negative selection are performed. In another preferred embodiment of the method of the invention, positive and negative selection screening includes purifying the expression vector after cell culture obtained in step iv, and analyzing the recombinant and unrecombinant vectors. Preferably, positive selection is performed on the asymmetric target site loxF8, and negative selection is performed on the symmetric target sites loxF8R and loxF8L. The method according to the invention may further include the following steps: viii. identifying potential off-target sites of the desired specific DNA recombinase; ix. analyzing the recombinase activity of the desired specific DNA recombinase at the identified off-target sites; and x. selecting specific DNA recombinases that do not exhibit recombinase activity at at least one off-target site. The invention further relates to specific DNA recombinases identified or obtained using any of the above methods.The characteristics, properties, and embodiments of specific DNA recombinases described above also apply to methods for producing specific DNA recombinases for genome editing and the specific DNA recombinases obtained by such methods. The genetically engineered DNA recombinant enzymes of the present invention, or the nucleic acid molecules, recombinant polynucleotides, expression vectors, or host cells of the present invention, may be further included in pharmaceutical compositions, which may, if desired, contain one or more therapeutically acceptable diluents or carriers. According to another embodiment, the present invention provides pharmaceutical compositions, for example, for the prevention or treatment of diseases treatable by genome editing, such as hemophilia A. Pharmaceutical compositions of the present invention comprise at least one first DNA recombinase enzyme and / or at least one second DNA recombinase enzyme or the DNA recombinant enzyme of the present invention, or the nucleic acid molecules or plurality of nucleic acid molecules of the present invention, or multiple recombinant polynucleotides, or expression vectors, or the host cells of the present invention, and one or more therapeutically acceptable diluents or carriers. According to a preferred embodiment, a pharmaceutical composition comprises a therapeutically effective amount of a carrier, the carrier comprising a nucleic acid sequence encoding one or more genetically engineered proteins according to the present invention, or a nucleic acid comprising a therapeutically active amount of a genetically engineered recombinant DNA enzyme according to the present invention, or a recombinant genetically engineered DNA enzyme according to the present invention comprising a therapeutically active amount, or a host cell according to the present invention comprising a therapeutically active amount (collectively, "therapeutic agent"). The present invention also provides a method for treating diseases or conditions, particularly hereditary diseases or conditions, by administering to an individual in need a therapeutically effective amount of a genetically engineered DNA recombinant enzyme, or a nucleic acid molecule, or a recombinant polynucleotide, or an expression carrier, or a host cell according to the present invention. It is understood that the single dose or total daily dose of the therapeutic agent and composition of the present invention will be determined by the attending physician within a reasonable medical judgment. The specific therapeutically effective dose level for any particular patient will depend on a variety of factors, including the condition being treated and its severity; the activity of the specific compound used; the specific components used; the patient's age, weight, general health, sex, and diet; the timing, route of administration, and excretion rate of the specific compound used; the duration of treatment; the combination with or concurrent use of the specific nucleic acid or peptide used; and similar factors well-known in the medical field. For example, within the skill level of this art, the initial dose of the compound is lower than that required to achieve the desired therapeutic effect, and the dose is gradually increased until the expected effect is achieved. However, the daily dose of the product may vary widely from day to day for each adult. The therapeutically effective dose of the therapeutic active agent to be administered, such as the carrier according to the invention, and the dose of the viral or non-viral particles and / or pharmaceutical components described herein to treat the pathological condition will depend on many factors, including the patient's age and condition, the severity of the disturbance or condition, the method and frequency of administration, and the specific peptide to be used.Pharmaceutical compositions containing the therapeutic active agent according to the invention can be in any form suitable for a chosen administration method. In one embodiment, the pharmaceutical composition of the invention is administered parenterally. As used herein, the phrase "parenteral administration" refers to administration other than intestinal and local administration, typically by injection, including intradermal, intravenous, intramuscular, intraarterial, intrasheath, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratendonal, tracheal, subcutaneous, subcutaneous, intra-articular, subcapsular, subarachnoid, intraspinal, intracranial, intrathoracic, epidural, and intraspinal injections and infusions. The therapeutic active agent of the invention can be administered to animals and humans as the sole active agent or in combination with other active agents, in unit dose form, as a mixture with conventional pharmaceutical supports. In a further embodiment, the pharmaceutical composition contains a pharmaceutically acceptable vehicle for injectable formulations. These mediators may be, in particular, isotonic, sterile saline solutions (sodium dihydrogen phosphate or disodium hydrogen phosphate, sodium chloride, potassium chloride, calcium chloride, or magnesium chloride and the like, or mixtures of such salts), or dried (particularly lyophilized) compositions, which, depending on the circumstances, may be used to create injectable solutions upon the addition of sterilized water or physiological saline. Suitable pharmaceutical forms for injection include sterile aqueous solutions (when water-soluble) or dispersions of propylene glycol or sterile powders for the immediate preparation of sterile injectable solutions or dispersions. Suitable pharmaceutical forms for injection include sterile aqueous solutions or dispersions; preparations including aqueous solutions of sesame oil, peanut oil, or propylene glycol; and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be a fluid. It must be stable under manufacturing and storage conditions and must be preservative-resistant against microbial contamination (such as bacteria and fungi). Solutions containing therapeutic active agents as free bases or pharmaceutically acceptable salts can be prepared in water appropriately mixed with a surfactant such as hydroxypropyl cellulose. Dispersants can also be prepared in glycerol, liquid polyethylene glycol and mixtures thereof, as well as oils. Under normal storage and use conditions, these formulations contain preservatives to prevent microbial growth. Therapeutic active agents can be formulated into compositions in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (forming with the free amino groups of proteins) and those formed with inorganic acids such as hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc. Salts formed with free carboxyl groups can also be derived from inorganic bases such as hydroxides of sodium, potassium, ammonium, calcium, or iron, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, etc.The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Appropriate fluidity can be maintained, for example, by using coatings such as lecithin, by maintaining the desired particle size in the case of a dispersion, and by using surfactants. Antimicrobial action can be achieved by various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenols, sorbic acid, sodium thiomercurate, and the like). In many cases, isotonic agents, such as sugars or sodium chloride, are preferred. Long-term absorption of the injectable composition can be achieved by using an absorption-delaying agent (e.g., aluminum monostearate and gelatin) in the composition. The sterile injection solution is prepared by adding the required amount of active peptide to a suitable solvent, and, if necessary, adding the other components mentioned above, followed by filtration and sterilization. Typically, dispersions are prepared by adding various sterilized active ingredients to a sterile carrier containing a basic dispersion medium and other desired components listed above. In the case of preparing sterile powders for sterile injectable solutions, preferred methods include vacuum-drying and freeze-drying techniques, which yield an active ingredient powder plus any additional desired components from its prior sterile-filtered solution. After formulation, the solution can be administered in a manner appropriate to the dosage formulation and at a therapeutically effective amount. These formulations are readily administered in various dosage forms, such as the aforementioned injectable solutions, but drug-release capsules are also possible. Multiple-dose administration is also possible. Where appropriate, the therapeutic active agents described herein can be formulated for delivery in any suitable carrier. For example, they can be placed in pharmaceutically acceptable suspensions, solutions, or emulsions. Suitable media include saline and liposome formulations. More specifically, pharmaceutically acceptable carriers can include non-aqueous solutions of sterile aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include, but are not limited to, water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Intravenous carriers include fluids and nutritional supplements, electrolyte supplements (such as those based on Ringer's glucose), etc. Preservatives and other additives may also be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases. Colloidal dispersion systems can also be used for targeted gene delivery. Colloidal dispersion systems include macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, microcells, hybrid microcells, and liposomes. Appropriate treatment regimens can be determined by a physician and depend on the individual's age, sex, weight, and stage of disease.As an example, for the delivery of the nucleic acid sequence encoding the genetically engineered DNA recombinant enzyme of the present invention using a viral expression vector, each unit dose of the genetically engineered DNA recombinant enzyme expression vector may contain 2.5 μl to 100 μl of composition, which includes the viral expression vector in a pharmaceutically acceptable liquid at a concentration of 10 per ml. 11 Up to 10 16A viral genome, for example. The effective dose and dosage regimen of the recombinant polypeptide form of the genetically engineered DNA recombinant enzyme or its subunits of the present invention depend on the disease or condition to be treated and can be determined by those skilled in the art. An exemplary, non-limiting range of the therapeutically effective amount of the genetically engineered DNA recombinant enzyme of the present invention is about 0.1-10 mg / kg / body weight, for example about 0.1-5 mg / kg / body weight, for example about 0.1-2 mg / kg / body weight, for example about 0.1-1 mg / kg / body weight, for example about 0.15, about 0.2, about 0.5, about 1, about 1.5, or about 2 mg / kg / body weight. A physician or veterinarian with ordinary skills in the art can readily determine and prescribe the required effective amount of the pharmaceutical composition. For example, a physician or veterinarian can start with a dose of the therapeutic active agent of the present invention used in the pharmaceutical composition below a level below the desired therapeutic effect and gradually increase the dose until the desired effect is achieved. Generally, the appropriate daily dose of the composition of the present invention will be the amount of the delivery system at the lowest effective dose to produce a therapeutic effect. This effective dose generally depends on the factors described above. The administration method may be, for example, intravenous injection, intramuscular injection, intraperitoneal injection, or subcutaneous injection, e.g., proximal to the target site. If desired, the daily effective dose of the pharmaceutical composition may be administered as two, three, four, five, six, or more doses at appropriate intervals throughout the day, in unit dose form as needed. While the administration system of the present invention can be administered individually, it is preferred to administer the administration system as described above for the pharmaceutical composition. Further provided are kits comprising the therapeutic active agent described above and herein. In one embodiment, the kit provides the prepared therapeutic active agent in one or more unit dosage forms, such as in pre-filled syringes or ampoules, for individual administration. In another embodiment, the therapeutic active agent is provided in lyophilized form.The nucleic acid sequence of a potential target site for a DNA recombinant enzyme capable of inducing location-specific DNA recombination of a sequence of interest in the genome can be determined according to the method described in WO 2018 / 229226 A1, which includes, for example, the following steps: a) screening the genome or a portion thereof containing the sequence of interest to identify two potential spacer sequences of at least 5 bp and at most 12 bp in length, one potential spacer sequence being upstream of the sequence of interest and the other potential spacer sequence being downstream of the sequence of interest, wherein the maximum distance between the two sequences is 2 megabases or less, preferably 1.5 megabases or less or 1 megabases or less, more preferably 900 kb, 800 kb, 700 kb, 600 kb or 500 kb, most preferably 400 kb or 300 kb, and the minimum distance is 150 bp; b) By identifying adjacent nucleotides, preferably 10 to 20 nucleotides, more preferably 12 to 15 nucleotides, and most preferably 13 nucleotides, to one side of each potential spacer sequence, a potential first half-site is formed, and preferably 10 to 20 nucleotides, more preferably 12 to 15 nucleotides, and most preferably 13 nucleotides, a potential second half-site is formed. The two potential half-sites and the spacer sequence in between form a potential target site. c) Further screening of the potential target sites identified in step b) to select potential target site sequences that do not appear elsewhere in the host genome to ensure sequence-specific recombination, preferably in reverse order. Preferably, the identified potential target site sequences for DNA recombinases are naturally occurring in the genome. The first and second recombinase enzymes can be evolved by directed evolution or rational design, preferably by, for example, by substrate-linked directed evolution (SLiDE) as described in WO 2018 / 229226 A1, wherein the directed evolution includes the following steps: a) selecting an upstream nucleotide sequence of the nucleotide sequence to be modified as a first target site and a downstream nucleotide sequence of the nucleotide sequence to be modified as a second target site, wherein the sequences of the target sites are preferably different, wherein each target site includes a first half-site and a second half-site, each site having 10 to 20 nucleotides, separated by a spacer sequence of 5 to 12 nucleotides; b) using a carrier containing the first and second target sites selected in a) as a substrate, performing molecular directed evolution on at least one DNA recombinase enzyme library until at least one first specially designed DNA recombinase enzyme active to the first target site and at least one second specially designed DNA recombinase enzyme active to the second target site selected in a) are obtained. Choosing asymmetric target locations provides an opportunity to compare two different evolutionary strategies.A single recombinase can evolve to simultaneously recognize 10 to 20 bp, more preferably 12 to 15 bp, and most preferably 13 bp halves, or two recombinases can evolve in parallel for each halves. Combining these two recombinases can form a functional heterodimer capable of recombinating asymmetric sites. In one embodiment of the invention, it is preferred to evolve a single recombinase to recognize both 10 to 20 bp, more preferably 12 to 15 bp, and most preferably 13 bp halves. In another embodiment of the invention, it is preferred to evolve two recombinases in parallel for each halves, thereby forming a heterodimer. Because the heterodimer consists of two recombinases, they can form a heterodimer or two different homodimers, increasing the potential number of recognized sequences. This approach may be detrimental to increasing the chance of unintended recombination at off-target sites. To reduce the chance of recombination at off-target sites, the objective of this invention is to limit the homodimerization of monomers. To achieve this goal, recombinase monomers are physically fused / bound together to force the desired heterodimer assembly, facilitated by the mutations disclosed herein. To select genetically engineered DNA recombinant enzymes with high specificity to the desired recombinase target site, i.e., genetically engineered DNA recombinant enzymes exhibiting reduced off-target recombination, the method of the present invention, in another embodiment, may include the following steps: i. identifying potential off-target sites of the desired genetically engineered DNA recombinant enzyme; ii. analyzing the recombinase activity of the desired genetically engineered DNA recombinant enzyme at the off-target sites identified in step i; and iii. selecting genetically engineered DNA recombinant enzymes that do not exhibit recombinase activity at at least one off-target site. Recombinase off-target sites can be identified, for example, using bioinformatics methods known to those skilled in the art. Other methods include ChIP-Seq-based assays, identifying human putative off-targets after verification by qPCR and DNA enrichment. These methods are also known to those skilled in the art. The recombinase activity at these potential off-target sites of genetically engineered DNA recombinases can be experimentally assessed by using genomic sequences as reporter vectors for excision of selected bacterial colonies, as described below. Off-target recombination can then be detected by monitoring the expression of the reporter gene, for example, using PCR-based detection methods. Such detection can also be performed in human tissue cultures to investigate whether genetically engineered DNA recombinases alter off-target sites in vivo. Preferably, the genetically engineered DNA recombinant enzyme of the present invention targets sequences having SEQ ID NO: 65 and 66. The loxF8 exhibits high specificity at its target site and no activity at off-target sites with high induction levels. Preferably, the off-target sites are not recognized by the genetically engineered DNA recombinant enzyme of this invention and are selected from the group consisting of SEQ ID NOs: 67 to 83 shown in Table 4. A particular advantage of this invention is that any recombinase target site can be used to evolve the recombinase enzyme for use as a genetically engineered DNA recombinase enzyme exhibiting specific activity toward this recombinase target site. Because the method of this invention includes providing a specific recombinase complex with target site specificity, wherein the monomer of the recombinase heterodimer is specifically adapted by introducing a single mutation into the evolved or naturally occurring recombinase. A further advantage of the method of this invention is that the undesired off-target activity of the recombinase complex, i.e., the genetically engineered DNA recombinase, can be greatly reduced, preferably completely eliminated. This makes the specific recombinase complex, i.e., the genetically engineered DNA recombinase, particularly suitable for gene therapy. In a further embodiment, the present invention provides a method for determining genomic-level recombination in host cell culture, the method comprising a genetically engineered DNA recombinant enzyme for efficient and specific genome editing according to the present invention, wherein the method comprises the following steps: i. providing a nucleic acid molecule encoding a first recombinase enzyme, wherein the first recombinase enzyme has been evolved by directed evolution or rational design to a first half-site specifically recognizing a recombinase target site, and the first recombinase enzyme contains at least one mutation that inactivates the catalytic activity of the first recombinase enzyme as a DNA recombinase enzyme; ii. providing a nucleic acid molecule encoding a second recombinase enzyme, wherein the second recombinase enzyme has been evolved by directed evolution or rational design to a second half-site specifically recognizing a recombinase target site, and the second recombinase enzyme contains at least one mutation that inactivates the catalytic activity of the second recombinase enzyme as a DNA recombinase enzyme; iii. An expression vector is created by selecting nucleic acid molecules encoding the first recombinase enzyme of step i and the second recombinase enzyme of step ii) into an expression vector, the expression vector further comprising a first reporter gene for expressing the first reporter protein; iv. Host cells are transfected with the expression vector of step iii, and the host cells are transfected with reporter plastids comprising the second reporter gene to express the second reporter protein; v. A genetically engineered DNA recombinase comprising the first and second recombinase enzymes, wherein the genetically engineered DNA recombinase is fused with the first reporter gene; and the second reporter protein is expressed; vi. Cells exhibiting dual expression of the first and second reporter proteins are identified, indicating successful recombination, and thus complementing the function of DNA recombinases by forming a specific genetically engineered DNA recombinase comprising the first and second recombinase enzymes. According to step iii, a suitable first reporter gene is a gene encoding EGFP. Therefore, the suitable first reporter protein is EGFP. According to step iv, a suitable second reporter gene is a gene encoding mCherry. Therefore,A suitable second reporter protein line, mCherry, is used. The advantage of this system is that the transfection efficiency of cells transfected with both phenoplastins and reporter plastids can be measured based on GFP fluorescence. GFP and mCherry double-positive cells reflect recombination of the reporter gene in human cells. To calculate the recombination efficiency of reporter plastids in human cells, double-positive cells can be normalized to transfection efficiency. Genetically engineered first and second recombinase enzymes, and single mutations that render their DNA recombinase activity inactive, are suitable for determining genomic-level recombination in host cell culture, as described above. Similarly, suitable first and second recombinase enzyme pairs are also described above, forming specific DNA recombinase complexes with complementary DNA recombinase activities. For example, the genetically engineered DNA recombinase enzyme described herein was developed to correct the large gene inversion of exon 1 of the F8 gene causing hemophilia A. To study the inversion effect of heterodimers at the genomic level, an in vitro recombinase assay as described in Example 9 was developed. In cells exhibiting recombinase expression, the inverse effect of the obligate heterodimer at the genomic level was found to be the same as that of the non-obligatory heterodimer. This is also demonstrated by the deletion efficiency of the obligate heterodimer according to the invention (see Example 6 and Figure 3, particularly Figure 3C). The deletion efficiency of the obligate heterodimer according to the invention is even slightly increased. This is surprising, as conventional obligate heterodimers generated by altering the protein-protein interface show a significant decrease in recombinant activity. Therefore, in another embodiment of the present invention, a method for reversing DNA sequences at the genomic level of a cell is provided, wherein the method comprises the following steps: i. providing a nucleic acid molecule encoding a first recombinase enzyme, wherein the first recombinase enzyme contains at least one mutation in its catalytic region that deactivates the catalytic activity of the first recombinase enzyme as a DNA recombinase, and wherein the first recombinase monomer specifically recognizes a first half-site of the recombinase target site; ii. providing a nucleic acid molecule encoding a second recombinase enzyme, wherein the second recombinase enzyme contains at least one mutation in its catalytic region that deactivates the catalytic activity of the second recombinase enzyme as a DNA recombinase, and wherein the second recombinase monomer specifically recognizes a second half-site of the recombinase target site; iii. creating an expression vector by selecting the nucleic acid molecule encoding the first recombinase enzyme and the nucleic acid molecule encoding the second recombinase enzyme into an expression vector; iv. delivering the expression vector of step iii to a cell containing the DNA sequence to be reversed; v. expressing the first and second recombinase enzymes in the cell; vi. The first and second recombinase enzymes are expressed in the cell, and the DNA sequence to be reversed is reversed on the cell's chromosome. According to a preferred embodiment, the cell is a human cell, and the reversal occurs on the human chromosome of the cell. According to a particularly preferred embodiment, the cell is not a human germ cell. Preferably,The DNA recombinant enzyme of the present invention described herein, in step v, preferably identifies the upstream target site and the first and second half-sites of the downstream target site of the recombinase, and most preferably identifies the upstream target site of SEQ ID NO: 65 and the downstream target site of SEQ ID NO: 66 of the loxF8 recombinase, or their reverse complementary sequences. According to one embodiment, the expression vector of step iii is delivered to the cell, for example, by transfection. According to an alternative embodiment, the method does not include the step of creating the expression vector, but includes delivering an RNA molecule encoding the genetically engineered DNA recombinant enzyme according to the present invention to the cell. In one embodiment, the method of reverse DNA sequencing at the genomic level is performed in a genetically engineered host cell. In a preferred embodiment, the method of reverse DNA sequencing at the genomic level is performed in vivo in human cells from a patient, more preferably from a patient with hemophilia A. In a further preferred embodiment, the method for reverse DNA sequencing at the genomic level is performed in vivo in a patient, particularly a patient with hemophilia A. Genetically engineered first and second recombinase enzymes, along with a single mutation rendering their DNA recombinase activity inactive, are suitable for methods of reverse DNA sequence at the genomic level in host cell culture, as described above. Similarly, suitable pairings of the first and second recombinase enzymes are also described above, forming specific DNA recombinase complexes with complementary DNA recombinase activities. According to a further embodiment, the present invention provides a method for treating or preventing a disease comprising administering to an individual in need the genetically engineered DNA recombinase of the present invention, or a nucleic acid molecule or multiple nucleic acid molecules, or an expression vector, or a host cell, or a pharmaceutical composition. The present invention further provides a method for treating or preventing hemophilia A, comprising administering to an individual in need the genetically engineered DNA recombinase of the present invention, or a nucleic acid molecule or multiple nucleic acid molecules, or an expression vector, or a host cell, or a pharmaceutical composition. If desired, the hemophilia A is severe hemophilia A. The present invention further provides a method for recombinating a targeted DNA sequence in cells, comprising introducing the following into the cells: (a) a nucleic acid molecule encoding the first recombinase enzyme and a nucleic acid molecule encoding the second recombinase enzyme of the present invention; and / or (b) the first recombinase enzyme and the second recombinase enzyme of the present invention, thereby recombinating the targeted DNA sequence of the cells. According to one embodiment, the nucleic acid molecule encoding the first recombinase enzyme and / or the nucleic acid molecule encoding the second recombinase enzyme is mRNA. According to a further embodiment, the nucleic acid molecule encoding the first recombinase enzyme and / or the nucleic acid molecule encoding the second recombinase enzyme is an expression vector.Preferred is the expression vector as described herein. This invention also relates to the following: Item 1. A genetically engineered DNA recombinant enzyme comprising a complex of at least one first DNA recombinase enzyme and at least one second DNA recombinase enzyme, wherein the first DNA recombinase enzyme and the second DNA recombinase enzyme specifically recognize a first half-site and a second half-site of an upstream target site and / or a downstream target site of a DNA recombinase, wherein each of the first DNA recombinase enzyme and the second DNA recombinase enzyme comprises a single amino acid substitution in its catalytic region, wherein the first DNA recombinase enzyme and the second DNA recombinase enzyme carrying the single amino acid substitution, when expressed alone, do not exhibit DNA recombinase catalytic activity, and wherein the first DNA recombinase enzyme and the second DNA recombinase enzyme carrying the single amino acid substitution, when expressed together and forming a complex, exhibit DNA recombinase catalytic activity. Preferably, the single amino acid substitution in the catalytic region of the first recombinase enzyme is different from the single amino acid substitution in the catalytic region of the second recombinase enzyme. More preferably, the single amino acid substitution in the catalytic region of the first recombinase enzyme and the single amino acid substitution in the catalytic region of the second recombinase enzyme are located at different positions in the catalytic region. Item 2. The DNA recombinase enzyme according to Item 1, wherein the at least one first recombinase and the at least one second recombinase are of the same type. Item 3. The DNA recombinase enzyme according to Item 2, wherein both the at least one first recombinase and the at least one second recombinase are Cre recombinase, Dre recombinase, VCre recombinase, SCre recombinase, Vika recombinase, λ-Int recombinase, Flp recombinase, R recombinase, Kw recombinase, Kd recombinase, B2 recombinase, B3 recombinase, Nigri recombinase, or Panto recombinase. Project 4. A DNA recombinant enzyme according to any one of Projects 1 to 3, wherein the DNA recombinant enzyme is a recombinase complex in the form of a heterotetrameric form. Project 5. A DNA recombinant enzyme according to any one of the preceding projects, wherein the single amino acid substitution in the at least one first and the at least one second recombinase enzyme is at the position of the retained amino acid in the catalytic region. Project 6. A DNA recombinant enzyme according to any one of the preceding projects,The single amino acid substitution system in the at least one first recombinant enzyme and the at least one second recombinant enzyme is selected from the group consisting of: E129R, Q133H, R173A, R173C, R173D, R173E, R173F, R173G, R173I, R173K, R173L, R173M, R173N, R173P, R173Q, R173S, R173T, R173V, R173W, R173Y, E176H, E176I, E176L, E176M, E176V, E1 76W, E176Y, K201A, K201C, K201C, K201D, K201F, K201G, K201H, K201I, K201L, K201M, K201N, K 201P, K201Q, K201R, K201S, K201T, K201V, K201W, K201Y, H289D, H289E, H289I, H289K, H289R, H 289W, R292A, R292C, R292E, R292F, R292G, R292H, R292I, R292L, R292M, R292N, R292P, R292Q, R292S, R292T, R292V, R292W, R292Y, Q311R, W315C, W315E, W315G, W315I, W315K, W315L, W315M W315N, W315Q, W315R, W315S, W315T, W315V, Y324A, Y324C, Y324E, Y324F, Y324H, Y324I, Y324K, Y324L, Y324M, Y324N, Y324Q, Y324R, Y324S, Y324T, Y324V, and Y324W, or in the corresponding position of another recombinase, preferably in the corresponding position of SEQ ID NO: 14, SEQ ID NO: 17, or SEQ ID NO: 20. Item 7. A DNA recombinant enzyme according to any of the foregoing items,The single amino acid substitution in the at least one first and the at least one second recombinant enzyme is selected from the group consisting of: (i) E129, Q133, R173, E176, K201, H289, R292, Q311, W315 and Y324 of SEQ ID NO: 1; (ii) E146, Q151, R191, N194, K219, H308, R311, Q330, W334 and Y343 of SEQ ID NO: 14; (iii) E130, Q134, R174, E177, K202, H290, R293, Q312, W316 and Y325 of SEQ ID NO: 17; (iv) SEQ ID NO: 20 of E131, Q135, R175, E178, K202, H290, R293, Q312, W316 and Y325; or (v) at an amino acid position of another recombinase, wherein the amino acid position of the other recombinase corresponds to position E129, Q133, R173, E176, K201, H289, R292, Q311, W315 or Y324 of SEQ ID NO: 1. Item 8. A genetically engineered DNA recombinant enzyme comprising a complex of at least one first DNA recombinase enzyme and at least one second DNA recombinase enzyme, wherein (i) the first recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7 and containing a single mutant K201R in its catalytic region; and wherein the second recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7 and containing a single mutant Q311R in its catalytic region; or (ii) the first recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7 and containing a single mutant K201R in its catalytic region; and wherein the second recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7 and containing a single mutant K201R in its catalytic region; and wherein the second recombinase enzyme is a polypeptide having an amino acid sequence with at least 70%, preferably 80%, more preferably 90% sequence identity with the sequence according to SEQ ID NO: 7 and containing a single mutant Q311R in its catalytic region. A polypeptide having at least 70%, preferably 80%, and more preferably 90% sequence identity with the amino acid sequence of SEQ ID NO: 2 and containing a single mutant Q311K in its catalytic region. Item 9. A DNA recombinant enzyme comprising: (i) a first Cre recombinase enzyme containing a single mutant K201R in its catalytic region and having an amino acid sequence having at least 70%, preferably 80%, and more preferably 90% identity with the polypeptide having the sequence according to SEQ ID NO: 2; and a second Cre recombinase,The enzyme comprises a single mutant Q311R in the catalytic region and has an amino acid sequence that is at least 70%, preferably 80%, and more preferably 90% identical to the polypeptide having the sequence according to SEQ ID NO: 5; (ii) a first Cre recombinase enzyme comprising a single mutant K201R in the catalytic region and having an amino acid sequence that is at least 70%, preferably 80%, and more preferably 90% identical to the polypeptide having the sequence according to SEQ ID NO: 2; and a second Cre recombinase enzyme comprising a single mutant Q311K in the catalytic region and having an amino acid sequence that is at least 70%, preferably 80%, and more preferably 90% identical to the polypeptide having the sequence according to SEQ ID NO: 4; (iii) a first Vika recombinase enzyme comprising a single mutant K219R in the catalytic region and having an amino acid sequence that is at least 70%, preferably 80%, and more preferably 90% identical to the polypeptide having the sequence according to SEQ ID NO: 5. (iv) A first Panto recombinase enzyme containing a single mutant Q330R in the catalytic region and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO: 15; and a second Vika recombinase enzyme containing a single mutant Q330R in the catalytic region and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO: 18; and a second Panto recombinase enzyme containing a single mutant Q312R in the catalytic region and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO: 19; and (v) a first Dre recombinase enzyme containing a single mutant K202R in the catalytic region and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO: 19. The second Dre recombinase comprising a single mutant Q312R in the catalytic region and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO 22; or (vi) a first Vcre recombinase enzyme comprising a single mutant K221R in the catalytic region and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO 24; and a second Vcre recombinase comprising a single mutant Q336R in the catalytic region and having an amino acid sequence with at least 70%, preferably 80%, and more preferably 90% identity to the polypeptide having the sequence according to SEQ ID NO 25. Item 10. A nucleic acid molecule,Its encoding is based on at least one first DNA recombinase enzyme and / or at least one second DNA recombinase enzyme according to any one of items 1 to 9. Item 11. An expression vector comprising a nucleic acid molecule according to item 10 and one or more expression control elements operatively linked to the nucleic acid to drive its expression. Item 12. A host cell comprising a nucleic acid molecule according to item 10 or an expression vector according to item 11. Item 13. A pharmaceutical composition comprising at least one first DNA recombinase enzyme and / or at least one second DNA recombinase enzyme according to any one of items 1 to 9, or a nucleic acid molecule according to item 10, or an expression vector according to item 11, or a host cell according to item 12, and one or more therapeutically acceptable diluents or carriers. Item 14. A DNA recombinase complex according to any one of items 1 to 9, or a nucleic acid molecule according to item 10, or an expression vector according to item 11, or a host cell according to item 12, or a pharmaceutical composition according to item 13, which is intended for use in medicine. Item 15. A DNA recombinase complex according to any one of Items 1 to 9, or a nucleic acid molecule according to Item 10, or an expression vector according to Item 11, or a host cell according to Item 12, or a pharmaceutical composition according to Item 13, which is used to treat hemophilia A, preferably for the treatment of severe hemophilia A. Item 16. A method for generating an obligate DNA recombinase for genome editing, wherein the method comprises the following steps: (i) providing a nucleic acid molecule encoding a first recombinase enzyme and a nucleic acid molecule encoding a second recombinase enzyme, wherein the first recombinase enzyme binds to a first half-site of an asymmetric recombinase target site, and the second recombinase enzyme binds to a second half-site of the asymmetric recombinase target site, wherein the first recombinase enzyme and the second recombinase enzyme form a heterodimer capable of inducing specific DNA recombination at a position of interest in a DNA sequence at the asymmetric recombinase target site, wherein the asymmetric recombinase target site comprises a first half-site and a second half-site of an upstream target site and / or a downstream target site of the DNA recombinase, the upstream and downstream target site half-sites being distinct and not palindromic; (ii) (iii) Inducing mutations to create a nucleic acid library encoding a mutant first recombinase enzyme and a nucleic acid library encoding a mutant second recombinase enzyme, wherein the mutations are introduced into the first recombinase enzyme and the second recombinase enzyme; and (iii) Creating expression vectors by selecting the nucleic acid libraries encoding the first mutant recombinase enzyme and the nucleic acid libraries encoding the second mutant recombinase enzyme into expression vectors, wherein the expression vectors carry the DNA sequence of interest.The DNA sequence of interest is to be recombined; (iv) Transfect cells with the expression vectors of step iii and express a library of the mutant first recombinase enzyme and the mutant second recombinase enzyme in the same cells, resulting in the formation of a recombinase heterodimer containing the mutant first recombinase enzyme and the mutant second recombinase enzyme; (v) Perform positive selection to screen the heterodimers obtained in step iv, which are capable of inducing position-specific DNA recombination of the sequence of interest at an asymmetric recombinase target site in DNA; (vi) Perform negative selection to screen the heterodimers obtained in steps iv or v, which are unable to induce position-specific DNA recombination of the sequence of interest at an off-target, preferably symmetric, recombinase target site in DNA; (vii) The selected specific DNA recombinase is capable of recombinating the DNA sequence of interest at a recombinase target site in DNA. The recombinase target site includes a first half-site and a second half-site of an upstream target site and / or a downstream target site of the DNA recombinase. The specific DNA recombinase is not capable of recombinating the DNA sequence of interest at an off-target, preferably symmetrical, recombinase target site in DNA. In the specific DNA recombinase obtained in step (vii), the first mutant recombinase enzyme and the second mutant recombinase enzyme each contain at least one mutation at the catalytic site. The at least one mutation renders the first recombinase enzyme and the second recombinase enzyme inactive when acted alone. Item 17. A method for producing a complex of obligate DNA recombinase enzymes, the method comprising the steps of: (i) introducing a monoamino acid substitution into the catalytic region of a first DNA recombinase enzyme, wherein the monoamino acid substitution renders the first DNA recombinase enzyme inactive; (ii) introducing a monoamino acid substitution into the catalytic region of a second DNA recombinase enzyme, wherein the monoamino acid substitution renders the second DNA recombinase enzyme inactive; (iii) co-expressing the mutated first and mutated second DNA recombinase enzymes in a host cell; (iv) isolating the mutated first and mutated second DNA recombinase enzymes from the host cell. Item 18. A DNA recombinase enzyme obtained by the method of Item 16 or 17. Item 19. A method for reverse DNA sequencing at the genomic level in vitro from cells, the method comprising the steps of: (i) providing a nucleic acid molecule encoding a first recombinase enzyme as described in any one of Items 1 to 9, wherein the first recombinase enzyme specifically recognizes a first half-site of a recombinase target site; (ii) providing a nucleic acid molecule encoding a second recombinase enzyme as described in any one of Items 1 to 9.The second recombinase enzyme specifically recognizes the second half-site of the recombinase target site; (iii) an expression vector is created by selecting nucleic acid molecules encoding the first recombinase enzyme and the second recombinase enzyme into an expression vector; (iv) the expression vector is delivered to a cell containing a DNA sequence to be reversed; (v) the first recombinase enzyme and the second recombinase enzyme are expressed in the cell; (vi) a DNA recombinase complex containing the first recombinase enzyme and the second recombinase enzyme is formed; and (vii) the DNA sequence to be reversed in the cell is reversed. Examples of the Invention The following examples are provided for the purpose of illustrating various embodiments of the invention only and are not intended to limit the invention in any way. Example 1: Plastid Construction The previously described plastids containing loxF8, loxF8L, and loxF8R target sites were used for evolution (pEVO-loxF8, pEVO-loxF8L, and pEVO-loxF8R, respectively) (10). The mutations published by Zhang et al. (16) were introduced into two D7 subunit sequences via DNA fragment synthesis (Twist Bioscience). Mutations A3 (K25R, D29R, R32E, D33L, Q35R, R337E, E123L) were applied to D7L, and mutations B2 (E69D, R72E, L76E, E308R) were applied to D7R. The synthesized fragments were inserted into pEVO plastids through two selection steps. First, D7L, A3 Performed with SacI and XhoI, then D7R B2 The sequence was determined using BsrGI and XbaI (NEB). Once the correct sequence was confirmed by Sanger sequencing using primers 1 and 2 (Table 5), the two molecules were then selectively colonized into three different pEVO plastids containing target sites of loxF8, loxF8L, and loxF8R using restriction enzymes SacI and SbfI (NEB). The plasmid pEVO-lacZ used for library analysis was adapted from the previously described selected plasmid (8). A spacer sequence was added between the symmetrical target sites loxF8L (terminal 5'-3' ATAAATCTGTGGAGCATACATTCCACAGATTTAT, SEQ ID NO: 65) and loxF8R (terminal 5'-3' CTAAGATTGTGTGG CATACATCACACAATCTTAG, SEQ ID NO: 66) and loxP to prevent recombination between the symmetrical site and the loxF8 site. Two strong transcription terminators (17) are located lateral to the symmetrical target sites. During recombination, removal of the terminator sequences allows transcription of the lacZa fragment driven by the persistent cat promoter. Example 2: Plasma-Connected Directed Evolution The previously described plasma-connected protein evolution (SLiDE) was used to evolve recombinases (Buchholz and Stewart, 2001; Sakara et al., 2007; Karpinski et al., 2016; Lansing et al., 2019). This was achieved by separately... A counterselection strategy is established by altering the activity and inactivity of recombinases at loxF8 and symmetric sites. A modified plasmid-ligation directed evolution method (6) is used to achieve positive selection pressure on the activity at the asymmetric site (loxF8) and negative selection pressure on the symmetric sites (loxF8L and loxF8R). Each evolutionary cycle involves diversifying a library using error-prone PCR (MyTaq DNA Polymerase Bioline) and selecting variants with desired activity at the target site. The diversified library is then implanted with pEVO containing the target site, and the plasmid is transfected into an electroporator capable of operating XL1-Blue. In E. coli, recombinase variants were expressed overnight via arabinose-induced promoter. Selection was cyclical between positive and negative selection strategies. For positive selection of loxF8 recombination, purified plastids were cut with enzymes NdeI and AvrII to linearize all unrecombined variants, and then amplified with primers 1 and 3 (Table 5). Negative selection was achieved by amplifying only recombinases that had not yet undergone recombination events using primers (primer 4, Table 5) capable of binding between symmetrical target sites. For each round of evolution, selection alternated between the three target sites. Recombination efficiency was monitored by plastid-based activity assays. A schematic diagram of the evolutionary method used is shown in Figure 15. Example 3: Recombinase Activity Assay: Plastid-Based and Blue-White Screening To visualize the recombination activity of recombinases or recombinase libraries at target sites of interest, plastid-based assays (6, 9, 10) were used as previously described. Blue-white activity screening was used for activity analysis and selection of active variants for the final library. The library was selected into pEVO LacZ reverse-selected plasmids using the restriction enzymes SacI and SbfI. Once plated on Xgal indicator plates containing antibiotic selection and arabinose, the activity of recombinase variants was interpreted as blue or white. White colonies represented either inactive recombinase pairings or pairings highly specific for LoxF8. To exclude inactive recombinases, the library was induced overnight with a low amount of arabinose (10 µg / ml L-arabinose, Sigma) before blue-white selection. The purified plasmids were linearized by cutting with NdeI and AvrII, then retransformed and induced with a higher amount of arabinose (100 µg / ml L-arabinose, Sigma) for sensitive detection of low-level symmetric site activity. Blue colonies contained mutants active at the symmetric site. Therefore, white colonies, containing mutants with no recombinant symmetric site but recombinant LoxF8 sites, were selected. Eighty white colonies were selected, and colony PCR showed that 75 of the selected colonies exhibited the desired activity profile, displaying a 1.7 KB band. Example 4: Library Design The A3 amino acid positions K25, D29, R32, and D33, and the B2 positions E69, R72, and L76 were targeted using ISOR (incorporating synthetic oligonucleotides via gene reassembly). To ensure diversity in targeting the A3 and B2 positions, an adaptor method using ISOR (18) was applied. The incorporated oligonucleotides were designed using degenerate codons (VNS, GHW, and MDG).VNS contains 16 possible amino acids (D, E, H, I, K, M, N, Q, S, A, G, L, P, T, V, R), GHW includes codons corresponding to 4 possible amino acid variants (D, E, A, V), and MDG includes codons corresponding to 5 amino acid variants (K, L, M, Q, R). The incorporated A3 and B2 oligonucleotides (introducers 5 to 20, Table 3) were applied in parallel to the washed D7L and D7R recombinases, respectively. Example 5: Sequence Analysis To determine which mutations occurred most frequently in the mutated recombinases, the amino acid sequences of the D7L mutant were aligned with the original D7L recombinase sequence, and the amino acid sequences of the D7R mutant were aligned with the original D7R recombinase sequence. From the sequence alignments, the mutation frequency at each position was determined by dividing the mutation occurrence at each position by the total number of sequenced samples (Figure 2C). For D7L, the most frequently mutated amino acid positions are (highlighted in dark gray) K25, D29, K201, and S305, and for D7, the most frequently mutated residue is Q311. Residue positions 1 through 10 of the D7R mutant were removed due to poor read background. The primer binding site length between the two recombinase libraries was insufficient to extract a suitable read while keeping the mutant pair together. Mutations must be applied to each monomer to control complex formation. Even without their respective unique mutations, D7L or D7R can still form functional homotetramers, resulting in undesired recombination at their associated evolutionary half sites. Therefore, combinations of mutations are considered necessary. Example 6: Performance in mammalian cells and recombination efficiency in mammalian cells The recombination characteristics of specific monomers were determined using fluorescence-based reporter gene assays as previously described (10). HEK293T cells were seeded at a density of 350,000 cells / ml one day prior to transfection. The mRNA encoding the specific monomer and blue fluorescent protein (BFP) was transfected into the HEK293 reporter cell line, which contains inserted lox sites flanked by repeating SV multiple (A) sequences. Recombination at these sites resulted in the expression of the downstream monomeric red fluorescent protein (mCherry). Forty-eight hours post-transfection, recombinase activity was quantified using a MACSQuant VYB flow cytometer (Miltenyi Biotec) via FACS. The recombination percentage was determined by the percentage of cells exhibiting red fluorescence within the blue fluorescent protein population. Example 7: HEK293T Cell Culture HEK293T cells were cultured in 12-well configurations using DMEM (Gibco) supplemented with 10% FBS (Capricon Scientific) and 1% penicillin-streptomycin (ThermoFisher). When 90% confluence was reached, the cells were aliquoted. Each well was washed once with PBS and 100 µl of trypsin (Gibco) was added.After incubation at 37°C for 3 min, the desorbed cells were collected in 15 ml tubes. Cells were counted using a Countess 3 FL automated cell counter (ThermoFisher) and seeded in 1 ml of medium at a density of 75,000 cells / well. For transfection, cells were seeded in 1 ml of medium at a density of 350,000 cells / well. Example 8: mRNA transfection of HEK293T cells was performed 24 h after seeding. For each transfection reaction, a 1.5 ml tube was prepared containing a total of 300 ng of mRNA (100 ng of tagBFP mRNA and 200 ng of recombinase mRNA). 100 µl of Opti-MEM I serum-lowering medium was mixed with 1.5 µl of Lipofectamine MessengerMax (ThermoFisher) and added to the mRNA sample. The mixture was gently shaken and incubated at RT for 15 min. The cell culture medium was replaced with fresh medium. The transfection mixture was then added to the cells. The culture medium was changed every other day, and the cells were analyzed two days after transfection. Example 9: Reverse detection of the loxF8 locus in HEK293T cells treated with D7 recombinase dimer was detected as previously described (10). Example 10: In vitro transcribed (IVT) mRNA was prepared using the HiScribe™ T7 ARCA mRNA Kit (NEB) and purified using the Monarch RNA Cleanup Kit (NEB) according to the manufacturer's instructions. IVT templates for D7 recombinase dimer and tagBFP were generated as previously described (10). Templates for different Cre variants were generated using primers 21 and 22 (Table 5). 4 µg of mRNA was aliquoted and stored at -80 °C for up to 6 months. Example 11: Evaluation of Single-Point Mutation in the Catalytic Region of Recombinant Synapse to Create a Specific Phenotype To generate further specific recombinases, a single mutation was introduced into the catalytic region of the recombination synapse of Cre recombinase (i.e., amino acid positions 129-136, 163-181, 199-211, 289-301, 310-316, and 321-324 of SEQ ID NO: 1, see Figure 17A, dark area), as summarized in Table 6 below. A more detailed overview of the mutation locations in Cre is provided in Figure 17B. Experiments showed that inactive mutations in the catalytic region of the first recombinase monomer could be rescued by different inactive mutations in the catalytic region of the second recombinase monomer. In this example, a single-amino acid-substituted Cre recombinase mutant system with the catalytic region of SEQ ID NO: 1 was generated and expressed at their loxP target sites to evaluate whether the introduced mutation rendered the monomer inactive.In the second step, two distinct inactive monomers co-exist at their loxP target sites to assess whether the combination of the two inactive monomers could salvage recombinase activity. The recombinase activity against loxP was measured using the plastid-based assays described earlier (6, 9, 10). In the experiments, the recombinant pEVO was smaller in size compared to the unrecombined pEVO. Larger fragments (~5 kb) indicated the unrecombined plasmid, while smaller fragments (~4.3 kb) indicated the recombined plasmid. These two distinct fragments could be distinguished by gel electrophoresis or sequencing. Recombination efficiency (expressed as dimer and monomer activity, respectively) was calculated using the following formula based on the ratio of recombined to unrecombined plasmids: Recombinant activity (%) = 100 x (recombined plasmid / (recombined + unrecombined plasmid)). Results achieved by embodiments of the present invention: 1. Monomer-monomer interface mutations reduce recombination activity. To form hetero-specific Cre-type SSR complexes targeting asymmetric receptors, previous studies have focused on redesigning the protein-protein interfaces of interacting monomers. Specifically, Zhang and colleagues have engineered heterotetramers of specific Cre and Cre variants to recombinant artificial asymmetric loxM7 / loxP target sequences (16). The key sites for interface redesign were selected from predicted mutations that could form alternative interaction surfaces between wild-type Cre molecules and Cre variants. To investigate whether the same interface mutations could be adapted for other hetero-specific Cre-type SSRs, two subunit mutations were used to generate D7 variants to potentially form specific D7 recombinases. Thus, the D7L variant (D7L... A3 The D7R variant (D7R) is generated through mutations at K25R, D29R, R32E, D33L, Q35R, E123L, and R337E. B2 The loxF8 target sites carried mutations of E69D, R72K, L76E, and E308R. To compare recombination efficiency before and after mutation, plastids carrying loxF8, loxF8L, or loxF8R target sites were used as excision recipients, co-expressing unmutated D7L and D7R (Figs. 1A and 6). As expected, the co-expression of D7L and D7R subunits on the asymmetric loxF8 recipient led to efficient recombination (Fig. 1B). Recombination was also observed for symmetric loxF8L and loxF8R target sites (Fig. 1B), possibly due to the corresponding evolution of recombinase functionality and tetramer formation. The introduction of the interfacial mutation (D7L)... A3 and D7R B2The assembly of the homotetramer should be prevented, thereby blocking recombination at the symmetrical loxF8L and loxF8R sites, while different subunits should still be able to form active heterotetramers on the asymmetric loxF8 sequence (Figure 1C). Indeed, D7L A3 and D7R B2 The combined effects of these mutations did not result in detectable recombination in vectors carrying the symmetrical loxF8L or loxF8R sequences (Figure 1D), indicating that these mutations prevent the formation of active isotetramers. However, D7L A3 and D7R B2 Co-expression at the asymmetric loxF8 site, compared to the original D7L+D7R complex, resulted in no observable activity at the same L-arabinose induction concentration (100 µg / mL). To determine the co-expression of D7L... A3 and D7R B2Whether the recombinase can form an active complex that induces an increase in L-arabinose to 1000 µg / mL, resulting in very low activity at the loxF8 site, proves that the complex is functional, but very inefficient (Fig. 1D). Therefore, the applied specific mutation works in principle, but also affects the recombinant activity of the D7 heterotetramer. Therefore, it is hoped that the activity can be restored by finding a combination of amino acid changes that are more suitable for the specific D7 system. 2. Mass-dependent directed evolution to evolve a highly active specific D7 recombinase In order to find beneficial amino acid changes, two libraries of D7L and D7R recombinase variants were started around the residue positions previously described (16) (A3 - K25, D29R, R32E, D33L, Q35R, E123L and R337E, and B2 - E69D, R72K, L76E and E308R), which are involved in the protein-protein interface. These libraries were applied to an established synthesizer-linked directed evolution (SLiDE) procedure (6, 18). To maintain the libraries at the practical screening size, diversity was directed to subsets of residue positions, namely K25, D29, R32, and D33 at position A3, and E69, R72, and L76 at position B2, which are located at the largest monomer-monomer interfaces. At each of these positions, mutations were restricted to subsets of amino acids previously predicted for interface redesign (D, E, H, I, K, M, N, Q, S, A, G, L, P, T, V, R) (16). Two starting libraries, D7L and D7R, were selected and inserted into their respective vectors, and positive selection for activity at the asymmetric site (loxF8) and negative selection at the symmetric sites (loxF8L and loxF8R) were initiated using a modified version of SLiDE (Figs. 2A and 7A). By evolving two libraries together, rather than in parallel, functional pairs with the desired activity profile can be selected. After 26 SLiDE cycles, a significant increase in recombination activity at asymmetric sites and negligible recombination at symmetric sites were detected (Fig. 2B), indicating that recombinase heterodimer pairs with the desired characteristics had evolved. To eliminate any presence of inactive recombinase variants missed by selection, single variant pairs were evaluated using blue-white colony screening. The pEVO-LacZa selection plastid allowed for the simultaneous identification of variants that did not recombine at symmetric sites while simultaneously exhibiting high activity at the asymmetric loxF8 site (Fig. 8A-C). Seventy-five white colonies were selected, and the encoded recombinase pairs were sequenced. Surprisingly, non-hypermutated amino acid positions (69, 72, 76, and 308) were enriched in the evolved D7R recombinases. Conversely, in 41% (31 out of 75 variants) of the sequenced D7R recombinases, glutamic acid at position 311 was altered, with 87% (27 out of 31) of the mutants exhibiting arginine at this position.The results showed that the initial target residues did not lead to the desired outcome; instead, a single substitution occurring randomly during evolution was preferred (i.e., Q311R). This may prevent recombination at the symmetric loxF8R site while maintaining activity when co-expressed with the D7L variant at the asymmetric loxF8 sequence. Sequencing of D7L-derived selected strains revealed mutations at five positions in more than 20% of the sequenced strains (positions 25, 29, 20, 282, and 305, Fig. 2C). Positions 25 and 29 likely originated from the initial target residues involved in protein-protein interactions, while positions 201, 282, and 305 were not targeted in the starting library, suggesting they occurred through random mutation and selection during directed evolution. The most surprising result was at position 201, which was frequently mutated, found to be altered in 48% (36 out of 75) of the selected strains, with all selected strains containing arginine instead of lysine at this position (Fig. 2C). What makes this change so interesting is that lysine 201 is highly conserved throughout the tyrosine SSR family (19), and this residue has been described as essential for the catalytic activity of Cre (20–22). K201 has been observed to function as an active residue in Cre complexes to facilitate DNA cleavage during recombination (20, 23). Therefore, recombinases altered at position 201 are not expected to exhibit any recombinase activity. Based on these studies, it was desirable to further investigate whether mutating the catalytic K201 residue in D7L renders the SSR inactive when expressed as a monomer, and if so, whether the activity could be salvaged for recombination by the presence of the paired mutation Q311R on the D7L monomer. To determine the effect of the mutations applied to each monomer on recombination, their ability to recombine their original targets when expressed as monomers alone was first assessed. D7L K201R Or D7R Q311R Individually expressed at the symmetrical loxF8L or loxF8R sites, these mutations did not lead to detectable recombination events, confirming that these mutations render the enzyme inactive when expressed alone (Figure 2D). Furthermore, D7L... K201R and D7R Q311R When expressed alone, it is inactive at the asymmetric loxF8 site (Fig. 2D). However, when D7L... K201R and D7R Q311RIn co-expression, effective recombination was observed at the asymmetric loxF8 site (Fig. 2E), while no recombination was detected at the symmetric loxF8L and loxF8R sites (Fig. 2E). Importantly, the recombination rate at the loxF8 site was similar to that of the original wild-type D7 selector (Fig. 2E), indicating that these two mutations did not affect the overall activity of the recombinase complex. Therefore, by applying only one mutation to each recombinase monomer, a specific SSR complex with activity comparable to the wild-type D7 SSR was obtained. 3. D7L K201R +D7R Q311R Supporting specific recombination in mammals, since the D7 recombinase was designed for use with the human genome, the next step is to detect specific D7L. K201R +D7R Q311R The activity of the recombinant in human cells. To allow for simple quantification, the recombinant efficiency of the HEK293T reporter cell line (10) was measured. The reporter cell line was co-transfected with mRNA carrying the recombinase and mRNA encoding tagBFP for monitoring transfection efficiency (Fig. 3A). Specific D7L K201R + D7R Q311R Transfection of the complex showed a recombination efficiency of 81%, compared to 79% for wild-type D7 (Fig. 3B, C), suggesting that the introduction of specific mutations did not affect the activity of the recombinase in human cells. Importantly, transfection of each mutant monomer subunit alone did not produce significant loxF8 target site recombination (Fig. 3B, C). The D7 recombinase was initially developed to correct the genomic int1h reversal frequently found in hemophilia A patients (24). The enzyme identifies two loxF8 sequences located on the human X chromosome, 140 kb apart. The first site is located in intron 1 of the factor VIII gene, and the second site is located 130 kb upstream of the factor VIII transcription start site (10, 25, 26). It has been shown that, when expressed in human cells, D7 effectively reverses the transposed exon 1 sequence, which has a loxF8 target site flanking it (10). To confirm D7L K201R +D7R Q311R The ability of variants to act on these sites at endogenous loci, extracted using D7L K201R and D7R Q311RGenomic DNA from HEK293T cells transfected with mRNA was analyzed and subjected to PCR-based assays designed to detect the inversion of exon 1 (Figure 3D). Indeed, D7L... K201R +D7R Q311R This resulted in the reversal of genomic segments (Figure 3E), confirming that specific mutations do not interfere with the recombinase recombination activity that causes disease reversal. To assess D7L... K201R +D7R Q311R The heterodimer showed improved specificity for its target sites, and its activity at four predicted human off-target sites was analyzed using a plastid-based activity assay (Supplementary Fig. 1) (Fig. 3F). Consistent with previous data (10), the wild-type D7 recombinase did not show detectable activity at three of the four sequences, but did show activity at the HG2L off-target site (Fig. 3G). In contrast, the specific 7L... K201R + D7R Q311R The complex showed no detectable activity at all four predicted off-target sites (Figure 3G), confirming its improved application properties. In summary, these results demonstrate that D7L… K201R + D7R Q311R Heterodimers promote target specificity while maintaining comparable recombination efficiency at the loxF8 target site in mammalian cells. 4. K201R and Q311R mutations reduce the specificity of Cre, Vika, and Dre recombinases. To explore more general applications and gain insights into the molecular mechanisms of established specific SSR systems, two naturally occurring homotetrameric SSR complexes, Cre and Vika, were investigated, with corresponding mutant phenotypes (27). To test this system, Cre was generated. K201R and Cre Q311R Based on the conserved sequences observed in sequence alignment (27), the specific mutations were incorporated into positions 219 and 330 of Vika, forming two mutant monomers, namely Vika. K219R and Vika Q330R The activity of both on the cleavage receptor was analyzed in *E. coli*. When Cre alone... K201R or Cre Q311RAt this time, no recombination was observed on the loxP target (Figure 4A). To test for recombination caused by the introduction of two mutations into the same monomer, CreK201R+Q311R was generated. Analysis of the excision receptor of the Cre double mutant in E. coli showed no observable recombination of the loxP target sequence, indicating that the mutations must be present on different monomers to allow the formation of a viable SSR complex (Figure 4A). When Vika K219R and Vika Q330R When both were expressed on the vox-targeting sequence, a similar activity profile was observed (although with some loss of activity), while no recombination was observed when the mutant monomer was expressed alone (Fig. 4B). Next, the efficacy of the obligate Cre system was assessed to determine whether it could function effectively in mammalian cells and maintain the recombination profile observed in bacteria. HEK293T red fluorescent reporter cells were transfected with SSR mRNA to assess recombination activity (Fig. 4C). Negligible recombination activity was detected when only the Cre mutant was expressed (Figs. 4D, 4E), indicating that only Cre expression... K201R and Cre Q311R It is inactive. In stark contrast, Cre... K201R and Cre Q311R The combined effects of these mutations resulted in recombination efficiencies comparable to wild-type Cre on loxP (Figs. 4D and 4E). In summary, these results confirm that these targeted mutations are applicable not only to the heterotetramer D7 / loxF8 complex but also to specific systems for obtaining wild-type SSRs found in nature. Further applicability of specific SSR systems was tested in naturally occurring Dre / rox complexes. Based on conserved sequences observed in Cre sequence alignment, specific mutations were incorporated into positions 202 and 312 of Dre, forming the DreK202R+DreQ312R / rox complex (Fig. 16). To test the functionality of the mutant complex in *E. coli*, a sensitive PCR-based detection method was used due to the low activity of wild-type Dre (Fig. 14) (introductions 23 and 24 in Table 3). Amplification on the receptor confirmed that recombination of rox occurred when both DreK202R and DreQ312R were present, and that recombination was minimized or completely absent when the specific Dre mutant was expressed alone. The results based on PCR testing are shown in Figure 14. 5. Molecular simulations support the mechanism of catalytically driven specific heterotetramer formation. To gain a more mechanistic understanding of specific mutations, a Cre cocrystal structure was created based on the highest resolution Cre cocrystal structure (PDB: 3C29). K201Rand Cre Q311R A molecular model was developed that binds to the loxP target site, followed by extensive molecular dynamic simulations. These analyses revealed why a single mutant, Cre... K201R and Cre Q311R It is inactive (Figure 5). For Cre... K201R In the mutant, arginine 201 undergoes a dramatic shift in the inactive subunit, now interacting with the DNA backbone at base A2 of the bottom strand instead of base T5 of the top strand, thus affecting recombination efficiency. Furthermore, the catalytic tyrosine 324 in the active subunit shifts from base T3' of the top strand and now forms a hydrogen bond with base A4', explaining why Cre... K201R It is inactive. Regarding Cre... Q311RIn the mutant, catalytic tyrosine 324 was observed to be translocated in both the active and inactive subunits, while K201 lost its important interaction with the DNA backbone. Furthermore, another residue known to play a crucial role in recombination catalysis (H289) was altered (Fig. 10D). Next, a model with the K201R mutation introduced into the active subunit and the Q311R mutation placed in the inactive subunit was analyzed (Fig. 10E). Surprisingly, this configuration resulted in a model incompatible with active recombination. Tyrosine 324 in the inactive subunit was translocated to interact with the C3 base of the basal strand, and K201 also moved drastically to interact with the C3 base of the basal strand. Therefore, this configuration does not constitute an active recombinase. Finally, a model with the K201R mutation introduced into the inactive subunit and the Q311R mutation placed in the active unit was analyzed. This configuration is consistent with an active enzyme, where all catalytic residues are localized to allow recombination. 6. Single-point mutation in the catalytic region of the recombinant pair leads to a specific phenotype. The inventors further demonstrated that an inactive mutation in the catalytic region of one monomer can be rescued by an inactive mutation in the catalytic region of another monomer. Specifically, when expressed alone, a single Cre monomer mutant (see Table 4) is inactive at the loxP target site (see Figure 18, gray bar). However, when two different inactive monomers are co-expressed at loxP, the activity to loxP is restored (see Figure 18, black bar). The principle that catalytically impaired monomers can form specific heteroreplicates is shown in 186 combinations (Table 6). Furthermore, since the catalytic region is conserved in the T-SSR family (see, for example, the comparison in Figure 19), this principle can be applied to other DNA recombinases, and particularly other DNA recombinases such as T-SSRs, such as Vika, Dre, and Panto recombinases. Discussion of Working Examples: By altering the DNA specificity of Cre through engineering and directed evolution, different SSR variants can be generated, which can recombine asymmetric target sequences as heterotetramers (6, 8-10). The generation of this heterotetramer SSR system greatly expands the potential sequences that can be targeted within the genome. However, possible combinations of subunits may lead to active SSR byproducts capable of catalyzing off-target recombination. Previously, prevention of homotetramer formation was achieved through structure-guided redesign of several residues involving the protein-protein interaction interface between different recombinase monomers (16). Therefore, this method for generating specific SSR systems is limited to enzymes with available crystal structures and is therefore not easily adapted to engineered or distant recombinases. The inventors of this study demonstrate that specific SSR systems can also be generated by mutating amino acid residues in the catalytic region. Importantly, this novel method for generating specific SSRs only requires changing a single conserved residue within each different SSR monomer. This simplified method can potentially be applied to many engineered or natural SSRs without prior knowledge of the enzyme's structure.In summary, this invention provides a simple method to reduce off-target recombination and improve the specificity of engineered and wild-type SSRs. Specifically, D7L. K201R and D7R Q311R The enhanced specificity of the system at off-target sites has been confirmed. The data provided further support the general notion that an inactive monomer can be rescued when co-expressed with another inactive monomer. Importantly, this novel method for generating specific SSRs requires only the alteration of a single residue within the catalytic region of each different SSR monomer. This simplified method can be applied to many engineered or natural DNA recombinases without prior knowledge of the enzyme's structure. [ picture [1] Protein-protein interface changes of heterospecific D7 recombinase. (A) Nucleotide sequences of relevant SSR target sites. loxF8, loxF8L, and loxF8R represent the target sequences of D7L and D7R recombinases, respectively. Highlighting features (bold - differences from loxP site, underline - asymmetric residues at loxF8 site). (B) Bacterial assay showing the co-existing activity of D7L and D7R (recombinase enzyme) at target sites loxF8, loxF8L, and loxF8R (receptor). Recombination is represented by a band aligned with a single triangle, and non-recombination events are represented by two triangles. The concentration of L-arabinose (ug / mL) used to induce recombinase expression is shown at the bottom. (C) Schematic representation of desired specific D7 recombinase activity. D7LA3 and D7RB2 are mutated and should only allow heterodimer formation at the loxF8 target site. This mutation should prevent the formation of homodimers of D7LA3 and D7RB2 at the symmetrical loxF8R and loxF8L sites. (D) Bacterial assays demonstrating the recombinant activity of D7LA3 and D7RB2 at the designated target sites. The concentration of L-arabinose (ug / mL) used to induce recombinase expression is shown at the bottom. picture [2] The selection method is shown, comparing the activities of the starting and final libraries, and subsequent analysis of the obtained mutations. (A) Selection scheme, wherein positive selection pressure is applied to the library to select recombinases active at the loxF8 site, and negative selection pressure is applied to select variants (denoted by X) inactive at the symmetrical loxF8L or loxF8R sites. (B) Bacterial assays show the activity of the starting library (the target library generated by applying ISOR to the D7 recombinase sequence) and the final library (the library after 26 rounds of evolution and selection pressure) at the target sites (substrate) loxF8, loxF8L, and loxF8R. L-arabinose used to induce recombinase expression (g / mL) Concentrations (g / mL) are shown at the bottom. (C) Mutation frequency is calculated as the number of amino acid position mutations compared to the D7 sequence, divided by the total number of sequences. The amino acid positions of D7L and D7R are plotted on the x-axis, and the mutation frequency is plotted as a percentage of all sequences on the y-axis. Positions with a mutation frequency exceeding 20% ​​are marked. Due to the high background of sequence readings, the plotting position of D7R starts from the 6th amino acid position. (D) Activity of the isolated D7 monomer at the asymmetric site loxF8 and the symmetric sites loxF8L and loxF8R. (E) Activity of D7 compared to the heterodimer D7LK201R+D7RQ311R at the asymmetric site loxF8 and the symmetric sites loxF8L and loxF8R. The induction amount of L-arabinose (ug / ml) is listed at the bottom. picture [3] Demonstrating specific D7 activity in mammalian cells. (A) Schematic diagram of the mRNA expression construct and reporter HEK293T cell line. HEK293T cells were co-transfected with mRNA expressing NLS or BFP containing recombinases. Schematic diagram of the reporter construct embedded with loxF8 in HEK293T cells. The loxF8 site is flanked by the puromycin selection gene. mCherry is expressed from the SFFV promoter after successful recombination (excision). (B) Representative bright-field image and mCherry fluorescence image of reporter HEK293T cells transfected with the specified recombinase. (C) Recombination efficiency was analyzed by FACS and is shown as the percentage of mCherry-expressing cells to total cells containing BFP. *Normalized to BFP. (D) Genome reverse detection PCR protocol. Two PCR programs were performed simultaneously on extracted genomic DNA from HEK293T cells 48 hours after recombinase mRNA transfection. WT orientation is indicated by the amplified product generated by the primer. Reverse orientation is also indicated by the primer. (E) PCR results of untreated cells at the top and mRNA-transfected cells at the bottom. Controls consisted of BFP-transfected and recombinase mRNA-free (untreated) HEK293T cells, patient iPSCs carrying exon 1 reverse (reverse Ctrl), non-reverse amplified product (WT-Ctrl), and water. (F) Predicted off-target sequences in the human genome that are highly similar to loxF8L (HG1L and HG2L) and loxF8R (HG1R and HG2R). (G) The D7 recombination activity at the predicted human off-target sites compared to the activity of D7K201R+D7RQ311R. picture [4] This demonstrates the widespread use of specific mutations in other recombinase systems. (A) In bacteria, Cre exhibits recombinant activity on loxP as a heterodimer composed of both mutated subunits CreK201R and CreQ311R, or as a single mutated subunit of CreK201R or CreQ311R. (B) In bacteria, Vika exhibits recombinant activity compared to a specific related mutation of Vika with K291R in one subunit and Q330R in the second mutated subunit. First, both Vika mutants are expressed together on vox, or individually as the mutated subunits VikaK219R or VikaQ330R on vox. (C) mRNA expression construct and HEK293T loxP reporter cell line. (D) Bright-field and fluorescent mCherry cell images of HEK293T. (E) Recombination efficiency of the combination of Cre / loxP and the specific Cre subunit in HEK293T cells. CreK201R and CreQ311R together and subsequently individually expressed the subunits CreK201R and Q311R of other mutants. Recombination percentages were normalized to BFP. picture [5] Structural details of Cre and the studied mutant are shown. (A) MD-refined structure of the Cre complex (PDBID 3C29). A complex of one DNA loxP molecule and two Cre monomers (active (A) and inactive (I)). K201 and Q311 residues are depicted as spheres. (B) LoxP sequence, labeled with the top strand (TS, SEQ ID NO: 51) and the bottom strand (BS, SEQ ID NO: 139). Arrows indicate the attack sites of catalytic tyrosine (Y324) in their respective DNA strands; the first cleavage is indicated by the upward-pointing arrow. The base sequence of the spacer region is labeled. (C)-(F) Cre and the mutant Cre K201R(A)-K201R(I) / loxP (C), Cre Q311R(A)-Q311R(I) / loxP (D), Cre K201R(A)-Q311R(I) / loxP (E) and Cre Q311R(A)-K201R(I) Overlap of the MD-refined structure of / loxP (F) (taken from the last 50 ns of the simulation). In the mutant structure, the active (A) and inactive (I) monomers are depicted on the left and right sides of the figure, respectively, showing the DNA. Side chains of relevant residues are shown as balls and bars with labels. Intermolecular H bonds are depicted with dashed lines. Q311R(A)-Q311R(I)H289 of the active monomer and A4' in loxP TS The lack of H bonds between phosphate groups is highlighted by two arrows pointing to the atoms (block D). For clarity, a cartoon representation is shown in a transparent manner. Checkmarks and crosses indicate activity relative to inactive mutants. (G) Recombination test results of dimers containing monomers with K201 and Q311 mutations. picture [6] Visualization of recombinant activity based on plasmid assay. The vector carries the recombinase or recombinase library of interest and the target site. After recombination, a 750 bp fragment with a lox site on the side is excised. Protein-coding genes are depicted with arrows, the origin of replication (oriP15A) and pBAD promoter are depicted with rectangles, and the target site is depicted with triangles. Protein-coding genes include the chloramphenicol resistance gene (cmR), arabinose regulatory protein (araC), and genes encoding the recombinase or library of interest. Restriction enzyme sites are shown with dashed lines. NdeI and AvrII lines are used to select vectors that have already been recombined. SacI and SbfI are used to visualize unrecombined or recombined plasmid systems. These enzymes excise a 2.2 kb fragment containing the recombinase, and a 5 kb or 4.2 KB fragment if the plasmid is unrecombined or recombined. picture 7] Display selection strategies. (A) A modified positive selection scheme is used for plasmid-linked directed evolution. Any unrecombined plasmids are linearized by cutting purified plasmids with NdeI / AvrII, removing inactive variants at the loxF8 target site from the library. Active variants are then amplified with primers F and R1 and a resistant Taq polymerase to add mutations, and the variants are carried into the next evolutionary cycle. (B) A modified negative selection scheme is used to remove variants capable of recombinating the loxF8L or loxF8R symmetric sites. Here, only the loxF8L site is depicted because the selection method remains the same for both sites. Variants are amplified with primers F and R2, which bind between symmetric sites, amplifying only unrecombined variants. The Taq polymerase system is used to add mutations, and the variant system proceeds to the next evolutionary cycle. picture [8] Blue and white screening of the library and activity testing of selected colony samples. (A) Plasmids containing a transcription terminator with a symmetrical site upstream of LacZa on their lateral side were selected. After recombination at the symmetrical site, the transcription terminator was excised, allowing LacZa transcription driven by the persistent cat promoter. Inactive variants were removed by NdeI and AvrII cleavage. (B) Blue colonies contained mutants active at the symmetrical site; therefore, white colonies containing mutants that did not recombine the symmetrical site but recombined the loxF8 site were selected. (C) Samples of 75 white colonies, of which colony PCR showed colonies with the desired activity profile, with a 1.7KB band. picture [9] Shows the gating strategy used to evaluate the SSR recombination efficiency of the HEK293T reporter cell line. (A) FACS gating strategy. Single cells are cells grouped from live cells. Dead cells are excluded from the grouping. From single cells, BFP+ cells are grouped, and finally mCherry+ cells are grouped. (B) Schematic diagram of mRNA expression constructs and the HEK293T reporter cell line. Shows mRNA with specified characteristics (5' cap and multiple A tails) that expresses nuclear localization signals (NLS) for fusion with recombinase and tagBFP mRNA. Stable reporter cells have two loxP sites (triangles) with the puromycin selection gene (puro) on their sides. Once successfully excised by recombination, mCherry cells are expressed from the SFFV promoter (arrow). (C) Representative microscopic images with bright field, BFP, mCherry, and overlap, showing the distribution of recombination. (D) FACS image of a representative HEK293T reporter cell line transfected with mRNA, where BFP fluorescence indicates transfected cells and mCherry fluorescence indicates selected BFP+ cells with recombination events. picture

[10] MD-based analysis of hydrogen bonds and van der Waals contacts in Cre and the studied CreK201R and CreQ311R mutants. (A) Hydrogen bond and van der Waals occupancy in the last 100 ns of MD simulation. The top block diagram shows the LoxP sequence, labeled with the top strand (TS) (SEQ ID NO: 51) and the bottom strand (BS) (SEQ ID NO: 139). (BF) Overview of hydrogen bonds and van der Waals contacts in the last 100 ns of MD simulation, (B) Cre, (C) CreK201R(A)-K201R(I), (D) CreQ311R(A)-Q311R(I), (E) CreK201R(A)-Q311R(I) and (F) CreQ311R(A)-K201R(I). The black LoxP bases correspond to spacers. LoxP bases interacting with the active (A) and inactive (I) monomers of the protein are shown in light and dark gray, respectively. Interacting protein residues from the active (A) and inactive (I) monomers are listed in light and dark gray, respectively. Residues involved in H-bond formation are highlighted in bold, residues involved in van der Waals contacts are highlighted with a bold underline, and residues involved in both H-bonds and van der Waals contacts are highlighted in bold with an asterisk. Phosphate groups involved in Y324 identification are highlighted with circles. Active and inactive mutants are highlighted with checkmarks and crosses, respectively. picture 1 [1] This shows that Cre molecules bind to their labeling. The scheme for loxP sites. The loxP site consists of two inverted repeats (13 bp) flanked by non-palindromic spacers (8 bp). Two Cre molecules bind to... loxP sites, each binding to one of the half-sites. picture

[12] Scheme for a typical tyrosine SSR recombination reaction. (A) Schematic diagram of the stepwise recombination mechanism. Four recombinase molecules bind to two DNA receptors to form a tetramer complex (1). Recombinases showing the “cleaving competent” conformation are shown in light gray, and recombinases showing the “non-cleaving” conformation are shown in dark gray. Nucleophilic tyrosine is indicated by a Y in a light gray circle, and only the active monomer is shown. The activated nucleophilic tyrosine attacks the cleavage phosphate (denoted as P), forming a 3'-phosphotyrosine linker and resulting in the release of free 5'OH (2). The released 5'OH attacks the adjacent phosphotyrosine, forming a Halleday linker intermediate and resulting in strand exchange (3). The complex is isomerized, and the active monomer changes conformation to inactive, and vice versa (4). The cleavage and strand exchange steps are repeated (5,6). (B) Possible outcomes of the recombination reaction. Depending on the orientation of the target site (spacer sequence), recombination reactions can result in the excision / intercalation or reversal of DNA fragments. Target sites are represented by black triangles, the direction of which indicates the target site's orientation. (Meinke et al., 2016). picture

[13] Bacterial recombinant assays on plasmids loxF8, loxF8L, and loxF8R showed that the mutant combinations resulted in a D7 heterotetramer with specific catalytic activity. The recombinase D7L was also shown. K201R +D7R Q311R and D7L K201R +D7R Q311K Recombinant activity. picture

[14] Visualization of specific Dre activity in bacteria using a PCR-based detection method (left plastid). Recombinase Dre, Dre K202R +Dre Q312R Dre K202R and Dre Q312R The recombinant activity was shown in At the rox site. picture

[15] Evolutionary and Selection Scheme: The library was created by targeting the diversity of amino acid positions 25, 29, 32, and 33 in the D7L recombinase and positions 69, 72, and 76 in the D7R recombinase. Both libraries were selected together into expression vectors carrying the target sites of interest, then transfected into *E. coli*, and the recombinases were expressed overnight. The resulting recombinant and non-recombinant plasmids were then purified to begin selection. (A) Selection for recombinants at symmetrical sites was performed by selecting inactive variants. Primer p4 binds between the target sites, amplifying only variants inactive at those sites. (B) Selection for active variants at the sites occurred in two steps. First, the purified plasmids were cleaved with restriction enzymes at both target sites. Amplification resulted only in products from the active recombinase. Then, the isolated variants with the desired activity were selected back into the vector carrying the target sites of interest for the next cycle. Each new cycle selects between active variants on loxF8 and inactive variants on loxF8l and loxF8R. (Example: the first cycle selects active variants on loxF8, the second cycle selects inactive variants on loxF8L, and the third cycle selects inactive variants on loxF8R.) picture

[16] Shows an amino acid sequence alignment for preparing the wild-type DNA recombinase used in the preparation of the mutated DNA recombinase according to the present invention. picture

[17] Shows the 3D structure of the wild-type Cre recombinase-loxP pair. A) Shows the pre-cleavage dimer complex, with black highlights indicating regions of high mutation frequency in the obligate Cre-like recombinase. These regions include positions 129-136, 163-181, 289-301, 310-316, and 321-324. B) Shows example positions in the Cre dimer complex where mutations produce an obligate Cre-like recombinase (indicated by spheres), including positions 129, 133, 173, 176, 201, 289, 292, 311, 315, and 324. Positions on the right-hand monomer subunit are indicated in italics. picture

[18] is an overview showing the effects of single-point mutations on the recombinase activity of single recombinase subunits and recombinase obligate dimer complexes. picture

[19] shows the sequence alignment of the Cre, Vika, and Dre recombinases, revealing the catalytic region of each recombinase, which consists of six catalytic sites (indicated by boxes). Conserved amino acids between the different recombinases are highlighted in gray. TW202338091A_111143571_SEQL.xml

Claims

1. A method for generating an obligate DNA recombinase for genome editing, the method comprising the following steps: i. providing a nucleic acid molecule encoding a first recombinase enzyme and a nucleic acid molecule encoding a second recombinase enzyme, wherein the first recombinase enzyme binds to a first half-site of an asymmetric recombinase target site, and the second recombinase enzyme binds to a second half-site of the asymmetric recombinase target site, wherein the first recombinase enzyme and the second recombinase enzyme form a heterodimer capable of inducing position-specific DNA recombination at the asymmetric recombinase target site in a DNA sequence, wherein the asymmetric recombinase target site comprises a first half-site and a second half-site of an upstream target site and / or a downstream target site of the DNA recombinase, wherein the first half-site and the second half-site are distinct and not palindromic; ii. iii. Inducing mutations to create nucleic acid libraries encoding a mutant first recombinase enzyme and a mutant second recombinase enzyme, wherein the mutations are introduced into the first and second recombinase enzymes; iv. Creating expression vectors by selecting the nucleic acid libraries encoding the first and second mutant recombinase enzymes into expression vectors, wherein the expression vectors carry the DNA sequence of interest, which is to be recombined; iv. Transfecting cells with the expression vectors of step iii and expressing the libraries of the mutant first and second recombinase enzymes in the same cells, resulting in the formation of recombinase heterodimers containing the mutant first and second recombinase enzymes; v. Forwardly selecting the heterodimers obtained in step iv, which are capable of inducing position-specific DNA recombination of the sequence of interest at the asymmetric recombinase target site in DNA; vi. Negative selection of heterodimers obtained in screening steps iv or v, which cannot induce site-specific DNA recombination at the desired sequence location (off-target); vii. Selection of a specific DNA recombinase capable of recombinating the desired DNA sequence at its target site, the target site comprising a first and a second half of an upstream and / or downstream target site of the DNA recombinase, wherein the first and second half are distinct and non-palindromic; and the specific DNA recombinase cannot recombine at the desired DNA sequence (off-target). In the specific DNA recombinase obtained in step vii, the first mutant recombinase enzyme and the second mutant recombinase enzyme each contain at least one mutation at the catalytic site, and the at least one mutation causes the first recombinase enzyme and the second recombinase enzyme to have no catalytic activity when acted alone.

2. The method of claim 1, wherein the first mutant recombinase enzyme and the second mutant recombinase enzyme according to steps ii to vi are evolved by substrate-linked directed evolution (SLiDE) or directed evolution.

3. The method of claim 1 or 2, wherein the selection according to steps v and vi is performed repeatedly between selecting a specific heterodimer with catalytic activity at the asymmetric target site (forward selection) and a heterodimer without catalytic activity at the off-target site.

4. A genetically engineered DNA recombinant enzyme for genome editing, wherein the DNA recombinant enzyme comprises an obligate recombinase complex, wherein the complex comprises at least one first recombinase enzyme and at least one second recombinase enzyme, wherein the first recombinase enzyme and the second recombinase enzyme specifically recognize a first half-site and a second half-site of an upstream target site and / or a downstream target site of a DNA recombinase; wherein each of the first recombinase enzyme and the second recombinase enzyme contains at least one mutation at a catalytic site; wherein the first recombinase enzyme and the second recombinase enzyme carrying the at least one mutation at a catalytic site, when acted alone, do not exhibit the catalytic activity of a DNA recombinase; and wherein, In this specific recombinase complex, the catalytic activity system, which is a DNA recombinase, is complementary.

5. The genetically engineered DNA recombinant enzyme of claim 4, wherein the at least one first recombinant enzyme and the at least one second recombinant enzyme are of the same type.

6. The genetically engineered DNA recombinant enzyme of claim 5, wherein both the at least one first recombinase enzyme and the at least one second recombinase enzyme are Cre recombinase, Dre recombinase, VCre recombinase, SCre recombinase, Vika recombinase, λ-Int recombinase, Flp recombinase, R recombinase, Kw recombinase, Kd recombinase, B2 recombinase, B3 recombinase, Nigri recombinase, or Panto recombinase.

7. The genetically engineered DNA recombinant enzyme of claim 4, wherein the DNA recombinant enzyme is a recombinase complex in the form of a heterotetramer.

8. The genetically engineered DNA recombinant enzyme of claim 4, wherein the at least one mutation is a single amino acid substitution in the catalytic region of the recombinant enzyme.

9. The genetically engineered recombinant DNA enzyme as described in claim 4, wherein: (i) The first recombinase enzyme contains Cre recombinase and the second recombinase enzyme contains Cre recombinase, wherein each Cre recombinase contains a single amino acid substitution within an amino acid region selected from the group consisting of SEQ ID NO: 109 to SEQ ID NO: 114; (ii) The first recombinase enzyme contains Vika recombinase and the second recombinase enzyme contains Vika recombinase, wherein each Vika recombinase contains a single amino acid substitution within an amino acid region selected from the group consisting of SEQ ID NO: 115 to SEQ ID NO: 120; (iii) The first recombinase enzyme contains Dre recombinase and the second recombinase enzyme contains Dre recombinase, wherein each Dre recombinase enzyme contains a single amino acid substitution within an amino acid region selected from the group consisting of SEQ ID NO: 121 to SEQ ID NO: 126; or (iv) The first recombinase enzyme contains Panto recombinase and the second recombinase enzyme contains Panto recombinase, wherein each Panto recombinase contains a single amino acid substitution within an amino acid region selected from the group consisting of SEQ ID NO: 127 to SEQ ID NO:

132.

10. The genetically engineered DNA recombinant enzyme of claim 4, wherein the at least one mutation or single amino acid substitution in the at least one first recombinase enzyme and the at least one second recombinase enzyme is selected from the group consisting of: E129R, Q133H, R173A, R173C, R173D, R173E, R173F, R173G, R173I, R173K, R173L, R173M, R173N, R173P, R173Q, R173S, R173T, R173V, R173W, R173Y, E176H, E176I, E176L, E176M, E176 V, E176W, E176Y, K201A, K201C, K201C, K201D, K201F, K201G, K201H, K201I, K201L, K201M, K 201N, K201P, K201Q, K201R, K201S, K201T, K201V, K201W, K201Y, H289D, H289E, H289I, H289 K, H289R, H289W, R292A, R292C, R292E, R292F, R292G, R292H, R292I, R292L, R292M, R292N, R 292P, R292Q, R292S, R292T, R292V, R292W, R292Y, Q311R, W315C, W315E, W315G, W315I, W315 K, W315L, W315M, W315N, W315Q, W315R, W315S, W315T, W315V, Y324A, Y324C, Y324E, Y324F, Y324H, Y324I, Y324K, Y324L, Y324M, Y324N, Y324Q, Y324R, Y324S, Y324T, Y324V, and Y324W, or in the corresponding positions of SEQ ID NO: 14, SEQ ID NO: 17, or SEQ ID NO:

20.

11. The genetically engineered DNA recombinant enzyme of claim 4, wherein the at least one mutation or single amino acid substitution in the at least one first recombinase enzyme and the at least one second recombinase enzyme is located in a position selected from the group consisting of: (i) E129, Q133, R173, E176, K201, H289, R292, Q311, W315 and Y324 of SEQ ID NO: 1; (ii) E146, Q151, R191, N194, K219, H308, R311, Q330, W334 and Y343 of SEQ ID NO: 14; (iii) E130, Q134, R174, E177, K202, H290, R293, Q312, W316 and Y325 of SEQ ID NO: 17; (iv) SEQ ID NO: 20 at the positions of E131, Q135, R175, E178, K202, H290, R293, Q312, W316, and Y325; or (v) at the positions of E129, Q133, R173, E176, K201, H289, R292, Q311, W315, or Y324 of SEQ ID NO:

1.

12. The method of claim 1, wherein the first mutant recombinase enzyme and the second mutant recombinase enzyme do not contain monomer-monomer-interface mutations.

13. The genetically engineered DNA recombinant enzyme of claim 4, wherein the first recombinase enzyme and the second recombinase enzyme do not contain monomer-monomer-interface mutations.

14. The method of claim 1, wherein the obligate DNA recombinase is a mutant of a naturally occurring position-specific recombinase or a mutant of a designer DNA recombinase.

15. The genetically engineered DNA recombinant enzyme of claim 4, wherein the genetically engineered DNA recombinant enzyme is a mutant of a naturally occurring position-specific recombinase or a mutant of a designer DNA recombinase.

16. The method of claim 1, wherein: • the first mutant recombinase enzyme comprises a mutation selected from the group consisting of: SEQ ID NO: 1, 2 or 7, mutation K201R; SEQ ID NO: 18 or 21, mutation K202R; SEQ ID NO: 15, mutation K219R; and SEQ ID NO: 24, mutation K221R; and • the second mutant recombinase enzyme comprises a mutation selected from the group consisting of: SEQ ID NO: 4 or 11, mutation Q311K; SEQ ID NO: 5 or 12, mutation Q311R; SEQ ID NO: 19 or 22, mutation Q312R; SEQ ID NO: 16, mutation Q330R; and SEQ ID NO: 25, mutation Q336R.

17. The genetically engineered DNA recombinant enzyme of claim 4, wherein: • the first recombinant enzyme comprises a mutation selected from the group consisting of: SEQ ID NO: 1, 2 or 7, mutation K201R; SEQ ID NO: 18 or 21, mutation K202R; SEQ ID NO: 15, mutation K219R; and SEQ ID NO: 24, mutation K221R; and • the second recombinant enzyme comprises a mutation selected from the group consisting of: SEQ ID NO: 4 or 11, mutation Q311K; SEQ ID NO: 5 or 12, mutation Q311R; SEQ ID NO: 19 or 22, mutation Q312R; SEQ ID NO: 16, mutation Q330R; and SEQ ID NO: 25, mutation Q336R.

18. The method of claim 1, wherein the target site is a target site of a tyrosine site-specific recombinase, and the specific DNA recombinase is selected from the group consisting of: • a genetically engineered DNA recombinase comprising a first recombinase enzyme and a second recombinase enzyme, wherein the first recombinase enzyme is a polypeptide having an amino acid sequence that is at least 70% sequence identical to the sequence according to SEQ ID NO: 7 and containing a single mutant K201R at the catalytic site; and wherein the second recombinase enzyme is a polypeptide having an amino acid sequence that is at least 70% sequence identical to the sequence according to SEQ ID NO: 11 and containing a single mutant Q311R at the catalytic site; • a genetically engineered DNA recombinase enzyme comprising a first recombinase enzyme and a second recombinase enzyme, wherein the first recombinase enzyme is a polypeptide having an amino acid sequence that is at least 70% sequence identical to the sequence according to SEQ ID NO: 7 and containing a single mutant Q311R at the catalytic site; • Cre recombinase, comprising a first recombinase and a second recombinase, the first recombinase having a single mutation K201R at its catalytic site and containing an amino acid sequence at least 70% identical to that of a polypeptide having the sequence according to SEQ ID NO: 2; and the second recombinase having a single mutation Q311R at its catalytic site and containing an amino acid sequence at least 70% identical to that of a polypeptide having the sequence according to SEQ ID NO: 5; • Cre recombinase, comprising a first recombinase and a second recombinase, the first recombinase having a single mutation K201R at its catalytic site and containing an amino acid sequence at least 70% identical to that of a polypeptide having the sequence according to SEQ ID NO: 5; • Cre recombinase, comprising a first recombinase and a second recombinase, the first recombinase having a single mutation K201R at its catalytic site and containing an amino acid sequence at least 70% identical to that of a polypeptide having the sequence according to SEQ ID NO:

5. • An amino acid sequence that is at least 70% identical to the sequence of the polypeptide according to SEQ ID NO: 4; and the second recombinase enzyme has a single mutation Q311K at its catalytic site and has an amino acid sequence that is at least 70% identical to the sequence of the polypeptide according to SEQ ID NO: 4; • Vika recombinase, comprising a first recombinase enzyme and a second recombinase enzyme, the first recombinase enzyme having a single mutation K219R at its catalytic site and having an amino acid sequence that is at least 70% identical to the sequence of the polypeptide according to SEQ ID NO: 15; and the second recombinase enzyme having a single mutation Q330R at its catalytic site and having an amino acid sequence that is at least 70% identical to the sequence of the polypeptide according to SEQ ID NO: 16;• Panto recombinase, comprising a first recombinase enzyme and a second recombinase enzyme, the first recombinase enzyme having a single mutation K202R at its catalytic site and having an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO: 18; and the second recombinase enzyme having a single mutation Q312R at its catalytic site and having an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO: 19; • Dre recombinase, comprising a first recombinase enzyme and a second recombinase enzyme, the first recombinase enzyme having a single mutation K202R at its catalytic site and having an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO: 21; and the second recombinase enzyme having a single mutation Q312R at its catalytic site and having an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO: 22; and • Vcre recombinase, comprising a first recombinase enzyme and a second recombinase enzyme, wherein the first recombinase enzyme has a single mutation K221R at its catalytic site and has an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO: 24; and the second recombinase enzyme has a single mutation Q336R at its catalytic site and has an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO:

25.

19. The genetically engineered DNA recombinant enzyme of claim 4, wherein the target site is a target site of a tyrosine site-specific recombinase, and the genetically engineered DNA recombinant enzyme is selected from the group consisting of: • A genetically engineered DNA recombinant enzyme comprising a first recombinase enzyme and a second recombinase enzyme, wherein the first recombinase enzyme is a polypeptide having an amino acid sequence that is at least 70% sequence identical to the sequence according to SEQ ID NO: 7 and containing a single mutation K201R at the catalytic site; and wherein the second recombinase enzyme is a polypeptide having an amino acid sequence that is at least 70% sequence identical to the sequence according to SEQ ID NO: 11 and containing a single mutation Q311R at the catalytic site; • A genetically engineered DNA recombinant enzyme comprising a first recombinase enzyme and a second recombinase enzyme, wherein the first recombinase enzyme is a polypeptide having an amino acid sequence that is at least 70% sequence identical to the sequence according to SEQ ID NO: 7 and containing a single mutation Q311R at the catalytic site; • Cre recombinase, comprising a first recombinase and a second recombinase, the first recombinase having a single mutation K201R at its catalytic site and containing an amino acid sequence at least 70% identical to that of a polypeptide having the sequence according to SEQ ID NO: 2; and the second recombinase having a single mutation Q311R at its catalytic site and containing an amino acid sequence at least 70% identical to that of a polypeptide having the sequence according to SEQ ID NO: 5; • Cre recombinase, comprising a first recombinase and a second recombinase, the first recombinase having a single mutation K201R at its catalytic site and containing an amino acid sequence at least 70% identical to that of a polypeptide having the sequence according to SEQ ID NO: 5; • Cre recombinase, comprising a first recombinase and a second recombinase, the first recombinase having a single mutation K201R at its catalytic site and containing an amino acid sequence at least 70% identical to that of a polypeptide having the sequence according to SEQ ID NO:

5. • An amino acid sequence that is at least 70% identical to the sequence of the polypeptide according to SEQ ID NO: 4; and the second recombinase enzyme has a single mutation Q311K at its catalytic site and has an amino acid sequence that is at least 70% identical to the sequence of the polypeptide according to SEQ ID NO: 4; • Vika recombinase, comprising a first recombinase enzyme and a second recombinase enzyme, the first recombinase enzyme having a single mutation K219R at its catalytic site and having an amino acid sequence that is at least 70% identical to the sequence of the polypeptide according to SEQ ID NO: 15; and the second recombinase enzyme having a single mutation Q330R at its catalytic site and having an amino acid sequence that is at least 70% identical to the sequence of the polypeptide according to SEQ ID NO: 16;• Panto recombinase, comprising a first recombinase enzyme and a second recombinase enzyme, the first recombinase enzyme having a single mutation K202R at its catalytic site and having an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO: 18; and the second recombinase enzyme having a single mutation Q312R at its catalytic site and having an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO: 19; • Dre recombinase, comprising a first recombinase enzyme and a second recombinase enzyme, the first recombinase enzyme having a single mutation K202R at its catalytic site and having an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO: 21; and the second recombinase enzyme having a single mutation Q312R at its catalytic site and having an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO: 22; and • Vcre recombinase, comprising a first recombinase enzyme and a second recombinase enzyme, wherein the first recombinase enzyme has a single mutation K221R at its catalytic site and has an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO: 24; and the second recombinase enzyme has a single mutation Q336R at its catalytic site and has an amino acid sequence with at least 70% identity to a polypeptide having the sequence according to SEQ ID NO:

25.

20. The method of claim 18, wherein the specific DNA recombinase specifically recognizes an upstream loxF8 target site having the nucleic acid sequence ATAAATCTGTGGAAACGCTGCCACACAATCTTAG (SEQ ID NO: 65) or its reverse complementary sequence; and recognizes a downstream loxF8 target site having the nucleic acid sequence CTAAGATTGTGTGGCAGCGTTTCCACAGATTTAT (SEQ ID NO: 66) or its reverse complementary sequence; and catalyzes recombination of a gene sequence between the upstream recombinase target site sequence of SEQ ID NO: 65 and the downstream recombinase target site sequence of SEQ ID NO: 66 at the loxF8 recombinase target site; and wherein the ability to catalyze recombination of a gene sequence between the upstream recombinase target site sequence of SEQ ID NO: 65 and the downstream recombinase target site sequence of SEQ ID NO: 66 at the loxF8 recombinase target site is tested by a method comprising the following steps: a) a) The genetically engineered DNA recombinant enzyme, comprising a first recombinase enzyme and a second recombinase enzyme, is expressed in the cell; and b) The genetically engineered DNA recombinant enzyme expressed in step a) is analyzed to determine whether it is capable of recombining DNA sequences on the human chromosome of the cell.

21. The genetically engineered DNA recombinant enzyme of claim 19, wherein the genetically engineered DNA recombinant enzyme specifically recognizes an upstream loxF8 target site having the nucleic acid sequence ATAAATCTGTGGAAACGCTGCCACACAATCTTAG (SEQ ID NO: 65) or its reverse complementary sequence; and recognizes a downstream loxF8 target site having the nucleic acid sequence CTAAGATTGTGTGGCAGCGTTTCCACAGATTTAT (SEQ ID NO: 66) or its reverse complementary sequence; and catalyzes the recombination of a gene sequence between the upstream recombinant enzyme target site sequence of SEQ ID NO: 65 and the downstream recombinant enzyme target site sequence of SEQ ID NO: 66; and wherein the ability to catalyze the recombination of a gene sequence between the upstream recombinant enzyme target site sequence of SEQ ID NO: 65 and the downstream recombinant enzyme target site sequence of SEQ ID NO: 66 is tested by a method comprising the following steps: a) a) The genetically engineered DNA recombinant enzyme, comprising a first recombinase enzyme and a second recombinase enzyme, is expressed in the cell; and b) The genetically engineered DNA recombinant enzyme expressed in step a) is analyzed to determine whether it is capable of recombining DNA sequences on the human chromosome of the cell.

22. A nucleic acid molecule or a plurality of nucleic acid molecules, each comprising or composed of the following: a nucleic acid sequence encoding a genetically engineered DNA recombinant enzyme or its subunit as claimed in claim 4.

23. A performance carrier comprising a nucleic acid molecule or a plurality of nucleic acid molecules as claimed in claim 22 and a performance control element operatively linked to the nucleic acid to drive its performance.

24. A host cell comprising a nucleic acid molecule or a plurality of nucleic acid molecules as claimed in claim 22 or an expression vector as claimed in claim 23.

25. A pharmaceutical composition comprising a genetically engineered DNA recombinant enzyme as claimed in claim 4, or a nucleic acid molecule or plurality of nucleic acid molecules as claimed in claim 22, or an expression vector as claimed in claim 23, or a host cell as claimed in claim 24.

26. The pharmaceutical composition of claim 25 further comprises one or more therapeutically acceptable diluents or carriers.

27. The genetically engineered recombinant DNA enzyme, as described in claim 4, is used in medicine.

28. Nucleic acid molecules or multiple nucleic acid molecules as requested in item 22, which are used in medicine.

29. The carrier of claim 23 is used in medicine.

30. The pharmaceutical composition of claim 25 or 26 is used in medicine.

31. The genetically engineered recombinant DNA enzyme, as claimed in claim 4, is used to treat hemophilia A.

32. The nucleic acid molecules or multiple nucleic acid molecules in claim 22 are used to treat hemophilia A.

33. The carrier of claim 23 is used to treat hemophilia A.

34. The pharmaceutical composition of claim 25 or 26 is used to treat hemophilia A.

35. A method for reverse DNA sequencing at the genomic level in vitro within cells, wherein the cells are not human germ cells, the method comprising the steps of: i. providing a nucleic acid molecule encoding a first recombinase enzyme as described in any one of claims 4 to 11, wherein the first recombinase enzyme contains at least one mutation that activates the catalytic activity of the first recombinase enzyme as a DNA recombinase, and wherein the first recombinase monomer specifically recognizes a first half-site of a recombinase target site; ii. providing a nucleic acid molecule encoding a second recombinase enzyme as described in any one of claims 4 to 11, wherein the second recombinase enzyme contains at least one mutation that activates the catalytic activity of the second recombinase enzyme as a DNA recombinase, and wherein the second recombinase monomer specifically recognizes a second half-site of a recombinase target site; iii. creating an expression vector by selecting the nucleic acid molecule encoding the first recombinase enzyme and the nucleic acid molecule encoding the second recombinase enzyme into an expression vector; iv. v. Deliver the expression vector to a cell containing the DNA sequence to be reversed, the expression vector of step iii, or an RNA molecule encoding a genetically engineered DNA recombinant enzyme as claimed in any of claims 4 to 11; v. Express the genetically engineered DNA recombinant enzyme as claimed in any of claims 4 to 11; vi. Reverse the DNA sequence to be reversed on the human chromosome of the cell using the genetically engineered DNA recombinant enzyme expressed in the cell as claimed in any of claims 4 to 11.

Images