An sirna, sirna conjugate, pharmaceutical composition, kit and use thereof

Abstract

This disclosure provides an siRNA, siRNA conjugates, pharmaceutical compositions, kits, and uses thereof for inhibiting angiotensinogen (AGT) gene expression. The siRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises at least 19 consecutive nucleotides differing by no more than 3 nucleotides from any of the antisense strand sequences shown in Table 1. This disclosure also provides methods for preventing and / or treating angiotensinogen dysregulation-related diseases using at least one of the above-described siRNA, siRNA conjugates, pharmaceutical compositions, and kits.

Description

Technical Field

[0001] This disclosure relates to the field of pharmaceutical technology, and particularly to an siRNA that inhibits angiotensinogen (AGT) gene expression, its conjugates, and pharmaceutical compositions. This disclosure also relates to a kit containing at least one of siRNA, its conjugates, and pharmaceutical compositions; a method for preventing and / or treating angiotensinogen dysregulation-related diseases using at least one of the aforementioned siRNA, its conjugates, and pharmaceutical compositions; and the use of at least one of the aforementioned siRNA, its conjugates, and pharmaceutical compositions in the preparation of medicaments for the prevention and / or treatment of angiotensinogen dysregulation-related diseases. Prior Technology

[0002] The renin-angiotensin-aldosterone system (RAAS) plays a crucial role in blood pressure regulation. The RAAS cascade begins with the secretion of renin into the circulation by glomerular cells near the kidney. AGT (Angiotensinogen) is the most upstream precursor in the renin-angiotensin-aldosterone system (RAAS), and its cascade effects in blood pressure regulation have been confirmed. For example, inhibiting AGT expression can have a good antihypertensive effect.

[0003] Hypertension is a disease characterized by persistently high blood pressure and is a major risk factor for related diseases such as stroke, heart disease, aneurysms, and kidney failure. It has become one of the leading causes of death worldwide. Therefore, treating hypertension with antihypertensive drugs to improve blood pressure control and lower blood pressure levels has become an urgent need for hypertensive patients. However, despite the large number of antihypertensive drugs available on the market, most patients cannot effectively lower their blood pressure by taking only one antihypertensive drug and need to take multiple antihypertensive drugs simultaneously to achieve a therapeutic effect. Therefore, the development of more effective antihypertensive drugs is urgently needed.

[0004] Small interfering RNA (siRNA) is an emerging and highly promising candidate for research. Based on RNA interference mechanisms, it can inhibit or block the expression of target genes of interest in a sequence-specific manner, thereby achieving the goal of treating diseases. Because siRNA recognizes target RNA through complementary base pairing and sequence-specific recognition, it can cleave the target RNA, thereby downregulating target RNA levels and inhibiting target gene expression. Therefore, siRNA has extremely broad application prospects.

[0005] However, compared to traditional drugs, siRNAs have poor stability and are easily degraded by nucleases when administered systemically. Furthermore, it is necessary to further improve their activity while avoiding off-target effects, immune stimulation, and cytotoxicity. Therefore, developing more candidate siRNAs that are stable in the blood, possess good biological activity, and have low cytotoxicity to inhibit AGT gene expression has become an urgent problem to be solved. Simultaneously, using the aforementioned candidate siRNAs that inhibit AGT gene expression, there is both the necessity for clinical research and the practicality for commercialization in developing drugs that can effectively prevent and / or treat angiotensinogen dysregulation-related diseases. Summary of the Invention

[0006] Based on the above, the purpose of this disclosure is to provide siRNA capable of effectively inhibiting AGT gene expression, siRNA conjugates obtained by conjugating the siRNA with conjugation molecules, pharmaceutical compositions containing the siRNA as an active ingredient, kits containing at least one of the siRNA, the siRNA conjugate, or the pharmaceutical composition, the use of the siRNA, the siRNA conjugate, or at least one of the pharmaceutical composition in the preparation of medicaments for the prevention and / or treatment of angiotensinogen dysregulation-related diseases, and methods for using the siRNA, the siRNA conjugate, or at least one of the pharmaceutical compositions to prevent and / or treat angiotensinogen dysregulation-related diseases. The AGT gene can be intracellular, for example, in the cells of a subject (e.g., a human).

[0007] In a first aspect, this disclosure provides an siRNA for inhibiting AGT gene expression, the siRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises at least 19 consecutive nucleotides that differ from any antisense strand sequence shown in Table 1 by no more than 3 nucleotides.

[0008] In a second aspect, this disclosure provides an siRNA conjugate obtained by conjugating siRNA as described in the first aspect with a conjugate molecule.

[0009] In a third aspect, this disclosure provides a pharmaceutical composition comprising siRNA as an active ingredient and a pharmaceutically acceptable carrier as described in the first aspect.

[0010] In a fourth aspect, this disclosure provides a kit containing at least one of the following: siRNA as described in the first aspect, siRNA conjugates as described in the second aspect, and pharmaceutical compositions as described in the third aspect.

[0011] In a fifth aspect, this disclosure provides the use of at least one of the siRNAs described in the first aspect, the siRNA conjugates described in the second aspect, and the pharmaceutical compositions described in the third aspect in the preparation of a medicament for the prevention and / or treatment of angiotensinogen dysregulation-related diseases.

[0012] In a sixth aspect, this disclosure provides a method for preventing and / or treating angiotensinogen dysregulation-related diseases, the method comprising administering at least one of the siRNAs described in the first aspect, siRNA conjugates described in the second aspect, and pharmaceutical compositions described in the third aspect to a subject in need.

[0013] In a seventh aspect, this disclosure provides siRNAs as described in the first aspect and / or siRNA conjugates as described in the second aspect and / or pharmaceutical compositions as described in the third aspect for the prevention and / or treatment of diseases related to angiotensinogen dysregulation.

[0014] This disclosure provides an siRNA, its conjugates, a pharmaceutical composition, and its uses, which have the following beneficial effects: the siRNA, siRNA conjugates, and pharmaceutical compositions provided in this disclosure have acceptable AGT gene inhibitory activity.

[0015] Other features and advantages of this disclosure will be described in detail in the following specific embodiments. Simple Explanation of the Diagram

[0016] none Implementation

[0017] The following provides a detailed description of specific embodiments of this disclosure. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure. Rather, various modifications, alterations, or changes can be made based on the spirit and concept of this disclosure, and such modifications, alterations, or changes still fall within the scope of this disclosure.

[0018] In this disclosure, unless otherwise specified, the term "AGT" includes human AGT, whose amino acids and complete coding sequences can be found, for example, in GenBank accession No. GI:188595658 (NM_001382817.3; SEQ ID NO:1); cynomolgus monkey (Macaca fascicularis) AGT, whose amino acids and complete coding sequences can be found, for example, in GenBank accession No. GI:90075391 (AB170313.1; SEQ ID NO:2); mouse (Mus musculus) AGT, whose amino acids and complete coding sequences can be found, for example, in GenBank accession No. GI:113461997 (NM_007428.3; SEQ ID NO:3); and rat (Rattus norvegicus) AGT, whose amino acids and complete coding sequences can be found, for example, in GenBank accession No. GI:51036672 (NM_134432; SEQ ID NO:1). It was found in NO:4).

[0019] Other instances of AGT mRNA sequences can be easily obtained using publicly available databases such as GenBank, UniProt, OMIM, and the Macaca Genome Project website.

[0020] In this disclosure, unless otherwise specified, uppercase letters C, G, U, and A represent the base composition of ribonucleotides; dC, dG, dT, and dA represent the base composition of deoxyribonucleotides; lowercase letter m indicates that the nucleotide adjacent to the right of letter m is a 2'-methoxy modified nucleotide; the identifier i2F indicates that the nucleotide adjacent to the right of identifier i2F is a 2'-fluorine modified nucleotide; the identifier * indicates that the two nucleotides adjacent to the left and right of identifier * are linked by a thiophosphate group; the identifier # indicates that the two nucleotides adjacent to the left and right of identifier # are linked by a methanesulfonamide phosphate bond (MsPA); the identifier (E)-VP indicates that the nucleotide adjacent to the right of identifier (E)-VP is a (E)-vinyl phosphate modified nucleotide; underscore " [, — , ] indicates that the underlined nucleotide is glycerol nucleotide (GNA); [T]” represents the S-isomer of thymidine diol nucleic acid (GNA), and their structures are shown below (where Base represents a base): 2'-methoxy modified nucleotides 2'-Fluorine-modified nucleotides Thiophosphate group linkage (E)-vinyl phosphate modified nucleotides MsPA Glyceryl nucleotide (GNA).

[0021] In this disclosure, unless otherwise specified, in the context of siRNA, "complementarity" means that in a double-stranded siRNA molecule, the bases of one strand pair with each base of the other strand in a complementary manner, or that the bases of the antisense strand of the siRNA pair with each base of the target gene or target sequence in a complementary manner. That is, when A / dA pairs with U / dT, and C / dC pairs with G / dG, the two strands are considered complementary. "Complementarity" as described in this disclosure can include base pairings formed by non-Watson-Crick base pairings and / or non-natural or modified nucleotides, as long as they hybridize and can form a double-stranded structure. Correspondingly, in this disclosure, unless otherwise specified, in the context of siRNA, "mismatch" means that in a double-stranded siRNA molecule, the bases at corresponding positions are not paired in a complementary manner, or that the bases of the antisense strand of the siRNA are not paired with the bases at corresponding positions of the target gene or target sequence in a complementary manner.

[0022] In this disclosure, unless otherwise specified, "substantially complementary pairing" means that the number of mismatched nucleotides is no more than 3, for example, the number of mismatched nucleotides is 2 or the number of mismatched nucleotides is 1.

[0023] In this disclosure, unless otherwise specified, "conjugation" refers to the covalent connection between two or more chemical moieties; "conjugated compound" refers to a compound formed by the covalent connection between two or more chemical moieties; and "siRNA conjugated compound" refers to a compound formed by the covalent attachment of one or more chemical moieties to siRNA. It should be noted that the chemical moieties can be directly attached to siRNA or attached to siRNA via a linker. For example, the conjugated molecule may optionally include a linker moiety for attachment to siRNA and a functional moiety (e.g., a targeting moiety for targeting specific tissues or cells, such as GalNAc).

[0024] In this disclosure, unless otherwise specified, the "-" in "connector-targeting ligand" refers to the covalent connection between the connector and the targeting ligand.

[0025] In this disclosure, unless otherwise specified, the term "pharmaceutically acceptable" means that the carrier, delivery vehicle, diluent, excipient and / or the salt / ester / hydrate formed therefrom is generally chemically or physically compatible with other components constituting a drug dosage form and physiologically compatible with the receptor.

[0026] In this disclosure, unless otherwise specified, the term "2'-fluoronucleotide" means that it contains a 2'-fluoro modification, and may also contain modifications at positions other than the 2' position in the nucleotide structure.

[0027] In this disclosure, unless otherwise specified, the term "2'-methoxynucleotide" means that it contains a 2'-methoxy modification, and may also contain modifications at positions other than the 2' position in the nucleotide structure.

[0028] In this disclosure, unless otherwise specified, "target sequence" refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the AGT gene, including mRNA of the RNA processing product of the primary transcription product.

[0029] In this disclosure, unless otherwise specified, the term "suppression" refers to the down-regulation of target gene expression due to siRNA-mediated mRNA degradation. "Down-regulation" refers to a decrease in target gene expression of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% or more, or even 100%, relative to the absence of siRNA treatment. A 100% decrease in target gene expression means that there is no detectable level of target gene expression.

[0030] In this disclosure, unless otherwise specified, the terms “comprising, including, and containing” or equivalents are open-ended expressions, meaning that in addition to the listed elements, components, or steps, other unspecified elements, components, or steps may also be included.

[0031] In this disclosure, unless otherwise specified, the term "identity" refers to the similarity between two nucleotide sequences or two amino acid sequences. The percentage of identity between sequences can be determined by algorithms known to those skilled in the art (e.g., Needleman-Wunsch algorithm, Smith-Waterman algorithm, BLAST algorithm).

[0032] In this disclosure, unless otherwise specified, the term "fundamentally complementary" means that two nucleic acid sequences are completely complementary or that at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of their nucleotides are complementary.

[0033] Unless otherwise stated, in this document, parameter values ​​representing the amount of an ingredient, its physicochemical properties, or reaction conditions, etc., should be understood to be modified by the term "about" in all cases. When the term "about" is used to describe this application, the term "about" indicates an existing error value, such as a variation within ±5%, for example ±1%, or ±0.1% of a particular value.

[0034] The terms “subject,” “patient,” and “individual” are used interchangeably herein and include mammals or non-mammalian vertebrates (such as chickens, emus, and fish), including but not limited to domesticated animals (e.g., cattle, sheep, cats, dogs, pigs, and horses), primates (e.g., humans, non-human primates such as monkeys), rabbits, and rodents (e.g., mice, rats, guinea pigs, and hamsters), preferably humans.

[0035] The term “treating” in this article means reducing or alleviating a disease or symptom, slowing the onset or development of a disease or symptom, reducing the risk of developing a disease or symptom, or delaying the development of symptoms associated with a disease or symptom, reducing or terminating symptoms associated with a disease or symptom, producing a complete or partial reversal of a disease or symptom, curing a disease or symptom, or a combination of the above.

[0036] The various aspects of this disclosure will now be described in detail.

[0037] I. The siRNA disclosed herein

[0038] In this disclosure, the term "siRNA" refers to an RNA molecule that can sequence-specifically induce RNAi (RNA interference) phenomena, comprising a sense strand and an antisense strand, and having a partially or fully complementary double-stranded structure.

[0039] This disclosure provides an siRNA for inhibiting AGT gene expression, the siRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises at least 19 consecutive nucleotides that differ from any antisense strand sequence shown in Table 1 by no more than 3 nucleotides.

[0040] In some embodiments of this disclosure, the antisense strand comprises at least 19 consecutive nucleotides that differ from any of the antisense strand sequences shown in Table 1 by no more than 2 nucleotides.

[0041] In some embodiments of this disclosure, the antisense strand comprises at least 19 consecutive nucleotides that differ from any of the antisense strand sequences shown in Table 1 by no more than one nucleotide.

[0042] This disclosure provides an siRNA for inhibiting AGT gene expression. The siRNA comprises a sense strand and an antisense strand, wherein the antisense strand contains a compound selected from SEQ ID NO: 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 30, 36, 60, 66, 68, 92, 94, 96, 98, 100, 102, 104, 106, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141. At least 19 consecutive nucleotides differing by no more than 3 nucleotides in any one of the antisense strands in the following sequences: 143, 145, 155, 157, 159, 161, 165, 167, 169, 171, 173, 175, 176, 177, 178, 179, 180, 186, 188, 190, 192, 194, 196, 197, 198, 199, and 203.

[0043] In some embodiments of this disclosure, the antisense chain includes SEQ ID NO: 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 30, 36, 60, 66, 68, 92, 94, 96, 98, 100, 102, 104, 106, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, At least 19 consecutive nucleotides differing by no more than 2 nucleotides in any one of the antisense strands in the following sequences: 143, 145, 155, 157, 159, 161, 165, 167, 169, 171, 173, 175, 176, 177, 178, 179, 180, 186, 188, 190, 192, 194, 196, 197, 198, 199, and 203.

[0044] In some embodiments of this disclosure, the antisense chain includes SEQ ID NO: 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 30, 36, 60, 66, 68, 92, 94, 96, 98, 100, 102, 104, 106, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, At least 19 consecutive nucleotides differing by no more than one nucleotide in any of the antisense strands in the following sequences: 143, 145, 155, 157, 159, 161, 165, 167, 169, 171, 173, 175, 176, 177, 178, 179, 180, 186, 188, 190, 192, 194, 196, 197, 198, 199, and 203.

[0045] In some embodiments of this disclosure, the antisense strand of the siRNA includes a 1-5 nucleotide length overhang at the 3' end.

[0046] In some embodiments of this disclosure, the antisense strand of the siRNA includes a 1-4 nucleotide length overhang at the 3' end.

[0047] In some embodiments of this disclosure, the antisense strand of the siRNA includes a 1-3 nucleotide length overhang at the 3' end.

[0048] In some embodiments of this disclosure, the antisense strand includes a 2-nucleotide-length end overhang at the 3' end.

[0049] In some embodiments of this disclosure, the 5' end of the antisense strand in the siRNA is blunt.

[0050] In some embodiments of this disclosure, the number of nucleotides in the positive strand of the siRNA is 16-25. In some embodiments of this disclosure, the number of nucleotides in the positive strand of the siRNA is 16.

[0051] In some embodiments of this disclosure, the number of nucleotides in the sense strand of the siRNA is 17.

[0052] In some embodiments of this disclosure, the number of nucleotides in the sense strand of the siRNA is 18.

[0053] In some embodiments of this disclosure, the number of nucleotides in the sense strand of the siRNA is 19.

[0054] In some embodiments of this disclosure, the number of nucleotides in the sense strand of the siRNA is 20.

[0055] In some embodiments of this disclosure, the number of nucleotides in the sense strand of the siRNA is 21.

[0056] In some embodiments of this disclosure, the number of nucleotides in the sense strand of the siRNA is 22.

[0057] In some embodiments of this disclosure, the number of nucleotides in the sense strand of the siRNA is 23.

[0058] In some embodiments of this disclosure, the number of nucleotides in the sense strand of the siRNA is 24.

[0059] In some embodiments of this disclosure, the number of nucleotides in the sense strand of the siRNA is 25.

[0060] In some embodiments of this disclosure, the number of nucleotides in the antisense strand of the siRNA is 19-27. In some embodiments of this disclosure, the number of nucleotides in the antisense strand of the siRNA is 19.

[0061] In some embodiments of this disclosure, the number of nucleotides in the antisense strand of the siRNA is 21.

[0062] In some embodiments of this disclosure, the number of nucleotides in the antisense strand of the siRNA is 22.

[0063] In some embodiments of this disclosure, the number of nucleotides in the antisense strand of the siRNA is 23.

[0064] In some embodiments of this disclosure, the number of nucleotides in the antisense strand of the siRNA is 24.

[0065] In some embodiments of this disclosure, the number of nucleotides in the antisense strand of the siRNA is 25.

[0066] In some embodiments of this disclosure, the number of nucleotides in the antisense strand of the siRNA is 26.

[0067] In some embodiments of this disclosure, the number of nucleotides in the antisense strand of the siRNA is 27.

[0068] In some embodiments of this disclosure, the antisense strand in the siRNA differs from any of the antisense strands listed in Table 1 by no more than 3 nucleotides.

[0069] In some embodiments of this disclosure, the antisense strand in the siRNA differs from any of the antisense strands listed in Table 1 by no more than two nucleotides.

[0070] In some embodiments of this disclosure, the antisense strand in the siRNA differs from any of the antisense strands listed in Table 1 by no more than one nucleotide.

[0071] In some embodiments of this disclosure, the antisense strand of the siRNA is associated with SEQ ID NO: 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 30, 36, 60, 66, 68, 92, 94, 96, 98, 100, 102, 104, 106, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137. The difference between any of the following is that they contain no more than 3 nucleotides: 139, 141, 143, 145, 155, 157, 159, 161, 165, 167, 169, 171, 173, 175, 176, 177, 178, 179, 180, 186, 188, 190, 192, 194, 196, 197, 198, 199, and 203.

[0072] In some embodiments of this disclosure, the antisense strand in the siRNA is associated with SEQ ID NO: 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 30, 36, 60, 66, 68, 92, 94, 96, 98, 100, 102, 104, 106, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137. The difference between any of the following is that they contain no more than two nucleotides: 139, 141, 143, 145, 155, 157, 159, 161, 165, 167, 169, 171, 173, 175, 176, 177, 178, 179, 180, 186, 188, 190, 192, 194, 196, 197, 198, 199, and 203.

[0073] In some embodiments of this disclosure, the antisense strand in the siRNA is associated with SEQ ID NO: 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 30, 36, 60, 66, 68, 92, 94, 96, 98, 100, 102, 104, 106, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137. The difference between any of the following is that they contain no more than one nucleotide: 139, 141, 143, 145, 155, 157, 159, 161, 165, 167, 169, 171, 173, 175, 176, 177, 178, 179, 180, 186, 188, 190, 192, 194, 196, 197, 198, 199, and 203.

[0074] In some embodiments of this disclosure, the antisense strand in the siRNA is any one of the antisense strands shown in Table 1.

[0075] In some embodiments of this disclosure, the antisense strand in the siRNA is SEQ ID NO: 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 30, 36, 60, 66, 68, 92, 94, 96, 98, 100, 102, 104, 106, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 13 5, 137, 139, 141, 143, 145, 155, 157, 159, 161, 165, 167, 169, 171, 173, 175, 176, 177, 178, 179, 180, 186, 188, 190, 192, 194, 196, 197, 198, 199, 203 any one of the antisense chains.

[0076] [Table 1] Unmodified siRNA sequences that suppress AGT gene expression 5'-sense-3' (Chain of Justice sequence) Serial Number 5'-antisense-3' (antisense sequence) Serial Number ACCGACCAGCUUGUUUGUGAA SEQ ID NO: 5 UUCACAAACAAGCUGGUCGGUUG SEQ ID NO: 6 CCAGCUUGUUUGUGAAACAAA SEQ ID NO: 7 UUUGUUUCACAAACAAGCUGGUC SEQ ID NO: 8 GACCAGCUUGUUUGUGAAACA SEQ ID NO: 9 UGUUUCACAAACAAGCUGGUCGG SEQ ID NO: 10 AGUGUUCCCUUUUCAAGUUGA SEQ ID NO: 11 STORMAAAGGGASTORM SEQ ID NO: 12 ACCAGCAUCACACA SEQ ID NO: 29 UPDATECAAGCUGGUCG SEQ ID NO: 30 GAGGUGCUUUUUU SEQ ID NO: 13 AAAAAUGCUCCUCCC SEQ ID NO: 14 AACAAAAAAGUCCCUUUUU SEQ ID NO: 15 AAAAGGGACAUUUUUUUUUUUUUH SEQ ID NO: 16 AACCGACCAGCOUG SEQ ID NO: 17 UCACAAACAAGCUGGUCGGUUGG SEQ ID NO: 18 CURRENT SEQ ID NO: 19 UGACASUAMSUMMERSUMMER SEQ ID NO: 20 SAVEAAAAAAAAAAAA SEQ ID NO: 21 UUUUUUUUCAAACAAGCUGG SEQ ID NO: 22 REVIEW SEQ ID NO: 35 UUAGAAAAAGGUGGGACUG SEQ ID NO: 36 CUCKUUUCUCUAUGA SEQ ID NO: 23 UCAUUAGAAGAAAAGGUGGGAGA SEQ ID NO: 24 CACCUUUUCUUCUAAUGAGUU SEQ ID NO:59 AACUCAUUAGAAGAAAAGGUGG SEQ ID NO: 60 CUCCUUUUCUUCUAAUGAGUU SEQ ID NO: 65 AACUCAUUAGAAGAAAAAGGAGGGG SEQ ID NO:66 CAGCUUUUCUUCUAAUGAGUU SEQ ID NO: 67 AACUCAUUAGAAGAAAAGCUGGG SEQ ID NO: 68 CACCUUUUCUUCUAAUGAGUA SEQ ID NO: 91 UACUCAUUAGAAGAAAAGGUGGG SEQ ID NO: 92 CGCCUUUUCUUCUAAUGAGUA SEQ ID NO: 93 UACUCAUUAGAAGAAAAAGGCGGG SEQ ID NO: 94 CUCCCACCUUUUCUUCUAAUGAGUA SEQ ID NO: 95 UACUCAUUAGAAGAAAAGGUGGAGAC SEQ ID NO: 96 UCCCACCUUUUCUUCUAAUGAGUA SEQ ID NO: 97 UACUCAUUAGAAGAAAAGGUGGGAGA SEQ ID NO: 98 CCCACCUUUUCUUCUAAUGAGUA SEQ ID NO: 99 UACUCAUUAGAAGAAAAGGUGGAG SEQ ID NO:100 CCACCUUUUCUUCUAAUGAGUA SEQ ID NO: 101 UACUCAUUAGAAGAAAAGGUGGGA SEQ ID NO: 102 ACCUUUUCUUCUAAUGAGUA SEQ ID NO: 103 UACUCAUUAGAAGAAAAGGUGG SEQ ID NO: 104 CCUUUUCUUCUAAUGAGUA SEQ ID NO: 105 UACUCAUUAGAAGAAAAGGUG SEQ ID NO: 106 UUUCUUCUAAAUGAGUA SEQ ID NO: 107 UACUCAUUAGAAGAAAAGGUG SEQ ID NO: 106 UUUUCUUCUAAUGAGUA SEQ ID NO: 108 UACUCAUUAGAAGAAAAGGUG SEQ ID NO: 106 UUUUCUUCUAAUGAGUA SEQ ID NO: 108 UACUCAUUAGAAGAAAAGGUGGG SEQ ID NO: 109 CUUUUCUUCUAAUGAGUA SEQ ID NO: 110 UACUCAUUAGAAGAAAAGGUGGG SEQ ID NO: 109 CCUUUUCUUCUAAUGAGUA SEQ ID NO: 105 UACUCAUUAGAAGAAAAGGUGGG SEQ ID NO: 109 UUUCUUCUAAAUGAGUA SEQ ID NO:107 UACUCAUUAGAAGAAAAGG SEQ ID NO: 111 UUUUCUUCUAAUGAGUA SEQ ID NO: 108 UACUCAUUAGAAGAAAAGG SEQ ID NO: 111 CUCCUUUUCUUCUAAUGAGUA SEQ ID NO: 112 UACUCAUUAGAAGAAAAGGAGGGG SEQ ID NO: 113 UCCUUUUCUUCUAAUGAGUA SEQ ID NO: 114 UACUCAUUAGAAGAAAAGGAGG SEQ ID NO: 115 AGCUUUUCUUCUAAUGAGUA SEQ ID NO: 116 UACUCAUUAGAAGAAAAGCUGG SEQ ID NO: 117 ACGUUUUCUUCUAAUGAGUA SEQ ID NO: 118 UACUCAUUAGAAGAAAACGUGG SEQ ID NO: 119 GCCUUUUCUUCUAAUGAGUA SEQ ID NO: 120 UACUCAUUAGAAGAAAAGGCGG SEQ ID NO: 121 GCACCUUUUCUUCUAAUGAGUA SEQ ID NO: 122 UACUCAUUAGAAGAAAAAGGUGCGA SEQ ID NO: 123 CGACCUUUUCUUCUAAUGAGUA SEQ ID NO: 124 UACUCAUUAGAAGAAAAGGUCGGA SEQ ID NO: 125 CCUCCUUUUCUUCUAAUGAGUA SEQ ID NO: 126 UACUCAUUAGAAGAAAAGGAGGGA SEQ ID NO: 127 CCGCCUUUUCUUCUAAUGAGUA SEQ ID NO: 128 UACUCAUUAGAAGAAAAAGGCGGGA SEQ ID NO: 129 CAGCUUUUCUUCUAAUGAGUA SEQ ID NO: 130 UACUCAUUAGAAGAAAAGCUGGG SEQ ID NO: 131 UGCCACCUUUUCUUCUAAUGA SEQ ID NO: 132 UCAUUAGAAGAAAAAGGUGGCAGA SEQ ID NO: 133 UCGCACCUUUUCUUCUAAUGA SEQ ID NO: 134 UCAUUAGAAGAAAAGGUGCGAGA SEQ ID NO: 135 GACCUUUUCUUCUAAUGAGUA SEQ ID NO: 136 UACUCAUUAGAAGAAAAGGUCGG SEQ ID NO: 137 CACGUUUUCUUCUAAUGAGUA SEQ ID NO: 138 UACUCAUUAGAAGAAAACGUGGG SEQ ID NO: 139 CACCAUUUCUUCUAAUGAGUA SEQ ID NO: 140 UACUCAUUAGAAGAAAUGGUGGG SEQ ID NO: 141 CACCUAUUCUUCUAAUGAGUA SEQ ID NO: 142 UACUCAUUAGAAGAAUAGGUGGG SEQ ID NO: 143

[0077] In some embodiments of this disclosure, there are at most three mismatches between the sense and antisense strands in the siRNA.

[0078] In some embodiments of this disclosure, there are at most two mismatches between the sense and antisense strands in the siRNA.

[0079] In some embodiments of this disclosure, the sense and antisense strands of the siRNA may have at most one mismatch.

[0080] In some embodiments of this disclosure, there is no mismatch between the sense and antisense strands in the siRNA.

[0081] In some embodiments of this disclosure, the antisense strand of the siRNA has at most three mismatches with the target sequence (as shown in SEQ ID NO:1).

[0082] In some embodiments of this disclosure, the antisense strand of the siRNA has at most two mismatches with the target sequence.

[0083] In some embodiments of this disclosure, the antisense strand of the siRNA has at most one mismatch with the target sequence.

[0084] In some embodiments of this disclosure, the nucleotides at positions 16 to 23 in the 5' to 3' direction of the siRNA antisense strand have at most one mismatch with the target sequence.

[0085] In some embodiments of this disclosure, the nucleotide at position 16 in the 5' to 3' direction of the siRNA antisense strand is mismatched with the target sequence.

[0086] In some embodiments of this disclosure, the nucleotide at position 17 in the 5' to 3' direction of the siRNA antisense strand is mismatched with the target sequence.

[0087] In some embodiments of this disclosure, the nucleotide at position 18 in the 5' to 3' direction of the siRNA antisense strand is mismatched with the target sequence.

[0088] In some embodiments of this disclosure, the nucleotide at position 19 in the 5' to 3' direction of the siRNA antisense strand is mismatched with the target sequence.

[0089] In some embodiments of this disclosure, the nucleotide at position 20 in the 5' to 3' direction of the siRNA antisense strand is mismatched with the target sequence.

[0090] In some embodiments of this disclosure, the nucleotide at position 21 of the siRNA antisense strand in the 5' to 3' direction is mismatched with the target sequence.

[0091] In some embodiments of this disclosure, the nucleotide at position 22 in the 5' to 3' direction of the antisense strand is mismatched with the target sequence.

[0092] In some embodiments of this disclosure, the nucleotide at position 23 in the 5' to 3' direction of the antisense strand is mismatched with the target sequence.

[0093] In some embodiments of this disclosure, the antisense strand of the siRNA has at least one mismatch with the target sequence.

[0094] In some embodiments of this disclosure, the antisense strand of the siRNA has at most three mismatches with the target sequence.

[0095] In some embodiments of this disclosure, the nucleotides at positions 16 to 21 of the siRNA antisense strand in the 5' to 3' direction have at most one mismatch with the target sequence.

[0096] In some embodiments of this disclosure, the nucleotides at positions 16 to 22 in the 5' to 3' direction of the siRNA antisense strand have at most three mismatches with the target sequence.

[0097] In some embodiments of this disclosure, two nucleotides at positions 16 to 21 of the siRNA antisense strand in the 5' to 3' direction may optionally be mismatched with the target sequence.

[0098] In some embodiments of this disclosure, three nucleotides at positions 16 to 21 of the siRNA antisense strand in the 5' to 3' direction may optionally be mismatched with the target sequence.

[0099] In some embodiments of this disclosure, two nucleotides at positions 19, 20, and 21 in the 5' to 3' direction of the siRNA antisense strand may be selected to mismatch with the target sequence.

[0100] In some embodiments of this disclosure, the nucleotides at positions 19 and 21 in the 5' to 3' direction of the siRNA antisense strand are mismatched with the target sequence.

[0101] In some embodiments of this disclosure, the nucleotides at positions 19 and 20 of the siRNA antisense strand in the 5' to 3' direction are mismatched with the target sequence.

[0102] In some embodiments of this disclosure, the nucleotides at positions 20 and 21 of the siRNA antisense strand in the 5' to 3' direction are mismatched with the target sequence.

[0103] In some embodiments of this disclosure, the nucleotides at positions 19, 20, and 21 in the 5' to 3' direction of the siRNA antisense strand are all mismatched with the target sequence.

[0104] In some embodiments of this disclosure, the siRNA antisense strand and the target sequence have mismatched sites, and the nucleotides of the antisense strand and the target sequence are identical.

[0105] In some embodiments of this disclosure, there are mismatched sites between the siRNA antisense strand and the target sequence, where the nucleotides of the target sequence and the siRNA sense strand are complementary.

[0106] In some embodiments of this disclosure, at sites in the siRNA antisense strand where there is a mismatch with the target sequence, the nucleotides of the antisense and sense strands are interchanged.

[0107] In some embodiments of this disclosure, at sites in the siRNA antisense strand where there is a mismatch with the target sequence, the nucleotides of the antisense and sense strands are complementary.

[0108] In some embodiments of this disclosure, at sites in the siRNA antisense strand where there is a mismatch with the target sequence, the nucleotides of the antisense and sense strands are interchanged, and the nucleotides of the antisense and sense strands are complementary.

[0109] In some embodiments of this disclosure, the nucleotide at position 16 in the 5' to 3' direction of the antisense strand is mismatched with the target sequence. At the mismatch site between the antisense strand and the target sequence, the nucleotides of the antisense strand and the target sequence are identical, and the nucleotides of the antisense strand and the sense strand are complementary.

[0110] In some embodiments of this disclosure, the nucleotide at position 17 in the 5' to 3' direction of the antisense strand is mismatched with the target sequence. At the mismatch site between the antisense strand and the target sequence, the nucleotides of the antisense strand and the target sequence are identical, and the nucleotides of the antisense strand and the sense strand are complementary.

[0111] In some embodiments of this disclosure, the nucleotide at position 18 in the 5' to 3' direction of the antisense strand is mismatched with the target sequence. At the mismatch site between the antisense strand and the target sequence, the nucleotides of the antisense strand and the target sequence are identical, and the nucleotides of the antisense strand and the sense strand are complementary.

[0112] In some embodiments of this disclosure, the nucleotide at position 19 in the 5' to 3' direction of the antisense strand is mismatched with the target sequence. At the mismatch site between the antisense strand and the target sequence, the nucleotides of the antisense strand and the target sequence are identical, and the nucleotides of the antisense strand and the sense strand are complementary.

[0113] In some embodiments of this disclosure, the nucleotide at position 20 in the 5' to 3' direction of the antisense strand is mismatched with the target sequence. At the mismatch site between the antisense strand and the target sequence, the nucleotides of the antisense strand and the target sequence are identical, and the nucleotides of the antisense strand and the sense strand are complementary.

[0114] In some embodiments of this disclosure, the nucleotide at position 21 in the 5' to 3' direction of the antisense strand is mismatched with the target sequence. At the mismatch site between the antisense strand and the target sequence, the nucleotides of the antisense strand and the target sequence are identical, and the nucleotides of the antisense strand and the sense strand are complementary.

[0115] In some embodiments of this disclosure, the nucleotide at position 22 in the 5' to 3' direction of the antisense strand is mismatched with the target sequence. At the mismatch site between the antisense strand and the target sequence, the nucleotides of the antisense strand and the target sequence are identical, and the nucleotides of the antisense strand and the sense strand are complementary.

[0116] In some embodiments of this disclosure, the nucleotide at position 23 in the 5' to 3' direction of the antisense strand is mismatched with the target sequence. At the mismatch site between the antisense strand and the target sequence, the nucleotides of the antisense strand and the target sequence are identical, and the nucleotides of the antisense strand and the sense strand are complementary.

[0117] In some embodiments of this disclosure, the antisense strand in the siRNA does not mismatch with the target sequence.

[0118] It is known to those skilled in the art that mismatches are permissible for the activity of siRNAs. The methods described herein and / or methods known in the art can be used to determine whether AGT siRNAs containing mismatches effectively inhibit the expression of the AGT gene.

[0119] In some embodiments of this disclosure, the unmodified duplex of siRNA is selected from duplexes composed of the sense and antisense strand sequences in the same row of Table 1.

[0120] In some embodiments of this disclosure, the unmodified double-stranded siRNA is selected from the double-stranded siRNAs composed of SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 29 and SEQ ID NO: 30, SEQ ID NO: 3 ...29 and SEQ ID NO: 30, SEQ ID NO: 35 and SEQ ID NO: 6, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO: 19 and SEQ The following double strands are listed: SEQ ID NO: 36, SEQ ID NO: 59 and SEQ ID NO: 60, SEQ ID NO: 65 and SEQ ID NO: 66, SEQ ID NO: 67 and SEQ ID NO: 68, SEQ ID NO: 91 and SEQ ID NO: 92, SEQ ID NO: 93 and SEQ ID NO: 94, SEQ ID NO: 95 and SEQ ID NO: 96, SEQ ID NO: 97 and SEQ ID NO: 98, SEQ ID NO: 99 and SEQ ID NO: 100, SEQ ID NO: 101 and SEQ ID NO: 102, SEQ ID NO: 103 and SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106, SEQ ID NO: 107 and SEQ ID NO: 108. The double strand composed of SEQ ID NO: 106, SEQ ID NO: 108 and SEQ ID NO: 106, SEQ ID NO: 108 and SEQ ID NO: 109, SEQ ID NO: 110 and SEQ ID NO: 109, SEQ ID NO: 105 and SEQ ID NO: 109, SEQ ID NO:The following double strands are listed: SEQ ID NO: 107 and SEQ ID NO: 111; SEQ ID NO: 108 and SEQ ID NO: 111; SEQ ID NO: 112 and SEQ ID NO: 113; SEQ ID NO: 114 and SEQ ID NO: 115; SEQ ID NO: 116 and SEQ ID NO: 117; SEQ ID NO: 118 and SEQ ID NO: 119; SEQ ID NO: 120 and SEQ ID NO: 121; SEQ ID NO: 122 and SEQ ID NO: 123; SEQ ID NO: 124 and SEQ ID NO: 125; SEQ ID NO: 126 and SEQ ID NO: 127; SEQ ID NO: 128 and SEQ ID NO: 129; SEQ ID NO: The double strands composed of SEQ ID NO: 130 and SEQ ID NO: 131, SEQ ID NO: 132 and SEQ ID NO: 133, SEQ ID NO: 134 and SEQ ID NO: 135, SEQ ID NO: 136 and SEQ ID NO: 137, SEQ ID NO: 138 and SEQ ID NO: 139, SEQ ID NO: 140 and SEQ ID NO: 141, and SEQ ID NO: 142 and SEQ ID NO: 143.

[0121] In some embodiments of this disclosure, the unmodified double-stranded siRNA is selected from the double-stranded siRNAs composed of SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 29 and SEQ ID NO: 30, SEQ ID NO: 3 ...29 and SEQ ID NO: 30, SEQ ID NO: 35 and SEQ ID NO: 6, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO: 19 and SEQ The following double strands are listed: SEQ ID NO: 36, SEQ ID NO: 59 and SEQ ID NO: 60, SEQ ID NO: 65 and SEQ ID NO: 66, SEQ ID NO: 67 and SEQ ID NO: 68, SEQ ID NO: 91 and SEQ ID NO: 92, SEQ ID NO: 93 and SEQ ID NO: 94, SEQ ID NO: 95 and SEQ ID NO: 96, SEQ ID NO: 97 and SEQ ID NO: 98, SEQ ID NO: 99 and SEQ ID NO: 100, SEQ ID NO: 101 and SEQ ID NO: 102, SEQ ID NO: 103 and SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106, SEQ ID NO: 107 and SEQ ID NO: 108. The double strand composed of SEQ ID NO: 106, SEQ ID NO: 108 and SEQ ID NO: 106, SEQ ID NO: 108 and SEQ ID NO: 109, SEQ ID NO: 110 and SEQ ID NO: 109, SEQ ID NO: 105 and SEQ ID NO: 109, SEQ ID NO:The following double strands are listed: SEQ ID NO: 107 and SEQ ID NO: 111; SEQ ID NO: 108 and SEQ ID NO: 111; SEQ ID NO: 112 and SEQ ID NO: 113; SEQ ID NO: 114 and SEQ ID NO: 115; SEQ ID NO: 116 and SEQ ID NO: 117; SEQ ID NO: 118 and SEQ ID NO: 119; SEQ ID NO: 120 and SEQ ID NO: 121; SEQ ID NO: 122 and SEQ ID NO: 123; SEQ ID NO: 126 and SEQ ID NO: 127; SEQ ID NO: 128 and SEQ ID NO: 129; SEQ ID NO: 130 and SEQ ID NO: 131; SEQ ID NO: A double strand composed of SEQ ID NO: 132 and SEQ ID NO: 133, and a double strand composed of SEQ ID NO: 134 and SEQ ID NO: 135.

[0122] In some embodiments of this disclosure, the unmodified double-stranded siRNA is selected from the double-stranded siRNAs composed of SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 29 and SEQ ID NO: 30, SEQ ID NO: 3 ...29 and SEQ ID NO: 30, SEQ ID NO: 35 and SEQ ID NO: 6, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO: 19 and SEQ The following double strands are listed: SEQ ID NO: 36, SEQ ID NO: 59 and SEQ ID NO: 60, SEQ ID NO: 65 and SEQ ID NO: 66, SEQ ID NO: 67 and SEQ ID NO: 68, SEQ ID NO: 91 and SEQ ID NO: 92, SEQ ID NO: 93 and SEQ ID NO: 94, SEQ ID NO: 95 and SEQ ID NO: 96, SEQ ID NO: 97 and SEQ ID NO: 98, SEQ ID NO: 99 and SEQ ID NO: 100, SEQ ID NO: 101 and SEQ ID NO: 102, SEQ ID NO: 103 and SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106, SEQ ID NO: 107 and SEQ ID NO: 108. The double strand composed of SEQ ID NO: 106, the double strand composed of SEQ ID NO: 108 and SEQ ID NO: 106, the double strand composed of SEQ ID NO: 108 and SEQ ID NO: 109, the double strand composed of SEQ ID NO: 110 and SEQ ID NO: 109, the double strand composed of SEQ ID NO: 105 and SEQ ID NO: 109, and the double strand composed of SEQ ID NO: 106.The double strands composed of SEQ ID NO: 107 and SEQ ID NO: 111, SEQ ID NO: 108 and SEQ ID NO: 111, SEQ ID NO: 112 and SEQ ID NO: 113, SEQ ID NO: 114 and SEQ ID NO: 115, SEQ ID NO: 116 and SEQ ID NO: 117, SEQ ID NO: 118 and SEQ ID NO: 119, SEQ ID NO: 120 and SEQ ID NO: 121, SEQ ID NO: 122 and SEQ ID NO: 123, SEQ ID NO: 126 and SEQ ID NO: 127, SEQ ID NO: 128 and SEQ ID NO: 129, SEQ ID NO: 130 and SEQ ID NO: 131, SEQ ID NO: 132 ...27 and SEQ ID NO: 128 and SEQ ID NO: 129, SEQ ID NO: 130 and SEQ ID NO: The double strands consisting of SEQ ID NO: 133, SEQ ID NO: 134 and SEQ ID NO: 135, SEQ ID NO: 136 and SEQ ID NO: 137, SEQ ID NO: 138 and SEQ ID NO: 139, SEQ ID NO: 140 and SEQ ID NO: 141, and SEQ ID NO: 142 and SEQ ID NO: 143.

[0123] In some embodiments of this disclosure, the unmodified double strand of siRNA is selected from at least one of double strand 1 to double strand 10, double strand 13, double strand 16, and double strand 21 to double strand 27.

[0124] Double chain 1

[0125] Chain of Justice: 5'-ACCGACCAGCUUGUUUGUGAA-3' (SEQ ID NO: 5)

[0126] Antonym: 5'-UUCACAAACAAGCUGGUCGGUUG-3' (SEQ ID NO: 6);

[0127] Double strand 2

[0128] Chain of Justice: 5'-CCAGCUUGUUUGUGAAACAAA-3' (SEQ ID NO: 7)

[0129] Antisense chain: 5'-UUUGUUUCACAAACAAGCUGGUC-3' (SEQ ID NO: 8);

[0130] Double strand 3

[0131] Chain of Justice: 5'-GACCAGCUUGUUUGUGAAACA-3' (SEQ ID NO: 9)

[0132] Antonym: 5'-UGUUUCACAAACAAGCUGGUCGG-3' (SEQ ID NO: 10);

[0133] Double strand 4

[0134] Chain of Justice: 5'-AGUGUUCCCUUUUCAAGUUGA-3' (SEQ ID NO: 11)

[0135] Antisense chain: 5'-UCAACUUGAAAAGGGAACACUUU-3' (SEQ ID NO: 12);

[0136] Double strand 5

[0137] Justice Chain: 5'-GAGGUGCUGAACAGCAUUUUU-3' (SEQ ID NO: 13)

[0138] Antisense chain: 5'-AAAAAUGCUGUUCAGCACCUCCC-3' (SEQ ID NO: 14);

[0139] Double chain 6

[0140] Chain of Justice: 5'-AACAAAAAAGUGUUCCCUUUU-3' (SEQ ID NO: 15)

[0141] Antisense chain: 5'-AAAAGGGAACACUUUUUUGUUUC-3' (SEQ ID NO: 16);

[0142] Double chain 7

[0143] Chain of Justice: 5'-AACCGACCAGCUUGUUUGUGA-3' (SEQ ID NO: 17)

[0144] Antisense chain: 5'-UCACAAACAAGCUGGUCGGUUGG-3' (SEQ ID NO: 18);

[0145] Double chain 8

[0146] Chain of Justice: 5'-CCUGUUUGCUGUGUAUGAUCA-3' (SEQ ID NO: 19)

[0147] Antonym: 5'-UGAUCAUACACAGCAAACAGGAA-3' (SEQ ID NO: 20);

[0148] Double chain 9

[0149] Chain of Justice: 5'-AGCUUGUUUGUGAAACAAAAA-3' (SEQ ID NO: 21)

[0150] Antisense chain: 5'-UUUUUGUUUCACAAACAAGCUGG-3' (SEQ ID NO: 22);

[0151] Double chain 10

[0152] Chain of Justice: 5'-UCCCACCUUUUCUUCUAAUGA-3' (SEQ ID NO: 23)

[0153] Antonym: 5'-UCAUUAGAAGAAAAGGUGGGAGA-3' (SEQ ID NO: 24);

[0154] Double chain 13

[0155] Chain of Justice: 5'-ACCAGCUUGUUUGUGAAACAA-3' (SEQ ID NO: 29)

[0156] Antisense chain: 5'-UUGUUUCACAAACAAGCUGGUCG-3' (SEQ ID NO: 30);

[0157] Double chain 16

[0158] Chain of Justice: 5'-GUCUCCCACCUUUUCUUCUAA-3' (SEQ ID NO: 35)

[0159] Antonym: 5'-UUAGAAGAAAAGGUGGGAGACUG-3' (SEQ ID NO: 36);

[0160] Double chain 21

[0161] Chain of Justice: 5'-CACCUUUUCUUCUAAUGAGUU-3' (SEQ ID NO:59)

[0162] Antonym: 5'-AACUCAUUAGAAGAAAAGGUGGG-3' (SEQ ID NO: 60);

[0163] Double chain 22

[0164] Chain of Justice: 5'-CUCCUUUUCUUCUAAUGAGUU-3' (SEQ ID NO: 65)

[0165] Antisense chain: 5'-AACUCAUUAGAAGAAAAGGAGGG-3' (SEQ ID NO: 66);

[0166] Double chain 23

[0167] Chain of Justice: 5'-CAGCUUUUCUUCUAAUGAGUU-3' (SEQ ID NO: 67)

[0168] Antonym: 5'-AACUCAUUAGAAGAAAAGCUGGG-3' (SEQ ID NO: 68).

[0169] Double chain 24

[0170] Chain of Justice: 5'-CACCUUUUCUUCUAAUGAGUA-3' (SEQ ID NO: 91)

[0171] Antisense chain: 5'-UACUCAUUAGAAGAAAAGGUGGG-3' (SEQ ID NO: 92);

[0172] Double chain 25

[0173] Chain of Justice: 5'-CGCCUUUUCUUCUAAUGAGUA-3' (SEQ ID NO: 93)

[0174] Antisense chain: 5'-UACUCAUUAGAAGAAAAGGCGGG-3' (SEQ ID NO: 94);

[0175] Double chain 26

[0176] Chain of Justice: 5'-CUCCUUUUCUUCUAAUGAGUA-3'(SEQ ID NO: 112)

[0177] Antisense chain: 5'-UACUCAUUAGAAGAAAAGGAGGG-3' (SEQ ID NO: 113);

[0178] Double chain 27

[0179] Chain of Justice: 5'-ACCUUUUCUUCUAAUGAGUA-3' (SEQ ID NO: 103)

[0180] Antonym: 5'-UACUCAUUAGAAGAAAAGGUGG-3' (SEQ ID NO: 104).

[0181] In some embodiments of this disclosure, the unmodified double strand of siRNA is a double strand that differs from any one of double strands 1 to 10, 13, 16, 21 to 27 by no more than 2 nucleotides.

[0182] In some embodiments of this disclosure, the unmodified double strand of siRNA differs from double strand 21 by no more than 2 nucleotides.

[0183] In some embodiments of this disclosure, the unmodified double strand of siRNA differs from double strand 24 by no more than 2 nucleotides.

[0184] In some embodiments of this disclosure, the difference between the unmodified double strand of siRNA and double strand 24 is 2 nucleotides.

[0185] In some embodiments of this disclosure, the difference between the sense strand of the unmodified double-stranded siRNA and the sense strand of double-stranded 24 is no more than 1 nucleotide, and the difference between the antisense strand of the unmodified double-stranded siRNA and the antisense strand of double-stranded 24 is no more than 1 nucleotide.

[0186] In some embodiments of this disclosure, the difference between the sense strand of the unmodified double strand of siRNA and the sense strand of double strand 24 is one nucleotide, and the difference is located at positions 1 to 3 in the direction from the 5' end to the 3' end of the sense strand. The difference between the antisense strand of the unmodified double strand of siRNA and the antisense strand of double strand 24 is one nucleotide, and the difference is located at positions 19 to 21 in the direction from the 5' end to the 3' end of the antisense strand.

[0187] In some embodiments of this disclosure, the difference between the sense strand of the unmodified double strand of siRNA and the sense strand of double strand 24 is located at the nucleotide position 1 in the direction from the 5' end to the 3' end of the sense strand, and the difference between the antisense strand of the unmodified double strand of siRNA and the antisense strand of double strand 24 is located at the nucleotide position 21 in the direction from the 5' end to the 3' end of the antisense strand.

[0188] In some embodiments of this disclosure, the difference between the sense strand of the unmodified double-stranded siRNA and the sense strand of double-stranded 24 is located at the nucleotide position 2 in the direction from the 5' end to the 3' end of the sense strand, and the difference between the antisense strand of the unmodified double-stranded siRNA and the antisense strand of double-stranded 24 is located at the nucleotide position 20 in the direction from the 5' end to the 3' end of the antisense strand.

[0189] In some embodiments of this disclosure, the difference between the sense strand of the unmodified double-stranded siRNA and the sense strand of double-stranded 24 is located at the 3rd nucleotide position in the direction from the 5' end to the 3' end of the sense strand, and the difference between the antisense strand of the unmodified double-stranded siRNA and the antisense strand of double-stranded 24 is located at the 19th nucleotide position in the direction from the 5' end to the 3' end of the antisense strand.

[0190] In some embodiments of this disclosure, the difference between the sense strand of the unmodified double-stranded siRNA and the sense strand of double-stranded 24 is located at the nucleotide position 2 in the 5' to 3' direction of the sense strand, and the difference between the antisense strand of the unmodified double-stranded siRNA and the antisense strand of double-stranded 24 is located at the nucleotide position 20 in the 5' to 3' direction of the antisense strand. The nucleotide position 2 in the 5' to 3' direction of the sense strand of the unmodified double-stranded siRNA and the nucleotide position 20 in the 5' to 3' direction of the antisense strand are complementary.

[0191] In some embodiments of this disclosure, the siRNA may also contain modified nucleotides or nucleotide analogs as needed, wherein the modified nucleotides or nucleotide analogs do not cause a significant weakening or loss of the siRNA's function in inhibiting AGT gene expression. Currently, there are various ways in the art to modify siRNA, including, for example, backbone modification (such as phosphate group modification), ribose group modification, and base modification (Watts, JK, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55).

[0192] In some embodiments of this disclosure, at least one nucleotide in the sense or antisense strand of the siRNA is a modified nucleotide. For example, the modified nucleotide may include a ribose group and optionally a phosphate group, but is not limited thereto. In some preferred embodiments of this disclosure, the modified nucleotide is a nucleotide modified at the 2' position of its ribose, for example, a nucleotide with the following 2' position modifications: 2'-deoxy, 2'-fluoro, 2'-amino, 2'-methyl, 2'-ethyl, 2'-methyl-O-methyl, 2'-ethyl-O-methyl, 2'-O-methyl (2'-OMe), 2'-O-ethyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-methoxyethyl (2'-MOE), 2'-O-ethyl-O-methyl, or 2'-O-allyl.

[0193] In some embodiments of this disclosure, at least one nucleotide in the positive strand of the siRNA is a modified nucleotide.

[0194] In some embodiments of this disclosure, all nucleotides in the sense strand of the siRNA are modified nucleotides.

[0195] In some embodiments of this disclosure, at least one nucleotide in the antisense strand of the siRNA is a modified nucleotide.

[0196] In some embodiments of this disclosure, all nucleotides in the antisense strand of the siRNA are modified nucleotides.

[0197] In some embodiments of this disclosure, the modified nucleotide is selected from at least one of 2'-methoxynucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'-methoxyethylnucleotide, 2'-aminonucleotide, 2'-alkylnucleotide, and 3'-methoxynucleotide, but this disclosure is not limited thereto.

[0198] In some embodiments of this disclosure, the modified nucleotide is selected from 2'-methoxynucleotides and 2'-fluoronucleotides.

[0199] In some embodiments of this disclosure, the modified nucleotide is a phosphate analog modified nucleotide. In some embodiments of this disclosure, the phosphate analog modified nucleotide may include (E)-vinyl phosphate ((E)-VP) modified nucleotides, (Z)-vinyl phosphate ((Z)-VP) modified nucleotides, phosphate thiophosphate modified (Ps) nucleotides, Sp-configured phosphate thiophosphate modified nucleotides, Rp-configured phosphate thiophosphate modified nucleotides (Anastasia Khvorova, Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotichnology, 2017, 35(3): p. 238-248), or methanesulfonylaminophosphate modified (MsPA) nucleotides, etc.

[0200] In some embodiments of this disclosure, the nucleotide analogue refers to a group capable of replacing a nucleotide in a nucleic acid, but whose base structure differs from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments of this disclosure, these nucleotide analogues may include locked nucleic acids (LNA), unlocked nucleic acids (UNA), or glycerol nucleic acids (GNA).

[0201] In this disclosure, unless otherwise specified, each nucleotide may have more than one modification at the same time. For example, a nucleotide may be a nucleotide modified with both 2'-fluoronucleotide and (E)-vinyl phosphate ((E)-VP).

[0202] The inventors of this disclosure have discovered that the preferred siRNA exhibits surprising stability and gene silencing efficiency, as well as satisfactory cytotoxicity and immunostimulatory activity in animal experiments.

[0203] In some embodiments of this disclosure, all nucleotides in the sense and / or antisense strands of the siRNA are modified nucleotides or nucleotide analogs.

[0204] In some embodiments of this disclosure, each nucleotide in the sense and antisense strands of the siRNA may be independently a 2'-methoxynucleotide, a 2'-fluoronucleotide, or a 2'-deoxynucleotide.

[0205] In some embodiments of this disclosure, the positive strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21, in the direction from the 3' end to the 5' end of the positive strand, and the nucleotides at positions 11, 12, and 13 are all 2'-fluoronucleotides.

[0206] In some embodiments of this disclosure, the positive strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from the 1st, 3rd, 5th, 7th, 9th, 11th, 12th, 13th, 15th, 17th, 19th, or optionally the 21st position in the 3' to 5' direction of the positive strand, and the nucleotides at positions 9, 11th, 12th and 13th are all 2'-fluoronucleotides.

[0207] In some embodiments of this disclosure, the positive strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from the 1st, 3rd, 5th, 7th, 9th, 11th, 12th, 13th, 15th, 17th, 19th, or optionally the 21st position in the direction from the 3' end to the 5' end of the positive strand, and the nucleotides at positions 5, 11th, 12th, and 13th are all 2'-fluoronucleotides.

[0208] In some embodiments of this disclosure, the positive strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21, in the direction from the 3' end to the 5' end of the positive strand, and the nucleotides at positions 1, 11, 12, and 13 are all 2'-fluoronucleotides.

[0209] In some embodiments of this disclosure, the positive strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21, in the direction from the 3' end to the 5' end of the positive strand, and the nucleotides at positions 1, 5, 11, 12, and 13 are all 2'-fluoronucleotides.

[0210] In some embodiments of this disclosure, the positive strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21, in the direction from the 3' end to the 5' end of the positive strand, and the nucleotides at positions 1, 9, 11, 12, and 13 are all 2'-fluoronucleotides.

[0211] In some embodiments of this disclosure, the positive strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21, in the direction from the 3' end to the 5' end of the positive strand, and the nucleotides at positions 5, 9, 11, 12, and 13 are all 2'-fluoronucleotides.

[0212] In some embodiments of this disclosure, the positive strand has six nucleotides that are 2'-fluoronucleotides, and the six 2'-fluoronucleotides are located at positions 1, 5, 9, 11, 12 and 13 in the direction from the 3' end to the 5' end of the positive strand.

[0213] In some embodiments of this disclosure, the positive strand has six nucleotides that are 2'-fluoronucleotides, located at positions 5, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand.

[0214] In some embodiments of this disclosure, the positive strand has five nucleotides that are 2'-fluoronucleotides, located at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand.

[0215] In some embodiments of this disclosure, the antisense strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from positions 2, 4, 6, 8, 10, 14, 16, 18, 20, or optionally 22 in the direction from the 5' end to the 3' end of the antisense strand, and the nucleotides at positions 2, 6, 14, and 16 are all 2'-fluoronucleotides.

[0216] In some embodiments of this disclosure, the antisense strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from positions 2, 4, 6, 8, 10, 14, 16, 18, 20, or optionally 22 in the 5' to 3' direction of the antisense strand, and the nucleotides at positions 2, 6, 14, 16, and optionally 22 are all 2'-fluoronucleotides.

[0217] In some embodiments of this disclosure, the antisense strand has five nucleotides that are 2'-fluoronucleotides, which are selected from positions 2, 4, 6, 8, 10, 14, 16, 18, 20, or optionally 22 in the direction from the 5' end to the 3' end of the antisense strand, and the nucleotides at positions 2, 6, 14, and 16 are all 2'-fluoronucleotides.

[0218] In some embodiments of this disclosure, the antisense strand has five nucleotides that are 2'-fluoronucleotides, located at positions 2, 6, 14, 16, or optionally 22 in the direction from the 5' end to the 3' end of the antisense strand.

[0219] In some embodiments of this disclosure, the antisense strand has six nucleotides that are 2'-fluoronucleotides, the six 2'-fluoronucleotides being selected from positions 2, 4, 6, 8, 10, 14, 16, 18, 20, and optionally 22 in the 5' to 3' direction of the antisense strand, and the nucleotides at positions 2, 6, 14, 16, and optionally 22 are all 2'-fluoronucleotides.

[0220] In some embodiments of this disclosure, the antisense strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from the 2nd, 4th, 6th, 8th, 10th, 14th, 16th, 18th, 20th, or optionally the 22nd position in the 5' to 3' direction of the antisense strand, and the nucleotides at the 20th and optionally the 22nd positions are both 2'-fluoronucleotides.

[0221] In some embodiments of this disclosure, the antisense strand has five or six nucleotides that are 2'-fluoronucleotides, which are selected from the 2nd, 4th, 6th, 8th, 10th, 14th, 16th, 18th, 20th, or optionally 22nd positions in the 5' to 3' direction of the antisense strand, and the nucleotides at the 4th, 8th, 20th and optionally 22nd positions are all 2'-fluoronucleotides.

[0222] In some embodiments of this disclosure, the sense strand has five nucleotides that are 2'-fluoronucleotides, selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21, along the 3' to 5' direction of the sense strand, with positions 11, 12, and 13 being 2'-fluoronucleotides. The antisense strand has five nucleotides that are 2'-fluoronucleotides, selected from positions 2, 4, 6, 8, 10, 14, 16, 18, 20, or optionally 22, along the 5' to 3' direction of the antisense strand, with positions 2, 6, 14, and 16 being 2'-fluoronucleotides.

[0223] In some embodiments of this disclosure, the sense strand has five nucleotides that are 2'-fluoronucleotides, which are selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21, in the direction from the 3' end to the 5' end of the sense strand, and the nucleotides at positions 11, 12, and 13 are all 2'-fluoronucleotides. The antisense strand has five nucleotides that are 2'-fluoronucleotides, which are selected from positions 2, 6, 14, 16, or optionally 22, in the direction from the 5' end to the 3' end of the antisense strand.

[0224] In some embodiments of this disclosure, the sense strand has six nucleotides that are 2'-fluoronucleotides, selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21, along the 3' to 5' direction of the sense strand, with positions 11, 12, and 13 being 2'-fluoronucleotides. The antisense strand has five nucleotides that are 2'-fluoronucleotides, selected from positions 2, 4, 6, 8, 10, 14, 16, 18, 20, or optionally 22, along the 5' to 3' direction of the antisense strand, with positions 2, 6, 14, and 16 being 2'-fluoronucleotides.

[0225] In some embodiments of this disclosure, the sense strand has six nucleotides that are 2'-fluoronucleotides, located at positions 5, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand, and the antisense strand has five nucleotides that are 2'-fluoronucleotides, located at positions 2, 6, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand.

[0226] In some embodiments of this disclosure, the sense strand has five nucleotides that are 2'-fluoronucleotides, selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21, along the 3' to 5' direction of the sense strand, with positions 11, 12, and 13 being 2'-fluoronucleotides. The antisense strand has six nucleotides that are 2'-fluoronucleotides, selected from positions 2, 4, 6, 8, 10, 14, 16, 18, 20, or optionally 22, along the 5' to 3' direction of the antisense strand, with positions 2, 6, 14, and 16 being 2'-fluoronucleotides.

[0227] In some embodiments of this disclosure, the sense strand has five nucleotides that are 2'-fluoronucleotides, selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21, along the 3' to 5' direction of the sense strand, with positions 11, 12, and 13 being 2'-fluoronucleotides. The antisense strand has six nucleotides that are 2'-fluoronucleotides, selected from positions 2, 4, 6, 8, 10, 14, 16, 18, 20, or optionally 22, along the 5' to 3' direction of the antisense strand, with positions 2, 6, 14, 16, and 22 being 2'-fluoronucleotides.

[0228] In some embodiments of this disclosure, the sense strand has six nucleotides that are 2'-fluoronucleotides, selected from positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, or optionally 21 from the 3' to 5' end of the sense strand, with positions 11, 12, and 13 being 2'-fluoronucleotides. The antisense strand has six nucleotides that are 2'-fluoronucleotides, selected from positions 2, 4, 6, 8, 10, 14, 16, 18, or optionally 22 from the 5' to 3' end of the antisense strand, with positions 2, 6, 14, and 16 being 2'-fluoronucleotides. In some embodiments of this disclosure, the sense strand has six nucleotides that are 2'-fluoronucleotides, located at positions 5, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand. The antisense strand has six nucleotides that are 2'-fluoronucleotides, selected from positions 2, 4, 6, 8, 10, 14, 16, 18, 20, or optionally 22 in the direction from the 5' end to the 3' end of the antisense strand, with the nucleotides at positions 2, 6, 14, and 16 being 2'-fluoronucleotides.

[0229] In some embodiments of this disclosure, the sense strand has six nucleotides that are 2'-fluoronucleotides, located at positions 5, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand. The antisense strand has six nucleotides that are 2'-fluoronucleotides, selected from positions 2, 4, 6, 8, 10, 14, 16, 18, 20, and optionally 22 in the direction from the 5' end to the 3' end of the antisense strand, and the nucleotides at positions 2, 6, 14, 16, and 22 are all 2'-fluoronucleotides.

[0230] In some embodiments of this disclosure, the entire nucleotide sequence of the sense and antisense strands of the siRNA is independently 2'-methoxynucleotide or 2'-fluoronucleotide.

[0231] In some embodiments of this disclosure, the nucleotides at least at positions 11, 12, and 13 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0232] In some embodiments of this disclosure, the nucleotides at positions 11, 12, and 13 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0233] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0234] In some embodiments of this disclosure, the nucleotides at positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19 and optionally 21 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0235] In some embodiments of this disclosure, the nucleotides at positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, and 21 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, while the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0236] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at at least one of positions 1, 3, 5, 7, and 9 can be 2'-fluoronucleotides.

[0237] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotide at one of the positions 1, 3, 5, 7, and 9 can be 2'-fluoronucleotides.

[0238] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and at least two of the nucleotides at positions 1, 3, 5, 7, and 9 can be 2'-fluoronucleotides.

[0239] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at two sites in positions 1, 3, 5, 7, and 9 can be 2'-fluoronucleotides.

[0240] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0241] In some embodiments of this disclosure, the nucleotides at positions 7, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0242] In some embodiments of this disclosure, the nucleotides at positions 6, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0243] In some embodiments of this disclosure, the nucleotides at positions 5, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0244] In some embodiments of this disclosure, the nucleotides at positions 3, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0245] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, and 15 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0246] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, 15, and optionally 21 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0247] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, 15, and 21 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0248] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, 15, and 19 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, while the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0249] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, 15, and 17 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.

[0250] In some embodiments of this disclosure, the nucleotides at least at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0251] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0252] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 8, 9, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0253] In some embodiments of this disclosure, the nucleotides at positions 2, 4, 6, 8, 10, 14, 16, 18, and optionally 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0254] In some embodiments of this disclosure, the nucleotides at positions 2, 4, 6, 8, 10, 14, 16, 18, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0255] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 14, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and at least one of the nucleotides at positions 4, 8, 10, 18, 20, and 22 is a 2'-fluoronucleotide.

[0256] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 14, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotide at one of the positions 4, 8, 10, 18, 20, and 22 is a 2'-fluoronucleotide.

[0257] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 14, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and at least two of the nucleotides at positions 4, 8, 10, 18, 20, and 22 are 2'-fluoronucleotides.

[0258] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 14, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at two of the positions at positions 4, 8, 10, 18, 20, and 22 are 2'-fluoronucleotides.

[0259] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0260] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0261] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0262] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0263] In some embodiments of this disclosure, the nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0264] In some embodiments of this disclosure, the nucleotides at positions 2, 6, 8, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.

[0265] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 9, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0266] In some embodiments of this disclosure, the nucleotides at positions 11, 12, and 13 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0267] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0268] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0269] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0270] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0271] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0272] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0273] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0274] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0275] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0276] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0277] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0278] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0279] In some embodiments of this disclosure, the nucleotides at positions 7, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0280] In some embodiments of this disclosure, the nucleotides at positions 7, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0281] In some embodiments of this disclosure, the nucleotides at positions 7, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0282] In some embodiments of this disclosure, the nucleotides at positions 7, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0283] In some embodiments of this disclosure, the nucleotides at positions 7, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0284] In some embodiments of this disclosure, the nucleotides at positions 7, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0285] In some embodiments of this disclosure, the nucleotides at positions 7, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0286] In some embodiments of this disclosure, the nucleotides at positions 7, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0287] In some embodiments of this disclosure, the nucleotides at positions 6, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0288] In some embodiments of this disclosure, the nucleotides at positions 5, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0289] In some embodiments of this disclosure, the nucleotides at positions 5, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0290]

[0291] In some embodiments of this disclosure, the nucleotides at positions 5, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0292] In some embodiments of this disclosure, the nucleotides at positions 5, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0293] In some embodiments of this disclosure, the nucleotides at positions 5, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0294] In some embodiments of this disclosure, the nucleotides at positions 5, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0295] In some embodiments of this disclosure, the nucleotides at positions 3, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0296] In some embodiments of this disclosure, the nucleotides at positions 3, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0297] In some embodiments of this disclosure, the nucleotides at positions 3, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0298] In some embodiments of this disclosure, the nucleotides at positions 3, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0299] In some embodiments of this disclosure, the nucleotides at positions 3, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0300] In some embodiments of this disclosure, the nucleotides at positions 3, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0301] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0302] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0303] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0304] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0305] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0306] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0307] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, 15, and 21 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0308] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 21 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0309] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 21 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0310] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 21 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0311] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 21 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0312] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, 15, and 19 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0313] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 19 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0314] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 19 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0315] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 19 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0316] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 19 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0317] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, 15, and 17 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0318] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 17 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0319] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 17 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0320] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 17 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0321] In some embodiments of this disclosure, the nucleotides at positions 1, 11, 12, 13, 15, and 17 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0322] In some embodiments of this disclosure, the nucleotides at positions 5, 6, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 9, 14, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0323] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, 20, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0324] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0325] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0326] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0327] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 4, 6, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0328] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0329] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 6, 8, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0330] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 6, 14, 16, 18, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0331] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0332] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0333] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 18, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0334] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0335] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 8, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0336] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 6, 9, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0337] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 9, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0338] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 9, 14, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0339] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 4, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0340] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0341] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 6, 8, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0342] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 6, 14, 16, 18, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0343] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0344] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0345] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 18, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0346] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0347] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 8, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0348] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 6, 9, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0349] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 9, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0350] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 9, 14, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0351] In some embodiments of this disclosure, the nucleotides at positions 1, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0352] In some embodiments of this disclosure, the nucleotides at positions 11, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 12, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0353] In some embodiments of this disclosure, the nucleotides at positions 9, 11, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 12, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0354] In some embodiments of this disclosure, the nucleotides at positions 5, 11, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 12, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0355] In some embodiments of this disclosure, the nucleotides at positions 5, 11, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0356] In some embodiments of this disclosure, the nucleotides at positions 11, 12, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0357] In some embodiments of this disclosure, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 9, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0358] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 9, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0359] In some embodiments of this disclosure, the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 9, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0360] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0361] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 3, 6, 10, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0362] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 5, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0363] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0364] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 9, 10, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0365] In some embodiments of this disclosure, the nucleotides at positions 5, 11, 12, 13, and 15 of the positive strand from the 3' to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the positive strand can be 2'-methoxynucleotides. Similarly, the nucleotides at positions 2, 6, 9, 10, 14, 16, and 22 of the negative strand from the 5' to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the negative strand can be 2'-methoxynucleotides. In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 of the positive strand from the 3' to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the positive strand can be 2'-methoxynucleotides. Similarly, the nucleotides at positions 2, 6, 14, 16, and 26 of the negative strand from the 5' to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the negative strand can be 2'-methoxynucleotides.

[0366] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 25 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0367] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 24 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0368] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 23 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0369] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 21 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0370] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0371] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0372] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 10, 14, 16, and 18 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0373] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0374] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0375] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 10, 14, 16, and 20 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.

[0376] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 14, 16, and 21 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0377] In some embodiments of this disclosure, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 14, 16, and 23 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.

[0378] In some embodiments of this disclosure, at least one of the following connections is a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group: between the nucleotides at positions 1 and 2 at the 5' end of the sense strand, between the nucleotides at positions 2 and 3 at the 5' end of the sense strand, between the nucleotides at positions 1 and 2 at the 5' end of the antisense strand, between the nucleotides at positions 2 and 3 at the 5' end of the antisense strand.

[0379] In some embodiments of this disclosure, at least four or six of the following connections are phosphate thioester groups, Rp-configured phosphate thioester groups, or Sp-configured phosphate thioester groups: between the 1st and 2nd nucleotides at the 5' end of the sense strand, between the 2nd and 3rd nucleotides at the 5' end of the sense strand, between the 1st and 2nd nucleotides at the 5' end of the antisense strand, between the 1st and 2nd nucleotides at the 5' end of the antisense strand, and between the 2nd and 3rd nucleotides at the 5' end of the antisense strand.

[0380] In some embodiments of this disclosure, the nucleotides at positions 1 and 2 and positions 2 and 3 of the 5' end of the positive strand are linked by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group.

[0381] In some embodiments of this disclosure, the nucleotides at positions 1 and 2 and positions 2 and 3 of the 5' end of the positive strand are connected by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group, and the nucleotides at positions 1 and 2 and positions 2 and 3 of the 3' end of the positive strand are connected by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group.

[0382] In some embodiments of this disclosure, the nucleotides at positions 1 and 2 at the 5' end of the antisense strand, and the nucleotides at positions 2 and 3, are linked by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group.

[0383] In some embodiments of this disclosure, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand are linked by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group.

[0384] In some embodiments of this disclosure, the nucleotides at positions 1 and 2 and positions 2 and 3 of the 3' end of the antisense strand are linked by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group, and the nucleotides at positions 1 and 2 and positions 2 and 3 of the 5' end of the antisense strand are linked by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group.

[0385] In some embodiments of this disclosure, the nucleotides at positions 1 and 2, 2 and 3, 3 and 4, and 4 and 5 of the 3' end of the antisense strand are connected by thiophosphate groups, Rp-configured thiophosphate groups, or Sp-configured thiophosphate groups, and the nucleotides at positions 1 and 2, and 2 and 3 of the 5' end of the antisense strand are connected by thiophosphate groups, Rp-configured thiophosphate groups, or Sp-configured thiophosphate groups.

[0386] In some embodiments of this disclosure, at least one nucleotide at positions 6, 7, and 8 of the 5' end of the antisense strand is a heat-labile nucleotide.

[0387] In some embodiments of this disclosure, the 6th nucleotide at the 5' end of the antisense strand is a heat-labile nucleotide.

[0388] In some embodiments of this disclosure, the 7th nucleotide at the 5' end of the antisense strand is a heat-labile nucleotide.

[0389] In some embodiments of this disclosure, the 8th nucleotide at the 5' end of the antisense strand is a heat-labile nucleotide.

[0390] In some embodiments of this disclosure, the heat-labile nucleotide may be selected from LNA, UNA, or GNA. In some embodiments of this disclosure, the heat-labile nucleotide may be GNA.

[0391] In some embodiments of this disclosure, the first nucleotide at the 5' end of the antisense strand may be a (E)-VP modified nucleotide.

[0392] In some embodiments of this disclosure, the sense strand has nucleotides modified as follows:

[0393] (1) The nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides; the nucleotides at other positions of the positive strand can be 2'-methoxynucleotides;

[0394] (2) The nucleotides at positions 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides; one of the nucleotides at positions 1, 3, 5, 6, 7, and 19 in the direction from the 3' end to the 5' end of the positive strand may further be 2'-fluoronucleotides; the nucleotides at other positions of the positive strand may be 2'-methoxynucleotides;

[0395] (3) The nucleotides at positions 1, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides; the nucleotides at other positions of the positive strand can be 2'-methoxynucleotides;

[0396] (4) The nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides, and the nucleotide at position 2 is GNA; the nucleotides at other positions of the positive strand can be 2'-methoxynucleotides;

[0397] (5) The nucleotides at positions 5, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides; the nucleotides at other positions of the positive strand can be 2'-methoxynucleotides;

[0398] (6) The nucleotides at positions 11 and 13 in the direction from the 3' end to the 5' end of the positive strand are 2'-fluoronucleotides; one of the nucleotides at positions 5, 9, 12, and 19 in the direction from the 3' end to the 5' end of the positive strand may be 2'-fluoronucleotides; the nucleotides at other positions of the positive strand may be 2'-methoxynucleotides.

[0399] In some embodiments of this disclosure, the antisense strand has nucleotides modified as follows:

[0400] (1) The nucleotides at positions 2, 6, 7, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides; the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides; the nucleotide at position 1 in the 5' to 3' direction of the antisense strand is further modified with (E)-VP;

[0401] (2) The nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides; one or two of the nucleotides at positions 4, 8, 9, 10, 18, and 20 in the 5' to 3' direction of the antisense strand may further be 2'-fluoronucleotides; the nucleotides at other sites of the antisense strand may be 2'-methoxynucleotides;

[0402] (3) The nucleotides at positions 2, 6, 14, and 16 from the 5' end to the 3' end of the antisense strand, and at position 2 from the 3' end to the 5' end, are 2'-fluoronucleotides; one or two of the nucleotides at positions 4, 8, 9, 10, 12, and 20 from the 5' end to the 3' end of the antisense strand may further be 2'-fluoronucleotides; the nucleotides at other sites of the antisense strand may be 2'-methoxynucleotides; the nucleotide at position 1 from the 5' end to the 3' end of the antisense strand may further have (E)-VP modification;

[0403] (4) The nucleotides at positions 2, 6, 7, 14, and 16 from the 5' end to the 3' end of the antisense strand, and at position 2 from the 3' end to the 5' end, are 2'-fluoronucleotides; the nucleotide at position 10 from the 5' end to the 3' end of the antisense strand may further be 2'-fluoronucleotides; the nucleotides at other positions of the antisense strand may be 2'-methoxynucleotides; the nucleotide at position 1 from the 5' end to the 3' end of the antisense strand may further have (E)-VP modification;

[0404] (5) The nucleotides at positions 2, 14, and 16 from the 5' end to the 3' end and at position 2 from the 3' end to the 5' end of the antisense strand are 2'-fluoronucleotides; one of the nucleotides at positions 4, 8, and 9 from the 5' end to the 3' end of the antisense strand may further be a 2'-fluoronucleotide; the nucleotides at other sites of the antisense strand may be 2'-methoxynucleotides;

[0405] (6) The nucleotides at positions 2, 6, and 14 from the 5' end to the 3' end and at position 2 from the 3' end to the 5' end of the antisense strand are 2'-fluoronucleotides; one of the nucleotides at positions 4, 8, 9, and 18 from the 5' end to the 3' end of the antisense strand may further be 2'-fluoronucleotides; the nucleotides at other sites of the antisense strand may be 2'-methoxynucleotides; or

[0406] (7) The nucleotides at positions 6, 14, and 16 in the 5' to 3' direction and at position 2 in the 3' to 5' direction of the antisense strand are 2'-fluoronucleotides; one of the nucleotides at positions 4, 8, 9, and 18 in the 5' to 3' direction of the antisense strand may be further 2'-fluoronucleotides; the nucleotides at other sites of the antisense strand may be 2'-methoxynucleotides.

[0407] In some embodiments of this disclosure, the siRNA comprises a sense strand and an antisense strand as follows:

[0408] The nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other positions of the positive strand are 2'-methoxynucleotides.

[0409] The nucleotides at positions 2, 6, 7, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand are 2'-methoxynucleotides. The nucleotide at position 1 in the 5' to 3' direction of the antisense strand is further modified with (E)-VP, and the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23 in the 5' to 3' direction of the antisense strand are linked by phosphate thioester groups.

[0410] In some embodiments of this disclosure, the siRNA may be selected from at least one of modified double strand 46, modified double strand 61 to modified double strand 64, modified double strand 66 to modified double strand 116, and modified double strand 182;

[0411] Modified double strand 46

[0412] Justice Chain: 5'-mU*mC*mCmCmAmCi2FCmUi2FUi2FUi2FUmCmUmUmCmUmAmAmUmGmA-3' (SEQ ID NO: 144)

[0413] Antisense strand: 5'-mU*i2FC*mAmUmUi2FAmGmAmAmGmAmAmAi2FAmGi2FGmUmGmGmGmA*mG*mA-3' (SEQ ID NO: 145);

[0414] Modified double strand 61

[0415] Justice Chain: 5'-mC*mC*mAmGmUmCi2FUmCi2FCi2FCi2FAmCmCmUmUmUmUmCmUmUmU-3' (SEQ ID NO: 154)

[0416] Antisense strand: 5'-mA*i2FA*mAmGmAi2FAmAmAmGmGmUmGmGi2FGmAi2FGmAmCmUmGmG*mG*mG-3' (SEQ ID NO: 155);

[0417] Modified double strand 62

[0418] Justice Chain: 5'-mC*mA*mGmUmCmUi2FCmCi2FCi2FAi2FCmCmUmUmUmUmCmUmUmCmU-3' (SEQ ID NO: 156)

[0419] Antisense chain: 5'-mA*i2FG*mAmAmGi2FAmAmAmAmGmGmUmGi2FGmGi2FAmGmAmCmUmG*mG*mG-3' (SEQ ID NO: 157);

[0420] Modified double strand 63

[0421] Justice Chain: 5'-mA*mG*mUmCmUmCi2FCmCi2FAi2FCi2FCmUmUmUmUmCmUmUmCmUmA-3' (SEQ ID NO: 158)

[0422] Antisense chain: 5'-mU*i2FA*mGmAmAi2FGmAmAmAmAmGmGmUi2FGmGi2FGmAmGmAmCmU*mG*mG-3' (SEQ ID NO: 159);

[0423] Modified double strand 64

[0424] Justice Chain: 5'-mG*mU*mCmUmCmCi2FCmAi2FCi2FCi2FUmUmUmUmCmUmUmCmUmAmA-3' (SEQ ID NO: 160)

[0425] Antisense strand: 5'-mU*i2FU*mAmGmAi2FAmGmAmAmAmAmGmGi2FUmGi2FGmGmAmGmAmC*mU*mG-3' (SEQ ID NO: 161);

[0426] Modified double strand 66

[0427] Justice Chain: 5'-mC*mU*mCmCmCmAi2FCmCi2FUi2FUi2FUmUmCmUmUmCmUmAmAmUmU-3' (SEQ ID NO: 164)

[0428] Antisense strand: 5'-mA*i2FA*mUmUmAi2FGmAmAmGmAmAmAmAi2FGmGi2FUmGmGmGmAmG*mA*mC-3' (SEQ ID NO: 165);

[0429] Modified double strand 67

[0430] Justice Chain: 5'-mC*mC*mCmAmCmCi2FUmUi2FUi2FUi2FCmUmUmCmUmAmAmUmGmAmU-3' (SEQ ID NO: 166)

[0431] Antisense strand: 5'-mA*i2FU*mCmAmUi2FUmAmGmAmAmGmAmAi2FAmAi2FGmGmUmGmGmG*mA*mG-3' (SEQ ID NO: 167);

[0432] Modified double strand 68

[0433] Justice Chain: 5'-mC*mC*mAmCmCmUi2FUmUi2FUi2FCi2FUmUmCmUmAmAmUmGmAmGmU-3' (SEQ ID NO: 168)

[0434] Antisense strand: 5'-mA*i2FC*mUmCmAi2FUmUmAmGmAmAmGmAi2FAmAi2FAmGmGmUmGmG*mG*mA-3' (SEQ ID NO: 169);

[0435] Modified double strand 69

[0436] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 170)

[0437] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 171);

[0438] Modified double strand 70

[0439] Justice Chain: 5'-mA*mC*mCmUmUmUi2FUmCi2FUi2FUi2FCmUmAmAmUmGmAmGmUmCmU-3' (SEQ ID NO: 172)

[0440] Antisense chain: 5'-mA*i2FG*mAmCmUi2FCmAmUmUmAmGmAmAi2FGmAi2FAmAmAmGmGmU*mG*mG-3' (SEQ ID NO: 173);

[0441] Modified double strand 71

[0442] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 174)

[0443] Antisense strand: 5'-mA*i2FA*mCi2FUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 175);

[0444] Modified double strand 72

[0445] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 174)

[0446] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUi2FUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 176);

[0447] Modified double strand 73

[0448] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 174)

[0449] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 177);

[0450] Modified double strand 74

[0451] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 174)

[0452] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAi2FGmGmUmG*mG*mG-3' (SEQ ID NO: 178);

[0453] Modified double strand 75

[0454] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 174)

[0455] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGi2FUmG*mG*mG-3' (SEQ ID NO: 179);

[0456] Modified double strand 76

[0457] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 174)

[0458] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 180);

[0459] Modified double strand 77

[0460] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAi2FAmUmGmAmGmUmU-3' (SEQ ID NO: 181)

[0461] Antisense strand: 5'-mA*i2FA*mCi2FUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 175);

[0462] Modified double strand 78

[0463] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAi2FAmUmGmAmGmUmU-3' (SEQ ID NO: 181)

[0464] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUi2FUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 176);

[0465] Modified double strand 79

[0466] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAi2FAmUmGmAmGmUmU-3' (SEQ ID NO: 181)

[0467] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO:177);

[0468] Modified double strand 80

[0469] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAi2FAmUmGmAmGmUmU-3' (SEQ ID NO: 181)

[0470] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAi2FGmGmUmG*mG*mG-3' (SEQ ID NO: 178);

[0471] Modified double strand 81

[0472] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAi2FAmUmGmAmGmUmU-3' (SEQ ID NO: 181)

[0473] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGi2FUmG*mG*mG-3' (SEQ ID NO: 179);

[0474] Modified double strand 82

[0475] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAi2FAmUmGmAmGmUmU-3' (SEQ ID NO: 181)

[0476] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 180);

[0477] Modified double strand 83

[0478] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUi2FGmAmGmUmU-3' (SEQ ID NO: 182)

[0479] Antisense strand: 5'-mA*i2FA*mCi2FUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 175);

[0480] Modified double strand 84

[0481] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUi2FGmAmGmUmU-3' (SEQ ID NO: 182)

[0482] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUi2FUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 176);

[0483] Modified double strand 85

[0484] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUi2FGmAmGmUmU-3' (SEQ ID NO: 182)

[0485] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 177);

[0486] Modified double strand 86

[0487] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUi2FGmAmGmUmU-3' (SEQ ID NO: 182)

[0488] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAi2FGmGmUmG*mG*mG-3' (SEQ ID NO: 178);

[0489] Modified double strand 87

[0490] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUi2FGmAmGmUmU-3' (SEQ ID NO: 182)

[0491] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGi2FUmG*mG*mG-3' (SEQ ID NO: 179);

[0492] Modified double strand 88

[0493] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUi2FGmAmGmUmU-3' (SEQ ID NO: 182)

[0494] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 180);

[0495] Modified double strand 89

[0496] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAi2FGmUmU-3' (SEQ ID NO: 183)

[0497] Antisense strand: 5'-mA*i2FA*mCi2FUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 175);

[0498] Modified double strand 90

[0499] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAi2FGmUmU-3' (SEQ ID NO: 183)

[0500] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUi2FUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 176);

[0501] Modified double strand 91

[0502] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAi2FGmUmU-3' (SEQ ID NO: 183)

[0503] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 177);

[0504] Modified double strand 92

[0505] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAi2FGmUmU-3' (SEQ ID NO: 183)

[0506] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAi2FGmGmUmG*mG*mG-3' (SEQ ID NO: 178);

[0507] Modified double strand 93

[0508] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAi2FGmUmU-3' (SEQ ID NO: 183)

[0509] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGi2FUmG*mG*mG-3' (SEQ ID NO: 179);

[0510] Modified double strand 94

[0511] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAi2FGmUmU-3' (SEQ ID NO: 183)

[0512] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 180);

[0513] Modified double strand 95

[0514] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAmGmUi2FU-3' (SEQ ID NO: 184)

[0515] Antisense strand: 5'-mA*i2FA*mCi2FUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 175);

[0516] Modified double strand 96

[0517] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAmGmUi2FU-3' (SEQ ID NO: 184)

[0518] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUi2FUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 176);

[0519] Modified double strand 97

[0520] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAmGmUi2FU-3' (SEQ ID NO: 184)

[0521] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmGmUmG*mG*mG-3' (SEQ ID NO: 177);

[0522] Modified double strand 98

[0523] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAmGmUi2FU-3' (SEQ ID NO: 184)

[0524] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAi2FGmGmUmG*mG*mG-3' (SEQ ID NO: 178);

[0525] Modified double strand 99

[0526] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAmGmUi2FU-3' (SEQ ID NO: 184)

[0527] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGi2FUmG*mG*mG-3' (SEQ ID NO: 179);

[0528] Modified double strand 100

[0529] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUmGmAmGmUi2FU-3' (SEQ ID NO: 184)

[0530] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 180);

[0531] Modified double strand 101

[0532] Sense strand: 5'-mG*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 185)

[0533] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmC*i2FG*mG-3' (SEQ ID NO: 186);

[0534] Modified double strand 102

[0535] Sense strand: 5'-mC*mU*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 187)

[0536] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmAmG*i2FG*mG-3' (SEQ ID NO: 188);

[0537] Modified double strand 103

[0538] Sense strand: 5'-mC*mA*mGmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 189)

[0539] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmCmUmG*i2FG*mG-3' (SEQ ID NO: 190);

[0540] Modified double strand 104

[0541] Sense strand: 5'-mC*mA*mCmGmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 191)

[0542] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmCmGmUmG*i2FG*mG-3' (SEQ ID NO: 192);

[0543] Modified double strand 105

[0544] Sense strand: 5'-mC*mA*mCmCmAmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 193)

[0545] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmUmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 194);

[0546] Modified double strand 106

[0547] Sense strand: 5'-mC*mA*mCmCmUmAi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 195)

[0548] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FUmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 196);

[0549] Modified double strand 107

[0550] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 174)

[0551] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGi2FUmG*i2FG*mG-3' (SEQ ID NO: 197);

[0552] Modified double strand 108

[0553] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 174)

[0554] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUi2FUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 198);

[0555] Modified double strand 109

[0556] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 174)

[0557] Antisense strand: 5'-mA*i2FA*mCi2FUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 199);

[0558] Modified double strand 110

[0559] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmU-3' (SEQ ID NO: 200)

[0560] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 180);

[0561] Modified double strand 111

[0562] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUi2FU-3' (SEQ ID NO: 201)

[0563] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 180);

[0564] Modified double strand 112

[0565] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCmUi2FUmCmUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 202)

[0566] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAi2FAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 203);

[0567] Modified double strand 113

[0568] Justice Chain: 5'-mC*mA*mCmCmUmUmUmUi2FCmUi2FUmCi2FUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 204)

[0569] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAi2FAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 203);

[0570] Modified double strand 114

[0571] Justice Chain: 5'-mC*mA*mCmCmUmUmUmUi2FCmUi2FUmCmUmAmAmUi2FGmAmGmUmU-3' (SEQ ID NO: 205)

[0572] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAi2FAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 203);

[0573] Modified double strand 115

[0574] Justice Chain: 5'-mC*mA*mCmCmUmUmUmUi2FCmUi2FUmCmUmAmAmUi2FGmAmGmUmU-3' (SEQ ID NO: 205)

[0575] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 180);

[0576] Modified double strand 116

[0577] Justice Chain: 5'-mC*mA*mCmCmUmUmUmUi2FCi2FUi2FUmCmUmAmAmUmGmAmGmUmU-3' (SEQ ID NO: 206)

[0578] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 180);

[0579] Modified double strand 182

[0580] Sense strand: 5'-mC*mU*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmA-3'(SEQ ID NO: 250)

[0581] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmAmG*i2FG*mG-3' (SEQ ID NO: 281).

[0582] Those skilled in the art will recognize that the siRNA described herein can be obtained using conventional siRNA preparation methods (e.g., solid-phase synthesis and liquid-phase synthesis), both of which are commercially available custom-made services. Those skilled in the art will also understand that modified nucleotide groups can be introduced into the siRNA described herein using appropriately modified nucleotide monomers. Methods for preparing appropriately modified nucleotide monomers are well known to those skilled in the art, and commercially available monomers are also available.

[0583] II. The siRNA conjugate disclosed herein

[0584] The siRNA conjugates disclosed herein are obtained by conjugating the siRNA of the present disclosure with a pharmaceutically acceptable conjugate molecule, said conjugate molecule comprising a pharmaceutically acceptable targeting ligand and a linker.

[0585] A "connector" is an organic part that connects two parts of a compound, for example, by covalently attaching two parts of a compound. A connector typically includes a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO2, SO2NH, or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalenyl, arylalkynyl, heteroarylalkyl, heteroarylalenyl, heteroarylalkynyl, heterocyclic alkyl, heterocyclic alkenyl, heterocyclic alkenyl, aryl, heteroaryl, heterocyclic, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalenyl, alkenylarylalkyl, alkenylarylalenyl, alkenylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalenyl, alkyl Heteroarylynyl, alkenylheteroarylalkyl, alkenylheteroarylalynyl, alkenylheteroarylynyl, alkenylheteroarylalkyl, alkenylheteroarylalynyl, alkenylheteroarylynyl, alkylheterocyclic alkyl, alkylheterocyclic alkenyl, alkylheterocyclic ynyl, alkenylheterocyclic alkenyl, alkenylheterocyclic ynyl, alkenylheterocyclic alkenyl, alkenylheterocyclic ynyl, alkylaryl, alkenylaryl, alkenylaryl, alkylheteroaryl, alkenylheteroaryl, alkenylheterocyclic ynyl, alkylaryl, alkenylaryl, alkenylaryl, alkylheteroaryl, alkenylheteroaryl, alkenylheteroaryl, alkenylheteroaryl, alkylaryl, alkenylheteroaryl, alkenylheteroaryl, alkylaryl, alkenylheteroaryl, ynylaryl, wherein one or more methylene groups may be interrupted or capped by: O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; wherein R8 is hydrogen, acetylated, aliphatic or substituted aliphatic. In some embodiments of this disclosure, the connector is between approximately 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16 or 8-16 atoms.

[0586] In some embodiments of this disclosure, the siRNA is covalently conjugated to the conjugated molecule. To reduce the potential impact of conjugation on siRNA activity, the conjugation site between the siRNA and the conjugated molecule can be at the 3' or 5' end of the sense strand of the siRNA, or at the 5' end of the antisense strand. In some embodiments, the conjugation site between the siRNA and the conjugated molecule can also be within the internal sequence of the siRNA.

[0587] Pharmaceutically acceptable targeting ligands can be those conventionally used in the field of siRNA drug delivery. In some embodiments of this disclosure, the targeting ligand may include, but is not limited to, one or more of the following targeting ligands or their derivatives: lipophilic molecules, polymers, peptides, aptamers, antibodies, quantum dots, carbohydrates, folic acid, or receptor ligands expressed by hepatocytes. In some embodiments of this disclosure, the lipophilic molecule may include at least one of cholesterol, bile acids, vitamins (e.g., vitamin E), and lipid molecules of varying chain lengths (e.g., phospholipids). In some embodiments of this disclosure, the polymer may include polyethylene glycol. In some embodiments of this disclosure, the peptide may include a transmembrane peptide. In some embodiments of this disclosure, the carbohydrate may include at least one of lactose, polylactose, mannose, galactose, N-acetylglucosamine (GalNAc), and CMM (Chemically Modified Mannose). In some embodiments of this disclosure, the receptor ligand expressed by hepatocytes may include at least one of desialyl glycoprotein, desialyl sugar residues, lipoproteins (such as high-density lipoprotein, low-density lipoprotein, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, and transferrin.

[0588] In some embodiments of this disclosure, the targeting ligand is N-acetylgalactosamine or CMM. In some embodiments of this disclosure, the targeting ligand is N-acetylgalactosamine.

[0589] In some embodiments of this disclosure, the targeting ligand can be directly attached to the 3' end of the siRNA's positive strand. In some embodiments of this disclosure, the targeting ligand can be attached to the 3' end of the siRNA's positive strand via a adapter.

[0590] In some embodiments of this disclosure, the connector-targeting ligand portion has the following structure: ;or ;or GalNAc(L96); or SerGalNAc.

[0591] In some embodiments of this disclosure, the structure of the siRNA conjugate may be as follows: The conjugated molecule described in this paper is combined with the one shown in the above formula. The siRNA is shown to be covalently conjugated at the 3' end of the positive strand.

[0592] In some embodiments of this disclosure, the siRNA conjugate may be selected from at least one of conjugates 101-103, 110, 117-125, 129-130, 133-136, 150-151, and 155-199, wherein the structure of the conjugate is as follows: ,in, This represents siRNA.

[0593] Conjugate 101

[0594] Justice Chain: 5'-mG*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 330)

[0595] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmC*i2FG*mG-3' (SEQ ID NO: 186);

[0596] Conjugate 102

[0597] Justice Chain: 5'-mC*mU*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 331)

[0598] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmAmG*i2FG*mG-3' (SEQ ID NO: 188);

[0599] Conjugate 103

[0600] Justice Chain: 5'-mC*mA*mGmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 332)

[0601] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmCmUmG*i2FG*mG-3' (SEQ ID NO: 190);

[0602] Conjugate 110

[0603] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 336)

[0604] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 180);

[0605] Conjugate 117

[0606] Sense strand: 5'-mG*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 342)

[0607] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmC*i2FG*mG-3' (SEQ ID NO: 186);

[0608] Conjugate 118

[0609] Sense strand: 5'-mC*mU*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 343)

[0610] Antisense strand: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmAmG*i2FG*mG-3' (SEQ ID NO: 188);

[0611] Conjugate 119

[0612] Justice Chain: 5'-mC*mA*mGmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 344)

[0613] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmCmUmG*i2FG*mG-3' (SEQ ID NO: 190);

[0614] Conjugate 120

[0615] Sense strand: 5'-mG*mU*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 345)

[0616] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmAmC*i2FG*mG-3' (SEQ ID NO: 211);

[0617] Conjugate 121

[0618] Sense strand: 5'-mG*mA*mGmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 346)

[0619] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmCmUmC*i2FG*mG-3' (SEQ ID NO: 213);

[0620] Conjugate 122

[0621] Justice Chain: 5'-mC*mU*mGmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 347)

[0622] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmCmAmG*i2FG*mG-3' (SEQ ID NO: 215);

[0623] Conjugate 123

[0624] Sense strand: 5'-mG*mU*mGmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 348)

[0625] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmCmAmC*i2FG*mG-3' (SEQ ID NO: 217);

[0626] Conjugate 124

[0627] Justice Chain: 5'-mG*mU*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 349)

[0628] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmAmC*i2FG*mG-3' (SEQ ID NO: 211);

[0629] Conjugate 125

[0630] Justice Chain: 5'-mG*mU*mGmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmUGalNAc(L96)-3' (SEQ ID NO: 350)

[0631] Antisense chain: 5'-mA*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmCmAmC*i2FG*mG-3' (SEQ ID NO: 217);

[0632] Conjugate 129

[0633] Justice Chain: 5'-mU*mC*mCmCmAmCi2FCmUi2FUi2FUi2FUmCi2FUmUmCmUi2FAmAmUmGmAGalNAc(L96)-3' (SEQ ID NO: 351)

[0634] Antisense strand: 5'-mU*i2FC*mAmUmUi2FAmGmAmAmGmAmAmAi2FAmGi2FGmUmGmGmGmA*i2FG*mA-3' (SEQ ID NO: 221);

[0635] Conjugate 130

[0636] Justice Chain: 5'-mA*mC*mCmCmAmCi2FCmUi2FUi2FUi2FUmCi2FUmUmCmUi2FAmAmUmGmAGalNAc(L96)-3' (SEQ ID NO: 352)

[0637] Antisense strand: 5'-mU*i2FC*mAmUmUi2FAmGmAmAmGmAmAmAi2FAmGi2FGmUmGmGmGmU*i2FG*mA-3' (SEQ ID NO: 223);

[0638] Conjugate 133

[0639] Justice Chain: 5'-mA*mG*mGmCmAmCi2FCmUi2FUi2FUi2FUmCi2FUmUmCmUi2FAmAmUmGmAGalNAc(L96)-3' (SEQ ID NO: 353)

[0640] Antisense strand: 5'-mU*i2FC*mAmUmUi2FAmGmAmAmGmAmAmAi2FAmGi2FGmUmGmCmCmU*i2FG*mA-3' (SEQ ID NO: 225);

[0641] Conjugate 134

[0642] Justice Chain: 5'-mA*mC*mCmGmAmCi2FCmAi2FGi2FCi2FUmUi2FGmUmUmUi2FGmUmGmAmAGalNAc(L96)-3' (SEQ ID NO:354)

[0643] Antisense chain: 5'-mU*i2FU*mCmAmCi2FAmAmAmCmAmAmGmCi2FUmGi2FGmUmCmGmGmU*i2FU*mG-3' (SEQ ID NO: 227);

[0644] Conjugate 135

[0645] Justice Chain: 5'-mU*mC*mCmGmAmCi2FCmAi2FGi2FCi2FUmUi2FGmUmUmUi2FGmUmGmAmAGalNAc(L96)-3' (SEQ ID NO:355)

[0646] Antisense chain: 5'-mU*i2FU*mCmAmCi2FAmAmAmCmAmAmGmCi2FUmGi2FGmUmCmGmGmA*i2FU*mG-3' (SEQ ID NO: 229);

[0647] Conjugate 136

[0648] Justice Chain: 5'-mU*mG*mGmGmAmCi2FCmAi2FGi2FCi2FUmUi2FGmUmUmUi2FGmUmGmAmAGalNAc(L96)-3' (SEQ ID NO: 356)

[0649] Antisense chain: 5'-mU*i2FU*mCmAmCi2FAmAmAmCmAmAmGmCi2FUmGi2FGmUmCmCmCmA*i2FU*mG-3' (SEQ ID NO: 231);

[0650] Conjugate 150

[0651] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 357)

[0652] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 249);

[0653] Conjugate 151

[0654] Sense strand: 5'-mC*mA*mGmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 358)

[0655] Antisense chain: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmCmUmG*i2FG*mG-3' (SEQ ID NO: 308);

[0656] Conjugate 155

[0657] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 359)

[0658] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 249);

[0659] Conjugate 156

[0660] Justice Chain: 5'-mC*mU*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 360)

[0661] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmAmG*i2FG*mG-3' (SEQ ID NO: 251);

[0662] Conjugate 157

[0663] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 359)

[0664] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 252);

[0665] Conjugate 158

[0666] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 359)

[0667] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUi2FUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 253);

[0668] Conjugate 159

[0669] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 359)

[0670] Antisense strand: 5'-(E)-VPmU*i2FA*mCi2FUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 254);

[0671] Conjugate 160

[0672] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 359)

[0673] Antisense strand: 5'-(E)-VPmU*i2FA*i2FCmUmCi2FAmUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 255);

[0674] Conjugate 161

[0675] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 359)

[0676] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUi2FCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 256);

[0677] Conjugate 162

[0678] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 359)

[0679] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 257);

[0680] Conjugate 163

[0681] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 359)

[0682] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUi2FUi2FAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 258);

[0683] Conjugate 164

[0684] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 359)

[0685] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUi2FAi2FGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 259);

[0686] Conjugate 165

[0687] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCmUmAmAmUi2FGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 361)

[0688] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUi2FAi2FGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 259);

[0689] Conjugate 166

[0690] Justice Chain: 5'-mC*mG*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 362)

[0691] Antisense chain: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmCmG*i2FG*mG-3' (SEQ ID NO: 262);

[0692] Conjugate 167

[0693] Justice chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmG [T]mAGalNAc(L96)-3' (SEQ ID NO: 363)

[0694] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 249);

[0695] Conjugate 168

[0696] Justice Chain: 5'-mC*mU*mCmCmCmAmCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 364)

[0697] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmGmGmGmAmG*i2FA*mC-3'(SEQ ID NO: 265);

[0698] Conjugate 169

[0699] Justice Chain: 5'-mU*mC*mCmCmAmCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 365)

[0700] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmGmGmGmA*i2FG*mA-3'(SEQ ID NO: 267);

[0701] Conjugate 170

[0702] Justice Chain: 5'-mC*mC*mCmAmCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 366)

[0703] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmGmGmG*i2FA*mG-3' (SEQ ID NO: 269);

[0704] Conjugate 171

[0705] Justice Chain: 5'-mC*mC*mAmCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 367)

[0706] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmGmG*i2FG*mA-3' (SEQ ID NO: 271);

[0707] Conjugate 172

[0708] Justice Chain: 5'-mA*mC*mCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 368)

[0709] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmU*i2FG*mG-3'(SEQ ID NO: 273);

[0710] Conjugate 173

[0711] Justice Chain: 5'-mC*mC*mUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 369)

[0712] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmG*i2FU*mG-3'(SEQ ID NO: 275);

[0713] Conjugate 174

[0714] Justice Chain: 5'-mU*i2FU*mUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 370)

[0715] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmG*i2FU*mG-3'(SEQ ID NO: 275);

[0716] Conjugate 175

[0717] Sense strand: 5'-mU*mU*i2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 371)

[0718] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmG*i2FU*mG-3'(SEQ ID NO: 275);

[0719] Conjugate 176

[0720] Sense strand: 5'-mU*mU*i2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 371)

[0721] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3'(SEQ ID NO: 249);

[0722] Conjugate 177

[0723] Justice Chain: 5'-mC*mU*mUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 372)

[0724] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3'(SEQ ID NO: 249);

[0725] Conjugate 178

[0726] Justice Chain: 5'-mC*mC*mUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 369)

[0727] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3'(SEQ ID NO: 249);

[0728] Conjugate 179

[0729] Justice Chain: 5'-mU*i2FU*mUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 370)

[0730] Antisense chain: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmA*i2FG*mG-3'(SEQ ID NO: 279);

[0731] Conjugate 180

[0732] Sense strand: 5'-mU*mU*i2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 371)

[0733] Antisense chain: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAmGmAmAmGi2FAmAi2FAmA*i2FG*mG-3'(SEQ ID NO: 279);

[0734] Conjugate 181

[0735] Justice Chain: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 359)

[0736] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3'(SEQ ID NO: 280);

[0737] Conjugate 182

[0738] Justice Chain: 5'-mC*mU*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO:360)

[0739] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmAmG*i2FG*mG-3' (SEQ ID NO: 281);

[0740] Conjugate 183

[0741] Justice Chain: 5'-mC*mG*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 362)

[0742] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmCmG*i2FG*mG-3'(SEQ ID NO: 282);

[0743] Conjugate 184

[0744] Justice Chain: 5'-mC*mU*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 360)

[0745] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmGmAmG*i2FG*mG-3' (SEQ ID NO: 283);

[0746] Conjugate 185

[0747] Justice Chain: 5'-mC*mG*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 362)

[0748] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmGmCmG*i2FG*mG-3' (SEQ ID NO: 284);

[0749] Conjugate 186

[0750] Sense strand: 5'-mU*mU*i2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 371)

[0751] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAmUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmG*i2FU*mG-3'(SEQ ID NO: 285);

[0752] Conjugate 187

[0753] Sense strand: 5'-mU*mU*i2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 371)

[0754] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmG*i2FU*mG-3'(SEQ ID NO: 286);

[0755] Conjugate 188

[0756] Sense strand: 5'-mU*mU*i2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 371)

[0757] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAi2FGmAmAmGi2FAmAi2FAmAmGmG*i2FU*mG-3'(SEQ ID NO: 287);

[0758] Conjugate 189

[0759] Justice Chain: 5'-mA*mC*mCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 368)

[0760] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmU*i2FG*mG-3'(SEQ ID NO: 288);

[0761] Conjugate 190

[0762] Justice Chain: 5'-mU*mC*mCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 373)

[0763] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmA*i2FG*mG-3'(SEQ ID NO: 290);

[0764] Conjugate 191

[0765] Justice Chain: 5'-mA*mG*mCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 374)

[0766] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmCmU*i2FG*mG-3'(SEQ ID NO: 292);

[0767] Conjugate 192

[0768] Sense strand: 5'-mA*mC*mGmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 375)

[0769] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmCmGmU*i2FG*mG-3'(SEQ ID NO: 294);

[0770] Conjugate 193

[0771] Justice Chain: 5'-mG*mC*mCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 376)

[0772] Antisense chain: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmC*i2FG*mG-3'(SEQ ID NO: 296);

[0773] Conjugate 194

[0774] Justice Chain: 5'-mC*mC*mAmCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 367)

[0775] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmGmG*i2FG*mA-3' (SEQ ID NO: 297);

[0776] Conjugate 195

[0777] Justice Chain: 5'-mG*mC*mAmCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 377)

[0778] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmGmC*i2FG*mA-3' (SEQ ID NO: 299);

[0779] Conjugate 196

[0780] Justice Chain: 5'-mC*mG*mAmCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 378)

[0781] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmUmCmG*i2FG*mA-3'(SEQ ID NO: 301);

[0782] Conjugate 197

[0783] Justice Chain: 5'-mC*mC*mUmCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 379)

[0784] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmAmGmG*i2FG*mA-3' (SEQ ID NO: 303);

[0785] Conjugate 198

[0786] Justice Chain: 5'-mC*mC*mGmCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUmGmAmGmUmAGalNAc(L96)-3'(SEQ ID NO: 380)

[0787] Antisense strand: 5'-(E)-VPmU*i2FA*mCmUmCi2FAi2FUmUmAmGmAmAmGi2FAmAi2FAmAmGmGmCmGmG*i2FG*mA-3' (SEQ ID NO: 305);

[0788] Conjugate 199

[0789] Sense strand: 5'-mC*mA*mCmCmUmUi2FUmUi2FCi2FUi2FUmCi2FUmAmAmUi2FGmAmGmUmAGalNAc(L96)-3' (SEQ ID NO: 357)

[0790] Antisense chain: 5'-(E)-VP mU*i2FA*mCmUmCi2FAmUi2FUi2FAmGmAmAmGi2FAmAi2FAmAmGmGmUmG*i2FG*mG-3' (SEQ ID NO: 258).

[0791] In some embodiments of this disclosure, the siRNA conjugate may be selected from at least one of conjugates 101-103, conjugate 110, conjugates 117-125, conjugates 129-130, conjugates 133-136, conjugates 150-151, conjugates 155-157, conjugates 162, conjugates 166, conjugates 171-172, and conjugates 181-198. In some embodiments of this disclosure, the siRNA conjugate may be selected from at least one of conjugates 150, 151, 155, 156, 157, 162, 166, 171, 172, 175, 181, 182, 183, 184, and 185. In some embodiments of this disclosure, the siRNA conjugate may be selected from conjugate 155, conjugate 156, conjugate 157, conjugate 162, conjugate 171, conjugate 172, conjugate 175, conjugate 182, conjugate 183, and conjugate 184 (e.g., conjugate 155, conjugate 156, conjugate 157, conjugate 162, conjugate 171, conjugate 172, conjugate 175, conjugate 182, and conjugate 183). In some embodiments of this disclosure, the siRNA conjugate may be selected from conjugate 157, conjugate 158, conjugate 159, conjugate 160, conjugate 161, conjugate 162, conjugate 163, conjugate 164, and conjugate 165.

[0792] In some embodiments of this disclosure, the siRNA conjugate may be selected from conjugate 155, conjugate 156, conjugate 162, conjugate 182, and conjugate 184. In further embodiments, the siRNA conjugate may be selected from conjugate 156, conjugate 182, and conjugate 184. In some embodiments of this disclosure, the siRNA conjugate may be conjugate 156 or conjugate 182.

[0793] In some embodiments of this disclosure, the double strands in which the nucleotides at positions 19, 20, or 21 in the 5' to 3' direction of the antisense strand mismatch with the target sequence are preferably in which the nucleotide at position 20 in the 5' to 3' direction of the antisense strand mismatches with the target sequence, and at the mismatch site, the nucleotides of the antisense strand and the target sequence are identical (e.g., double strand 22, double strand 26). When a preferred modification is selected, for example, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2 The modified duplex or further modified conjugate obtained by modifying double-stranded molecules or conjugates with the same modification method has a higher gene silencing effect than the modified double-stranded molecules or conjugates obtained by modifying double-stranded molecules or conjugates with no mismatch at the above sites (e.g., double-stranded 21, double-stranded 24).

[0794] In some embodiments of this disclosure, the nucleotide at position 20 of the antisense strand (from the 5' to the 3' end) mismatches with the target sequence in the double strand 26, when a preferred modification method is selected, for example, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand (from the 3' to the 5' end) are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand are 2'-methoxynucleotides; the nucleotides at positions 2, 6, 7, 14, 16, and 22 of the antisense strand (from the 5' to the 3' end) are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand are 2'-methoxynucleotides, the resulting modified double strand or further conjugate, compared to the same modification method where there is no mismatch at the above-mentioned positions, exhibits a significantly improved gene silencing effect.

[0795] In some embodiments of this disclosure, conjugate 182, which employs a special mismatch (the nucleotide at position 20 in the 5' to 3' direction of the antisense strand is the same as the nucleotide in the target sequence), exhibits a higher gene silencing effect compared to conjugate 162, which has the same modification where the nucleotide at position 20 in the 5' to 3' direction of the antisense strand is not mismatched with the target sequence.

[0796] This application also provides siRNA or its conjugates having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the full-length nucleotide sequences of the aforementioned sense and antisense strands, respectively, wherein the siRNA or its conjugates can effectively inhibit AGT gene expression.

[0797] III. The siRNA pharmaceutical composition disclosed herein

[0798] This disclosure also provides a pharmaceutical composition comprising, as an active ingredient and a pharmaceutically acceptable carrier, the siRNA or siRNA conjugate described in any embodiment of this disclosure.

[0799] In some embodiments of this disclosure, the pharmaceutical composition contains one siRNA or siRNA conjugate as described in any embodiment of this disclosure. In other embodiments of this disclosure, the pharmaceutical composition contains at least two siRNAs or siRNA conjugates (including but not limited to two, three, four, five, six, seven, eight, nine, ten, or more) as active ingredients as described in any embodiment of this disclosure. In some embodiments of this disclosure, the at least two siRNAs or siRNA conjugates each target different target sequences in the AGT gene, thereby expecting a synergistic effect from acting simultaneously on different target sequences. Here, "different target sequences" means that there is no overlap between target sequences or the number of overlapping consecutive nucleotides between target sequences is less than 5 (e.g., the number of overlapping consecutive nucleotides is 4, 3, 2, 1, or 0). In this case, the at least two siRNAs or siRNA conjugates as described in any embodiment of this disclosure can be present in any different proportions. In some embodiments of this disclosure, the at least two siRNAs or siRNA conjugates as described in the first aspect may exist in a molar ratio of 1:100 to 100:1. In some embodiments of this disclosure, the at least two siRNAs or siRNA conjugates as described in the first aspect may exist in a molar ratio of 1:70 to 70:1. In some embodiments of this disclosure, the at least two siRNAs as described in the first aspect or siRNA conjugates as described in the second aspect may exist in a molar ratio of 1:50 to 50:1. In some embodiments of this disclosure, the at least two siRNAs as described in the first aspect or siRNA conjugates as described in the second aspect may exist in a molar ratio of 1:10 to 10:1. In some embodiments of this disclosure, the at least two siRNAs as described in the first aspect or siRNA conjugates as described in the second aspect may exist in a molar ratio of 1:5 to 5:1. In some embodiments of this disclosure, the at least two siRNAs as described in the first aspect or the siRNA conjugates as described in the second aspect may exist in a molar ratio of 1:2 to 2:1. In some embodiments of this disclosure, the at least two siRNAs as described in the first aspect or the siRNA conjugates as described in the second aspect exist in a molar ratio of 1:1.

[0800] In some embodiments of this disclosure, the pharmaceutically acceptable carrier may include, but is not limited to, magnetic nanoparticles (such as Fe3O4, Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethyleneimine, polyamide-type dendritic polymers, poly-L-lysine, chitosan, 1,2-diolethio-3-trimethylammonium propane, poly-D-type or L-type lactic acid / glycolic acid copolymers, poly(2-aminoethyl ethylene phosphate) and poly(N,N-dimethylaminoethyl methacrylate), and one or more of their derivatives. There are no particular requirements regarding the content of the pharmaceutically acceptable carrier in the pharmaceutical compositions of this disclosure. In some embodiments of this disclosure, the ratio of the total weight of siRNA contained in the pharmaceutical composition to the total weight of the pharmaceutically acceptable carrier may be 1:(1-500). In some embodiments of this disclosure, the ratio of the total weight of siRNA contained in the pharmaceutical composition to the total weight of the pharmaceutically acceptable carrier may be 1:(1-300). In some embodiments of this disclosure, the ratio of the total weight of siRNA contained in the pharmaceutical composition to the total weight of a pharmaceutically acceptable carrier may be 1:(1-100). In some embodiments of this disclosure, the ratio of the total weight of siRNA or siRNA conjugate contained in the pharmaceutical composition to the total weight of a pharmaceutically acceptable carrier may be 1:(1-50).

[0801] In some embodiments of this disclosure, the pharmaceutical composition may further comprise a cationic component to assist in vivo drug delivery. In some embodiments of this disclosure, the cationic component may include, but is not limited to, at least one of positively charged peptides or proteins, cationic lipids, positively charged polymers, etc. In some embodiments of this disclosure, the positively charged peptides or proteins may include at least one of oligomeric arginine, oligomeric lysine, protamine, etc.In some embodiments of this disclosure, the cationic lipid may be selected from dimethyl bis(octadecyl)ammonium bromide (DDAB), 1,2-dimyristyl-3-trimethylammonium propane, 1,2-dioleyl-3-trimethylammonium propane (DOTAP), 1,2-dioleyl-3-trimethylammonium propane methyl sulfate, 1,2-dipalmityl-3-trimethylammonium propane, 1,2-distearylyl-3-trimethylammonium propane, N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), dimyristyloxypropyl dimethylhydroxyethylammonium bromide (DMRIE), dioleyloxypropyl dimethylhydroxyethylammonium bromide (DMRIE), etc. DORIE), dimethyl di(dodecyl)ammonium bromide, N-(a-trimethylammonium acetylated)-di(dodecyl)-D-glutamine hydrochloride, N-(a-trimethylammonium acetylated)-O,O'-bis-(1H,1H,2H,2H-perfluorodecyl)-L-glutamine hydrochloride, O,O'-di(dodecyl)-N-(a-trimethylammonium acetylated)diethanolamine hydrochloride, methylallyl di(dodecyl)ammonium bromide, N-{p-(w-trimethylammonium butyloxy)-benzoyl}-di(dodecyl)-L-glutamine hydrochloride, 9-(w-trimethylammonium butyl)-3,6-bis(dodecyl)thazolium bromide, dimethyl di (Octadecyl)ammonium hydrochloride, Nw-trimethylammonium decyl-di(hexadecyl)-D-glutamine bromide, N-{p-(w-trimethylammonium hexyloxy)-benzoyl}-di(tetradecyl)-L-glutamine bromide, p-(w-trimethylammonium decyloxy)-p'-octyloxyazobenzene bromide (MC-1-0810), p-{w-(b-hydroxyethyl)dimethyl-ammonium-decyloxy}-p'-octyloxyazobenzene bromide (MC-3-0810), O,O',O”-tris(dodecanoyl)-N-(w-trimethyl-ammonium decyl)-tris(hydroxymethyl)aminomethane bromide (TC-1-12), 1,2-di At least one of the following: lauryl-glycerol-3-ethylphosphocholine, 1,2-dimyristyl-glycerol-3-ethylphosphocholine, 1,2-dipalmityl-glycerol-3-ethylphosphocholine, 1,2-distearatel-glycerol-3-ethylphosphocholine, 1,2-dioleyl-glycerol-3-ethylphosphocholine, 1-palmityl-2-oleyl-glycerol-3-ethylphosphocholine, N,N-dihydroxyethyl-N-methyl-N-2-(cholesteroloxycarbonylamino)ethylammonium bromide (BHEM-Chol), (2,3-dioleoxypropyl)trimethylammonium chloride (DOTAP), and N-(1-(2,3-dioleoxy)propyl)-N,N,N-trimethylammonium chloride.In some embodiments of this disclosure, the positively charged polymer may be selected from at least one of polyethyleneimine, polyβ-amino ester, and chitosan quaternary ammonium salt.

[0802] For the same purpose, the pharmaceutical composition may also comprise a non-cationic component. The non-cationic component may include, but is not limited to, at least one of neutral membrane-fused lipids, anionic lipids, and amphiphilic polymers. In some embodiments of this disclosure, the membrane-fused lipid may comprise dioleylphosphatidylethanolamine, dioleylphosphatidylcholine, transphosphatidylethanolamine, 1,2-bis(10,12-tetratridecyldiol)-phosphoethanolamine, 1,2-ditransoleylphosphoethanolamine, 1,2-bis(hexadecyl)phosphoethanolamine, 1,2-dihexylphosphoethanolamine, 1,2-dilaurylphosphoethanolamine, 1,2-dilinylphosphoethanolamine, 1,2-dimyristylphosphoethanolamine, 1,2-dioleylphosphoethanolamine, 1,2-dipalmitoylphosphoethanolamine, 1, 2-Dipalmitoylphosphoethanolamine, 1,2-diphylloxyethanolamine, 1,2-distearateloxyethanolamine, 1-palmitoyl-2-oleoylphosphoethanolamine, 1-palmitoyl-2-(10,12-tetracarbazide-2-olyl)phosphoethanolamine, 1,2-dioleoylphosphoethanolamine-N-hexylamine, 1,2-dipalmitoylphosphoethanolamine-N-hexylamine, N,N-dimethyl-1,2-dioleoylphosphoethanolamine, N,N-dimethyl-1,2-dipalmitoylphosphoethanolamine, N-dodecanoyl-1,2-dipalmitoylphosphoethanolamine, N-dodecanoyl- 1,2-Dioleoylphosphoethanolamine, 1,2-Dioleoylphosphoethanolamine-N-dodecylamine, 1,2-Dipalmitoylphosphoethanolamine-N-dodecylamine, 1,2-Dioleoylphosphoethanolamine-N-pentanediol, 1,2-Dipalmitoylphosphoethanolamine-N-pentanediol, 1,2-Dioleoylphosphoethanolamine-N-lactose, 1,2-Dioleoylphosphoethanolamine-N-[4(p-maleiminomethyl)cyclohexane-carboxylate], Dipalmitoylphosphoethanolamine-N-[4-(p-maleicoiminomethyl)cyclohexane-carboxylate], 1,2-Dipalmitoylphosphoethanolamine At least one of N-[4-(p-maleiminophenyl)butyramine], 1,2-dioleylphosphoethanolamine-N-[4-(p-maleiminophenyl)butyrate], N-methyl-1,2-dioleylphosphoethanolamine, N-methyl-dispalmitoylphosphoethanolamine, 1,2-dioleylphosphoethanolamine-N-[3-(2-pyridinedithio)propionate, 1,2-dispalmitoylphosphoethanolamine-N-[3-(2-pyridinedithio)propionate], N-(succinyl)-1,2-dioleylphosphoethanolamine, and N-(succinyl)-1,2-dispalmitoylphosphoethanolamine. By adding the above-mentioned membrane-fused lipids to the pharmaceutical composition disclosed herein, the transport and delivery efficiency of the pharmaceutical composition in mammals can be further improved.In some embodiments of this disclosure, the amphiphilic polymer may include at least one of the following: polyethylene glycol-polylactic acid diblock copolymer, polyethylene glycol-polylactic acid triblock copolymer, polyethylene glycol-poly(lactic acid-glycolic acid) diblock copolymer, or polyethylene glycol-poly(lactic acid-glycolic acid) triblock copolymer, polycaprolactone-polyphosphate diblock copolymer, polycaprolactone-polyphosphate triblock copolymer, polyethylene glycol-polycaprolactone diblock copolymer, and polyethylene glycol-polycaprolactone triblock copolymer.

[0803] In some embodiments of this disclosure, the pharmaceutical composition may further comprise other pharmaceutically acceptable excipients. In some embodiments of this disclosure, the other pharmaceutically acceptable excipients may include at least one of a pH buffer, a protectant, and an osmotic pressure regulator. In some embodiments of this disclosure, the pH buffer may be one or both of a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH of 7.5-8.5 and a phosphate buffer with a pH of 5.5-8.5. In some embodiments of this disclosure, the pH buffer may be a phosphate buffer with a pH of 5.5-8.5. In some embodiments of this disclosure, the protectant may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. In some embodiments of this disclosure, the protectant may constitute 0.01%-30% of the total weight of the pharmaceutical composition. In some embodiments of this disclosure, the protectant may constitute 0.1%-25% of the total weight of the pharmaceutical composition. In some embodiments of this disclosure, the protective agent may comprise 1%-20% of the total weight of the pharmaceutical composition. In some embodiments of this disclosure, the protective agent may comprise 5%-15% of the total weight of the pharmaceutical composition. In some embodiments of this disclosure, the protective agent may comprise 10%-12% of the total weight of the pharmaceutical composition. In some embodiments of this disclosure, the osmotic pressure regulator may be one or both of sodium chloride and potassium chloride. In some embodiments of this disclosure, the content of the osmotic pressure regulator results in an osmotic pressure of 200-700 mImol / kg for the pharmaceutical composition. In some embodiments of this disclosure, the content of the osmotic pressure regulator results in an osmotic pressure of 300-600 mImol / kg for the pharmaceutical composition. In some embodiments of this disclosure, the content of the osmotic pressure regulator results in an osmotic pressure of 400-500 mImol / kg for the pharmaceutical composition. The content of the osmotic pressure regulator can be readily determined by those skilled in the art based on the desired osmotic pressure.

[0804] In some embodiments of this disclosure, the pharmaceutical composition may be a liquid formulation, such as an injection. In some embodiments of this disclosure, the pharmaceutical composition may also be a lyophilized powder for injection, which is mixed with a liquid excipient to form a liquid formulation for administration. In some embodiments of this disclosure, the liquid formulation may be for subcutaneous, intramuscular, or intravenous administration. In some embodiments of this disclosure, the liquid formulation may be for administration via a spray to the lungs, or via a spray to other organs or tissues (such as the liver). In some embodiments of this disclosure, the pharmaceutical composition is for intravenous administration.

[0805] IV. The reagent kit disclosed herein

[0806] The kit disclosed herein contains at least one of the siRNA, siRNA conjugates, or pharmaceutical compositions described in any embodiment of this disclosure. Where multiple siRNAs are present, each siRNA may exist individually or in a mixture of two or more.

[0807] In some embodiments of this disclosure, in addition to the siRNA, siRNA conjugate, or pharmaceutical composition, the kit may also contain components necessary or beneficial for achieving one or more specific applications of this disclosure, including but not limited to: (1) one or more components for achieving the desired cell transfection; (2) one or more components for achieving the diagnosis, treatment, or prevention of a specific disease, such as one or more additional therapeutic compounds or compositions, one or more diagnostic reagents; (3) one or more buffers; (4) positive or negative control samples; and (5) at least one of excipients, stabilizers, or preservatives. In some embodiments of this disclosure, the kit may also include instructions for use.

[0808] In some embodiments of this disclosure, the siRNA, siRNA conjugates, or pharmaceutical compositions in the kit may be provided in any form, such as liquid, dry, or lyophilized. In some embodiments of this disclosure, the siRNA, siRNA conjugates, or pharmaceutical compositions in the kit are substantially pure and / or sterile.

[0809] V. Applications of the siRNA, siRNA conjugates, and pharmaceutical compositions disclosed herein

[0810] By administering at least one of the siRNA, siRNA conjugates, and pharmaceutical compositions disclosed herein to a subject in need, the expression level of the AGT gene can be effectively reduced in the subject, thereby potentially being used for the prevention and / or treatment of angiotensinogen dysregulation-related diseases in said subject, or for the preparation of a medicament for the prevention and / or treatment of angiotensinogen dysregulation-related diseases.

[0811] In the methods for preventing and / or treating angiotensinogen dysregulation-related diseases disclosed herein, an effective dose of the siRNA, siRNA conjugate, or pharmaceutical composition described herein is given to a subject suffering from angiotensinogen dysregulation-related diseases or a subject at risk of developing angiotensinogen dysregulation-related diseases.

[0812] In one implementation, the subject is a human being.

[0813] In one implementation scheme, angiotensinogen dysregulation-related diseases are selected from hypertension, borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, and arteriosclerosis. Arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other hyperglycemic states (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosteronism and other hypermineralocorticoid states, sleep apnea, thyroid / parathyroid disease, heart failure, myocardial infarction, angina pectoris, stroke, diabetes, nephropathy, renal failure, systemic sclerosis, intrauterine growth retardation (IUGR), and fetal growth restriction.

[0814] In another implementation, angiotensinogen dysregulation-related diseases are selected from hypertension, hypertensive heart disease, hypertensive nephropathy, pregnancy-related hypertension, atherosclerosis, arteriosclerosis, chronic kidney disease, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid hyperstatins (including chronic steroid treatment), pheochromocytoma, primary aldosteronism and other mineralocorticoid hyperstatins, sleep apnea, thyroid / parathyroid disease, heart failure, myocardial infarction, stroke, diabetes, kidney failure, and systemic sclerosis.

[0815] In one embodiment, the angiotensinogen dysregulation-related disease is pregnancy-related hypertension (e.g., pregnancy-induced hypertension, preeclampsia, and eclampsia), and administration of the iRNA of the present invention to the subject results in: decreased maternal blood pressure; decreased maternal proteinuria; increased uteroplacental unit weight; increased fetal weight; normalization of the fetal brain:liver ratio; decreased expression of AGT mRNA in the maternal liver and no significant decrease in hAGT mRNA expression in the placenta; increased overall placental size; increased chorionic placental size; no significant change in the size of the placental trophoblast; decreased expression ratio of sFLT1:PLGF mRNA in the maternal kidney; decreased serum FLT1:PLGF level ratio; and / or decreased levels of AT1-stimulating autoantibodies.

[0816] Based on the average of correctly measured seated blood pressure readings taken during two or more clinic visits, subjects with normal blood pressure are defined as those with a systolic blood pressure of approximately 90-119 mmHg (approximately 12-15.9 kPa (kN / m2)) and a diastolic blood pressure of approximately 60-79 mmHg (approximately 8.0-10.5 kPa (kN / m2)); subjects with prehypertension are defined as those with a systolic blood pressure of approximately 120-139 mmHg (approximately 16.1-18.5 kPa (kN / m2)) and a diastolic blood pressure of approximately 60-79 mmHg (approximately 8.0-10.5 kPa (kN / m2)). Subjects with hypertension (e.g., stage I hypertension) are defined as those with a systolic blood pressure of approximately 140-159 mmHg (approximately 18.7-21.2 kPa (kN / m2)) and a diastolic blood pressure of approximately 90-99 mmHg (approximately 12.0-13.2 kPa (kN / m2)). Subjects with hypertension (e.g., stage II hypertension) are defined as those with a systolic blood pressure of approximately ≥160 mmHg (approximately ≥21.3 kPa (kN / m2)) and a diastolic blood pressure of approximately ≥100 mmHg (approximately ≥13.3 kPa (kN / m2)). Subjects with blood pressure exceeding 130 / 80 mmHg, along with type 1 or type 2 diabetes or kidney disease, are considered to have hypertension.

[0817] In one implementation, angiotensinogen dysregulation-related disease is primary hypertension. "Primary hypertension" is the result of environmental or genetic factors (e.g., the result of no obvious underlying medical cause).

[0818] In one implementation, angiotensinogen dysregulation-related disease is secondary hypertension. "Secondary hypertension" has an identifiable underlying dysregulation that can have multiple etiologies, including renal, vascular, and endocrine causes, such as renal parenchymal disease (e.g., polycystic kidney disease, glomerular or interstitial disease), renal vascular disease (e.g., renal artery stenosis, fibromuscular dysplasia), endocrine disorders (e.g., excessive adrenocortical or mineralocorticoid hormones, pheochromocytoma, hyperthyroidism or hypothyroidism, excessive growth hormone, hyperparathyroidism), aortic coarctation, or oral contraceptive use.

[0819] In one implementation, angiotensinogen dysregulation-related diseases are hypertensive crises, such as malignant hypertension and malignant hypertension. “Malignant hypertension” is severely elevated blood pressure (i.e., systolic blood pressure equal to or higher than 180 mmHg or diastolic blood pressure equal to or higher than 110 mmHg) that causes direct damage to one or more end organs. Blood pressure must be reduced immediately to prevent further organ damage. “Malignant hypertension” is severely elevated blood pressure (systolic blood pressure equal to or higher than 180 mmHg or diastolic blood pressure equal to or higher than 110 mmHg) that causes direct damage to one or more end organs and papilledema. Blood pressure must be reduced immediately to prevent further organ damage. Neurological end-organ damage due to uncontrolled blood pressure can include hypertensive encephalopathy, cerebrovascular accident / cerebral infarction; subarachnoid hemorrhage, and / or intracranial hemorrhage. Cardiovascular end-organ damage can include myocardial ischemia / infarction, acute left ventricular dysfunction, acute pulmonary edema, and / or aortic dissection. Other organ systems may also be affected by uncontrolled hypertension, which could lead to acute renal failure / renal insufficiency, retinopathy, eclampsia, or microangiopathic hemolytic anemia.

[0820] In one implementation, angiotensinogen dysregulation-related disease is a hypertensive urgency. A “hypertensive urgency” is a severely elevated blood pressure (i.e., a systolic blood pressure equal to or higher than 180 mmHg or a diastolic blood pressure of 110 mmHg) without direct damage to one or more organs. The blood pressure can be safely lowered within hours.

[0821] In one implementation, angiotensinogen dysregulation-related disorders are pregnancy-related hypertension, such as chronic gestational hypertension, gestational hypertension, preeclampsia, eclampsia, preeclampsia with chronic hypertension, HELLP syndrome, and gestational hypertension (also known as transient gestational hypertension, chronic hypertension discovered in the second half of pregnancy, and pregnancy-induced hypertension (PIH)). Subjects with “chronic gestational hypertension” are those with blood pressure exceeding 140 / 90 mmHg before pregnancy or before 20 weeks of gestation. “Gestational hypertension” or “pregnancy-induced hypertension” refers to hypertension that occurs in late pregnancy (>20 weeks of gestation), without any other characteristics of preeclampsia, followed by normalization of blood pressure postpartum. “Mild preeclampsia” is defined as the presence of two episodes of hypertension (≥140 / 90 mmHg) at least six hours apart in women with normal blood pressure before 20 weeks of gestation, without evidence of end-organ damage. In subjects with pre-existing primary hypertension, preeclampsia is diagnosed if systolic blood pressure increases by 30 mmHg or diastolic blood pressure increases by 15 mmHg. “Severe preeclampsia” is defined as the presence of one of the following symptoms or signs in the presence of preeclampsia: two systolic blood pressures of 160 mmHg or higher or diastolic blood pressures of 110 mmHg or higher at an interval of at least six hours; proteinuria greater than 5 g in a 24-hour collection or greater than 3+ in two random urine samples collected at an interval of at least four hours; pulmonary edema or cyanosis; oliguria (<400 mL in 24 hours); persistent headache; epigastric pain and / or impaired liver function; thrombocytopenia; oligohydramnios; decreased fetal growth; or placental abruption. “Eclampsia” is defined as a seizure of a condition that cannot be attributed to other causes in women with preeclampsia. “HELLP syndrome” (also known as type B edema-proteinuria-hypertensive pregnancy toxemia) is hemolysis, elevated liver enzyme levels, and low platelet levels in pregnant subjects.

[0822] In one implementation, angiotensinogen dysregulation-related disease is refractory hypertension. "Refractory hypertension" is defined as blood pressure remaining above a target level (e.g., 140 / 90 mmHg) despite the simultaneous use of three different classes of antihypertensive medications (one of which is a thiazolinone diuretic). Subjects whose blood pressure is controlled with four or more medications are also considered to have refractory hypertension.

[0823] As used herein, the term "administration" refers to the method or route by which siRNA is placed into a subject by at least partially targeting the desired site to produce the desired effect. Suitable routes of administration for the methods of this disclosure include local administration and systemic administration. Generally, local administration results in the delivery of more siRNA to the specific site compared to the subject's entire body; systemic administration results in the delivery of said siRNA to substantially the entire body of the subject. Given that AGT is primarily expressed in the liver, a route of administration capable of specifically delivering it to the liver is preferred.

[0824] The medication can be administered to the subject via any suitable route known in the art. In some embodiments of this disclosure, the routes include, but are not limited to, oral or parenteral routes, including at least one of intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and topical (including oral and sublingual) administration. In some embodiments of this disclosure, the administration frequency can be once or multiple times daily, weekly, monthly, or annually.

[0825] The dosage of the siRNA described in this disclosure can be determined based on various parameters, particularly the age, weight, and sex of the subject. Toxicity and efficacy can be determined in cell culture or laboratory animals using standard pharmaceutical procedures, such as determining the LD50 (the dose that causes 50% of the population to die) and ED50 (the dose that elicits 50% of the maximum response intensity in a quantitative response, and the dose that elicits a positive response in 50% of the subjects in a qualitative response). The dose ratio between toxicity and efficacy is the therapeutic index, which can be expressed as the LD50 / ED50 ratio. siRNAs, siRNA conjugates, or pharmaceutical compositions exhibiting a high therapeutic index are preferred. The range of human dosages can be determined based on data obtained from cell culture analysis and animal studies, which is within the capabilities of those skilled in the art.

[0826] When administering the siRNA, siRNA conjugate, or pharmaceutical composition described herein, for example, to male or female C57BL / 6J or C3H / HeNCrlVr mice aged 6-12 weeks and weighing 18-25g, the amount of siRNA may be 0.001-50 mg / kg body weight, preferably 0.01-10 mg / kg body weight, more preferably 0.05-5 mg / kg body weight, and most preferably 0.1-3 mg / kg body weight.

[0827] In some embodiments of this disclosure, the siRNA, siRNA conjugates, and / or pharmaceutical compositions of this disclosure are used as a single active ingredient for the prevention and / or treatment of angiotensinogen dysregulation-related diseases.

[0828] In some embodiments of this disclosure, the siRNA, siRNA conjugates, and / or pharmaceutical compositions of this disclosure are used in combination with other active ingredients for the prevention and / or treatment of angiotensinogen dysregulation-related diseases.

[0829] Those skilled in the art will understand that the above description of this disclosure is exemplary, and the embodiments disclosed herein can be readily modified into other specific forms without altering the technical spirit or essential characteristics of this disclosure. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.

[0830] Unless otherwise specified, singular terms encompass plural terms, and plural terms encompass singular terms. Unless otherwise specified, the words "a" or "an" mean "at least one" or "at least one". Unless otherwise specified, the use of "or" means "and / or".

[0831] For purposes of description and disclosure, all patents, patent applications, and other identified publications are expressly incorporated herein by reference. These publications are provided solely because their publication predates the filing date of this application. All statements regarding the dates of these documents or representations of their contents are based on information available to the applicant and do not constitute any acknowledgment of the accuracy of the dates or contents of these documents. Furthermore, in any country, any reference to these publications herein does not constitute an endorsement that such publication is part of the general knowledge in the art.

[0832] [Example]

[0833] In the following description, exemplary embodiments will be provided to aid in understanding this disclosure. However, the following embodiments are provided merely for the purpose of facilitating understanding of this disclosure and are not intended to limit it.

[0834] Unless otherwise specified, all materials and reagents used in the examples are commercially available. Nucleic acid electrophoresis, real-time PCR, and other procedures were performed according to standard protocols. For example, they could be performed as described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)).

[0835] Example 1: siRNA Synthesis

[0836] The siRNAs used in this embodiment can all be commercially available or synthesized. The specific synthesis method is as follows.

[0837] For the sense and antisense strands of the siRNA duplex disclosed herein, standard CPG was used as a solid support. For the sense and antisense strands of the modified duplex, universal CPG was used as a solid support. For siRNA with GalNAc linked to the 3' end of the sense strand, GalNAc was linked to a long-chain amino CPG vector and then the chain was extended according to the standard phosphatidylamine method.

[0838] Sequence synthesis was performed using a high-throughput synthesizer. The phosphoramidine monomer was prepared at a concentration of 0.05 M, and the activator was 0.3 M BTT.

[0839] The synthesized sequences were cleaved and deprotected using a 1:1 mixture of ammonia and methylamine ethanol, followed by removal of the 2'-protecting group using triethylamine trifluoride. Sequences containing complete 2'-position modifications required ammonia hydrolysis. The cleaved and deprotected sequences were precipitated using an acetone-ethanol mixture (80:20 v / v) and dissolved in RNase-free water. Sequence accuracy was determined by LC-MS, quantification by spectrophotometry, and purity by HPLC.

[0840] After HPLC purification, lyophilization, and quality control, the salt was replaced by sodium acetate alcohol precipitation, and then desalted using a 3KD ultrafiltration tube. After desalting, the sense and antisense strands were quantitatively determined by spectrophotometer. The sense and antisense strands were mixed and annealed in a 1:1 molar ratio to form the siRNA duplex and conjugate disclosed herein.

[0841] Example 2: In vitro activity detection

[0842] Cell culture: Hep3B cells were cultured at 37°C and 5% CO2 in DMEM complete medium (Gibco, with 10% FBS and 1% penicillin-streptomycin) until near confluence. Then, the cells were trypsin-digested and seeded in 24-well plates. 1.0 × 10⁵ Hep3B cells and 1.0 mL of DMEM complete medium were added to each well. After culturing at 37°C and 5% CO2 for 16-24 h, transfection was performed.

[0843] Cell transfection: Add 3 μL of lipofectamineRNAiMax (Invitrogen) to 47 μL of opti-MEM (Gibco) per well, followed by 50 μL of opt-MEM dilution of each siRNA or conjugate prepared in Example 1. Mix wells, add to centrifuge tubes, and incubate at room temperature for 5 min. Finally, add the siRNA transfection complex to the cells and continue culturing for 24 h before RNA extraction. Single-dose experiments were performed at concentrations of 1 nM and 0.1 nM siRNA duplexes or conjugates. IC50 assays were performed at concentrations of 10 nM, 1.0 nM, 0.1 nM, 0.01 nM, 0.001 nM, 0.0001 nM, and 0.00001 nM siRNA duplexes or conjugates.

[0844] RNA extraction: The total RNA isolation kit (VAZYME, Cat: RC112-01) was used according to the instructions. Finally, 50 μL of RNase-free water was added, and the mixture was allowed to stand for 5 min before centrifugation at 12000 rpm for 1 min to elute the RNA.

[0845] cDNA synthesis: cDNA synthesis was performed using a gDNA removal and cDNA synthesis kit (VAZYME, Cat: RC333-01). 400 ng of total RNA was added to each sample, and cDNA synthesis was performed using a gradient thermal cycler (Bio-rad, T100) following the instructions of the instrument and kit.

[0846] Real-time quantitative PCR: A 20 μL amplification system was used. The synthesized cDNA and a mixed stock solution (containing primers, 1×SYBR Green premix, and ultrapure water) were added to a 96-well plate (Thermofisher, Cat: A36924) to make the final real-time quantitative PCR system contain 0.4 μM each of the forward and reverse primers for the target gene (hAGT, sequence as shown in SEQ ID NO: 1) or the internal control gene (GAPDH), and 10 μL of 1×SYBR Green premix (Thermofisher, Cat: A25742). Real-time fluorescence PCR was performed using the ΔΔCt assay on an ABI QuantStudio 1 Plus real-time fluorescence PCR system. Each duplex or conjugate was tested three times independently, with each transfection performed in triplicate.

[0847] result

[0848] The in vitro activity test results for some duplexes are shown in Table 2, and the in vitro activity test results for some modified duplexes and conjugates are shown in Tables 3-9. For the in vitro activity tests of duplexes, modified duplexes, and conjugates, PC A, PC B, and PC C, known to have AGT gene inhibitory effects, were used as positive controls. PC A is the duplex AD-85481 from WO2019222166A1, PC B is the modified duplex AD-85481, and PC C is the conjugate of the modified duplex AD-85481 and GalNAc(L96). Test results are expressed as mean ± SD.

[0849] PC A is:

[0850] Chain of Justice: 5'-GUCAUCCACAAUGAGAGUACA-3' (SEQ ID NO: 391)

[0851] Antonym: 5'-UGUACUCUCAUUGUGGAUGACGA-3' (SEQ ID NO: 392);

[0852] PC B is:

[0853] Justice Chain: 5'-mG*mU*mCmAmUmCi2FCmAi2FCi2FAi2FAmUmGmAmGmAmGmUmAmCmA-3' (SEQ ID NO: 393);

[0854] antisense chain: 5'-mU*i2FG*mUmAmC [T]mCmUmCmAmUmUmGi2FUmGi2FGmAmUmGmAmC*mG*mA-3' (SEQ ID NO: 394);

[0855] PC C is:

[0856] Justice Chain: 5'-mG*mU*mCmAmUmCi2FCmAi2FCi2FAi2FAmUmGmAmGmAmGmUmAmCmAGalNAc(L96)-3' (SEQ ID NO: 395);

[0857] antisense chain: 5'-mU*i2FG*mUmAmC [T]mCmUmCmAmUmUmGi2FUmGi2FGmAmUmGmAmC*mG*mA-3' (SEQ ID NO: 394).

[0858] [Table 2] Results of single-dose testing of unmodified double strands [Double-stranded number] [1 nM siRNA] [0.1 nM siRNA] [Mean] [SD] [Mean] [SD] [Double strand] [1] 0.089 0.0135 0.197 0.0006 [Double strand] [2] 0.141 0.0120 0.209 0.0182 [Double strand] [3] 0.145 0.0192 0.200 0.0189 [Double strand] [4] 0.147 0.0333 0.258 0.0209 [Double strand] [5] 0.085 0.0071 0.305 0.0403 [Double strand] [6] 0.135 0.0286 0.258 0.0288 [Double strand] [7] 0.056 0.0103 0.251 0.0353 [Double strand] [8] 0.085 0.0107 0.253 0.0420 [Double strand] [9] 0.123 0.0129 0.225 0.0064 [Double strand]

[10] 0.100 0.0604 0.186 0.0222 [Double strand]

[13] 0.103 0.0266 0.263 0.0234 [PCA] 0.132 0.0285 0.218 0.0274

[0859] [Table 3] Results of single-dose testing of modified double strands [Double-stranded number] [1 nM siRNA] [0.1 nM siRNA] [Mean] [SD] [Mean] [SD] [Modifying the double strand]

[61] 0.474 0.0735 0.768 0.0679 [Modifying the double strand]

[62] 0.323 0.0501 0.607 0.0020 [Modifying the double strand]

[63] 0.473 0.0316 0.793 0.0432 [Modifying the double strand]

[66] 0.294 0.0217 0.533 0.0585 [Modifying the double strand]

[67] 0.292 0.0320 0.670 0.0792 [Modifying the double strand]

[68] 0.428 0.0305 0.868 0.0701 [Modifying the double strand]

[69] 0.204 0.0434 0.448 0.0239 [Modifying the double strand]

[70] 0.302 0.0275 0.763 0.0381 [Modifying the double strand]

[64] 0.347 0.0669 0.565 0.0316 [Modifying the double strand]

[46] 0.365 0.0473 0.710 0.0430 [PC B] 0.232 0.0353 0.381 0.0273

[0860] [Table 4] Results of single-dose testing of modified double strands [Double-stranded number] [1 nM siRNA] [0.1 nM siRNA] [Mean] [SD] [Mean] [SD] [Modifying the double strand]

[71] 0.428 0.069 0.640 0.050 [Modifying the double strand]

[72] 0.439 0.059 0.641 0.079 [Modifying the double strand]

[73] 0.528 0.100 0.953 0.075 [Modifying the double strand]

[74] 0.511 0.140 0.701 0.119 [Modifying the double strand]

[75] 0.402 0.079 0.708 0.062 [Modifying the double strand]

[76] 0.359 0.085 0.581 0.078 [Modifying the double strand]

[77] 0.444 0.052 0.719 0.032 [Modifying the double strand]

[78] 0.401 0.034 0.635 0.092 [Modifying the double strand]

[79] 0.480 0.110 0.556 0.022 [Modifying the double strand]

[80] 0.499 0.033 0.519 0.017 [Modifying the double strand]

[81] 0.482 0.132 0.745 0.166 [Modifying the double strand]

[82] 0.499 0.053 0.508 0.064 [Modifying the double strand]

[83] 0.466 0.040 0.611 0.058 [Modifying the double strand]

[84] 0.463 0.097 0.547 0.018 [Modifying the double strand]

[85] 0.512 0.050 0.720 0.070 [Modifying the double strand]

[86] 0.462 0.071 0.522 0.034 [Modifying the double strand]

[87] 0.585 0.061 0.595 0.076 [Modifying the double strand]

[88] 0.376 0.030 0.506 0.057 [Modifying the double strand]

[69] 0.483 0.092 0.679 0.081 [PC B] 0.366 0.063 0.530 0.083

[0861] [Table 5] Results of single-dose testing of modified double strands [Double-stranded number] [1 nM siRNA] [0.1 nM siRNA] [Mean] [SD] [Mean] [SD] [Modifying the double strand]

[89] 0.295 0.0004 0.458 0.0014 [Modifying the double strand]

[90] 0.283 0.0005 0.581 0.0008 [Modifying the double strand]

[91] 0.289 0.0006 0.470 0.0002 [Modifying the double strand]

[92] 0.298 0.0006 0.508 0.0012 [Modifying the double strand]

[93] 0.248 0.0003 0.489 0.0005 [Modifying the double strand]

[94] 0.228 0.0007 0.445 0.0006 [Modifying the double strand]

[95] 0.239 0.0003 0.571 0.0007 [Modifying the double strand]

[96] 0.262 0.0006 0.524 0.0007 [Modifying the double strand]

[97] 0.288 0.0005 0.545 0.0008 [Modifying the double strand]

[98] 0.252 0.0005 0.564 0.0008 [Modifying the double strand]

[99] 0.203 0.0002 0.655 0.0002 [Modifying the double strand]

[0100] 0.171 0.0004 0.586 0.0005 [PC B] 0.147 0.0005 0.306 0.0003

[0862] [Table 6] Results of single-dose testing of modified double strands [Double-stranded number] [1 nM siRNA] [0.1 nM siRNA] [Mean] [SD] [Mean] [SD] [Modifying the double strand]

[76] 0.243 0.025 0.398 0.018 [Modifying the double strand]

[88] 0.286 0.051 0.368 0.040 [Modifying the double strand]

[0101] 0.175 0.011 0.339 0.015 [Modifying the double strand]

[0102] 0.170 0.019 0.315 0.051 [Modifying the double strand]

[0103] 0.180 0.015 0.291 0.043 [Modifying the double strand]

[0104] 0.207 0.026 0.465 0.045 [Modifying the double strand]

[0105] 0.216 0.056 0.374 0.040 [Modifying the double strand]

[0106] 0.303 0.064 0.433 0.004 [Modifying the double strand]

[0107] 0.260 0.023 0.418 0.020 [Modifying the double strand]

[0108] 0.219 0.039 0.293 0.014 [Modifying the double strand]

[0109] 0.226 0.073 0.343 0.013 [Modifying the double strand]

[0110] 0.236 0.018 0.296 0.016 [Modifying the double strand]

[0111] 0.344 0.021 0.299 0.052 [Modifying the double strand]

[0112] 0.300 0.054 0.661 0.043 [Modifying the double strand]

[0113] 0.247 0.063 0.449 0.019 [Modifying the double strand]

[0114] 0.221 0.100 0.495 0.029 [Modifying the double strand]

[0115] 0.353 0.018 0.565 0.006 [Modifying the double strand]

[0116] 0.298 0.042 0.286 0.044 [PC B] 0.224 0.018 0.306 0.036

[0863] In vitro experiments revealed that modified duplexes with mismatches, particularly those with mismatches at positions 19, 20, or 21 of the antisense strand (from the 5' to the 3' end) exhibited significantly enhanced in vitro activity compared to duplexes without mismatches at these positions (e.g., modified duplex 76).

[0864] [Table 7] Results of Single-Dose Tests of Conjugates [Double-stranded number] [1 nM siRNA] [0.1 nM siRNA] [Mean] [SD] [Mean] [SD] [Conjugate]

[0110] 0.256 0.022 0.399 0.064 [Conjugate]

[0117] 0.399 0.064 0.631 0.002 [Conjugate]

[0118] 0.252 0.061 0.613 0.170 [Conjugate]

[0119] 0.173 0.066 0.397 0.012 [Conjugate]

[0120] 0.270 0.027 0.717 0.129 [Conjugate]

[0121] 0.773 0.096 1.138 0.140 [Conjugate]

[0122] 0.496 0.112 0.867 0.127 [Conjugate]

[0123] 0.704 0.124 0.851 0.187 [Conjugate]

[0101] 0.232 0.015 0.416 0.115 [Conjugate]

[0102] 0.197 0.013 0.402 0.061 [Conjugate]

[0103] 0.222 0.010 0.482 0.068 [Conjugate]

[0124] 0.252 0.104 0.472 0.113 [Conjugate]

[0125] 0.686 0.120 0.799 0.082 [Conjugate]

[0129] 0.303 0.088 0.594 0.090 [Conjugate]

[0130] 0.230 0.025 0.403 0.037 [Conjugate]

[0133] 0.284 0.063 0.793 0.053 [Conjugate]

[0134] 0.278 0.045 0.623 0.095 [Conjugate]

[0135] 0.332 0.065 0.613 0.042 [Conjugate]

[0136] 0.508 0.032 0.929 0.062 [PC C] 0.192 0.032 0.446 0.137

[0865] [Table 8] Results of single-dose tests of conjugates [Double-stranded number] [1 nM siRNA] [0.1 nM siRNA] [Mean] [SD] [Mean] [SD] [Conjugate]

[0155] 0.221 0.0230 0.376 0.303 [Conjugate]

[0156] 0.158 0.0111 0.285 0.0119 [Conjugate]

[0157] 0.132 0.0340 0.218 0.0379 [Conjugate]

[0162] 0.153 0.0170 0.240 0.0198 [Conjugate]

[0166] 0.154 0.0114 0.312 0.0257 [Conjugate]

[0171] 0.184 0.0161 0.273 0.0099 [Conjugate]

[0172] 0.138 0.0503 0.237 0.0286 [Conjugate]

[0175] 0.115 0.0304 0.149 0.0295 [Conjugate]

[0181] 0.173 0.0283 0.221 0.0072 [Conjugate]

[0182] 0.131 0.0021 0.252 0.0489 [Conjugate]

[0183] 0.162 0.0388 0.216 0.0236 [Conjugate]

[0184] 0.147 0.0153 0.220 0.0123 [Conjugate]

[0185] 0.160 0.0090 0.226 0.0236 [Conjugate]

[0186] 0.313 0.0162 0.417 0.0292 [Conjugate]

[0187] 0.230 0.1013 0.239 0.0652 [Conjugate]

[0188] 0.209 0.0780 0.219 0.0870 [Conjugate]

[0189] 0.249 0.0201 0.246 0.0296 [Conjugate]

[0190] 0.309 0.0406 0.342 0.0526 [Conjugate]

[0191] 0.292 0.1159 0.264 0.0137 [Conjugate]

[0192] 0.333 0.0879 0.380 0.0775 [Conjugate]

[0193] 0.368 0.0218 0.433 0.0156 [Conjugate]

[0194] 0.323 0.0486 0.417 0.0674 [Conjugate]

[0195] 0.298 0.0552 0.323 0.0655 [Conjugate]

[0196] 0.283 0.0647 0.411 0.2027 [Conjugate]

[0197] 0.352 0.0288 0.384 0.0143 [Conjugate]

[0198] 0.264 0.0327 0.345 0.0170 [PC C] 0.246 0.0380 0.494 0.0506

[0866] [Table 9] In vitro IC50 test results of conjugate 182 [Double-stranded number] [Dosage] [Mean] [SD] [Conjugate]

[0182] 10nM 0.060 0.012 1.0nM 0.139 0.075 0.1nM 0.183 0.087 0.01n M 0.725 0.046 0.001nM 0.937 0.081 0.0001nM 1.004 0.029 0.00001nM 0.982 0.080

[0867] The results in Table 9 show that the IC50 curve of conjugate 182 has a good nonlinear fit, with an IC50 value of 0.01975 nM and an R squared value of 0.9734.

[0868] Example 3: Free uptake of primary liver cells from PCH-treated cynomolgus monkeys

[0869] Resuscitation of primary liver cells from cynomolgus monkeys: 1 mL of primary liver cells from cynomolgus monkeys was added to 19 mL of culture medium and gently inverted to mix. The cells were centrifuged at 50×g for 5 minutes, the supernatant was discarded, and the cells were resuspended in 10 mL of culture medium.

[0870] Drug administration: The diluted siRNA conjugate was added at a rate of 10 μL / well to 96-well collagen-coated cell plates (drug-treated group), and 5.4 × 10⁴ cells / well of PCH were seeded into the 96-well cell plates. A nuclease-free water control group without siRNA conjugate was also set up. After plating, the plates were incubated at 37°C in a 5% CO₂ incubator.

[0871] RNA Extraction and Reverse Transcription: After 48 hours of free uptake, the culture medium was removed and cells were collected for RNA extraction. Total RNA was extracted using the RNeasy® 96 Kit (QIAGEN-74182) according to the kit instructions. cDNA synthesis was then performed using the gDNA Removal and cDNA Synthesis Kit (VAZYME, Cat: RC333-01) according to the manufacturer's instructions. 400 ng of total RNA was added to each sample, and cDNA synthesis was performed using a gradient thermal cycler (Bio-rad, T100) following the manufacturer's instructions.

[0872] qPCR detection of target gene mRNA expression level: The synthesized cDNA and mixed stock solution (containing primers, 1×SYBR Green premix and ultrapure water) were added to a 96-well plate (Thermofisher, Cat: A36924) to make the final real-time quantitative PCR system contain the target gene (hAGT) or internal reference gene (GADPH), 0.4 μM each of forward and reverse primers, and 1×SYBR Green premix (Thermofisher, Cat: A25742).

[0873] Data analysis: The expression level of the target gene AGT mRNA in each sample was calculated based on the CT value, using the ΔΔCT relative quantification method. The relative expression level of the target gene was expressed as 2-ΔΔCT.

[0874] The calculation formula is as follows:

[0875] ΔCT = Average CT value of target gene - Average CT value of internal reference gene

[0876] ΔCT = ΔCT (drug-treated group) - ΔCT (nuclease-free water control group)

[0877] Relative expression level of target gene mRNA = 2 - ΔΔCT

[0878] Inhibition rate % = (1 - relative expression level in the drug-treated group / average expression level in the nuclease-free water control) × 100

[0879] The results of the in vitro activity tests of the conjugates are shown in Table 10. The test results are expressed as mean ± SD.

[0880] [Table 10] Results of siRNA conjugate free uptake assay in primary liver cells of cynomolgus monkeys [Double-stranded number] [10nM siRNA] [1 nM siRNA] [Mean] [SD] [Mean] [SD] [PC C] 8.12% 0.460 23.32% 0.784 [Conjugate]

[0155] 5.73% 0.240 15.80% 0.588 [Conjugate]

[0156] 4.46% 0.343 13.14% 0.610 [Conjugate]

[0166] 20.26% 0.765 60.49% 1.489 [Conjugate]

[0150] 5.01% 0.517 15.25% 1.092 [Conjugate]

[0157] 6.26% 0.937 19.37% 1.257 [Conjugate]

[0162] 7.39% 0.974 20.73% 1.437 [Conjugate]

[0182] 6.35% 0.606 13.90% 0.726 [Conjugate]

[0183] 7.17% 0.407 16.69% 1.523 [Conjugate]

[0175] 28.98% 1.380 47.07% 1.721 [Conjugate]

[0172] 5.57% 0.515 12.26% 2.789 [Conjugate]

[0171] 10.38% 0.824 20.33% 2.216 [Conjugate]

[0185] 6.35% 0.310 15.83% 2.364 [Conjugate]

[0151] \ \ 21.58% 3.430 [Conjugate]

[0181] \ \ 12.51% 1.730 [Conjugate]

[0184] \ \ 12.19% 1.070

[0881] Example 4: Free uptake by PHH human primary liver cells

[0882] Human primary liver cells resuscitation: Take 1 mL of human primary liver cells and add them to 19 mL of culture medium. Gently invert and mix. Centrifuge at 50×g for 5 min. Discard the supernatant and resuspend in 10 mL of culture medium.

[0883] Drug administration: The diluted siRNA conjugate was added at a rate of 10 μL / well to 96-well collagen-coated cell plates (drug-treated group), and 5.4 × 10⁴ cells / well of PCH were seeded into the 96-well cell plates. A nuclease-free water control group without siRNA conjugate was also set up. After plating, the plates were incubated at 37°C in a 5% CO₂ incubator.

[0884] RNA Extraction and Reverse Transcription: After 48 hours of free uptake, the culture medium was removed and cells were collected for RNA extraction. Total RNA was extracted using the RNeasy® 96 Kit (QIAGEN-74182) according to the kit instructions. cDNA synthesis was then performed using the gDNA Removal and cDNA Synthesis Kit (VAZYME, Cat: RC333-01) according to the manufacturer's instructions. 400 ng of total RNA was added to each sample, and cDNA synthesis was performed using a gradient thermal cycler (Bio-rad, T100) following the manufacturer's instructions.

[0885] qPCR detection of target gene mRNA expression level: The synthesized cDNA and mixed stock solution (containing primers, 1×SYBR Green premix and ultrapure water) were added to a 96-well plate (Thermofisher, Cat: A36924) to make the final real-time quantitative PCR system contain the target gene (AGT) or internal reference gene (GADPH), 0.4 μM each of forward and reverse primers, and 1×SYBR Green premix (Thermofisher, Cat: A25742).

[0886] Data analysis: The expression level of the target gene AGT mRNA in each sample was calculated based on the CT value, using the ΔΔCT relative quantification method. The relative expression level of the target gene was expressed as 2-ΔΔCT.

[0887] The calculation formula is as follows:

[0888] ΔCT = Average CT value of target gene - Average CT value of internal reference gene

[0889] ΔCT = ΔCT (drug-treated group) - ΔCT (nuclease-free water control group)

[0890] Relative expression level of target gene mRNA = 2 - ΔΔCT

[0891] Inhibition rate % = (1 - relative expression level in the drug-treated group / average expression level in the nuclease-free water control) × 100

[0892] The results of the in vitro activity tests of the conjugates are shown in Table 11. The test results are expressed as mean ± SD.

[0893] [Table 11] Results of siRNA conjugate free uptake assay in primary human liver cells [Double-stranded number] [10nM siRNA] [1 nM siRNA] [Mean] [SD] [Mean] [SD] [PC C] 11.10% 0.390 38.6% 2.814 [Conjugate]

[0155] 10.59% 0.304 39.4% 2.503 [Conjugate]

[0156] 9.23% 0.339 30.2% 4.727 [Conjugate]

[0166] 49.97% 0.625 94.5% 7.973 [Conjugate]

[0150] 10.51% 0.665 35.6% 1.339 [Conjugate]

[0157] 12.48% 0.752 56.2% 7.993 [Conjugate]

[0162] 11.75% 0.870 39.8% 0.474 [Conjugate]

[0182] 9.55% 0.415 26.9% 4.507 [Conjugate]

[0183] 15.51% 0.959 36.8% 2.562 [Conjugate]

[0175] 54.86% 0.884 72.3% 8.997 [Conjugate]

[0172] 11.70% 1.886 31.4% 6.080 [Conjugate]

[0171] 18.10% 1.423 40.7% 8.303 [Conjugate]

[0185] 15.31% 1.560 44.5% 5.282 [Conjugate]

[0151] \ \ 47.4% 6.772 [Conjugate]

[0181] \ \ 27.2% 3.715 [Conjugate]

[0184] \ \ 25.2% 3.944

[0894] In vitro experiments revealed that several conjugates, including conjugate 156 and conjugate 182, exhibited significantly better in vitro activity than *Codonopsis pilosula*.

[0895] Example 5 In vivo activity experiment

[0896] (1) Silencing of AGT in transgenic mice expressing human AGT:

[0897] Transgenic mice expressing human AGT were administered different doses of siRNA subcutaneously once (3 mice / group), while a PBS control group (3 mice / group) was set up. Blood samples were collected one day before administration and every 7 days after administration.

[0898] After serum was extracted from the blood, the expression level of hAGT protein was detected by ELISA. The expression level of hAGT protein one day before drug administration was used as the baseline value to calculate KD. The results of the in vivo activity test of some conjugates in mice are shown in Table 12. The test results are expressed as mean ± SD.

[0899] [Table 12] Results of in vivo mouse experiments [Conjugate Number] [time] [serum] [AGT] [of] [KD] [Mean] [SD] [Conjugate]

[0155] [(] [1mg / kg, n=3] [)] -1 day 1.00 0.13 7 days 0.18 0.02 14 days 0.21 0.04 [Conjugate]

[0157] [(] [1mg / kg, n=3] [)] -1 day 1.00 0.05 7 days 0.17 0.04 14 days 0.24 0.05 [Conjugate]

[0162] [(] [1mg / kg, n=3] [)] -1 day 1.00 0.03 7 days 0.17 0.01 14 days 0.22 0.01 [Conjugate]

[0171] [(] [1mg / kg, n=3] [)] -1 day 1.00 0.13 7 days 0.18 0.00 14 days 0.21 0.02 [Conjugate]

[0172] [(] [1mg / kg, n=3] [)] -1 day 1.00 0.07 7 days 0.19 0.01 14 days 0.24 0.03 [Conjugate]

[0175] [(] [1mg / kg, n=3] [)] -1 day 1.00 0.02 7 days 0.21 0.02 14 days 0.27 0.01 [Conjugate]

[0182] [(] [1mg / kg, n=3] [)] -1 day 1.00 0.09 7 days 0.13 0.01 14 days 0.15 0.03 [Conjugate]

[0183] [(] [1mg / kg, n=3] [)] -1 day 1.00 0.08 7 days 0.16 0.01 14 days 0.19 0.00 [PC C] [(] [1mg / kg, n=3] [)] -1 day 1.00 0.03 7 days 0.45 0.10 14 days 0.38 0.06 [PBS] [(] [n=3] [)] -1 day 1.00 0.16 7 days 0.90 0.14 14 days 0.84 0.12

[0900] (2) Study on the activity and long-term effects in cynomolgus monkeys:

[0901] In vivo activity and long-term efficacy were assessed using cynomolgus monkeys. Different doses of siRNA were administered subcutaneously to cynomolgus monkeys (3 males per group). Blood samples were collected on days 1, 6, and 15 before administration and after administration. hAGT protein expression was measured using ELISA. The mean hAGT protein expression levels on days 1, 6, and 15 before administration were used as baseline values. The in vivo activity test results of the partial conjugates in cynomolgus monkeys are shown in Table 13, and the results are expressed as mean ± SD.

[0902] [Table 13] Results of in vivo experiments on cynomolgus monkeys [Conjugate Number] [time] [serum] [AGT] [of] [KD] [Mean] [SD] [Conjugate]

[0156] [(] [3mg / kg, n=3] [)] Baseline value 1.00 0.04 4 days 0.90 0.13 8 days 0.43 0.07 14 days 0.19 0.03 22 days 0.14 0.03 28 days 0.12 0.03 36 days 0.13 0.03 42 days 0.18 0.04 [Conjugate]

[0182] [(] [3mg / kg, n=3] [)] Baseline value 1.00 0.08 4 days 0.72 0.09 8 days 0.28 0.03 14 days 0.11 0.01 22 days 0.08 0.01 28 days 0.08 0.01 36 days 0.10 0.02 42 days 0.12 0.01 [Conjugate]

[0182] [(] [6mg / kg, n=3] [)] Baseline value 1.00 0.05 4 days 0.70 0.10 8 days 0.24 0.03 14 days 0.09 0.01 22 days 0.07 0.02 28 days 0.06 0.01 36 days 0.07 0.02 42 days 0.10 0.04 [PC C] [(] [3mg / kg, n=3] [)] Baseline value 1.00 0.21 4 days 0.93 0.09 8 days 0.35 0.06 14 days 0.18 0.03 22 days 0.17 0.06 28 days 0.16 0.04 36 days 0.17 0.04 42 days 0.27 0.09

[0903] The results showed that, in vivo experiments in monkeys, both conjugates 156 and 182 exhibited good KD activity, and their KD activity was significantly better than that of PC C. Furthermore, they still showed good AGT inhibitory effects 42 days after administration.

[0904] Example 6: Stability of SD rat and human serum

[0905] 20 μL of the siRNA to be tested was added to 180 μL of SD rat or human serum and incubated at 37℃ for 0 h, 24 h, and 48 h, respectively. After incubation, the mixture was vortexed and 200 μL of lysis buffer (Pyromex, Cat: #AL0-8579) was added. Extraction was performed using an SPE column (Pyromex, Cat: #8B-S103-EBJ). 5 μL of the extracted product was separated using an Agilent oligonucleotide Waters (100 mm × 2.1 mm, 2.7 μm) chromatography column. High-resolution mass spectrometry was used to detect the residual amounts of the sense and antisense strands and the amount of metabolites produced. 0 h was used as a blank control.

[0906] The results showed that PC C and its conjugates 155, 156, 162, 182 and 184 were stable after incubation at 37°C for 48 hours in SD rat or human serum.

[0907] Example 7: Cytotoxicity Test

[0908] Cell culture: Hep3B cells were cultured at 37°C and 5% CO2 in DMEM complete medium (Gibco, with 10% FBS and 1% penicillin-streptomycin) until near confluence. Then, the cells were digested with trypsin and seeded into plates. 7000 Hep3B cells and 0.1 mL of DMEM complete medium were added to each well of a 96-well plate and cultured at 37°C and 5% CO2 for 16-24 h before transfection.

[0909] Cell transfection: Add 0.3 μL of lipofectamine RNAiMax (Invitrogen) to each well of 4.7 μL opti-MEM, then add 5 μL of opt-MEM dilution of the siRNA conjugate and mix. Add the mixture to centrifuge tubes and incubate at room temperature for 5 min. Finally, add the siRNA transfection complex to the cells and continue culturing for 24 h, 48 h, or 96 h before performing cytotoxicity assays. This experiment was performed at siRNA conjugate concentrations of 100 nM, 10 nM, and 1 nM.

[0910] Cytotoxicity test: Cytotoxicity was performed using the CCK-8 kit (Abmle Cat: #M4839-5007ests). After transfecting Hep3B cells for 24h, 48h, or 96h as described above, the culture medium was removed, and 500 μL of the corresponding complete culture medium (containing 10% CCK-8) was added to each well. The cells were incubated at 37℃ for 30-60 min in the dark. The OD value of the samples was detected using a microplate analyzer (Tecan Cat: #spark 20M) with a wavelength of 450 nm and a reference wavelength of 620 nm.

[0911] The results showed that PC C and its conjugates 155, 156, 162, 182 and 184 did not exhibit significant cytotoxicity and had no effect on cell proliferation.

[0912] Example 8: siRNA off-target detection

[0913] Cell culture: Hep3B cells were cultured at 37°C and 5% CO2 in DMEM complete medium (Gibco, with 10% FBS and 1% penicillin-streptomycin) until near confluence. Then, the cells were digested with trypsin and seeded into 24-well plates. 1.0 × 10⁵ Hep3B cells and 1.0 mL of DMEM complete medium were added to each well. After culturing at 37°C and 5% CO2 for 16-24 h, transfection was performed.

[0914] Cell transfection: Add 3 μL of lipofectamine RNAiMax (Invitrogen) to each well of 47 μL opti-MEM, then add 50 μL of opt-MEM dilution of the siRNA conjugate and mix. Add the mixture to centrifuge tubes and incubate at room temperature for 5 min. Finally, add the siRNA transfection complex to the cells and continue culturing for 24 h before RNA extraction. Single-dose experiments were performed using 10 nM and 1 nM siRNA conjugate concentrations.

[0915] RNA extraction: Wash cells with PBS, then add 1 mL of Trizol reagent, vortex, and incubate at room temperature for 5 min. Centrifuge at 12000×g for 10 min at 4ºC. Transfer the upper aqueous phase to a new 1.5 mL EP tube (approximately 400-500 µL), and incubate at room temperature for 5 min to allow for complete cell lysis. Add 200 µL of chloroform to each 1 mL of Trizol, tighten the cap, vortex, and incubate at room temperature for 3-5 min to allow for natural phase separation. Centrifuge at 12000×g for 10 min at 4ºC. The mixture will separate into three layers: a red lower layer (phenol-chloroform organic phase), a middle protein layer, and a colorless upper aqueous phase. RNA is mainly concentrated in the aqueous phase. Transfer the upper aqueous phase (approximately 400-500 µL), add an equal volume of chloroform / isoamyl alcohol (24:1), mix, incubate on ice for 5 min, and centrifuge at 12000×g for 10 min at 4ºC. Repeat the chloroform / isoamyl alcohol extraction once until the intermediate layer is relatively clean. Add an equal volume of isopropanol to the transferred supernatant and incubate at -20°C for 1 hour. Centrifuge at 13600 rpm for 20 minutes at 4°C and discard the supernatant. Wash the RNA precipitate twice with 1.0 mL of 75% ethanol, incubating for 3 minutes each time, inverting the washing direction during the wash, and centrifuging at 13600 rpm for 3 minutes at 4°C. Remove the residual ethanol, air dry the precipitate in a clean bench, and dissolve the RNA precipitate in 30–50 µL of nuclease-free water.

[0916] mRNA sequencing: Take 1 μg of extracted total RNA, remove RNase, process the sample with an rRNA kit and construct a library, and sequence all samples using a second-generation sequencer (NovaSeq6000, Illumina). Compare and analyze the sequencing results with those of blank samples.

[0917] The degree of inhibition of the target gene AGT expression was compared with the degree of inhibition of all other mRNAs expressed in Hep3B cells. The results showed that PC C and conjugates 155, 156, 162, 182 and 184 had no significant off-target risk.

[0918] Example 9: siRNA Immunogenicity Test

[0919] Cell resuscitation and plating: Remove one vial of frozen PBMC cells from the liquid nitrogen tank and immediately thaw them in a 37°C water bath. Transfer the cells to preheated complete culture medium RF (RPMI 1640 + 10% FBS, prepared in advance) and mix well. Take a small amount of the cell suspension and count and assess cell viability using a cell counter and hemocytometer. Add RF to a final volume of 14 mL, and centrifuge the cells in the tube at 400 g for 10 min at room temperature. Discard the supernatant, add 2 mL of RF, gently disperse the cells and mix well. Plate 8 × 10⁵ cells per well in a 96-well plate, with a volume of 0.2 mL / well.

[0920] Cell transfection: 0.6 μL / well of transfection reagent (Lipofectamine RNAiMax, Invitrogen); 24.4 μL / well of Opti-MEM (Invitrogen); siRNA conjugate dosages were 1 μM, 100 nM, and 10 nM, respectively. 50 μL / well of the above mixed solution was transferred to the above-mentioned 96-well cell culture plates and incubated at 37°C for 24 h.

[0921] Cytokine detection: After 24 h, the cell culture supernatant was transferred to a new centrifuge tube and centrifuged at 1000×g for 20 min at 2-8℃. The supernatant was collected. Cytokines were quantified using the hIFN-α and hIL-6 ELISA kit (Elabscience), and the optical density (OD value) of each well was measured at 450 nm using a microplate analyzer.

[0922] The results showed that PC C and its conjugates 155, 156, 162, 182 and 184 did not significantly affect the expression of hIFN-α and hIL-6 in PBMC cells.

[0923] The applicant found that the conjugates of this application (e.g., conjugate 182) exhibited excellent overall drug properties in terms of in vitro activity in Hep3B cells, in vitro activity with free uptake in cynomolgus primary liver cells, in vitro activity with free uptake in human primary liver cells, in vivo activity in transgenic mice and cynomolgus monkeys containing AGT, and in vitro stability, and were superior to PC C.

[0924] none

[0925] TW202544248A_114116345_SEQL.xml

Claims

1. A siRNA for inhibiting angiotensinogen expression, said siRNA comprising a sense strand and an antisense strand, wherein, The sequence of the antisense chain is 5'-UACUCAUUAGAAGAAAAGGAGGG-3' (SEQ ID NO: 113), and the sequence of the justice chain is 5'-CUCCUUUUCUUCUAAUGAGUA-3' (SEQ ID NO: 112).

2. The siRNA as described in claim 1, wherein, The antisense strand has the following modified nucleotides: (1) The nucleotides at positions 2, 6, 7, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides; the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides; the nucleotide at position 1 in the 5' to 3' direction of the antisense strand is further modified with (E)-VP; (2) The nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction and at position 2 in the 3' to 5' direction of the antisense strand are 2'-fluoronucleotides; the nucleotides at other positions of the antisense strand are 2'-methoxynucleotides; the nucleotide at position 1 in the 5' to 3' direction of the antisense strand may further have (E)-VP modification; or (3) The nucleotides at positions 2, 6, 7, 14, and 16 in the 5' to 3' direction of the antisense strand and at position 2 in the 3' to 5' direction of the antisense strand are 2'-fluoronucleotides; the nucleotide at position 10 in the 5' to 3' direction of the antisense strand is further 2'-fluoronucleotides; the nucleotides at other positions of the antisense strand are 2'-methoxynucleotides; the nucleotide at position 1 in the 5' to 3' direction of the antisense strand is further (E)-VP modification.

3. The siRNA as described in claim 1 or 2, wherein, The nucleotides at positions 9, 11, 12, 13, and 15 of the positive strand from the 3' to the 5' end are 2'-fluoronucleotides, and the nucleotides at other positions of the positive strand are 2'-methoxynucleotides. Furthermore, the nucleotides at positions 19 and 20, and positions 20 and 21 of the positive strand from the 3' to the 5' end are linked by a thiophosphate group. Similarly, the nucleotides at positions 2, 6, 7, 14, 16, and 22 of the antisense strand from the 5' to the 3' end are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand are 2'-methoxynucleotides. The nucleotide at position 1 of the antisense strand from the 5' to the 3' end is further modified with (E)-VP, and the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23 of the antisense strand from the 5' to the 3' end are linked by a thiophosphate group.

4. The siRNA as described in claim 1 or 2, wherein, The siRNA is modified double-stranded 182.

5. A siRNA conjugate, wherein, The siRNA conjugate is obtained by conjugating an siRNA as described in any one of claims 1-4 with a conjugate molecule.

6. The siRNA conjugate as described in claim 5, wherein, The conjugated molecule comprises: .

7. The siRNA conjugate as described in claim 5 or 6, wherein, The siRNA conjugate is conjugate 156 or conjugate 182.

8. A pharmaceutical composition, wherein, The pharmaceutical composition contains siRNA as described in any one of claims 1-4 or siRNA conjugates as described in any one of claims 5-7 as the active ingredient and a pharmaceutically acceptable carrier.

9. A reagent kit, wherein, The kit contains at least one of the following: siRNA as described in any one of claims 1-4, siRNA conjugates as described in any one of claims 5-7, and pharmaceutical compositions as described in claim 8.

10. Use of at least one of the siRNAs of any one of claims 1-4, the siRNA conjugates of any one of claims 5-7, and the pharmaceutical composition of claim 8 in the preparation of a medicament for treating angiotensinogen dysregulation-related diseases, said angiotensinogen dysregulation-related diseases being selected from hypertension.

11. The use as described in claim 10, wherein the hypertension is selected from at least one of borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and unstable hypertension.