5 '-utr with improved translation efficiency, a synthetic nucleic acid molecule including the same, and a vaccine or therapeutic composition including the same

Abstract

This invention discloses synthetic nucleic acid molecules comprising a 5'-UTR with improved translation efficiency and vaccine / therapeutic compositions comprising the same. Specifically, it discloses 5'-UTR polynucleotides endowed with improved translation efficiency based on specific motifs, synthetic nucleic acid molecules comprising the same, and vaccine / therapeutic compositions comprising the synthetic nucleic acid molecules. Due to the improved translation efficiency of the 5'-UTR polynucleotides, the expression of target proteins can be effectively induced, thus benefiting various RNA-based applications, such as vaccines, in vivo / in vitro gene therapy, etc.

Description

Technical Field

[0001] This invention relates to synthetic nucleic acid molecules containing a 5'-untranslated region (5'-UTR) and having improved translation efficiency, and to vaccine / therapeutic compositions containing the same. More specifically, it relates to 5'-UTR polynucleotides endowed with improved translation efficiency based on specific motifs, synthetic nucleic acid molecules containing the same, and vaccine / therapeutic compositions containing the synthetic nucleic acid molecules. Prior Technology

[0002] It has been reported that the untranslated region (UTR) of mRNA plays a crucial role in regulating mRNA stability and translation. The UTR is known to influence translation initiation, elongation, and termination, as well as mRNA stability and intracellular localization, through interactions with RNA-binding proteins (Jackson RJ, et al., Nat Rev Mol Cell Biol. Vol. 11(2), pp. 113-127, 2010). Depending on specific motifs, the UTR may increase or decrease mRNA turnover (Barrett LW, et al., Cell Mol Life Sci. Vol. 69(21), pp. 3613-34, 2012). Recently, data on mRNA half-life and corresponding UTR sequences have been published (Hoen PA, et al., Nucleic Acids Res. Vol. 39(2), pp. 556-566, 2012).

[0003] UTR stands for the portion of the mRNA molecule upstream of the start codon and downstream of the stop codon, i.e., the non-translated sequence. These regions are transcribed along with the coding regions, and because they are present in the mature mRNA, these regions are exons. The UTR upstream of the start codon of the mRNA is called the "5'-UTR," and once transcribed, it has the so-called "Kozak sequence," as well as the sequence corresponding to the remaining 3' portion of the promoter.

[0004] Kozak common sequences (Kozak consensus sequence, Kozak consensus, or Kozak sequence) are known to be found in eukaryotic mRNAs with a common sequence of (gcc)gccRccAUGG. The Kozak common sequence plays an important role in the initiation of the translation process. This sequence is named after Marilyn Kozak, who discovered its importance. This sequence in the mRNA molecule is recognized by the ribosome at the transcription start site, and the protein is encoded by the mRNA molecule from the transcription start site. This sequence or its possible variants are required by ribosomes to initiate translation.

[0005] The sequence is identified by the symbol (gcc) gccRccAUGG, which consolidates information obtained by Kozak's analysis from a wide range of sources (about 699 in total), as follows: Lowercase letters indicate the most common base at one position, but that base is at that position Position still variable;Uppercase letters indicate highly conserved bases, i.e. 'AUGG' sequence is constant or rarely altered (if any); 'R' indicates purines (adenine or guanine) are always observed at this position (According to Kozak, adenine is more common);the sequence (gcc) in parentheses is of unknown significance.

[0006] Several means and methods have been published (US 10080809, US 2018-0353618, US 2019-0144883) to enhance the stability of mRNA, reduce the immune response triggered by mRNA in cells or organisms, and improve expression efficiency (i.e., transcription and / or translation efficiency). Specifically, however, additional or alternative means to improve expression efficiency (i.e., transcription and / or translation efficiency) still need to be improved. This is because expression efficiency is an important parameter for expected medical applications, for example, because it determines the administration and administration interval of the mRNA drug and ultimately determines the bioavailability (bioavailability) of the final product (i.e., the encoded peptide or protein). At the same time, it is necessary to further reduce the production cost of mRNA drugs, increase the yield of the produced mRNA molecules, and increase the available space in the resulting mRNA molecules for the coding region encoding the actual transgenic gene (i.e., the polypeptide of interest).

[0007] Meanwhile, gene vaccines have been developed since it was reported that if the DNA and RNA encoding the target gene were directly injected into animals, the target gene would be expressed in living animals and that this expression could establish immunity (Wolff JA et al. Science, 247:1465-8, 1990).

[0008] Genetic vaccination targets selected antigens, such as characteristic components of bacterial surfaces, viral particles, and tumor antigens, triggering the desired immune response. Generally speaking, vaccination is one of the key achievements of modern medicine. However, currently only effective vaccines are available for a limited number of diseases. Therefore, infections that cannot be prevented by vaccination still affect millions of people each year.

[0009] DNA and RNA can be used as nucleic acid molecules for gene administration in gene therapy or gene vaccination, and DNA is known to be relatively stable and easier to handle than RNA. However, if a DNA fragment given to a patient's genome is inserted into an unintended location, the DNA may pose a potential risk, leading to gene damage. Furthermore, undesirable anti-DNA antibodies may develop. Another issue is that the expression levels of peptides or proteins expressed via DNA administration and subsequent transcription / translation are limited. The presence or absence of specific transcription factors that regulate DNA transcription has a significant impact on the expression levels of the administered DNA; in the absence of specific transcription factors, DNA transcription will not produce sufficient amounts of RNA, thus limiting the amount of translated and produced peptides or proteins.

[0010] Furthermore, when RNA is used as a means of gene delivery, it can synthesize proteins directly in the cytoplasm without transcription, unlike DNA which needs to enter the cell nucleus. Therefore, there is no risk of interfering with cell chromosomes or causing undesirable gene damage. In addition, because RNA has a shorter half-life than DNA, it does not cause long-term gene modification (Sayour EJ, et al., J Immunother Cancer Vol. 3, 13, 2015). When a typical RNA vaccine is delivered into cells, it is only activated for a short time to express the target protein, and then destroyed by enzymatic reactions within a few days, while a specific immune response to the expressed target antigen (protein) still exists.

[0011] Furthermore, when RNA is used as a means of gene delivery, it only functions by crossing the cell membrane, not the nuclear membrane. Although a smaller amount is used compared to DNA, the target protein can be expressed in the same quantity. In addition, RNA itself possesses immune adjuvantity, thus achieving the same immune effect even with smaller doses compared to DNA. By using RNA instead of DNA for gene vaccination, the risk of unwanted genome integration and the development of anti-DNA antibodies can be minimized or avoided. However, RNA is considered a relatively unstable molecule and may be easily degraded by ubiquitous ribonucleases (RNases).

[0012] Despite significant progress over the past few years, efficient mRNA vaccination, as an effective method for inducing adaptive immune responses, still faces challenges in the field, including inefficient mRNA translation due to premature antigen degradation or inefficient release of mRNA from cells. Furthermore, there is a growing need to reduce the dosage of mRNA vaccines to alleviate concerns about potential safety and make them more affordable in the developing world.

[0013] There are many challenges associated with delivering nucleic acids to induce desired responses in biological systems. Nucleic acid-based therapies (such as vaccines) hold enormous potential, but there is still a need to deliver nucleic acids more efficiently to appropriate locations within cells or organisms to realize this potential.

[0014] However, the therapeutic and preventative applications of nucleic acids currently face two challenges. First, free RNA is easily digested by nucleases in plasma. Second, free RNA has limited ability to enter the intracellular compartments containing relevant translation factors. Lipid nanoparticles derived from cationic lipids and other lipid components (such as neutral lipids, cholesterol, polyethylene glycol (PEG), PEGylated lipids, and oligonucleotides) have been developed to inhibit RNA degradation in plasma and promote cellular uptake of nucleic acids.

[0015] Therefore, as a result of extensive efforts to solve the above problems and develop 5'-UTRs with improved translation efficiency, the inventors discovered that by selecting artificial nucleic acid molecules that do not form secondary structures, contain less uridine, and do not contain sequences that would reduce stability from a combination of 30 bp artificial nucleic acid molecules, the present invention was completed. Summary of the Invention

[0016] One objective of this invention is to provide a 5'-UTR polynucleotide with improved translation efficiency.

[0017] Another object of the present invention is to provide a synthetic nucleic acid molecule comprising the 5'-UTR polynucleotide having improved translation efficiency.

[0018] Another object of the present invention is to provide a vaccine composition comprising the synthetic nucleic acid molecule.

[0019] According to one aspect of the present invention, the above and other objectives can be achieved by providing an isolated 5'-untranslated region (UTR) polynucleotide comprising a nucleotide sequence represented by the nucleic acid sequence of the following formula (I).

[0020] Formula (I):

[0021] AG[N 22]GCCACC

[0022] According to another aspect of the present invention, an isolated 5'-untranslated region (UTR) polynucleotide is provided, the isolated 5'-untranslated region polynucleotide comprising a nucleotide sequence represented by the nucleic acid sequence of the following formula (II).

[0023] Formula (II):

[0024] AGGA[N 19]RGCCACC

[0025] Where R represents A or G.

[0026] According to another embodiment of the present invention, a synthetic nucleic acid molecule is provided, oriented from 5' to 3', comprising: a) a 5'-CAP structure; b) a 5'-UTR polynucleotide; c) at least one coding region; d) a 3'-untranslated region (3'-UTR); and e) 10 to 1000 poly(A) tails or poly(A) tail-like sequences.

[0027] According to another aspect of the present invention, a vaccine composition comprising the synthetic nucleic acid molecule is provided.

[0028] According to another aspect of the present invention, there is a use for a vaccine composition for preventing disease.

[0029] According to another aspect of the present invention, a method for preventing disease is provided, comprising administering the vaccine composition.

[0030] According to another aspect of the present invention, there is provided the use of a vaccine composition in the preparation of a medicament for the prevention of disease. Simple Explanation of the Diagram

[0031] The above and other objects, features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the drawings, wherein:

[0032] Figure 1 is a schematic diagram illustrating the process of selecting 5'-UTR candidate groups according to an embodiment of the present invention.

[0033] Figure 2 is a vector diagram of a vector formed to determine the in vitro transcriptional expression of mRNA, wherein the mRNA is contained in the 5'-UTR selected in the embodiments of the present invention.

[0034] Figure 3 is a schematic diagram illustrating the structure of the mRNA contained in the selected 5'-UTR in an embodiment of the present invention.

[0035] Figure 4 illustrates the expression efficiency of mRNA containing the selected 5'-UTR in the embodiments of the present invention in HEK293T cell lines (A) and (B) and in HeLa cell lines (C) and (D).

[0036] Figure 5 illustrates the expression efficiency of mRNA containing the selected 5'-UTR in the embodiments of the present invention in Huh7 cell lines (A) and (B) and in SNU423 cell lines (C) and (D). Implementation

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as understood by one of ordinary skill in the art to which this invention pertains. Generally, the nomenclature used herein is well-known and commonly used in the art.

[0038] In this invention, when a 5'-UTR line with improved translation efficiency is selected from the entire combinatorial pool based on specific logic rather than extracted from genes that exist in nature, it exhibits superior performance compared to 5'-UTRs that exist in nature.

[0039] That is, in one embodiment of the present invention, it was found that 5'-UTR polynucleotides selected by the following steps exhibit improved translation efficiency, the steps being as follows: removing polynucleotide combinations that may have secondary structures from 30 polynucleotide combinations, as shown in Figure 1, selecting sequences to improve capping efficiency, removing UUU and UUUU motifs from these sequences, removing at least 15% uridine from these sequences, and removing sequences with poor stability (Figure 1).

[0040] In one embodiment, the present invention relates to an isolated 5'-untranslated region (UTR) polynucleotide comprising a nucleotide sequence represented by the nucleic acid sequence of the following formula (I).

[0041] Formula (I):

[0042] AG[N 22]GCCACC

[0043] In another embodiment, the present invention relates to an isolated 5'-untranslated region (UTR) polynucleotide comprising a nucleotide sequence represented by the nucleic acid sequence of formula (II).

[0044] Formula (II):

[0045] AGGA[N19]RGCCACC

[0046] Where R represents A or G.

[0047] In this invention, 5'-UTR may be any of the nucleotide sequences represented by SEQ ID NOs:1 to 33.

[0048] [Table 1] Seq. ID No. Sequence (5' to 3') 1 AGGAGAAGAGAGAAAAGUAAAAUAGCCACC 2 AGGAGUAAAAGUAAAAUAGUAAAAGCCACC 3 AGGAGAAAAGAAAGAGUAAAAUAGGCCACC 4 AGGAUUAAAAAUAGAAAGAAUAAGGCCACC 5 AGGACAACAAACAAAAACAAACUAGCCACC 6 AGGACAGAGCACUAGAACAAAACAGCCACC 7 AGGACCACUCUCAACCAAAACCUAGCCACC 8 AGGAGACACUAACACCCCGACCGAGCCACC 9 AGGACCGGAACACAAAAACUAGCAGCCACC 10 AGGAACUACACUAGCCACUAAACAGCCACC 11 AGGACAACUAGACAGAGACACCGAGCCACC 12 AGGACACAACACCCAGACCACCGAGCCACC 13 AGGACACAACUACCGAACUACUCAGCCACC 14 AGGAGAACUAGUACCCACCCGACAGCCACC 15 AGGAGAGAAAAAAACAACUACACAGCCACC 16 AGGAGAAACAACUAGGACCACAGAGCCACC 17 AGGACCUAAAACACCUCGACAGCAGCCACC 18 AGGAAAAAACUCACCUCUCAGACAGCCACC 19 AGGAGAGAAACUACACAGACUAGAGCCACC 20 AGGAACAACAGACUCACUCACUCAGCCACC 21 AGGAAAACUAAACAGAACCUAACAGCCACC 22 AGGAACAGAGAACACUAGAGAGCAGCCACC 23 AGGACCACACAGACCCACCUACUAGCCACC 24 AGGAAACCGACUAAAAACCCUCUAGCCACC 25 AGGAACAACACCAGCAGAACUCGAGCCACC 26 AGGAACAACAGUCGUAACCCUCUAGCCACC 27 AGGACCCUAACCAAACCCACUCUAGCCACC 28 AGGACACAACUCUACCCGACUACAGCCACC 29 AGGAACACAGUCAGCACCAACACAGCCACC 30 AGGACACUCAGACAACCCACACUAGCCACC 31 AGGACCUCAAAAAAAAACUCUCUAGCCACC 32 AGGACAACAGCUCACACCCCCCUAGCCACC 33 AGGACCCAGAACCCACCUAACAGAGCCACC

[0049] As used herein, the term "UTR" refers to a non-translated region located upstream (5') and / or downstream (3') of the coding region of the nucleic acid molecule described herein, and therefore typically located lateral to the coding region. Thus, the term "UTR" generally includes a 3'-non-translated region ("3'-UTR") and a 5'-non-translated region ("5'-UTR"). A UTR may typically contain or consist of nucleic acid sequences that are not translated into proteins. Typically, a UTR contains "regulatory elements."

[0050] As used herein, the term "regulatory element" refers to a nucleic acid sequence that has the ability to influence gene regulatory activity or expression by influencing a transcribed nucleic acid sequence, particularly affecting transcription or translation, wherein the transcribed nucleic acid sequence is operatively linked (through cis or trans). The term "regulatory element" includes promoters, enhancers, internal ribosome entry sites (IRES), introns, leaders, transcription termination signals (such as polyadenylation signals and polyuridine sequences), and other expression regulatory elements. Regulatory elements act sustainably or in a time- and / or cell-specific manner. Optionally, regulatory elements may function through interactions (e.g., recruitment and binding) with regulatory proteins capable of regulating (including inducing, enhancing, reducing, eliminating, or preventing) gene expression (particularly gene transcription).

[0051] UTRs are preferably "operably linked" in the coding region in a manner that controls (i.e., mediates or modulates, preferably reinforces) the expression of the coding sequence, i.e., located in a functional relation.

[0052] As used herein, the term "5'-UTR" refers to a portion of a nucleic acid molecule located at the 5' end (i.e., "upstream") of an open reading frame and not translated into a protein. In the context of this invention, a 5'-UTR begins at the transcription start site and terminates at the nucleotide preceding the promoter codon of the open reading frame.

[0053] The 5'-UTR may contain elements that regulate gene expression, known as "regulatory elements." These regulatory elements may be, for example, ribosome binding sites. The 5'-UTR can be modified by post-transcriptional modifications, such as the addition of a 5'-CAP. Therefore, the 5'-UTR preferably corresponds to the nucleic acid sequence located between the 5'-CAP and the start codon, particularly the sequence of mature mRNA, and more specifically, to the following extended sequence: from the nucleotide at the 3' position of the 5'-CAP, preferably from the nucleotide immediately following the 3' position of the 5'-CAP, extending to the nucleotide at the 5' position of the start codon (transcription start site) of the protein-coding sequence, preferably extending to the nucleotide immediately preceding the 5' position of the start codon (transcription start site) of the protein-coding sequence.

[0054] The nucleotide immediately following the 3' position of the 5'-CAP in mature mRNA typically corresponds to the transcription start site. The length of the 5'-UTR is typically less than 500, 400, 300, 250, or 200 nucleotides. In some embodiments, the length of the 5'-UTR is 10, 20, 30, 40, or more nucleotides, preferably 10, 50, or fewer nucleotides.

[0055] In another embodiment, the present invention relates to a synthetic nucleic acid molecule comprising, in 5' to 3' order: a) a 5'-CAP structure; b) a 5'-UTR polynucleotide; c) at least one coding region; d) a 3'-untranslated region (3'-UTR); and e) 10 to 1000 polyadenylated tails or polyadenylated tail-like sequences.

[0056] The 5'-CAP of natural mRNA participates in nuclear export, increases mRNA stability, and binds to the mRNA cap-binding protein (CBP). This binding of CBP with polyadenylation-binding protein leads to the formation of mature circular mRNA variants, thus stabilizing mRNA during cellular and translational processes. This cap further facilitates the removal of 5'-proximal introns during mRNA splicing.

[0057] The 5'-CAP according to the present invention is a generally modified nucleotide (CAP analogue), particularly a guanine nucleotide added to the 5' end of an mRNA molecule. Preferably, a 5'-5'-triphosphate bond (also known as "m7GpppN") is used to add the 5'-CAP. Furthermore, examples of 5'-CAP structures include a glycerol group, a reverse deoxygenated abase residue (partially), a 4',5'-methylene nucleotide, a 1-(β-D-erythrofuranosyl) nucleotide, a 4'-thionucleotide, a carbocyclic nucleotide, a 1,5-anhydrous hexitol nucleotide, an L-nucleotide, an α-nucleotide, a modified base nucleotide, a threo-furanosyl nucleotide, or an acyclic 3',4'-seco Nucleotide), acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3',3'-reverse nucleotide moiety, 3',3'-reverse abase-free moiety, 3',2'-reverse nucleotide moiety, 3',2'-reverse abase-free moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3'-thiophosphate, dithiophosphate, or bridging or non-bridging methyl phosphonate moiety.

[0058] These modified 5'-CAP structures can be used to modify the sequence of the synthetic nucleic acid molecules of this invention.

[0059] Additional modified 5'-CAP structures that can be used in this invention include CAP1 (ribose of the adjacent nucleotide of additionally methylated m7GpppN), CAP2 (ribose of the second nucleotide downstream of additionally methylated m7GpppN), CAP3 (ribose of the third nucleotide downstream of additionally methylated m7GpppN), CAP4 (ribose of the fourth nucleotide downstream of additionally methylated m7GpppN), anti-reverse CAP analogue (ARCA), modified ARCA (e.g., ARCA modified with thiophosphate), myonucleotide, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deazo-guanosine, 8-side-oxy-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0060] In this invention, the 5'-CAP structure can be formed by in vitro transcription (co-transcriptional capping) using chemical RNA synthesis or cCAP analogs, or by using a capping enzyme (e.g., a commercially available capping kit) to form the CAP structure.

[0061] In this invention, CAP analogs refer to non-polymerizable dinucleotides with CAP function that, when introduced to the 5' end of an RNA molecule, promote translation or localization and / or prevent RNA degradation. Non-polymerizable means that because CAP analogs lack 5' triphosphate, they bind only at the 5' end and therefore cannot be extended in the 3' direction by template-dependent RNA polymerases.

[0062] CAP analogs include, but are not limited to, chemical structures selected from the group consisting of: m7GpppA, m7GpppAmpG, unmethylated CAP analogs, dimethylated CAP analogs, trimethylated CAP analogs (e.g., m2,2,7GpppA), dimethylated symmetrical CAP analogs (e.g., m7Gpppm7A), or anti-reverse CAP analogs (e.g., ARCA, m7,2'OmeGpppA, m7,2'dGpppA, m7,3'OmeGpppA, m7,3'dGpppA, and tetraphosphate derivatives of the above analogs).

[0063] Additional CAP analogues (US 7,074,596, WO 2008 / 016473, WO 2008 / 157688, WO 2009 / 149253, WO 2011 / 015347 and WO 2013 / 059475) have been disclosed in the prior art.

[0064] In this invention, the 5'-CAP structure can be freely selected from the group consisting of m7GpppAmpG, m7,3'OmeApppG and m7GpppA, but is not limited thereto.

[0065] In this invention, the coding region may encode at least one protein selected from the group consisting of antigenic proteins, allergenic proteins, therapeutic proteins, and fragments, mutants, or derivatives of the above proteins, but is not limited thereto.

[0066] In this invention, antigenic proteins include at least one selected from the group consisting of tumor antigens, pathogenic antigens, autoantigens, allogeneic antigens, and allergens, but are not limited thereto.

[0067] As used herein, the term "tumor antigen" refers to an antigenic (poly)peptide or protein derived from or associated with (preferably malignant) tumors or cancerous diseases. As used herein, the terms "cancer" and "tumor" are used interchangeably and refer to a neoplasm that invades surrounding tissues and metastasizes to distant parts of the body, characterized by uncontrolled and typically rapid cell proliferation. This terminology includes both benign and malignant tumors. Malignant tumors of cancer are typically characterized by anaplasia, invasiveness, and metastasis; benign tumors typically do not possess these characteristics. The terms "cancer" and "tumor" specifically refer to tumors characterized by tumor growth and cancers of the blood and lymphatic system. "Tumor antigen" is typically derived from cancer / tumor cells, preferably mammalian cancer / tumor cells, and may be located within or on the surface of tumor cells and tumors; for example, systemic or solid tumors originate from mammals, preferably humans. The term "tumor antigen" typically includes tumor-specific antigens (TSA) and tumor-associated antigens (TAA). TSA is typically derived from tumor-specific mutations and is specifically expressed by tumor cells. More common TAAs are often manifested by both tumors and "normal" (healthy and non-tumor) cells.

[0068] As used herein, the term "tumor antigen" can refer to a tumor-associated protein or nucleic acid sequence, wherein each nucleic acid sequence encodes another peptide or protein, and at least one nucleic acid sequence may encode 5T4, 707-AP, 9D7, AFP, AlbZIP HPG1, α-5-β-1-integrin, α-5-β-6-integrin, α-actinogen-4 / m, α-methylacetylated coenzyme A racemicase, AT-4, ARTC1 / m, B7H4, BAGE-1, BCL-2, bcr / abl, β-chain protein / m, BING-4, BRCA1 / m, BRCA2 / m, CA15-3 / CA27-29, CA 19-9, CA72-4, CA125, calreticulin, CAMEL, CASP-8 / m, cathepsin B, cathepsin L, CD19, CD20, CD22, CD25, CDE30, CD33, CD4, CD52, CD55, CD56, CD80, CDC27 / m, CDK4 / m, CDKN2A / m, CEA, CLCA2, CML28, CML66, COA-1 / m, coactosin-like protein Protein), Collagen XXIII, COX-2, CT-9 / BRD6, Cten, Cyclin B1, Cyclin D1, Cyp-B, CYPB1, DAM-10, DAM-6, DEK-CAN, EFTUD2 / m, EGFR, ELF2 / m, EMMPRIN, EpCam, EphA2, EphA3, ErbB3, ETV6-AML1, EZH2, FGF-5, FN, Frau-1, G250, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE7b, GAGE-8, GDEP, GnT-V, gp100, GPC3, GPNMB / m, HAGE, HAST-2, Hepsin, Her2 / neu, HERVK-MEL, HLA-A*0201-R1 ​​7I, HLA-A1 1 / m, HLA-A2 / m, HNE, Homeobox NKX3.1, HOM-TES-14 / SCP-1, HOM-TES-85, HPV-E6, HPV-E7, HSP70-2M, HST-2, hTERT, iCE, IGF-1R, IL-13Ra2, IL-2R, IL-5, Immature Laminin Receptor, Kallikrein-2, Kallikrein-4, i67, KIAA0205, KIAA0205 / m, KK-LC-1. K-Ras / m, LAGE-A1, LDLR-FUT, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A9, MAGE-A10, MAGE-A12, MAGE-B1, MAGE-B2, MAGE-B3, MAGE-B4, MAGE-B5, MAGE-B6, MAGE-B10, M AGE-B16, MAGE-B17, MAGE-C1, MAGE-C2, MAGE-C3, MAGE-D1, MAGED2, MAGE-D4, MAGE-E1, MAGE-E2, MAGE-F1, MAGE-HI, MAGEL2, Mammaglobulin A, MART-1 / Melan-A, MART-2, MART-2 / m, Matrix Protein 22, MC1 R,M-CSF,ME 1 / m, mesothelin, MG50 / PXDN, MMP1-1, MN / CA IX-antigen, MRP-3, MUC-1, MUC-2, MUM-1 / m, MUM-2 / m, MUM-3 / m, myosin class I / m, NA88-A, N-acetylglucosamine transferase-V, Neo-PAP, Neo-PAP / m, NFYC / m, NGEP, NMP22, NPM / ALK, N-Ras / m, NSE, NY-ESO-1, NY-ESOB, OA1, OFA-iLRP, OGT, OGT / m, OS-9, OS-9 / m, osteocalcin, osteopontin, pi 5. p190 times bcr-abl, p53, p53 / m, PAGE-4, PAI-1, PAI-2, PAP, PART-1, PATE, PDEF, Pim-1-kinase, Pin-1, Pml / PARα, POTE, PRAME, PRDX5 / m, prostaglandin, protease-3, PSA, PSCA, PSGR, PSM, PSMA, PTPRK / m, RAGE-1, RBAF600 / m, RHAMM / CD1 68, RU1, RU2, S-100, SAGE, SART-1, SART-2, SART-3, SCC, SIRT2 / m, Sp1 7. SSX-1, SSX-2 / HOM-MEL-40, SSX-4, STAMP-1, STEAP-1, Survivin, Survivin-2B, SYT-SSX-1, SYT-SSX-2, TA-90, TAG-72, TARP, TEL-AML1, TGF-β, TGF-βRII, TGM-4, TPI / m, TRAG-3, TRG, TRP-1, TRP-2 / 6b, TRP / INT2, TRP-p8, tyrosinase, UPA, VEGFR1, VEGFR-2 / FLK-1, WT1, and lymphocyte immunoglobulin genotypes or lymphocyte T-cell receptor genotypes or homologs, fragments, variants or derivatives of tumor antigens.

[0069] In this invention, tumor antigens are selected from the group consisting of NYESO-1, HER-2 / neu, MAGE-1, tyrosinase, MUC1, CEA, Mam-A, hTERT, Syalyl-Tn, WT1, alpha-fetoprotein, CA-125, gp-100, p53, Ras, Src, EGFRvIII, PSMA, GD2, Bcr-abl, survivin, PSA, EphA2, PAP, AFP, EpCAM, ALK, mesothelin, PSCA, MART-1, Melan-A, SCP-1, SPAG9, AKAP4, and OY-TES-1, but are not limited thereto.

[0070] In this invention, the pathogenic antigen can be selected from a group consisting of antigens from bacteria, viruses, fungi, and protozoa.

[0071] In this invention, the pathogenic antigen may be derived from influenza virus, respiratory syncytial virus (RSV), coronavirus, herpes simplex virus (HSV), human papillomavirus (HPV), human immunodeficiency virus (HIV), Plasmodium, Staphylococcus aureus, dengue virus, trachoma chlamydia, cytomegalovirus (CMV), hepatitis B virus (HBV), mycobacterium tuberculosis, rabies virus, and yellow fever virus, or isoforms, homologs, fragments, variants, or derivatives of such proteins.

[0072] In this invention, the viral antigen may be a coronavirus, but is not limited thereto.

[0073] In this invention, the coronavirus is human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), severe acute respiratory syndrome coronavirus (SARS-CoV), human coronavirus NL63 (HCoV-NL63, a new human coronavirus), human coronavirus HKU1, Middle East respiratory syndrome coronavirus (MERS-CoV), or severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2).

[0074] In this invention, 3'-UTR is selected from the group consisting of β-globulin 3'-UTR, CYBA 3'-UTR, albumin 3'-UTR, growth hormone (GH) 3'-UTR, VEEV 3'-UTR, hepatitis B virus (HBV) 3'-UTR, α-globulin 3'-UTR, DEN 3'-UTR, barley yellow dwarf virus-PAV (BYDV-PAV) 3'-UTR, elongation factor 1 α1 (EEF1A1) 3'-UTR, manganese superoxide dismutase (MnSOD) 3'-UTR, β subunit (β-mRNA) 3'-UTR of mitochondrial H(+)-ATP synthase, GLUT1 3'-UTR, MEF2A 3'-UTR, β-F1-ATPase 3'-UTR, and their functional fragments and combinations thereof, but is not limited thereto.

[0075] As used herein, the term "3'-UTR" typically refers to the portion of mRNA located between the protein-coding region (open reading frame, coding region) and the polyadenylated nucleotide sequence. The 3'-UTR of mRNA is not translated into an amino acid sequence. The 3'-UTR sequence is usually encoded by the gene that will be transcribed into individual mRNAs during gene expression. This genomic sequence is first transcribed into immature mRNAs containing selective introns. Then, during maturation, the immature mRNA is further processed into mature mRNA. This maturation process includes steps such as 5'-capping, splicing of immature mRNA to remove selective introns and modification of the 3' end, such as polyadenylation of the 3' end of the immature mRNA, and cleavage by selective endonucleases or exonucleases.

[0076] In this invention, the 3'-UTR corresponds to a mature mRNA sequence containing nucleotides from the 3' position of the stop codon in the protein-coding region to the 5' position (preferably the 5' position immediately adjacent to the polyadenylated nucleotide sequence). The term "corresponds" indicates that the 3'-UTR sequence can be an RNA sequence (such as the mRNA sequence used to define the 3'-UTR sequence) or a DNA sequence corresponding to this RNA sequence.

[0077] In this invention, the synthesized nucleic acid molecule further comprises a polyadenylated tail or a polyadenylated tail-like sequence. In a further embodiment, this is to stabilize the terminal group that can be incorporated into the polyadenylated tail. In another embodiment, the polyadenylated tail comprises a des-3' hydroxyl tail.

[0078] During RNA processing, a long chain of adenine nucleotides (polyadenylation tail) can be added to polynucleotides, such as mRNA molecules, to enhance stability. The 3' end of the transcript can be cleaved immediately after transcription to release the 3' hydroxyl group. Polyadenylation polymerase then adds the adenine nucleotide chain to the RNA. For example, a process called "polyadenylation" adds a polyadenylation tail of approximately 80 to approximately 250 residues (approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 residues in length). The polyadenylation tail can also be added after this construct is exported from the nucleus.

[0079] According to the present invention, in order to stabilize the terminal group that can be incorporated into the polyadenylate tail, the polynucleotide of the present invention may contain a des-3' hydroxy tail. The polynucleotide may also contain structural moieties as proposed by Junjie Li et al. or 2'-O-methyl modifications (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the contents of which are incorporated herein by reference in their entirety).

[0080] The unique polyadenylated tail length provides a predetermined advantage for the polynucleotides of the present invention. Generally, if a polyadenylated tail is present, its length is greater than 30 nucleotides. In other embodiments, the length of the polyadenylated tail is greater than 35 nucleotides (e.g., at least about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides).

[0081] In some embodiments, the polynucleotide or a region thereof comprises about 30 to about 3,000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 750, 30 to 1,000, 30 to 1,500, 30 to 2,000, 30 to 2,500, 50 to 100, 50 to 250, 50 to 500, 50 to 750, 50 to 1,000, 50 to 1,500, 50 to 2,000, 50 to 2,500, 50 to 3,000, 100 to 500, 100 to 750, 100 to 1,000, 100 to 3 ... 1,500, 100 to 2,000, 100 to 2,500, 100 to 3,000, 500 to 750, 500 to 1,000, 500 to 1,500, 500 to 2,000, 500 to 2,500, 500 to 3,000, 1,000 to 1,500, 1,000 to 2,000, 1,000 to 2,500, 1,000 to 3,000, 1,500 to 2,000, 1,500 to 2,500, 1,500 to 3,000, 2,000 to 2,500 and 2,500 to 3,000).

[0082] In some embodiments, the polyadenylated tail is designed specifically for the length of the entire polynucleotide or for the length of a specific region of the polynucleotide. This design may be based on the length of the coding region, a specific feature or length of a specific region, or the length of the final product expressed from the polynucleotide.

[0083] In this case, the length of the polyadenylated tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer than the length of the polynucleotide or its characteristic features. The polyadenylated tail can also be designed as part of the polynucleotide to which it belongs. In this case, the polyadenylated tail can be at least 10, 20, 30, 40, 50, 60, 70, 80, or 90% of the total length of the construct, the constructed region, or a value obtained by subtracting the polyadenylated tail from the total length of the construct. Furthermore, engineered binding sites for polyadenylated proteins and conjugation to polynucleotides can enhance expression.

[0084] Furthermore, multiple different polynucleotides can be linked together via PABP (polyadenylation binding protein) through the 3' end using modified nucleotides at the 3' end of the polyadenylation tail. Transfection experiments can be performed in suitable cell lines, and protein production can be measured by ELISA at 12, 24, 48, 72 hours, and day 7 post-transfection.

[0085] In some embodiments, the polynucleotides of the present invention are designed to include a polyadenylated G-quadruplex region. A G-quadruplex is a cyclic hydrogen-bonded structure of four guanine nucleotides, formed in DNA and RNA by G-rich sequences. In this experiment, the G-quadruplex was incorporated at the end of the polyadenylated tail. Other parameters of the resulting polynucleotide were measured at multiple time points, including stability, protein production, and half-life. It was found that using the polyadenylated G-quadruplex resulted in at least 75% of the protein yield from mRNA compared to using only a 120-nucleotide polyadenylated tail.

[0086] In this invention, the polyadenylated tail sequence can be used without restriction as long as it is a nucleic acid sequence that can perform the function of the polyadenylated tail. Preferably, it is at least one nucleotide that is different from adenine and selected from the group consisting of uracil (U), cytosine (C) and guanine (G) inserted between multiple adenines or located at the end of the polyadenylated tail, but it is not limited thereto.

[0087] In this invention, the synthesized nucleic acid molecule can be RNA.

[0088] In this invention, the RNA can be selected from the group consisting of mRNA, viral RNA, self-replicating RNA and replicon RNA, but is not limited thereto.

[0089] In this invention, the synthesized nucleic acid molecule may contain at least one main chain modified nucleic acid, a glycosylation modified nucleic acid, or a base modified nucleic acid, but is not limited thereto.

[0090] Glycosyl modification:

[0091] Modified nucleosides and nucleotides may be incorporated into modified mRNA compounds containing mRNA sequences as described herein, wherein the glycosyl moieties of the modified nucleosides and nucleotides may be modified. For example, the 2' hydroxyl (OH) may be modified or substituted with several different "oxygen" or "deoxygen" substituents. Examples of "oxy-2'-hydroxyl modification" include: alkoxy or allyloxy (-OR, e.g., R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or glycosyl); polyethylene glycol (PEG), -O(CH 2CH 2O) nCH 2CH 2OR; locked nucleic acid (LNA), wherein the 2' hydroxyl group is connected to the 4' carbon of the same ribose group, for example, by a methylene bridge; and amino (-O-amino, wherein the amino group, for example, NRR, is alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, diheteroarylamino, ethylenediamine, or polyamino) or aminoalkoxy, but are not limited thereto.

[0092] "Deoxygenation" modification includes hydrogen, an amino group (e.g., NH2, alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), or an amino group that can be attached to a glycosyl group via a linker, wherein the linker contains one or more of C, N, and O atoms.

[0093] The glycosyl group may also contain at least one carbon with a stereochemical configuration opposite to that of the corresponding carbon in ribose. Therefore, modified mRNA may contain nucleotides containing arabinose.

[0094] Main chain modification:

[0095] The phosphate backbone can be further modified with the modified nucleosides and nucleotides, which can be incorporated into a modified mRNA compound containing the mRNA sequence as described herein. The phosphate backbone can be modified by substituting at least one oxygen atom with another substituent. Furthermore, the modified nucleosides and nucleotides may comprise unmodified phosphate moieties completely replaced by modified phosphates as described herein. Examples of modified phosphates include, but are not limited to, thiophosphates, selenophosphates, boranophosphates, borate phosphates, hydrogen phosphonates, phosphoramidite, alkyl or aryl phosphonates, and triphosphates. In dithiophosphates, the two unattached oxygen atoms are replaced by sulfur.

[0096] Phosphate linkers can also be modified by replacing the linked oxygen with nitrogen (bridged phosphoamine), sulfur (bridged thiophosphate), and carbon (bridged methylene phosphate).

[0097] Base modification:

[0098] Modified nucleosides and nucleotides may be incorporated into modified mRNA compounds containing mRNA sequences as described herein, and these modified nucleosides and nucleotides may be further modified at their base moieties. Examples of nucleobases found in mRNA include, but are not limited to, adenine, guanine, cytosine, and uracil. For example, the nucleosides and nucleotides described herein may be chemically modified at their major groove surfaces. In some embodiments, the chemical modification of the major groove may include amino, thiol, alkyl, or halogen groups.

[0099] In a preferred embodiment of the present invention, the nucleotide analog / modifier is preferably determined by a base modification selected from the following: 2-amino-6-chloropurine nucleoside-5'-triphosphate, 2-aminopurine-nucleoside-5'-triphosphate, 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methyl 5'-Inosine-5'-triphosphate, 4-Thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate 5-Iodouridine-5'-triphosphate, 5-Iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azytidine-5'-triphosphate, 6-azyuridine-5'-triphosphate, 6-chloropurine nucleoside-5'-triphosphate, 7-deazoadenosine-5'- - Triphosphate, 7-dezoguanosine-5'-triphosphate, 8-azonasine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-nucleoside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, and flavin-5'-triphosphate.

[0100] The preferred base-modified nucleotides are selected from the group of base-modified nucleotides consisting of 5-methylcytidine-5'-triphosphate, 7-dezoguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate and pseudouridine-5'-triphosphate.

[0101] In some embodiments, the modified nucleosides include pyridine-4-ketoribonucleotide, 5-aza-uridine, 2-thio-5-aza-uridine, pseudouridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyluridine, 1-carboxymethyl-pseudouridine, 2'-O-methyluridine, 5-methyluridine, 5-propynyluridine, 1-propynyl-pseudouridine, 5-taurate methyluridine, 2-thio-uridine, 5-methoxyuridine, 1-taurate methyl-pseudouridine, 5 -Taurate methyl-2-thio-uridine, 1-Taurate methyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-denitro-pseudouridine, 2-thio-1-methyl-1-denitro-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine and 4-methoxy-2-thio-pseudouridine.

[0102] In some embodiments, the modified nucleosides include 5-aza-cytidine, pseudocytidine, 3-methylcytidine, 5-methylcytidine, N4-acetycytidine, 5-methytycytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudocytidine, pyrrole-cytidine, pyrrole-pseudocytidine, 2-thio-cytidine, 2-thio-5-methylcytidine, 4-thio-pseudocytidine, 4-thio-1-methyl-pseudocytidine. 4-Thio-1-methyl-1-denitro-pseudoisocytidine, 1-methyl-1-denitro-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine and 4-methoxy-1-methyl-pseudoisocytidine.

[0103] In other embodiments, the modified nucleosides comprise 2-aminopurine, 2,6-diaminopurine, 7-deadenine, 7-deadenine-8-aza-adenine, 7-deadenine-2-aminopurine, 7-deadenine-8-aza-2-aminopurine, 7-deadenine-2,6-diaminopurine, 7-deadenine-8-aza-2,6-diaminopurine, 1-methyladenosine, and N6-methyladenosine. N6-Isopentyladenosine, N6-(cis-hydroxyisopentyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylaminomethyladenosine, N6-threonylaminomethyladenosine, 2-methylthio-N6-threonylaminomethyladenosine, N6,N6-dimethyladenosine, 7-methyladenosine, 2-methylthio-adenosine, and 2-methoxy-adenosine.

[0104] In other embodiments, the modified nucleosides include inosine, 1-methyl-inosine, wybutosine, 7-deazo-guanosine, 7-deazo-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deazo-guanosine, 6-thio-7-deazo-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, 8-sideoxy-guanosine, 7-methyl-8-sideoxy-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.

[0105] In some embodiments, the nucleotide may be modified in the major groove and may include a methyl or halogen group replacing the hydrogen at C-5 of uracil. In some embodiments, the modified nucleoside is 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, or 5'-O-(1-thiophosphate)-pseuuridine.

[0106] In a further embodiment, the modified mRNA may contain a subset selected from 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudo-uridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl- Nucleoside modification of uridine, pyrrolo-cytidine, inosine, α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-sideoxy-guanosine, 7-deazo-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, and 7-deazo-adenosine.

[0107] In another embodiment, the present invention relates to vaccine compositions comprising synthetic nucleic acid molecules.

[0108] The term "vaccine" is considered to be a preventative or therapeutic substance that typically provides at least one antigen, preferably an antigenic peptide or protein. For example, "providing at least one antigen" means that the vaccine contains an antigen or contains, for example, a molecule encoding an antigen. Therefore, the vaccines of the present invention may be derived from, for example, tumor antigens, bacterial, viral, fungal, or protozoan antigens, autoantigens, allergens, or allogeneic antigens, and are particularly envisioned to contain at least one synthetic nucleic acid (RNA) molecule encoding at least one antigenic (poly)peptide or protein as defined herein, which, when expressed in and present in the immune system, induces an immune response against the antigen. However, synthetic nucleic acid (RNA) molecules encoding target non-antigenic (poly)peptides or proteins may also be used in the vaccines of the present invention.

[0109] In this invention, the synthesized nucleic acid molecules can be complexed with one or more lipids to form lipid nanoparticles or liposomes.

[0110] The synthetic nucleic acid (RNA) molecules of this invention are complexed or bound to, for example, one or more (multi)cationic compounds, preferably (multi)cationic polymers, (multi)cationic peptides or proteins (e.g., protamine), (multi)cationic polysaccharides, and / or (multi)cationic lipids. In this context, the terms "complexed" or "bound" indicate the binding of at least one synthetic nucleic acid (RNA) molecule to at least one compound, which is inherently stable and free of covalent bonds when combined as a larger complex.

[0111] lipids

[0112] In a preferred embodiment, the synthetic nucleic acid (RNA) molecule of the present invention is complexed or combined with lipids (particularly cationic and / or neutral lipids) to form one or more lipid nanoparticles or liposomes. Therefore, in some embodiments, the synthetic nucleic acid (RNA) molecule of the present invention may be provided in the form of a lipid-based formulation, particularly in the form of liposomes and / or lipid nanoparticles comprising the synthetic nucleic acid (RNA) molecule.

[0113] lipid nanoparticles

[0114] In some preferred embodiments, the synthetic nucleic acid (RNA) molecules of the present invention are complexed or combined with lipids (especially cationic and / or neutral lipids) to form one or more lipid nanoparticles.

[0115] Preferably, the lipid nanoparticles (LNPs) may comprise the following components: (a) at least one synthetic nucleic acid molecule (RNA) of the present invention; (b) cationic lipids; (c) aggregation reducing agents (e.g., polyethylene glycol (PEG) lipids or lipids modified with PEG); (d) optionally, non-cationic lipids (e.g., neutral lipids); and (e) optionally, sterols.

[0116] In some embodiments, the LNP may contain, in addition to at least one synthetic nucleic acid molecule (RNA) of the present invention, (i) at least one cationic lipid, (ii) a neutral lipid and (iii) sterols, such as cholesterol and PEG-lipids, wherein the cationic lipid is present in an amount of about 20 to 60%, the neutral lipid is present in an amount of 5 to 25%, the sterol is present in an amount of 25 to 55%, and the PEG-lipid is present in an amount of 0.5 to 15%.

[0117] In some embodiments, the synthetic nucleic acid molecules (RNA) of the present invention can be formulated into aminoalcohol lipidoids. The aminoalcohol lipidoids used in the present invention can be prepared by the method described in U.S. Patent No. 8,450,298, which is incorporated herein by reference in its entirety.

[0118] Liposomes

[0119] In some embodiments, the synthetic nucleic acid (RNA) molecules of the present invention are formulated into liposomes. Cationic lipid-based liposomes can form complexes with negatively charged nucleic acids (e.g., RNA) through electrostatic interactions, resulting in complexes that offer the biocompatibility, low toxicity, and large-scale production capabilities required for in vivo clinical applications. Liposomes can fuse with cell membranes for absorption; first, the liposomes enter the cell via phagocytosis, and then the nucleic acid is released from the endosome / carrier into the cytoplasm. Liposomes are essentially analogs of biological membranes and can be prepared from natural and synthetic phospholipids, and have long been considered drug delivery carriers due to their excellent biocompatibility.

[0120] Liposomes are typically formed from a lipid bilayer, which may contain cationic, anionic, or neutral (phospholipid) lipids and cholesterol surrounding an aqueous core. The lipid bilayer and the aqueous core may contain hydrophobic or hydrophilic compounds. Liposomes may have one or more lipid membranes. Liposomes can be monolayered, called "unilamellar liposomes," or multilayered, called "multilamellar liposomes."

[0121] The in vivo properties and behavior of liposomes can be modified by coating them with hydrophilic polymers, such as by adding polyethylene glycol (PEG) to the surface of liposomes to provide steric stability. In addition, liposomes can be used for specific targeting by attaching ligands (such as antibodies, peptides, and carbohydrates) to the surface of the liposomes or to the ends of the attached PEG chains.

[0122] Liposomes typically exist as spherical vesicles with dimensions ranging from 20 nanometers (nm) to several micrometers. Liposomes can have different diameters, such as multilayered vesicles (MLVs), small unilamellar vesicles (SUVs), and large unilamellar vesicles (LUVs). MLVs have diameters of several hundred nanometers and consist of a series of concentric bilayers separated by narrow water chambers. SUVs have diameters less than 50 nm, and LUVs can range in diameter from 50 nm to 500 nm, but are not limited to these. Liposomes can be designed to include, but are not limited to, opsonins or ligands to improve liposome attachment to unhealthy tissues or to activate events such as endocytosis, but are not limited to these. Liposomes can have low or high pH values ​​to enhance the transport of pharmaceutical preparations.

[0123] In this invention, the vaccine composition may further comprise one or more adjuvants or active agents.

[0124] In a broad sense, the term "adjuvant" or "adjuvant ingredient" generally refers to pharmaceutical and / or immunomodulatory agents that can be modified (e.g., enhance another active agent (e.g., a therapeutic agent or vaccine)). In this document, "adjuvant" can be considered any compound suitable for assisting in the administration and delivery of the vaccine compositions of the present invention. Specifically, adjuvants preferably enhance the immunostimulatory activity of the added vaccine. Furthermore, adjuvants are not limited to this and may initiate or enhance an immune response of the innate immune system, i.e., a nonspecific immune response.

[0125] "Adjuvants" generally do not elicit an adaptive immune response. To date, "adjuvants" are not considered antigens. That is, upon administration, the vaccine of the present invention typically initiates an adaptive immune response due to an antigenic peptide or protein encoded by at least one coding sequence of a synthetic nucleic acid (RNA) molecule contained within the vaccine.

[0126] Suitable adjuvants are known to those skilled in the art to which this invention pertains and may be selected from any suitable adjuvant in this application (i.e., assisting in eliciting an immune response in mammals), and may include: TDM, MDP, cell wall dipeptide, Pluronic, alum solution, aluminum hydroxide, ADJUMER™ (polyphosphazene), aluminum phosphate gel, dextran from algae, algammulin, aluminum hydroxide gel (alum), high protein adsorption aluminum hydroxide gel, low viscosity aluminum hydroxide gel, AF or SPT (squalane (5%), Tween 80 (0.2%), Pluronic L121 (1.25%), an emulsion of phosphate-buffered physiological saline, pH 7.4) or AVRIDINE™ (propylenediamine), but are not limited thereto.

[0127] In another embodiment, the present invention is directed to the use of vaccine compositions for the prevention of disease.

[0128] As used in this article, the term "disease" refers to an abnormality caused by tumor antigens, bacterial, viral, fungal or protozoan antigens, autoantigens, allergens or allogeneic antigens, and may include, but is not limited to, cancer, tumors, autoimmune diseases, inflammation, viral infections, bacterial infections, fungal infections, protozoan infections, etc.

[0129] As used herein, the term "prevention" means any action taken to suppress a disease or delay its progression by administering the vaccine composition of the present invention.

[0130] In another embodiment, the present invention relates to a method for preventing disease, which includes administering a vaccine composition.

[0131] In another embodiment, the present invention relates to the use of vaccine compositions in the preparation of medicaments for the prevention of disease.

[0132] Example

[0133] The present invention will now be described in detail with reference to the following examples. However, it will be apparent to those skilled in the art that the following embodiments are provided for illustrative purposes only and should not be construed as limiting the scope of the invention.

[0134] Example 1. 5'-UTR selection

[0135] All possible combinations of 30-base-pair (bp) 5'-UTR polynucleotides were constructed. Sequences with a mean free energy of 0 that would not form specific structures (such as secondary structures) were selected. Sequences starting with AGG sequences were selected to improve capping and transcription. AUG-like sequences were further removed from some sequences. Because uridine-rich elements reduce protein translation efficiency due to TLR7 / 8 immunosensing, sequences containing UUU and UUUU motifs were removed. To improve protein translation efficiency, uridine depletion was performed to remove 15% of uridine from the entire sequence. To improve mRNA stability, 5'-UTRs with CGC sequences were removed, resulting in a total of 33 5'-UTR sequences (Figure 1).

[0136] Example 2. Preparation of nucleic acids for synthesizing mRNA containing a 5'-UTR.

[0137] 2-1. Linearization for Template DNA Preparation

[0138] Linearization is performed using a restriction enzyme that cleaves downstream of the polyadenylated nucleotide site in the plastid. The linearized DNA is isolated using AMICON.

[0139] Then, plasmid DNA was identified on a 1% agarose gel to determine whether it had been cut.

[0140] 2-2. In vitro transcription

[0141] The process of transcription into mRNA in vitro.

[0142] The prepared template DNA was reacted with T7 RNA polymerase, buffer solution, NTPs (including natural and chemically modified NTPs) and other essential elements for IVT at 37°C for 4 hours (hr), as shown in Table 2 (HiScribe™ T7 Rapid High-Yield RNA Synthesis Kit, NEB E2050S, US).

[0143] [Table 2] Element volume NTP mixture (final concentration 10 mM) 2 microliters (μL) RNase inhibitors 0.5 μL Inorganic pyrophosphate hydrolysate (yeast) 0.4 μL 100 mM Clean Cap AG 2 μL Template DNA 1 microgram (μg) 10X T7 polymerase reaction buffer 2 μL T7 RNA polymerase mixture 2 μL Nuclease-free water Maximum 20 μL Total 20 μL

[0144] When the reaction was complete, 1 μg of DNA was treated with 1 U of DNase I and then reacted at 37°C for 15 to 30 minutes to remove the template DNA. After the reaction, the IVT product was purified according to the method recommended by the manufacturer of Invitrogen's MEGAclear™ kit (Austin, Tex.). The purified mRNA was then quantified by Nanodrop or UV / Vis absorption and the banding pattern on the agarose gel was identified.

[0145] 2-3. Purification of DsRNA

[0146] Cellulose is used to remove double-stranded RNA (dsRNA) generated during the IVT reaction.

[0147] Prewashed cellulose:

[0148] 0.2 g of cellulose was released into 1 ml of buffer solution A in a 50 ml tube, and then a bench top-scale cellulose column was prepared. The composition of buffer solution A and buffer solution B is shown in Table 3 below.

[0149] [Table 3] 1X Buffer A Concentration (mM) Source solution concentration (mM) Volume (mL) HEPES 10 1000 0.4 EDTA 0.1 5 0.8 NaCl 125 5000 1 ethanol 16% 100% 6.4 NaOH - 25000 0.02 DW 31.38 Total volume 40 2X Buffer A Concentration (mM) Source solution concentration (mM) Volume (mL) HEPES 20 1000 0.8 EDTA 0.2 5 1.6 NaCl 250 5000 2 ethanol 32% 100% 12.8 NaOH - 25000 0.035 DW 22.765 Total volume 40

[0150] Filling IVT mRNA:

[0151] IVT mRNA dissolved in 500 µl buffer solution A was fed into the column prepared above.

[0152] The reaction was induced at room temperature for 30 minutes using a rotor to allow cellulose to bind to dsRNA.

[0153] The product was centrifuged at 14,000 g for 1 minute, and the effluent was recovered and transferred to a new column.

[0154] The reaction was repeated for 30 minutes at room temperature, followed by centrifugation under the same conditions, and the effluent was recovered.

[0155] Precipitate mRNA:

[0156] The precipitate was recovered by isopropanol precipitation and dissolved in nuclease-free water.

[0157] Example 3. Determining the purity of the prepared mRNA

[0158] 3-1. IP-RP UPLC

[0159] To determine the purity of the prepared mRNA, reverse chromatography columns such as C18 or C8 were used to analyze the mRNA.

[0160] Aqueous-based and acetonitrile (ACN)-based buffer solutions were used as mobile phases for chromatographic analysis. These buffer solutions contained ion-pairing additives based on alkyl ammonium acetates (e.g., TBAA, TPAA, DMBAA, HAA, etc.) containing TEAA. The column was washed and stored using organic solvents such as acetonitrile and methanol. Buffer solutions with high water content were used as weak washing buffers, while buffer solutions containing 10-50% organic solvents were used as strong washing buffers and seal wash buffers.

[0161] The TEAA in the water-based buffer solution is connected to pump A, and the TEAA in the ACN-based buffer solution is connected to pump B. An initial priming process is executed. The column is connected to the equipment, and at least 5 CV (Column Volume) is applied to the column under initial gradient conditions and held at equilibrium. It is determined whether Δpsi remains stable during equilibrium.

[0162] mRNA was injected and then analyzed at a gradient of increasing organic solvent ratio compared to the initial state.

[0163] After analysis, the column was cleaned and preserved using organic solvents such as acetonitrile and methanol, and subjected to at least 10 CV.

[0164] 3-2. Dotted ink dot method

[0165] The dot speckle method was used to qualitatively identify double-stranded RNA (dsRNA) as an impurity.

[0166] The J2 antibody binds to dsRNA and is thus used as a probe to determine the presence or absence of dsRNA.

[0167] Add 2 μL of the IVT mRNA to be analyzed at a concentration of 100-200 ng / μL to a positively charged nylon membrane (Merck / 11417240001) and allow it to dry completely at room temperature for at least 1 hour.

[0168] The sample was crosslinked into the membrane using a UV crosslinking agent at 1,250 μJ / CM², and then reacted with a 4% skim milk (in 1X TBST) blocking solution at room temperature for 1 hour on a shaker.

[0169] The J2 primary antibody was diluted 1:5000 in the blocking solution and reacted overnight at 4°C using a shaker.

[0170] The product was washed three times for 10 minutes with 1X TBST solution at room temperature using a shaker. The goat anti-mouse (IgG) secondary antibody conjugated with wasabi peroxidase (HRP) was diluted 1:5000 in the blocking solution and reacted at room temperature using a shaker for 1 hour.

[0171] The product was then washed three times for 10 minutes at room temperature with 1X TBST solution using a shaker.

[0172] Mix ECL reagent 1 and 2 solutions in a 1:1 (v / v) ratio, immerse the membrane in the mixture and expose it for 10 seconds, and visualize the bands using Chemi Doc.

[0173] Example 4. Determining the translation efficiency of the prepared mRNA

[0174] The translation efficiency of prepared mRNA was evaluated by determining the luciferase activity.

[0175] Human embryonic kidney cell line HEK293T cells (human embryonic kidney cell line, ATCC CRL-3216) and HeLa cells (human cervical epithelial cells, CCL2) were cultured in DMEM / Dulbecco's modified Eagles medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. Huh7 cells (human hepatocellular carcinoma cell line, Korea cell line bank, 60104) and SNU423 cells (human hepatocellular carcinoma cell line, Korea cell line bank, 00423) were cultured in RPMI-1640 (Gibco) medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin.

[0176] 250 ng of mRNA was transfected into 12-well plates containing lipofectamine 3000 (Invitrogen, Carlsbad, Calif).

[0177] The control groups used in this article are as follows:

[0178] 1. Human alpha globulin A (WO 2020 / 198337 derived sequence modification):

[0179] AGTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC (SEQ ID NO:34)

[0180] 2. Cytochrome b-245 α chain CYBA (WO 2020 / 198337):

[0181] AGTGCGCGCCTAGCAGTGTCCCAGCCGGGTTCGTGTCGCC (SEQ ID NO:35)

[0182] 3. Ref UTR no. 1 (US2020 / 0208145):

[0183] AGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC (SEQ ID NO: 36)

[0184] 4. Ref UTR no. 2 (US2020 / 0208145):

[0185] GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCCGCCACC (SEQ ID NO:37)

[0186] Add 20 μL of bright-glo luciferase assay reagent to the transfected 96-well plate, then allow the 96-well plate to stain for 1 minute and then shake at room temperature for 10 minutes.

[0187] The integration time was set to 0.3 seconds on the GloMax Navigator photometer, and then the luciferase activity in the prepared dish was measured.

[0188] Dispense 20 μL of stopglo luciferase assay reagent from the Dual-glo kit into the measurement pan, then place the device at room temperature for 10 minutes and then shake the pan for 1 minute.

[0189] Luciferase activity was measured using a GloMax Navigator photometer.

[0190] The results are shown in Figures 4 and 5. The translation efficiency of mRNA containing the UTR of the present invention is better than that of the control group in all cell lines.

[0191] Although the specific components of the invention have been described in detail, those skilled in the art will understand that these detailed descriptions are provided as preferred embodiments for illustrative purposes and should not be construed as limiting the scope of the invention. Therefore, the essential scope of the invention is defined by the appended patent application claims and their equivalents.

[0192] Industrial utilization

[0193] The 5'-UTR polynucleotide of the present invention can effectively induce the expression of target proteins due to its improved translation efficiency, thus contributing to various RNA-based applications, such as vaccines, in vivo / in vitro gene therapy, etc.

[0194] none

[0195] TW202323527A_111146294_SEQL.xml

Claims

1. An isolated 5'-untranslated region (UTR) polynucleotide, comprising any of the nucleotide sequences represented by SEQ ID NOs: 1 to 33.

2. A synthetic nucleic acid molecule, in 5' to 3' order, comprising: a) a -5'-CAP structure; b) a separated 5'-untranslated polynucleotide as described in claim 1; c) at least one coding region; d) a -3'-untranslated region (3'-UTR); and e) 10 to 1000 poly(A) tails or poly(A) tail-like sequences, wherein the poly(A) tail-like sequence has a conformation different from adenine and selected from the group consisting of uracil (U), cytosine (C), and guanine (G) inserted between or at the end of the poly(A) tail.

3. The synthetic nucleic acid molecule as described in claim 2, wherein the 5'-CAP structure is selected from the group consisting of m7GpppAmpG, m7GpppApG and m7,3'OmeApppG.

4. The synthetic nucleic acid molecule as claimed in claim 2, wherein the coding region encodes at least one protein selected from the group consisting of antigenic proteins, allergenic proteins, therapeutic proteins, and fragments, mutants, or derivatives of the aforementioned proteins.

5. The synthetic nucleic acid molecule as claimed in claim 4, wherein the antigenic protein comprises at least one selected from the group consisting of tumor antigens, pathogenic antigens, autoantigens, allogeneic antigens and allergens.

6. The synthetic nucleic acid molecule as described in claim 5, wherein the tumor antigen is selected from the group consisting of NYESO-1, HER-2 / neu, MAGE-1, tyrosinase, MUC1, CEA, Mam-A, hTERT, Syalyl-Tn, WT1, alpha-fetoprotein, CA-125, gp-100, p53, Ras, Src, EGFRvIII, PSMA, GD2, Bcr-abl, survivin, PSA, EphA2, PAP, AFP, EpCAM, ALK, mesothelin, PSCA, MART-1, Melan-A, SCP-1, SPAG9, AKAP4, and OY-TES-1.

7. The synthetic nucleic acid molecule as described in claim 5, wherein the pathogenic antigen is selected from the group consisting of antigens of bacteria, viruses, fungi and protists.

8. The synthetic nucleic acid molecule as described in claim 7, wherein the virus is a coronavirus.

9. The synthetic nucleic acid molecule as described in claim 2, wherein the synthetic nucleic acid molecule is RNA.

10. The synthetic nucleic acid molecule as described in claim 9, wherein the RNA is selected from the group consisting of mRNA, viral RNA, self-replicating RNA and replicon RNA.

11. The synthetic nucleic acid molecule as described in claim 2, wherein the synthetic nucleic acid molecule comprises at least one backbone-modified nucleic acid, a glycosyl-modified nucleic acid, or a base-modified nucleic acid.

12. The synthetic nucleic acid molecule as described in claim 2, wherein the 3'-untranslated region is selected from the 3'-untranslated region of β-globulin, CYBA, albumin, growth hormone (GH), VEEV, hepatitis B virus (HBV), α-globulin, DEN, barley yellow dwarf virus-PAV (BYDV-PAV), elongation factor 1 α1 (EEF1A1), manganese superoxide dismutase (MnSOD), the β subunit (β-mRNA) of mitochondrial H(+)-ATP synthase, GLUT1, MEF2A The group consists of the 3'-untranslated region and the β-F1-ATPase 3'-untranslated region.

13. A vaccine composition comprising a synthetic nucleic acid molecule as described in any one of claims 2 to 12.

14. The vaccine composition as claimed in claim 13, wherein the synthetic nucleic acid molecule (RNA) is complexed or combined with one or more lipids to form one or more lipid nanoparticles or liposomes.

15. The vaccine composition as described in claim 13 further comprises one or more adjuvants or active agents.

Images