Pharmaceutical composition and use thereof

Abstract

This invention belongs to the field of biopharmaceuticals, specifically relating to a pharmaceutical composition. The pharmaceutical composition comprises hepatitis B surface antigen, hepatitis B core antigen, and an immunostimulatory composition, wherein the immunostimulatory composition comprises a saponin and CpG oligodeoxynucleotides, or the immunostimulatory composition consists of an adjuvant containing a saponin and CpG oligodeoxynucleotides.

Description

[Technical Field]

[0001] This invention belongs to the field of biopharmaceuticals. Specifically, this invention relates to a pharmaceutical composition comprising hepatitis B surface antigen, hepatitis B core antigen, and an immunostimulatory composition. The immunostimulatory composition comprises a saponin and a CpG oligodeoxynucleotide, or the immunostimulatory composition consists of an adjuvant containing a saponin and a CpG oligodeoxynucleotide, wherein the CpG oligodeoxynucleotide sequence has two or more copies of a 5'-TTCGTT-3' motif or a 5'-TCGTCGTCG-3' motif. This invention also relates to the use of this pharmaceutical composition for treating hepatitis B virus infection and / or hepatitis B virus-mediated diseases. [Previous Technology]

[0002] Hepatitis B virus (HBV) infection is one of the most serious public health problems worldwide. HBV infection is a major cause of chronic hepatitis B, cirrhosis, and hepatocellular carcinoma (Fatt ovich GJ Hepatol. 2008;48:335-352). Commonly used drugs for the clinical treatment of chronic HBV infection include nucleoside analogs and interferon. Nucleoside analogs cannot completely eliminate cccDNA in hepatocytes, and long-term use can easily lead to the emergence of drug-resistant mutants and rebound after drug withdrawal (Kwon H, Lok AS. Nat Rev Gastroenterol Hepatol. 2011;8:275-284). Interferon is not suitable for asymptomatic HBV carriers. In patients with chronic HBV, the HBeAg seroconversion rate after six months of use is only 33%, and the significant side effects of interferon also limit its application (Tang SX, Yu GL. Lancet 1990;335(8684):302).

[0003] Currently, widely used hepatitis B protein vaccines achieve prevention by inducing humoral immunity and generating protective neutralizing antibodies. Numerous studies have found that neutralizing antibodies can only eliminate extracellular viral particles, while intracellular viral infection mainly relies on specific cellular immune responses, Th1 cytokines such as IFN-γ produced by helper T cells and CD4+ T cells, and especially virus-specific cytotoxic T lymphocytes (CTLs) to clear the virus (Chin R, Lacamini S. Rev Med Viorl. 2003:13(4):255-72). The strength of the cellular immune response directly determines the prognosis of hepatitis B. Therefore, an ideal therapeutic hepatitis B vaccine needs to simultaneously induce specific humoral and cellular immunity to overcome the immune tolerance of hepatitis B. For example, Chinese patent CN104043120B provides a therapeutic hepatitis B vaccine, which includes hepatitis B surface antigen (HBsAg), hepatitis B core antigen (HBcAg), and oligodeoxynucleotide (CpG), which can overcome the immune tolerance of hepatitis B and be used for the treatment of viral hepatitis B, especially chronic hepatitis B.

[0004] The inventors conducted in-depth research on existing technologies and discovered that adjuvants play an important role in the therapeutic effect of therapeutic hepatitis B vaccines. Commonly used adjuvants, oligodeoxynucleotides (CpG), are immunostimulatory compositions. Their chemical nature is that of oligodeoxynucleotides containing cytosine guanine dinucleotides, exhibiting an immune response similar to the natural CpG pattern recognition receptor. They can bind to Toll-like receptors on the cell membrane and effectively trigger a mammalian immune response via the TLR9 signaling pathway. Saponin adjuvants are a class of glycosides whose aglycones are triterpenoids or spirostane compounds, belonging to plant-derived adjuvants. Among them, saponins (QS) are saponins extracted from soap trees. QS-21 is currently the most widely reported adjuvant in the QS series, but QS-21 can induce hemolysis and has certain systemic and local toxic side effects. Alving et al. (ALVING CR, MATYAS G, BECK Z, et al. Revue Roumaine de Chimie, 2016, 61(8): 631-635.) found that using ALF liposomes combined with MPLA and QS-21 as adjuvants against HIV gp140 protein could effectively increase serum antibody titers. Ng et al. (NG H, FERNANDO GJP, DEPELSENAIRE ACI, et al. Scientific Reports, 2016, 6(1): 228-230.) used a subcutaneous delivery technology—nanopatch—to form an adjuvant complex with QS-21. The results showed that, compared with traditional intramuscular injection, the nanopatch significantly reduced the dosage of antigen and QS-21 and induced higher IgG titers (Han Ziyi, Zeng Zhongliang, Modern Agricultural Science and Technology, 2019(14): 220-221.).

[0005] Prior art (WO2001051083A3) has reported immunostimulatory compositions containing saponins and CpG oligodeoxynucleotides, wherein the CpG adjuvants involve CpG1826 and CpG7909. However, due to the structural diversity of CpG oligodeoxynucleotides, the effects of CpG adjuvants with different sequences vary greatly.

[0006] Therefore, there is currently a demand for adjuvants with stronger immune effects and hepatitis B treatment agents. [Summary of the Invention]

[0007] In response to the shortcomings of existing technologies, the inventors, after conducting extensive research, unexpectedly discovered an immunostimulatory composition with a stronger immune effect, and a pharmaceutical composition comprising this immunostimulatory composition. The pharmaceutical composition provided by this invention comprises dual adjuvants, and wherein a highly efficient synergistic effect is exhibited between the saponin and the CpG oligodeoxynucleotide, which can mediate a stronger immune response. This invention also provides the use of this pharmaceutical composition for treating hepatitis B virus infection and / or hepatitis B virus-mediated diseases.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] In one aspect, the present invention provides a pharmaceutical composition comprising: i) hepatitis B surface antigen, an active fragment of the antigen, a variant of the antigen, or a mixture of at least two thereof; ii) hepatitis B core antigen, an active fragment of the antigen, a variant of the antigen, or a mixture of at least two thereof; iii) an immunostimulatory composition comprising a saponin and a CpG oligodeoxynucleotide, or the immunostimulatory composition comprising an adjuvant containing a saponin and a CpG oligodeoxynucleotide; wherein the CpG oligodeoxynucleotide sequence has two or more copies of a 5'-TTCGTT-3' motif or a 5'-TCGTCGTCG-3' motif.

[0010] According to the pharmaceutical composition of the present invention, wherein the sequence of the CpG oligodeoxynucleotide is selected from any one of the following: CpG T1: TCG TTC GTT CGT TCG TTC GTT (SEQ ID NO: 6), CpG T2: TCG TTC GTT CGT TCG TTC GTT CGT T (SEQ ID NO: 7) and CpG T3: TCG TCG TCG TCG TCG TCG TCG TCG (SEQ ID NO: 8);

[0011] Preferably, the sequence of the CpG oligodeoxynucleotide is CpG T1:TCG TTC GTT CGT TCG TTC GTT (SEQ ID NO: 6).

[0012] According to the pharmaceutical composition of the present invention, the saponin may be selected from one or more of saponins, ginsenosides, platycodon saponins, astragalus saponins, notoginseng saponins, glycyrrhiza saponins, albizia bark saponins, ophiopogon saponins, bupleurum saponins, or bamboo rhizome saponins. Preferably, the saponin is saponin, ginsenosides, platycodon saponins, or astragaloside A; more preferably, the saponin is QS-7, QS-17, QS-18, or QS-21; even more preferably, the saponin is QS-21; the ginsenoside may be ginsenoside Rg1, ginsenoside Rg3, ginsenoside Rb1, or ginsenoside Re; the platycodon saponin may be platycodon saponin D, platycodon saponin D2, or a mixture thereof; the astragalus saponin may be... The saponin is a monomer of astragaloside IV, astragaloside I, astragaloside II, or a mixture of two or more of these saponin monomers; the saponin can be saponin R1; the saponin can be saponin D; the saponin can be saponin a, saponin d, or a mixture thereof; the saponin can be total saponins from Albizia bark; the saponin can be total saponins from licorice; and the saponin can be total saponins from Panax notoginseng.

[0013] In the pharmaceutical composition according to the present invention, the adjuvant containing saponin is an immunostimulatory complex adjuvant (Iscom adjuvant).

[0014] According to the pharmaceutical composition of the present invention, the CpG oligodeoxynucleotide may contain a thiophosphate linker; preferably, the CpG oligodeoxynucleotide is a thiooligodeoxynucleotide, more preferably a fully thiooligodeoxynucleotide.

[0015] In the pharmaceutical composition according to the present invention, the weight ratio of the CpG oligodeoxynucleotide to the saponin is 1~40:0.1~2, preferably 2~40:0.1~2.

[0016] Preferably, the weight ratio of the CpG oligodeoxynucleotide to the saponin is 1:0.1, 1:1, 1:2, 2:0.1, 2:1, 40:0.1, 40:1 or 20:1, more preferably 1:1, 2:1, 40:0.1, 40:1 or 20:1, and even more preferably 2:1.

[0017] The pharmaceutical composition according to the present invention, wherein the hepatitis B surface antigen comprises or consists of the sequence shown in SEQ ID NO: 1.

[0018] According to the pharmaceutical composition of the present invention, the hepatitis B core antigen comprises or is composed of the sequence shown in SEQ ID NO: 2; preferably, the active fragment of the hepatitis B core antigen comprises or is composed of the continuous amino acids at positions 1 to X in SEQ ID NO: 2, wherein X can be an integer between 149 and 183; more preferably, X is an integer between 152 and 183.

[0019] According to the pharmaceutical composition of the present invention, the weight ratio between components i), ii) and iii) of the pharmaceutical composition is 4:2:1.1 to 42, preferably 4:2:2.1 to 42.

[0020] Further preferably, the weight ratio between components i), ii) and iii) of the pharmaceutical composition is 4:2:1.1, 4:2:2, 4:2:3, 4:2:2.1, 4:2:40.1, 4:2:41 or 4:2:42, preferably 4:2:2, 4:2:3, 4:2:40.1, 4:2:41 or 4:2:42, and even more preferably 4:2:3.

[0021] According to the pharmaceutical composition of the present invention, the pharmaceutical composition further comprises: iv) a pharmaceutically acceptable carrier.

[0022] On the other hand, the present invention provides a hepatitis B prophylactic vaccine or a hepatitis B therapeutic vaccine comprising the pharmaceutical composition; preferably, the vaccine is a hepatitis B therapeutic vaccine.

[0023] In another aspect, the present invention provides the use of the pharmaceutical composition in the preparation of a medicament for the prevention and / or treatment of hepatitis B virus infection and / or hepatitis B virus-mediated diseases; preferably, the hepatitis B virus infection and / or hepatitis B virus-mediated diseases are selected from hepatitis B, cirrhosis and liver cancer.

[0024] In another aspect, the present invention provides the use of the pharmaceutical composition in the preparation of a medicament for generating humoral and / or cellular immune responses against hepatitis B virus in an article.

[0025] In another aspect, the present invention provides the use of the pharmaceutical composition in the preparation of a medicament for causing subtype conversion of hepatitis B core antibodies in an article.

[0026] In another aspect, the present invention provides the use of the pharmaceutical composition in the preparation of a medicament for overcoming hepatitis B virus immune tolerance in a subject.

[0027] In another aspect, the present invention provides a method for preventing and / or treating hepatitis B virus infection and / or hepatitis B virus-mediated diseases, the method comprising administering to a subject in need a preventive and / or therapeutically effective amount of a pharmaceutical composition; preferably, the hepatitis B virus infection and / or hepatitis B virus-mediated diseases are selected from hepatitis B, cirrhosis and liver cancer.

[0028] On the other hand, the present invention provides a method for generating a humoral and / or cellular immune response against hepatitis B virus in an article, the method comprising administering an effective amount of a pharmaceutical composition to a subject in need.

[0029] On the other hand, the present invention provides a method for subtype conversion of hepatitis B core antibodies in an article, the method comprising administering an effective amount of a pharmaceutical composition to a subject in need.

[0030] On the other hand, the present invention provides a method for overcoming hepatitis B virus immune tolerance in an object, the method comprising administering an effective amount of a pharmaceutical composition to a subject in need.

[0031] The pharmaceutical composition of the present invention contains two adjuvants, which have unexpected technical effects and can mediate a stronger immune response. The immunostimulatory effects of CpG T1, CpG T2, and CpG T3 alone are weaker than those of CpG1018, CpG7909, and CpG1826, but when used in combination with QS21, the adjuvants exhibit an unexpected synergistic effect, significantly enhancing the immune response. The hepatitis B therapeutic vaccine containing this immunostimulatory composition can overcome the immune tolerance of genetically modified mice, producing high titers of anti-HBsAg antibodies, anti-HBcAg antibodies, and neutralizing antibodies. All test results show that the vaccine can significantly clear hepatitis B virus from genetically modified mice through multiple immunizations. After the immunization process, the HBsAb level is close to saturation, maintaining a stable and long-lasting immune effect, with an average HBsAg reduction rate maintained at approximately 92%. Hepatitis B vaccines containing this immunostimulant can induce strong HBsAg and HBcAg-specific IFN-γ levels, with significantly better immunization effects than adjuvants alone, and significantly better than combinations of other CPG adjuvants and QS21.

Implementation Method

[0032] Definitions Unless otherwise defined, all technical terms used herein have the same meaning as understood by one of ordinary skill in the art. For specific definitions and terms in this field, those skilled in the art may refer to Current Protocols in Molecular Biology (Ausubel). The abbreviations for amino acid residues are the standard 3-letter and / or 1-letter codes used in the art to refer to one of the 20 commonly used L-amino acids.

[0033] Although the present invention uses a broad range to represent digital ranges and approximate parameter values, the values ​​shown in the specific embodiments are described as accurately as possible. However, any value inherently contains a certain degree of error due to the standard deviation present in their respective measurements. Furthermore, all ranges disclosed herein should be understood to encompass any and all subranges contained therein. For example, the range “1.1 to 42” should be considered to include any and all subranges between the minimum value 1.1 and the maximum value 42 (inclusive); that is, all subranges starting with a minimum value of 1.1 or greater, such as 1.1 to 6.1, and subranges ending with a maximum value of 42 or less, such as 5.5 to 42. Additionally, any references referred to as “incorporated herein” should be understood to be incorporated herein in their entirety.

[0034] It should also be noted that, as used herein, the singular form includes the plural form of the object it refers to, unless it is clearly and explicitly limited to one object. The term "or" may be used interchangeably with the term "and / or" unless the context clearly indicates otherwise.

[0035] The terms “pharmaceutical composition,” “composition drug,” and “pharmaceutical composition” as used herein are used interchangeably and refer to a combination of at least one drug substance and optional pharmaceutically acceptable excipients or adjuvants that are combined together to achieve a particular purpose. In some embodiments, the pharmaceutical composition comprises combinations that are separate in time and / or space, provided that they can work together to achieve the objectives of the invention. For example, the components contained in the pharmaceutical composition (e.g., HBsAg, HBcAg, QS-21, CpG oligodeoxynucleotides) may be applied to the article as a whole or separately. When the components contained in the pharmaceutical composition are applied to the article separately, the components may be applied to the article simultaneously or sequentially.

[0036] As used herein, the term "CpG oligodeoxynucleotide" or "CpG-ODN" refers to a short, single-stranded synthetic DNA molecule containing one or more "CpG" units, where C represents cytosine, G represents guanine, and p represents a phosphodiester bond. Specifically, the CpG oligodeoxynucleotide is unmethylated. In some embodiments, the CpG-ODN comprises phosphate thioester links or a phosphate thioester backbone. That is, in some embodiments, the CpG-ODN is a phosphate thioester oligodeoxynucleotide (i.e., a thiooligodeoxynucleotide). Preferably, all nucleotide links in the CpG-ODN are phosphate thioester links, i.e., the CpG-ODN is a fully thiooligodeoxynucleotide. In other embodiments, the CpG-ODN contains two or more copies of the 5'-TTCGTT-3' motif or the 5'-TCGTCGTCG-3' motif. Specifically, the CpG-ODN has a sequence selected from: TCG TTC GTT CGT TCG TTC GTT (SEQ ID NO: 6), TCG TTC GTT CGT TCG TTC GTT CGT T (SEQ ID NO: 7) or TCG TCG TCG TCG TCG TCG TCG (SEQ ID NO: 8), preferably TCG TTC GTT CGT TCG TTC GTT (SEQ ID NO: 6).

[0037] The terms “ginsenosides, platycodon saponins, astragalus saponins, notoginseng saponins, licorice saponins, albizia bark saponins, ophiopogon saponins, bupleurum saponins or bamboo joint saponins” used in this article refer to active ingredients that exist in the corresponding plants. For example, ginsenosides are sterol compounds that are mainly found in Panax ginseng medicinal materials and are active ingredients in ginseng. In some embodiments, the ginsenoside is preferably a monomer such as ginsenoside Rg1, ginsenoside Rg3, ginsenoside Rb1, ginsenoside Re, or a mixture of two or more of these monomers; platycodon saponin is preferably platycodon saponin D, platycodon saponin D2, or a mixture of both; astragalus saponin is preferably a monomer such as astragaloside IV, astragaloside I, astragaloside II, or a mixture of two or more of these monomers; notoginseng saponin is preferably notoginseng saponin R1, etc.; ophiopogon saponin is preferably ophiopogon saponin D, etc.; bupleurum saponin is preferably bupleurum saponin a, bupleurum saponin d, or a mixture of both; albizia bark saponin is preferably total albizia bark saponins, etc.; licorice saponin is preferably total licorice saponins, etc.; and bamboo rhizome saponin is preferably total bamboo rhizome saponins, etc.

[0038] The “Iscom adjuvant” used in this article is an immunostimulatory complex adjuvant, specifically an Iscom matrix (ISCOM MATRIX) that does not contain antigens. It is an adjuvant with a cage-like structure composed of phospholipids, saponins, and cholesterol.

[0039] As used herein, “therapeutic effective dose” or “effective dose” refers to a dose sufficient to demonstrate its benefit to the applied object. The actual amount applied, as well as the rate and duration of application, will depend on the individual patient’s condition and severity. Prescribing treatment (e.g., determining the dosage) is ultimately the responsibility of and depends on the general practitioner and other physicians, who typically consider the disease being treated, the individual patient’s condition, the site of delivery, the method of application, and other factors known to the physician.

[0040] The term “mammal” as used herein refers to humans, but may also refer to other animals, such as wild animals (e.g., herons, storks, cranes, etc.), livestock (e.g., ducks, geese, etc.) or laboratory animals (e.g., orangutans, monkeys, rats, mice, rabbits, guinea pigs, marmots, ground squirrels, etc.).

[0041] In other embodiments, the compositions of the present invention may also contain additional additives, such as pharmaceutically acceptable carriers or additives, especially when they are in the form of pharmaceutical formulations.

[0042] Preferred drug carriers are water, buffered aqueous solutions, preferably isotonic salt solutions such as PBS (phosphate-buffered saline), glucose, mannitol, dextran, lactose, starch, magnesium stearate, cellulose, magnesium carbonate, 0.3% glycerol, hyaluronic acid, ethanol, or polyalkylene glycols such as polypropylene glycol, triglycerides, etc. The type of drug carrier used depends particularly on whether the composition according to the invention is formulated for oral, nasal, intradermal, subcutaneous, intramuscular, or intravenous administration. The composition according to the invention may contain wetting agents, emulsifiers, or buffering substances as additives.

[0043] The pharmaceutical composition, vaccine or pharmaceutical preparation according to the present invention can be administered by any suitable route, such as oral, nasal, intradermal, subcutaneous, intramuscular or intravenous administration.

[0044] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, this is not a limitation of the present invention. Those skilled in the art can make various modifications or improvements based on the basic idea of ​​the present invention. However, as long as they do not depart from the basic idea of ​​the present invention, they are all within the scope of the present invention.

[0045] Best Implementation Method of the Invention

[0046] The present invention will be described below with reference to specific embodiments. Those skilled in the art will understand that these embodiments are for illustrative purposes only and do not limit the scope of the invention in any way.

[0047] Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the raw materials, reagents, and other materials used in the following examples are commercially available products.

[0048] Example 1: Preparation for the screening experiment of the immune stimulation composition

[0049] 1. HBsAg stock solution: The amino acid sequence of HBsAg protein is shown in SEQ ID NO: 1.

[0050] HBsAg protein is prepared from recombinant yeast cells containing the HBsAg gene. Yeast cell types include *Hansophora chinensis*, *Saccharomyces cerevisiae*, and *Pichia pastoris*, with *Hansophora chinensis* being preferred. Specific preparation steps are described in Chinese patent application CN108330145A. The recombinant *Hansophora chinensis* cells containing the HBsAg gene are fermented and cultured, and the cells are harvested. Purification is achieved through cell disruption, silica gel adsorption, column chromatography, and TFF (thermal fiber ionization).

[0051] 2. HBcAg stock solution: The amino acid sequence of HBcAg protein is shown in SEQ ID NO: 2.

[0052] HBcAg protein is prepared from recombinant yeast cells containing the HBcAg gene. Yeast cell types include *Hansenula polymorpha*, *Saccharomyces cerevisiae*, and *Pichia pastoris*, with *Hansenula polymorpha* being preferred. Specific preparation steps are described in Chinese patent application CN108047316A. The recombinant *Hansenula polymorpha* cells containing the HBcAg gene are fermented and cultured, and the cells are harvested. The cells are then purified through cell disruption, ammonium sulfate treatment, column chromatography, and TFF to prepare the HBcAg stock solution.

[0053] 3. QS-21: Purchased from Brenton AG, CAS.NO.A010-023.

[0054] 4. Preparation method of CPG oligodeoxynucleotide raw material:

[0055] Oligodeoxynucleotides are synthetically prepared oligoodeoxynucleotide sequence fragments containing one or more CpG motifs. The CpG sequences used in this embodiment are shown in Table 1: Table 1 Specific sequences of CPG oligoodeoxynucleotides CPG oligodeoxynucleotide typing CPG oligodeoxynucleotides sequence Type B CpG 1018 TGACTGTGAACGTTCGAGATGA(SEQ ID NO: 3) CpG 7909 TCGTCGTTTTGTCGTTTTGTCGTT(SEQ ID NO: 4) CpG 1826 TCCATGACGTTCCTGACGTT(SEQ ID NO: 5) CpG T1 TCGTTCGTTCGTTCGTTCGTT(SEQ ID NO: 6) CpG T2 TCG TTC GTT CGT TCG TTC GTT CGT T(SEQ ID NO: 7) CpG T3 TCG TCG TCG TCG TCG TCG TCG(SEQ ID NO: 8) CpG 684 TCGACGTTCGTCGTTCGTCGTTC(SEQ ID NO: 9) CpG 1668 TCC ATG ACG TTC CTG ATGCT(SEQ ID NO: 10) CpG D2 TGTCGTCGTCGTTTGTCGTTTGTCGTT(SEQ ID NO: 11) Type A CpG 2216 GGGGGACGATCGTCGGGGGG(SEQ ID NO: 12) ODN 2336 GGGGACGACGTCGTGGGGGGG(SEQ ID NO: 13) Type C ODN 2395 TCGTCGTTTCGCGCGCGCCG(SEQ ID NO: 14) ODN M362 TCGTCGTTCGTTCGTCGAACGACGTTTGAT(SEQ ID NO: 15)

[0056] Specific preparation method: Prepared using conventional solid-phase phosphoramidine triester chemical synthesis method, starting from the 3' end: 1) Deprotection: First, remove the protecting group DMT (dimethoxytriphenylmethyl) of the nucleotide linked to CpG with trichloroacetic acid to obtain a free 5' hydroxyl group for the next condensation reaction; 2) Activation: Mix the phosphoramidine-protected nucleotide monomer with a tetrazolium activator and enter the synthesis column to form a phosphoramidine tetrazolium active intermediate. This intermediate undergoes a condensation reaction with the deprotected nucleotide on CpG; 3) Linkage: When the phosphoramidine tetrazolium active intermediate encounters the deprotected nucleotide on CpG, it will undergo an affinity reaction with its 5' hydroxyl group, condensing and removing the tetrazolium. At this time, the oligonucleotide chain is extended forward by one... 4) Oxidation: During the condensation reaction, the nucleotide monomer is linked to the oligonucleotide attached to CpG via a phosphite bond. However, the phosphite bond is unstable and easily hydrolyzed by acids or bases. At this time, a thioreagent is used to oxidize the phosphite to a phosphotriester with a thiophosphoric double bond, thereby obtaining a stable oligonucleotide; 5) Blocking: After the condensation reaction, in order to prevent the unreacted 5' hydroxyl group attached to CpG from being extended in the subsequent loop reaction, acetylation is often used to block this terminal hydroxyl group; After the above five steps, a deoxynucleotide is attached to the nucleotide of CpG; Repeating the above deprotection, activation, ligation, oxidation, and blocking processes can yield a crude DNA fragment; Finally, it can be processed by cutting, deprotection, purification, quantification, and other post-synthetic treatments.

[0057] The HBsAg stock solution and HBcAg stock solution were diluted to 200 μg / ml and 100 μg / ml respectively using PBS solution (purchased from Hyclone); the CPG raw materials were dissolved and diluted to 100 μg / ml using PBS solution for the next step.

[0058] Example 2 Screening Experiment of CPG Oligodeoxynucleotides

[0059] 1. Experimental animals: C57BL / 6(N) mice, male, 4 weeks old, 135 mice, Shanghai Lingchang Experimental Animal Technology Co., Ltd.

[0060] 2. Experimental grouping: See Table 2. Each injection volume was 100 μL / animal. Group A was the negative control, with 100 μL of PBS solution per animal. Table 2 Experimental animal grouping Group Quantity (pieces) Components (μg / mouse) HBsAg HBcAg CpG T1 CpG T2 CpG T3 CpG 1018 CpG 7909 CpG 1826 CpG 684 CpG 1668 CPG D2 CpG 2216 ODN 2336 ODN 2395 ODNM362 Comparison 9 antigen 9 20 10 T1 9 20 10 10 T2 9 20 10 10 T3 9 20 10 10 1018 9 20 10 10 7909 9 20 10 10 1826 9 20 10 10 684 9 20 10 10 1668 9 20 10 10 D2 9 20 10 10 2216 9 20 10 10 2336 9 20 10 10 2395 9 20 10 10 M362 9 20 10 10

[0061] 3. Experimental steps: On the 7th day after immunization of mice, spleens were harvested and splenic lymphocytes were prepared according to conventional methods, as follows: Spleen harvesting under aseptic conditions: The spleen was cut with sterile forceps and scissors and placed in a 70μm cell filter. The spleen was then placed in a petri dish containing 2ml of pre-cooled 2% FBS (purchased from GIBCO)-PBS. The spleen was ground with a grinding rod, and the spleen cells passed through the sieve into the petri dish to obtain a cell suspension. The suspension was then placed into a 50ml sterile centrifuge tube filtered through a 40μm cell filter (purchased from BD) using a Pasteur pipette. The cells were centrifuged at 500×g and 4℃ for 5 minutes. The supernatant was discarded, and 2ml of 1× erythrocyte lysis agent (purchased from BD) was added to resuspend the cells. The cells were incubated at 4℃ in the dark for 5 minutes to lyse the erythrocytes. 10ml of 2% FBS-PBS was added to terminate the erythrocyte lysis reaction. The cells were centrifuged at 500×g and 4℃ for 5 minutes. The supernatant was discarded, and 5ml of 2% FBS-PBS was added to resuspend the cells for later use. Spleen cells were stimulated with the HBsAg-specific peptide library PS4 and the HBcAg-specific peptide library PCP, respectively. The HBsAg and HBcAg antigen-specific IFN-γ secretion levels were detected using the ELISPOT kit (BD Biosciences) according to the kit instructions. The number of spots detected by the ELISPOT kit was read using an ImmunoSPOT Series 3 enzyme-linked spot analyzer (for specific operating procedures, refer to Example 7 of Chinese Patent CN104043120B).

[0062] The HBsAg specific peptide library sequence is referenced in Example 7 of Chinese Patent CN104043120B; the HBcAg specific peptide library sequence is shown in SEQ ID NO: 16~30.

[0063] 4. Experimental results: The ELISPOT spot results are shown in Figures 1 and 2. The results show that different sequences of type B CpG adjuvants have different immune effects. Among them, CpG T1~T3, CpG1018, CpG7909, CpG 1826 and CpG 684 are generally better than type A CpG adjuvants and type C CpG adjuvants, while CpG1618 and CpG D2 have poor immune effects and induce HBsAg and HBcAg specific IFN-γ levels lower than type A CpG adjuvants and type C CpG adjuvants.

[0064] Example 3: Screening Experiment of Immunostimulatory Compositions

[0065] 1. Experimental animals: 81 male C57BL / 6(N) mice, 4 weeks old, from Shanghai Lingchang Experimental Animal Technology Co., Ltd.

[0066] 2. Experimental grouping: See Table 3. Each injection volume was 100 μL / animal. Group A was the negative control, with 100 μL of PBS solution per animal. Table 3 Experimental animal grouping Group Quantity (pieces) Components (μg / mouse) HBsAg HBcAg CpG T1 CpG T2 CpG T3 CpG 1018 CpG 7909 CpG 1826 CpG 684 QS21 Comparison 9 antigen 9 20 10 T1 9 20 10 10 5 T2 9 20 10 10 5 T3 9 20 10 10 5 1018 9 20 10 10 5 7909 9 20 10 10 5 1826 9 20 10 10 5 684 9 20 10 10 5

[0067] 3. Experimental steps: Same as Example 2.

[0068] 4. Experimental results: The ELISPOT spot results are shown in Figures 3 and 4. The results show that the combined application of CpG T1~T3 and QS21 produced a highly efficient synergistic effect, inducing HBsAg and HBcAg-specific IFN-γ levels that were significantly higher than those of other CpG adjuvants such as CpG1018 and CpG7909, with unexpected immune effects.

[0069] Example 4 Effect of different adjuvant contents on the immunogenicity of pharmaceutical composition 1. Experimental animals: C57BL / 6(N) mice, male, 4 weeks old, 60 mice, Shanghai Lingchang Experimental Animal Technology Co., Ltd. 2. Reagents and Materials: 1) HBsAg protein, HBcAg protein, and CpG T1 were prepared according to Example 1; 2) QS-21 (CAS.NO.A010-023, purchased from Brenton AG); 3) HBsAg stock solution and HBcAg stock solution were diluted to 200 μg / ml and 100 μg / ml respectively using PBS solution (purchased from Hyclone), QS-21 was diluted to 5 μg / ml, 50 μg / ml, and 100 μg / ml respectively, CpG T1 was dissolved in PBS solution and diluted to 50 μg / ml, 100 μg / ml, and 2 mg / ml respectively, and CPG7909 was dissolved in PBS solution and diluted to 100 μg / ml for the next step. 3. Experimental Groups: See Table 4. The injection volume was 100 μL / animal per injection. Group A was the negative control, with 100 μL of PBS solution per animal. 4. Experimental Procedure: Same as Example 2. 5. Experimental Results: ELISPOT spot test results are shown in Figures 5 and 6. The results show that dose changes of CpG T1 and QS21 significantly affected the vaccine composition. Immunostimulatory compositions at doses higher than 5 induced significantly higher levels of HBsAg and HBcAg-specific IFN-γ compared to the CPG7909 group. However, due to species differences, further increases in adjuvant dose did not significantly increase the induction effect, presumably because mice cannot accurately reflect the immune strength of the adjuvant. Doses 1, 2, and 4 had comparable immunostimulatory effects to the CPG7909 group, but the adjuvant doses used were lower than those in the equivalent CPG7909 group, thus also showing certain advantages. Table 4: Grouping of Experimental Animals Group Quantity (pieces) Components (μg / mouse) HBsAg HBcAg CpG T1 QS21 CPG7909 Comparison 5 antigen 5 20 10 Dosage 1 5 20 10 5 0.5 Dosage 2 5 20 10 5 5 Dosage 3 5 20 10 5 10 Dosage 4 5 20 10 10 0.5 Dosage 5 5 20 10 10 5 Dosage 6 5 20 10 10 10 Dosage 7 5 20 10 200 0.5 Dosage 8 5 20 10 200 5 Dosage 9 5 20 10 200 10 CPG7909 5 20 10 5 10

[0070] Example 5 Experimental group setup and immunization procedure for hepatitis B vaccine 1. Experimental animals and model establishment: 81 male C57BL / 6(N) mice, 4 weeks old, purchased from Shanghai Lingchang Experimental Animal Technology Co., Ltd.; rAAV8-HBV adenovirus purchased from Beijing Wujiahe Molecular Medicine Research Institute Co., Ltd. A mouse model of persistent rAAV8-HBV infection in C57BL / 6(N) mice was established by intravenous injection of rAAV8-HBV into the tail vein. 2. Reagents and materials: 1) HBsAg protein: prepared in Example 1. 2) HBcAg protein: prepared in Example 1. 3) Dilute HBsAg stock solution, HBcAg stock solution, and QS-21 to 200 μg / ml, 100 μg / ml, and 50 μg / ml respectively using PBS solution (purchased from Hyclone). Dissolve CpG in PBS solution and dilute to 100 μg / ml for the next step. 3. Experimental grouping: See Table 5. Each mouse received 100 μL of PBS solution per injection. Group A was the negative control, receiving 100 μL of PBS solution per mouse. Table 5 Experimental animal grouping and injection volume per group Group Quantity (pieces) Components (μg / mouse) HBsAg HBcAg CpG T1 CpG 7909 QS-21 A 9 B 9 10 C 9 5 D 9 10 5 E 9 20 10 F 9 20 10 10 G 9 20 10 5 H 9 20 10 10 5 I 9 20 10 10 5 4. Animal Immunization: All groups received intramuscular injections every two weeks in the right hind thigh for a total of six administrations, administered at weeks 4, 6, 8, 10, 12, and 14 following intravenous injection of rAAV8-HBV virus. Blood samples were collected every two weeks after the start of treatment, at weeks 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22. All mice were sacrificed at week 22.

[0071] Example 6 Effect of Hepatitis B Vaccine on Serum HBsAg Levels 1. Serum HBsAg Detection Procedure: The test was conducted by Nanjing Gulou Hospital. A two-step immunoassay was used. First, the sample was tested for binding to paramagnetic microparticles coated with hepatitis B surface antibody. After washing, acrid ester-labeled hepatitis B surface antibody conjugate was added. After washing again, pre-activation solution and activation solution were added to the reaction mixture. The relative luminescence value (RLU) of the test sample was measured. The HBsAg content in the sample was positively correlated with the RLU. The concentration of HBsAg in mouse serum samples was determined by the generated ARCHTITECT HBsAg standard curve. The final concentration of HBsAg in mouse serum samples was 50 to 200 times the measured value. 2. Results Analysis (Figure 7): The H group vaccine containing the immunostimulant of this invention showed a significant downward trend in HBsAg levels, maintaining a stable and long-lasting immune effect after the immunization process (starting from week 14). Compared with the CpG group (F group) and QS-21 group (G group) alone, it has a significant advantage. The HBsAg level in group H decreased from >6350 IU / ml initially to about 50 IU / ml. After the second immunization (week 6), the HBsAg level in this group decreased by more than 30%, and after the third immunization (week 8), the HBsAg level decreased by more than 70%, and the average decrease rate remained at about 92% after the immunization at week 14. It has a superior immune effect. Compared with the double adjuvant control (group I), H maintained a stable immune effect after the immunization at week 14, and the immune level was significantly better than that of group I.

[0072] Example 7 Evaluation of Humoral Immunological Effect of Hepatitis B Vaccine 1. Detection Procedure of Serum HBsAb: The test was conducted by Nanjing Gulou Hospital. A two-step immunoassay was used. First, the test sample was mixed with paramagnetic microparticles coated with recombinant HBsAg (rHBsAg). After washing, acrid ester-labeled rHBsAg conjugate was added. After washing again, pre-activation solution and activation solution were added to the reaction mixture. The relative luminescence value (RLU) of the test sample was measured. The HBsAb content in the sample was positively correlated with the RLU. The concentration of HBsAb in mouse serum samples was determined by the generated ARCHTITECT HBsAb calibration curve. The final concentration of HBsAb in mouse serum samples was 50 to 200 times the measured value. 2. Results Analysis (Figure 8): The H group vaccine containing this immunostimulant began to produce HBsAb (>10 mIU / ml) after the second immunization (week 6), and the HBsAb level showed a continuous increasing trend with the number of immunizations, and the increasing trend was significantly better than that of the CpG group (F group) and the QS-21 group (G group). Two weeks after the end of immunization (week 16), the HBsAb level was close to saturation, reaching about 4.0 log, or about 10,000 mIU / ml. Compared with the double adjuvant control (I group), the antibody level produced was also significantly better.

[0073] Example 8 Evaluation of Cellular Immunization Effect of Hepatitis B Vaccine 1. Detection Procedure: Same as Example 2; Experimental Groups are shown in Table 6. 2. Evaluation Indicators: If the number of control well spots ≤ 5 SCF and the number of sample well spots ≥ 10 SCF, it is judged as positive; if 5 SCF < control well spots ≤ 10 SCF and the number of sample well spots / control well spots ≥ 2, it is judged as positive; if the number of control well spots > 10 SCF and the number of sample well spots / control well spots ≥ 3, it is judged as positive. 3. Experimental Results: Table 6 Seroconversion Rate of HBsAg and HBcAg-Specific IFN-γ Secreted by Spleen Cells Group Quantity (pieces) Positive conversion rate (%) HBsAg HBcAg A 9 11.1 11.1 B 9 0 11.1 C 8 0 0 D 8 12.5 12.5 E 9 37.5 12.5 F 9 100 100 G 8 100 100 H 8 100 100 I 8 100 100 Cellular immune level detection results: ELISPOT spot results are shown in Figures 9 and 10. Analysis showed that the seroconversion rates of HBsAg-specific IFN-γ in groups F-I were both 100%. The H group vaccine containing this immunostimulant induced higher levels of HBsAg and HBcAg-specific IFN-γ, exceeding 2350 SFC / 10⁶ splenocytes and 1250 SFC / 10⁶ splenocytes, respectively, showing significant differences compared to the CpG group (F group) and QS-21 group (G group). Compared to the double adjuvant control (I group), the latter induced HBsAg and HBcAg-specific IFN-γ levels of approximately 1630 SFC / 10⁶ splenocytes and 750 SFC / 10⁶ splenocytes, respectively, significantly lower than those in group H.

[0074] Example 9 Detection of HBsAg and HBcAg specific antibodies in serum using pharmaceutical composition 1. Detection steps: A 96-well ELISA plate was coated with purified HBsAg and HBcAg to form a solid-phase antigen. After blocking, the serum to be tested was serially diluted at a certain initial dilution. Multiple dilutions were set. The serially diluted serum samples were added to the 96-well ELISA plate and then combined with HRP-labeled anti-IgG / IgG1 / IgG2a antibodies to form an antigen-antibody (serum)-ELISA antibody complex. Finally, the substrate TMB was added for color development, and the absorbance (OD value) at a wavelength of 450 nm was measured using an ELISA reader. The intensity of the color development was positively correlated with the level of HBsAg and HBcAg specific antibodies IgG / IgG1 / IgG2a in the test sample. The antibody titer was determined by fitting the relationship curve of "absorbance OD value - serum sample dilution factor (Log)". 2. Results Analysis: 1) Detection Results of HBsAb IgG Antibodies and Subtypes in Serum: The levels of HBsAb IgG antibodies and subtypes in mouse serum at different time points using ELISA are shown in Figure 11. Group H, containing the immunostimulant, produced high titers of anti-HBsAg specific IgG / IgG1 / IgG2a antibodies, and the antibody levels increased continuously with each immunization, reaching near saturation at the sixth immunization (week 14), with specific antibody titers exceeding 5.4 log values. No specific antibodies were detected in groups A-D. While groups E-G produced some levels of HBsAg specific IgG / IgG1 / IgG2a antibodies, these levels were significantly lower than those in group H. The levels of anti-HBsAg specific IgG and IgG2a antibodies produced by the double adjuvant control (group I) were significantly lower than those in group H. 2) Detection Results of HBcAb IgG Antibodies and Subtypes in Serum: The levels of HBcAb IgG antibodies and subtypes in mouse serum at different time points using ELISA are shown in Figure 12. The H group vaccine containing this immunostimulant produced high titers of anti-HBcAg specific IgG / IgG1 / IgG2a antibodies, and antibody levels continued to increase with each immunization, reaching near saturation at the sixth immunization (week 14), with specific antibody titers exceeding 4.8 log units. No specific antibodies were detected in groups A-D. While groups E-G produced some levels of HBcAg specific IgG / IgG1 / IgG2a antibodies, these levels were significantly lower than those in group H. Furthermore, group H showed a stronger bias towards the Th1 pathway; Figure D shows a significant upward trend in specific antibody IgG2a, indicating that the H group vaccine can promote anti-HBcAg antibody subtype conversion, and the conversion efficiency is significantly higher than that of the double adjuvant control (group I).

[0075] Example 10 Effect of different saponins on the immunomodulatory effect of pharmaceutical compositions 1. Experimental animals: C57BL / 6(N) mice, male, 4 weeks old, 40 mice, Shanghai Lingchang Experimental Animal Technology Co., Ltd. 2. Reagents and materials: 1) HBsAg protein, HBcAg protein and CpG T1 were all prepared in Example 1; 2) QS-21 (CAS.NO.A010-023, purchased from BRENNTAG); ginsenoside Rg1 (CAS: 22427-39-0, purchased from Nanjing Chunqiu Bioengineering Co., Ltd.), astragaloside A (CAS: 84687-43-4, purchased from Nanjing Chunqiu Bioengineering Co., Ltd.), platycodonoside D (CAS: 58479-68-8, purchased from Hubei Yunmei Technology Co., Ltd.), Iscom adjuvant (purchased from Shanghai Xiyuan Biotechnology Co., Ltd.). 3) Dilute HBsAg stock solution and HBcAg stock solution to 200 μg / ml and 100 μg / ml respectively using PBS solution (purchased from Hyclone), and dilute each saponin to 50 μg / ml. Dissolve CpG T1 in PBS solution and dilute to 100 μg / ml for the next step. 3. Experimental grouping: See Table 7. The injection volume was 100 μL / animal per injection. Group A was the negative control, with 100 μL of PBS solution per animal. 4. Experimental procedure: Same as Example 2. 5. Experimental results: ELISPOT spot results are shown in Figures 13 and 14. The results show that the combined application of CpG T1 and each saponin produced a highly efficient synergistic effect, inducing HBsAg and HBcAg-specific IFN-γ levels significantly higher than other CpG and saponin combinations. Among them, QS21 showed the best effect. Table 7 Experimental animal grouping Group Quantity (pieces) Components (μg / mouse) HBsAg HBcAg CpG T1 QS- twenty one Ginsenoside Rg1 Platycodon saponin D Astragaloside A Iscom adjuvant CpG 7909 Comparison 5 antigen 5 20 10 QS-21 5 20 10 10 5 Ginsenoside Rg1 5 20 10 10 5 Platycodon saponin D 5 20 10 10 5 Astragaloside A 5 20 10 10 5 Iscom adjuvant 5 20 10 10 5 7909 5 20 20 5 10

[0076] In summary, the pharmaceutical composition of the present invention utilizes a dual adjuvant combination. Compared to combinations of single adjuvants, other CPG adjuvants, and QS21, the CpG T1~T3 of the present invention exhibits a highly efficient synergistic effect with various adjuvants, especially QS-21, and can mediate a stronger immune response. Pharmaceutical compositions containing this immunostimulatory composition have significant advantages, exhibiting highly efficient immunotherapeutic effects, and possess high clinical application value and broad market prospects.

[0077] Although the present invention has been described in detail above, those skilled in the art will understand that various modifications and changes can be made to the present invention without departing from its spirit and scope. The scope of the present invention is not limited to the detailed description above, and such modifications and changes should fall within the scope of the appended patent applications. Although only examples of specific embodiments of the present invention have been described above, those skilled in the art should understand that these are merely illustrative examples, and the scope of protection of the present invention is defined by the appended patent applications. Those skilled in the art can make various changes or modifications to these embodiments without departing from the principles and essence of the present invention, but all such changes or modifications should fall within the scope of protection of the present invention. [Simplified Explanation of the Diagram]

[0079] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which: Figure 1 shows the effect of different CPG oligodeoxynucleotides on the HBsAg antigen-specific IFN-γ secretion level; Figure 2 shows the effect of different CPG oligodeoxynucleotides on the HBcAg antigen-specific IFN-γ secretion level; Figure 3 shows the effect of different immunostimulatory compositions according to the present invention on the HBsAg antigen-specific IFN-γ secretion level; Figure 4 shows the effect of different immunostimulatory compositions according to the present invention on the HBcAg antigen-specific IFN-γ secretion level; Figure 5 shows the effect of different doses of the immunostimulatory composition according to the present invention on the HBsAg antigen-specific IFN-γ secretion level; Figure 6 shows the effect of different doses of the immunostimulatory composition according to the present invention on the HBcAg antigen-specific IFN-γ secretion level; Figure 7 shows the effect of a hepatitis B vaccine containing the immunostimulatory composition of the present invention on the serum HBsAg level; Figure 8 shows the effect of a hepatitis B vaccine containing the immunostimulatory composition of the present invention on the serum HBsAb level. Figure 9 shows the effect of the hepatitis B vaccine containing the immunostimulating composition of the present invention on the HBsAg antigen-specific IFN-γ secretion level; Figure 10 shows the effect of the hepatitis B vaccine containing the immunostimulating composition of the present invention on the HBcAg antigen-specific IFN-γ secretion level; Figure 11 shows the effect of the hepatitis B vaccine containing the immunostimulating composition of the present invention on the HBsAg antigen-specific IgG antibody and its subtype levels in mouse serum; wherein, Figure A: HBsAb IgG level in mouse serum of each group; Figure B: HBsAb IgG1 level in mouse serum of each group; Figure C: HBsAb IgG2a level in mouse serum of each group; Figure D: Ratio of HBsAb IgG2a to IgG1 in mouse serum of each group; Figure 12 shows the effect of the hepatitis B vaccine containing the immunostimulating composition of the present invention on the HBcAg antigen-specific IgG antibody and its subtype levels in mouse serum; wherein, Figure A: HBcAb IgG level in mouse serum of each group; Figure B: HBcAb IgG level in mouse serum of each group; Figure 13 shows the effect of immunostimulatory compositions containing different saponins on the level of HBsAg antigen-specific IFN-γ secretion; Figure 14 shows the effect of immunostimulatory compositions containing different saponins on the level of HBcAg antigen-specific IFN-γ secretion. [Biomaterial Storage]

[0080] None

Claims

1. A pharmaceutical composition comprising: i) hepatitis B surface antigen, ii) hepatitis B core antigen, and iii) an immunostimulatory composition comprising a saponin and a CpG oligodeoxynucleotide, or comprising an adjuvant containing a saponin and a CpG oligodeoxynucleotide, wherein, The sequence of the CpG oligodeoxynucleotide is selected from any of the following: CpG T1: TCG TTC GTT CGT TCG TTC GTT (SEQ ID NO: 6), CpG T2: TCG TTC GTT CGT TCG TTC GTT CGT T (SEQ ID NO: 7), and CpG T3: TCG TCG TCG TCG TCG TCG TCG TCG (SEQ ID NO: 8); the CpG oligodeoxynucleotide contains a phosphate thioester linker, and the saponin is QS-21; wherein the hepatitis B surface antigen contains or is composed of the sequence shown in SEQ ID NO: 1; and the hepatitis B core antigen contains or is composed of the sequence shown in SEQ ID NO:

2.

2. The pharmaceutical composition as claimed in claim 1, wherein, The sequence of the CpG oligodeoxynucleotide is CpG T1: TCG TTC GTT CGT TCG TTC GTT (SEQ ID NO: 6).

3. The pharmaceutical composition as claimed in claim 1, wherein, The CpG oligodeoxynucleotide is a thio-oligodeoxynucleotide.

4. The pharmaceutical composition as claimed in claim 3, wherein, This CpG oligodeoxynucleotide is a fully thiolated oligodeoxynucleotide.

5. The pharmaceutical composition as claimed in claim 1, wherein, The weight ratio of the CpG oligodeoxynucleotide to the saponin is 1~40:0.1~2.

6. The pharmaceutical composition as claimed in claim 5, wherein, The weight ratio of the CpG oligodeoxynucleotide to the saponin is 2~40:0.1~2.

7. The pharmaceutical composition as claimed in claim 6, wherein, The weight ratio of the CpG oligodeoxynucleotide to the saponin is 2:

1.

8. The pharmaceutical composition as claimed in any one of claims 1 to 7, wherein, The weight ratio of components i), ii) and iii) of the pharmaceutical composition is 4:2:1.1 to 42.

9. The pharmaceutical composition as claimed in claim 8, wherein, The weight ratio of components i), ii) and iii) of the pharmaceutical composition is 4:2:2.1 to 42.

10. The pharmaceutical composition as claimed in claim 9, wherein, The weight ratio of components i), ii) and iii) of the pharmaceutical composition is 4:2:

3.

11. The pharmaceutical composition as claimed in any one of claims 1 to 7, wherein, The pharmaceutical composition also includes: iv) a pharmaceutically acceptable carrier.

12. A hepatitis B prophylactic vaccine or a hepatitis B therapeutic vaccine comprising a pharmaceutical composition as described in any one of claims 1 to 11.

13. Use of a pharmaceutical composition as claimed in any one of claims 1 to 11 in the preparation of a medicament for the prevention and / or treatment of hepatitis B virus infection and / or hepatitis B virus-mediated diseases.

14. The use as described in claim 13, wherein, The hepatitis B virus infection and / or hepatitis B virus-mediated diseases are selected from hepatitis B, cirrhosis, and liver cancer.

15. Use of a pharmaceutical composition as claimed in any one of claims 1 to 11 in the preparation of a medicament for generating a humoral and / or cellular immune response against hepatitis B virus in an article.

16. Use of a pharmaceutical composition as claimed in any one of claims 1 to 11 in the preparation of a medicament for causing subtype conversion of hepatitis B core antibodies in an article.

17. Use of a pharmaceutical composition as claimed in any one of claims 1 to 11 in the preparation of a medicament for overcoming hepatitis B virus immune tolerance in a subject.

Images