Use of composition including mesenchymal stem cells for alleviating myelofibrosis

Abstract

The present invention provides a composition comprising mesenchymal stem cells for use in the preparation of a pharmaceutical product for alleviating myelofibrosis in an individual.

Description

Technical Field

[0001] The present invention relates to the use of a composition comprising mesenchymal stem cells in alleviating myelofibrosis.

[0002] The attached sequence listing with the file name "SEQUENCE LISTING.xml", creation date of August 24, 2023 and size of 20.4 kilobytes is part of the specification and is incorporated into the specification in its entirety as a reference. Prior Art

[0003] Myelofibrosis (MF) is a type of myeloproliferative neoplasm (MPN), a group of cancers in which abnormal cells grow in the bone marrow. MF is typically associated with BCR-ABL1 gene fusion and overactivation of JAK signaling due to mutations in genes such as JAK2, MPL, and CALR. In MF, healthy bone marrow is replaced by scar tissue (fibrosis), leading to cytopenia, which causes anemia, increased susceptibility to infection, and splenomegaly. MF can be divided into primary MF (PMF) and secondary MF based on the pathogenic progression. Primary myelofibrosis (PMF) is myelofibrosis that develops in the absence of any preceding MPNs, while secondary myelofibrosis refers to myelofibrosis that develops from other MPNs such as essential thrombocythemia (ET) and polycythemia vera (PV) and can be classified as post-ET MF and post-PV MF.

[0004] The only curative treatment for myelofibrosis is allogeneic hematopoietic stem-cell transplantation (HSCT), in which patients undergo complete or partial bone marrow removal (i.e., myeloablative or nonmyeloablative HSCT) to remove mutated MPN cells in the bone marrow and then receive hematopoietic stem cells from a healthy donor; however, allogeneic HSCT is used in only 5% of patients because of human leukocyte antigen matching requirements and severe complications, including graft-versus-host disease (GvHD). To date, the U.S. Food and Drug Administration (FDA) has approved three JAK inhibitors for the treatment of intermediate-risk or high-risk myelofibrosis: ruxolitinib (Jakavi), fedratinib (Inrebic), and pacritinib (Vonjo). However, these drugs can only alleviate splenomegaly and some constitutional symptoms but cannot improve anemia and bone marrow fibrosis.

[0005] In myelofibrosis, fibrosis of bone marrow stromal cells may be induced by TGF-β1, megakaryocytes, or MPN cells. Inflammatory cytokines (such as IL-1β, IL-6, and TNF-α) released from fibrotic bone marrow stromal cells, megakaryocytes, or MPN cells are crucial for the pathogenesis of myelofibrosis. Targeting TGF-β1, megakaryocytes, MPN cells, and these inflammatory cytokines has been reported to alleviate myelofibrosis by reducing bone marrow fibrosis and / or indirectly regulating the differentiation and proliferation of megakaryocytes and MPN cells.

[0006] Phagocytic mesenchymal stem cells (MSCs) have been reported to possess immunomodulatory properties, effectively reducing inflammatory cytokines. In recent years, several studies have reported the use of MSCs in HSCT to control GvHD in patients diagnosed with myelofibrosis; however, the effectiveness of this approach remains unclear due to the limited number of cases and the lack of improvement in patient life expectancy after HSCT.

[0007] Therefore, there is an urgent need to develop new methods for the effective treatment of myelofibrosis. Summary of the Invention

[0008] [Summary of the Invention]

[0009] Therefore, an object of the present invention is to provide a composition for use in alleviating myelofibrosis, which can alleviate at least one disadvantage of the prior art.

[0010] According to the present invention, the composition is provided for use in preparing a medicament for alleviating myelofibrosis in a subject. Simple diagram description

[0011] Other features and advantages of the present invention will become apparent from the following detailed description of the specific examples with reference to the accompanying drawings. It should be noted that various features may not be drawn to scale.

[0012] FIG1 shows the platelet count (left panel), red blood cell (RBC) count (center panel), and hemoglobin concentration (right panel) of TPO-overexpressing mice at 8 weeks after transplantation in Example 1 below, where the symbols "*" and "***" indicate p < 0.05 and p < 0.001, respectively, compared to the control group.

[0013] Figure 2 shows (a) the hemoglobin concentration (left panel) and RBC count (right panel) of each group of mice before and after administration of umbilical cord-derived mesenchymal stem cells (UCMSCs) in Example 1 below, (b) and (c) the spleen size and weight of each group of mice, (d) hematoxylin and eosin (H&E) staining of the bone marrow of each group of mice, (e) periodic acid-Schiff (PAS) staining of the bone marrow of each group of mice, and (f) the relative percentage of PAS-stained (PAS+) area (left panel) and the relative percentage of PAS+ intensity (right panel) of the bone marrow of each group of mice.

[0014] FIG3 shows the relative mRNA expression levels of (a) COL1A1, (b) FN1, (c) ACTA2, (d) IL-1β, (e) TNF-α, and (f) TGF-β1 genes in the bone marrow stromal cells of each group in Example 2 below. "***" indicates p < 0.001 compared with the normal control group, and "#," "##," and "###" indicate p < 0.05, p < 0.01, and p < 0.001, respectively, compared with the pathological control group.

[0015] FIG4 shows the relative mRNA expression levels of (a) COL1A1 gene, (b) FN1 gene, (c) ACTA2 gene, (d) IL-1β gene, (e) TNF-α gene, and (f) TGF-β1 gene in each group of bone marrow stromal cells in Example 2 below, wherein the symbols "*," "**," and "***" respectively indicate p<0.05, p<0.01, and p<0.001 compared to the normal control group, and the symbols "#" and "###" respectively indicate p<0.05 and p<0.001 compared to the pathological control group 3.

[0016] FIG5 shows the relative mRNA expression levels of (a) COL1A1 gene, (b) FN1 gene, (c) ACTA2 gene, (d) IL-1β gene, and (e) IL-6 gene in each group of bone marrow stromal cells in Example 2 below.

[0017] Figure 6 shows the relative mRNA expression levels of (a) COL1A1 gene, (b) FN1 gene, (c) ACTA2 gene, (d) IL-1β gene, and (e) IL-6 gene in each group of bone marrow stromal cells in Example 2 below, where the symbols "*" and "**" indicate p<0.05 and p<0.01, respectively, compared to the normal control group, and the symbols "#" and "##" indicate p<0.05 and p<0.01, respectively, compared to the pathological control group 2.

[0018] FIG. 7 shows the relative mRNA expression levels of (a) IL-1β gene, (b) IL-6 gene, (c) TNF-α gene, and (d) TGF-β1 gene in each group of MEG-01 cells in Example 2 below.

[0019] FIG8 shows the relative mRNA expression levels of (a) IL-6 gene and (b) TNF-α gene in each group of HEL cells in Example 2 below.

[0020] FIG9 shows the relative mRNA expression levels of (a) COL1A1 gene and (b) FN1 gene in the bone marrow stromal cells of each group in Example 2 below, where the symbols "**" and "***" indicate p<0.01 and p<0.001, respectively, compared to the normal control group, and the symbols "#" and "###" indicate p<0.05 and p<0.001, respectively, compared to the pathological control group.

[0021] FIG10 shows the relative mRNA expression levels of (a) COL1A1 and (b) FN1 genes in the bone marrow stromal cells of each group in Example 2 below, where "***" indicates p < 0.001 compared to the normal control group, and "##" and "###" indicate p < 0.01 and p < 0.001, respectively, compared to the pathological control group.

[0022] FIG. 11 shows the percentage of UCMSCs expressing indoleamine-pyrrole 2,3-dioxygenase (IDO) in each group after treatment with different concentrations of IFN-γ in Example 3 below.

[0023] FIG. 12 shows the percentage of UCMSCs expressing IDO in each group after treatment with different concentrations of IFN-γ for different time periods in Example 3 below.

[0024] FIG. 13 shows the relative mRNA expression levels of the IDO gene in each group after treatment with IFN-γ combined with supplements in Example 3 below.

[0025] FIG. 14 shows the relative percentage of UCMSCs expressing IDO in each group after treatment with IFN-γ for different time periods combined with treatment with budesonide for different time periods in Example 3 below.

[0026] FIG15 shows the relative mRNA expression levels of (a) COL1A1, (b) FN1, and (c) ACTA2 genes in the bone marrow stromal cells of each group in Example 3 below, wherein the symbol "***" indicates p < 0.001 compared with the normal control group; the symbols "#," "##," and "###" indicate p < 0.05, p < 0.01, and p < 0.001, respectively, compared with the pathological control group; and the symbols "$$" and "$$$" indicate p < 0.01 and p < 0.001, respectively, compared with comparison group 1.

[0027] FIG16 shows the relative mRNA expression levels of (a) COL1A1, (b) FN1, and (c) ACTA2 genes in the bone marrow stromal cells of each group in Example 3 below, where the symbols "*," "**," and "***" indicate p<0.05, p<0.01, and p<0.001, respectively, compared to the normal control group; the symbols "#," "##," and "###" indicate p<0.05, p<0.01, and p<0.001, respectively, compared to the pathological control group; and the symbol "$$" indicates p<0.01 compared to the comparison group. Implementation Method

[0028] [Detailed Description of the Invention]

[0029] It is to be understood that if any prior publication is cited herein, this does not constitute an admission that the prior publication forms part of the common general knowledge in the art.

[0030] For the purposes of this specification, it will be expressly understood that the word "comprising" means "including but not limited to," and that the word "comprises" has a corresponding meaning.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which this invention pertains. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein that can be used to practice the present invention. Of course, the present invention is in no way limited to the methods and materials described.

[0032] To address the limitations of current JAK inhibitors in the treatment of myelofibrosis, the applicants have developed improved approaches and discovered that administering mesenchymal stem cells (MSCs) to a mouse model of myelofibrosis can alleviate three key clinical symptoms of myelofibrosis: anemia, splenomegaly, and bone marrow fibrosis. Furthermore, in vitro experiments demonstrated that MSCs exhibit anti-fibrotic and anti-inflammatory effects in bone marrow stromal cells, megakaryocytes, and mesenchymal nephropathy (MPN) cells. Furthermore, the optimized MSCs, generated by optimizing the MSCs, demonstrated superior efficacy against fibrosis in bone marrow stromal cells compared to standard (non-optimized) MSCs.

[0033] Therefore, the present invention provides a composition comprising mesenchymal stem cells (MSCs) for use in the preparation of a medicament for alleviating myelofibrosis in a subject.

[0034] Exemplary MSCs include, but are not limited to, umbilical cord-derived mesenchymal stem cells (UCMSCs), bone marrow-derived mesenchymal stem cells (BMMSCs), adipose tissue-derived mesenchymal stem cells (AMSCs), dermis-derived mesenchymal stem cells (DMSCs), epidermis-derived mesenchymal stem cells (EMSCs), synovial membrane-derived mesenchymal stem cells (SMMSCs), dental tissue-derived mesenchymal stem cells (dental MSCs), and lung-derived mesenchymal stem cells (LMSCs). In some embodiments, the MSCs are UCMSCs.

[0035] In some embodiments, the UCMSCs may be unoptimized UCMSCs that have not been optimized. In some embodiments, the UCMSCs may be optimized UCMSCs that have been optimized. In one exemplary embodiment, the optimized UCMSCs are UCMSCs that express indoleamine-pyrrole 2,3-dioxygenase (IDO).

[0036] According to the present invention, the IDO-expressing UCMSCs can be prepared by culturing non-optimized UCMSCs in a medium supplemented with IFN-γ for a period of time ranging from 24 hours to 72 hours. In an exemplary embodiment, the IDO-expressing UCMSCs can be prepared by culturing non-optimized UCMSCs in a medium supplemented with IFN-γ for 72 hours.

[0037] In some embodiments, the culture medium is further supplemented with a substance in addition to IFN-γ. Examples of such substances may include, but are not limited to, vitamins, steroids, cytokines, double-stranded RNA (dsRNA), and histone deacetylase (HDAC) inhibitors. In one exemplary embodiment, the vitamin is retinoic acid, the steroid is dexamethasone and budesonide, the cytokine is TNF-α, the double-stranded RNA is polyinosinic acid-polycytidylic acid (PCPA), and the HDAC inhibitor is valproic acid.

[0038] As used herein, the term "subject" refers to any animal of interest, such as humans, monkeys, cows, sheep, horses, pigs, goats, dogs, cats, mice, and rats. In some embodiments, the subject is a mouse. In some embodiments, the subject is a human.

[0039] In some embodiments, the individual has not undergone a myeloablative transplant.

[0040] As used herein, the term "administration" or "administering" means introducing, providing or delivering a predetermined active ingredient into a subject by any appropriate route to perform its intended function.

[0041] Examples of myelofibrosis may include, but are not limited to, primary myelofibrosis, post-essential thrombocythemia myelofibrosis, and post-polycythemia vera myelofibrosis.

[0042] According to the present invention, the pharmaceutical product can be formulated into a dosage form suitable for parenteral administration using techniques well known to those skilled in the art.

[0043] According to the present invention, for parenteral administration, the pharmaceutical product of the present invention can be formulated into an injection (i.e., a sterile aqueous solution, dispersion or emulsion).

[0044] The pharmaceutical product according to the present invention can be administered via one of the following parenteral routes: intraperitoneal injection, intrapleural injection, intramuscular injection, intravenous injection, intracarotid injection, intraarterial injection, intraarticular injection, intrasynovial injection, intrathecal injection, intracranial injection, intraepidermal injection, subcutaneous injection, intradermal injection, and intralesional injection.

[0045] In some embodiments, the drug is administered via intravenous injection.

[0046] In certain embodiments, after administration of the pharmaceutical agent, the subject exhibits reduced fibrosis and improved inflammation in the bone marrow.

[0047] In certain embodiments, after administration of the pharmaceutical agent, the subject further exhibits improved splenomegaly or improved anemia.

[0048] The dosage and frequency of administration of the drug will vary depending on the severity of the disease or disorder being treated, the route of administration, and the age, physical condition, and response of the individual being treated. Generally, the drug can be administered in a single dose or in several doses.

[0049] The present invention will be further described with reference to the following examples. However, it should be understood that these examples are for illustration only and should not be construed as limiting the implementation of the present invention. [Example] [General experimental materials:] [1.] Sources and culture of human bone marrow stromal cells, human erythroleukemia HEL cells, megakaryoblastic MEG-01 cells, and megakaryoblastic SET-2 cells

[0050] Human bone marrow stromal cells (also known as bone marrow-derived mesenchymal stem cells (BMMSCs)) were purchased from ScienCell Research Laboratories, the HEL 92.1.7 cell line and the MEG-01 cell line were obtained from the American Type Culture Collection, and the SET-2 cell line was obtained from the Deutsche Sammlung von Mikroorganismen und Zellkulturen.

[0051] Human bone marrow stromal cells were cultured in α-MEM medium (Gibco) supplemented with 5% human platelet lysate (HPL) (purchased from Sexton Biotechnologies). HEL 92.1.7 cells and MEG-01 cells were each cultured in RPMI 1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS), while SET-2 cells were cultured in RPMI 1640 medium supplemented with 20% FBS. [2.] [Umbilical cord] [-] [Derived mesenchymal stem cells] [(umbilical cord-derived mesenchymal stem cells, UCMSCs)] [Origin and cultivation:]

[0052] UCMSCs were isolated from human umbilical cord tissue using a modified method described in Mori Y. et al., "Improved explant method to isolate umbilical cord-derived mesenchymal stem cells and their immunosuppressive properties," published in Tissue Eng Part C Methods, 2015, Vol. 21, pp. 367-372. Briefly, human umbilical cord tissue was soaked in ice-cold phosphate-buffered saline (PBS) and then cut into tissue fragments. The central portion of the umbilical cord tissue fragment was cut to expose Wharton's jelly, which was then placed in a 10 cm culture dish. α-MEM medium supplemented with 10% HPL was then immediately added to the dish. After plating, the resulting explants were cultured at 37°C and 5% CO₂ for 7 days. The umbilical cord tissue fragments were then removed and the culture medium (i.e., α-MEM supplemented with 5% HPL) was changed every 2 days until the fibroblast-like attached UCMSCs reached 80% to 90% confluence. Within 10 to 14 days of plating, UCMSCs that had migrated from the explants and tissue fragments were harvested using TrypLE™ (Gibco).

[0053] UCMSC cultures were then prepared by seeding 3,000 to 5,000 cells / cm² per dish in α-MEM medium (Gibco) supplemented with 5% HPL (Sexton Biotechnologies). The medium was changed every two days, and the proliferated UCMSCs were cryopreserved in NutriFreez® D10 Cryopreservation Medium (Corning). [3.] [Experimental animals]

[0054] The experimental animals used in the following experiments (i.e., C57BL / 6 mice) were purchased from BioLASCO. All experimental animals were housed in an animal room with an independent air-conditioning system under the following laboratory conditions: an alternating 12-hour light and 12-hour dark cycle, a temperature maintained at 23°C ± 2°C, and a relative humidity maintained at 50% ± 10%. The animals were provided with water and feed ad libitum. All experimental procedures involving experimental animals complied with the Animal Protection Act of Taiwan and were performed in accordance with the guidelines of the Animal Care Committee of the Council of Agriculture, Taiwan. [General experimental methods:] 1. [Statistical Analysis]

[0055] All experiments described below were performed at least three times. Data are presented as the mean ± standard error of the mean (SEM) for all experimental groups. Intergroup differences were assessed using a two-tailed Student's t-test or one-way analysis of variance (ANOVA) followed by a Newman-Keuls post hoc test using Prism 6.0 software (developer: GraphPad software). A p value of < 0.05 was considered statistically significant. [Example] [1 TPO] [Preparation of Overexpressing Mice and Umbilical Cords] [-] [Derived mesenchymal stem cells] [(UCMSCs)] [In Relief] [TPO] [Myelofibrosis in Overexpressing Mice] [(myelofibrosis)] [Evaluation of the effectiveness of]

[0056] In this example, thrombopoietin (TPO)-overexpressing mice were generated and the induction of myelofibrosis was confirmed. The efficacy of UCMSCs in ameliorating myelofibrosis in TPO-overexpressing mice was then evaluated. [A.] [TPO] [Preparation of Overexpression Mice]

[0057] TPO-overexpressing mice were generated according to the procedure described by Yan XQ et al. in "A model of myelofibrosis and osteosclerosis in mice induced by overexpressing thrombopoietin (mpl ligand): reversal of disease by bone marrow transplantation," published in Blood, 1996, Vol. 88, pp. 402-409. Briefly, C57BL / 6 mice (6 to 8 weeks old) (n = 6) were intraperitoneally injected with 150 mg / kg of 5-fluorouracil. On the fourth day after administration, bone marrow tissue was extracted from the mice and incubated in a red blood cell (RBC) lysis solution for 3 minutes. Next, bone marrow cells were seeded at a concentration of 5 × 10 6 cells per well in each well of a 12-well plate containing 1 mL of StemSpan SFEM II medium (STEMCELL Technologies Inc.) supplemented with 50 ng / mL mouse stem cell factor (SCF), 50 ng / mL human TPO, 20 ng / mL mouse IL-3, and 50 ng / mL mouse Flt-3 ligand. The cells were immediately infected for the first time with a retrovirus containing TPO cDNA (Cell Biolabs, Catalog No. RV-101) according to the manufacturer's instructions, and then infected a second time 24 hours after the first infection. 16 hours after the second infection, 5×10 6 floating cells were collected as donor cells, and 2×10 5 of these donor cells were transplanted into recipient C57BL / 6 mice (these recipient mice had previously been γ-irradiated with a dose of 17 Gy of cesium-137) via intraorbital injection. These recipient mice were then fed with drinking water containing 1 mM neomycin for 2 weeks to obtain TPO-overexpressing mice.

[0058] At 8 weeks post-transplantation, the effects of hematopoiesis were assessed in TPO-overexpressing mice by measuring platelet, red blood cell (RBC), and hemoglobin levels compared to those in healthy C57BL / 6 mice (which served as a control group) to confirm the induction of myelofibrosis in TPO-overexpressing mice. Briefly, blood was collected from the retro-orbital plexus of each mouse, and platelet and red blood cell (RBC) counts, as well as hemoglobin concentrations, were measured using a ProCyte Dx Hematology Analyzer. The results are shown in Figure 1.

[0059] Figure 1 shows platelet counts, RBC counts, and hemoglobin concentrations in TPO-overexpressing mice and a control group at 8 weeks post-transplantation. As shown in Figure 1, TPO-overexpressing mice exhibited significantly increased platelet counts and significantly decreased RBC counts and hemoglobin concentrations compared to the control group, indicating that myelofibrosis symptoms were successfully induced in these TPO-overexpressing mice. [B.] [UCMSCs] [Effectiveness Evaluation in Alleviating Myelofibrosis]

[0060] Cryopreserved UCMSCs were thawed in a 37°C water bath, and then immersed in α-MEM medium (Gibco) supplemented with 5% HPL (Sexton Biotechnologies), followed by centrifugation at 350 g for 5 minutes and washing in ice-cold PBS.

[0061] Mice confirmed to have TPO overexpression with myelofibrosis as described in point A above were divided into two groups: a pathological control group and an experimental group, with n = 3 in each group. Healthy C57BL / 6 mice (n = 3) that did not undergo transplantation served as a normal control group. One, two, four, and five weeks after confirmation of myelofibrosis (i.e., month 0), the experimental group mice were treated with 5×10⁵ UCMSCs via intravenous injection into the tail vein at a rate of 100 μL / min, while the pathological control group mice were treated with PBS. The normal control group mice received no treatment. One, two, and three months after the first UCMSC administration, blood was collected from the pathological control and experimental group mice for measurement of hemoglobin concentration and RBC count. Three months after UCMSC administration and blood collection, the mice in the normal, pathological, and experimental groups were sacrificed, and spleen size and weight were measured. In addition, bone marrow fibrosis was assessed in the pathology control and experimental groups using hematoxylin and eosin (H&E) staining and periodic acid-Schiff (PAS) staining. Periodic acid-Schiff staining, which stains carbohydrates in different types of collagen, was performed based on the procedures described in Steinke H. et al., “Periodic acid-Schiff (PAS) reaction and plastination in whole body slices. A novel technique to identify fascial tissue structures,” published in Ann Annat, 2018, Vol. 216, pp. 29-35. Furthermore, the procedure was based on the protocol described in Thiele J. et al., “European consensus on grading bone marrow fibrosis and assessment of fascial tissue structures,” published in Haematologica, 2005, Vol. 90, pp. 1128-1132. Myelofibrosis was graded using the procedure described in the paper “Myelofibrosis”. The results are shown in Figures 2(a) to (f).

[0062] Figure 2(a) shows the hemoglobin concentration (left panel) and RBC count (right panel) of each group of mice at 0 months (i.e., 8 weeks after transplantation) and 1, 2, and 3 months after the first administration of UCMSCs. As shown in Figure 2(a), from 0 months to 3 months after UCMSC administration, the pathology control group mice showed a gradual decrease in hemoglobin concentration and RBC count, indicating worsening anemia. However, the experimental group mice showed an increase in hemoglobin concentration and RBC count 2 months after UCMSC administration, indicating that TPO-overexpressing mice showed improved anemia after UCMSC treatment.

[0063] Figures 2(b) and (c) show the spleen size and weight of each group of mice three months after UCMSCs administration. As shown in Figures 2(b) and (c), the pathological control group mice had larger and heavier spleens compared to the normal control group mice, while the experimental group mice showed smaller and lighter spleens compared to the pathological control group mice. This indicates that UCMSCs treatment of TPO-overexpressing mice showed improvement in splenomegaly.

[0064] Figures 2(d) and (e) show hematoxylin and eosin (H&E) and periodic acid-Schiff (PAS) staining of the bone marrow of each group of mice three months after UCMSCs administration. As shown in Figures 2(d) and (e), atypical cell streaming was observed in the control group (indicated by the circled area) but not in the experimental group. Furthermore, the area of ​​PAS- (PAS+) staining (indicated by the arrow) was greater in the control group than in the experimental group.

[0065] Figure 2(f) shows the relative percentage of PAS+ area (left panel) and PAS+ signal intensity (right panel) in the bone marrow of each group of mice three months after UCMSCs administration. As shown in Figure 2(f), compared to the pathological control group, the relative percentage of PAS+ area and PAS+ intensity in the experimental group decreased to 61.34±4.93% and 61.45±4.97%, respectively, indicating that UCMSC treatment reduced bone marrow fibrosis in TPO-overexpressing mice.

[0066] These results showed that UCMSCs could alleviate the three main clinical symptoms of myelofibrosis (i.e., anemia, splenomegaly, and bone marrow fibrosis) in a mouse model of myelofibrosis. [Example] [2 UCMSCs] [Evaluation of efficacy in alleviating myelofibrosis induced by various factors]

[0067] In this example, human bone marrow stromal cells and / or myeloproliferative neoplasms (MPNs) cells were used to establish myelofibrosis cell models, and then the effects of UCMSCs on these cell models were measured. [A.] [UCMSCs] [exist] [TGF-] [β1] [-] [Effects on fibrosis and inflammation induced in human bone marrow stromal cells]

[0068] Since TGF-β1 has been reported to regulate bone marrow fibrosis in myelofibrosis, in this experiment, human bone marrow stromal cells were cultured with TGF-β1 and then treated with UCMSCs to measure the expression levels of gene markers of fibrosis and inflammation.

[0069] First, human bone marrow stromal cells were divided into six groups: a normal control group, a pathological control group, a comparative group, and three experimental groups (i.e., experimental groups 1 to 3). Each group contained 4×10⁴ cells. Fibrosis and inflammation were induced by treating the human bone marrow stromal cells in the pathological control group and experimental groups 1 to 3 with 5 ng / mL of TGF-β1 for 72 hours. The human bone marrow stromal cells in the normal control group and the comparative group were not treated with TGF-β1. Subsequently, human bone marrow stromal cells in the comparative group, experimental groups 1, 2, and 3 were treated with UCMSCs at a cell ratio of 1:1, 1:4, 1:2, and 1:1, respectively, for 72 hours. The human bone marrow stromal cells in the normal control group and the pathological control group were not treated. Subsequently, the relative mRNA expression levels of fibrosis marker genes (i.e., collagen type 1 alpha 1 chain (COL1A1), fibronectin 1 (FN1), and actin alpha 2 (ACTA2)) and inflammatory marker genes (i.e., IL-1β, TNF-α, TGF-β1, and IL-6) were measured in each group of human bone marrow stromal cells. It should be noted that the relative mRNA expression levels of IL-6 in each group of human bone marrow stromal cells were not measured in this experiment.

[0070] Specifically, after removal of UCMSCs, total RNA was extracted from each group of human bone marrow stromal cells using the RNeasy Mini Kit (QIAGEN) according to the manufacturer's instructions. The resulting RNA was used as a template for cDNA synthesis via reverse transcription polymerase chain reaction (RT-PCR) using the GScript First-Strand Synthesis Kit (GeneDirex) and FastStart Essential DNA Green Master (Roche). The resulting cDNA was subjected to SYBR-Green I-based quantitative real-time PCR using primer pairs specifically designed for six marker genes (i.e., COL1A1, FN1, ACTA2, IL-1β, TNF-α, and TGF-β1) as shown in Table 1 and the reaction conditions shown in Table 2 using a LightCycler® 96 System (Roche). The peptidylprolyl isomerase A (PPIA) gene was used as an endogenous control in real-time PCR quantitative analysis to normalize gene expression data. Table 1 marker genes PCR primers Nucleotide sequence (5'→3') PCR product size (bp) COL1A1 gene (GenBank accession number XM_054315082) Forward primer COL1A1-F tcgaggattgcccggaacag (SEQ ID NO. 1) 233 Reverse primer COL1A1-R caccagtagcaccatcatttccac (SEQ ID NO. 2) FN1 gene (GenBank accession number NM_001365522) Forward primer FN1-F cacctctgtgcagaccacat (SEQ ID NO. 3) 244 Reverse primer FN1-R agttgccaccgtaagtctgg (SEQ ID NO. 4) ACTA2 gene (GenBank accession number NM_001406462) Forward primer ACTA2-F agcgtggctattccttcgtt (SEQ ID NO. 5) 153 Reverse primer ACTA2-R gcccatcaggcaactcgtaa (SEQ ID NO. 6) IL-1β (GenBank accession number NM_000576) Forward Introduction IL-1β-F gaccaccactacagcaaggg (SEQ ID NO. 7) 189 Reverse primer IL-1β-R atcgtgcacataagcctcgt (SEQ ID NO. 8) TNF-α (GenBank accession number NM_000594) Forward Introduction TNF-α-F cactttggagtgatcggccc (SEQ ID NO. 9) 129 Reverse primer TNF-α-R tcgtacaacatgggctacagg (SEQ ID NO. 10) TGF-β1 (GenBank accession number NM_000660) Forward Introduction TGF-β1-F tggtggaaacccacaacgaa (SEQ ID NO. 11) 113 Reverse primer TGF-β1-R gagcaacacgggttcaggta (SEQ ID NO. 12) IL-6 (GenBank accession number NM_001371096) Forward Introduction IL-6-F gacagccactcacctcttca (SEQ ID NO. 13) 124 Reverse primer IL-6-R agtgcctctttgctgctttc (SEQ ID NO. 14) PPIA gene (GenBank accession number NM_021130) Forward Introduction PPIA-F cgcgtctcctttgagctgtt (SEQ ID NO. 15) 175 Reverse primer PPIA-R acttgccaccagtgccatta (SEQ ID NO. 16) Table 2 Reaction mixture Volume (μL) cDNA (20 ng / μL) 5 Forward primer (10 μM) 1 Reverse primer (10 μM) 1 FastStart Essential DNA Green Master (2× concentrated master mix) (Manufacturer: Roche; Catalog Number: 06924204001) 10 Deionized water 3 Operating conditions: 45 reaction cycles as follows: denaturation at 95°C for 3 minutes, annealing at 95°C for 10 seconds, and extension at 60°C for 10 seconds.

[0071] Fluorescence intensity of the resulting PCR products was measured, and the cycle threshold (Ct) values ​​for each of the COL1A1, FN1, ACTA2, IL-1β, TNF-α, and TGF-β1 genes were calculated. Quantitative real-time PCR data were analyzed using the comparative Ct method. Briefly, the Ct values ​​for each marker gene in each group (i.e., COL1A1, FN1, ACTA2, IL-1β, TNF-α, and TGF-β1) were normalized using those for the PPIA gene, and the relative mRNA expression levels of each marker gene were further calculated using the following formula (I): A=2 -(BC)(I) Where A = relative mRNA expression level of each marker gene B = Normalized Ct value of each marker gene in each group C = Normalized Ct value of each marker gene in the normal control group

[0072] The results are shown in Figure 3.

[0073] Figure 3 shows the relative mRNA expression levels of six marker genes (i.e., (a) COL1A1, (b) FN1, (c) ACTA2, (d) IL-1β, (e) TNF-α, and (f) TGF-β1) in human bone marrow stromal cells from each group. As shown in Figures 3(a) to (c), the relative mRNA expression levels of COL1A1, FN1, and ACTA2 in the pathological control group were significantly higher than those in the normal control group, indicating that TGF-β1 treatment induced a fibrotic response in human bone marrow stromal cells. Furthermore, compared with the pathological control group, the relative mRNA expression levels of COL1A1 in Experimental Groups 2 and 3 were significantly lower. The relative mRNA expression levels of FN1 and ACTA2 in Experimental Groups 1 to 3 were also significantly lower, indicating that treatment with UCMSCs significantly ameliorated the fibrotic response in human bone marrow stromal cells induced by TGF-β1. In contrast, as shown in Figures 3(d) to (f), there was no significant difference in the relative mRNA expression levels of IL-1β, TNF-α, and TGF-β1 measured in the pathological control group and experimental groups 1 to 3 compared with those in the normal control group, suggesting that the inflammatory response in human bone marrow stromal cells was not significantly induced after treatment with TGF-β1, and therefore UCMSCs did not produce an anti-inflammatory effect on TGF-β1-induced human bone marrow stromal cells. [B.] [UCMSCs] [exist] [TGF-β1-] [Induced and] [MPN] [cell] [-] [Effects on fibrosis and inflammation induced in human bone marrow stromal cells]

[0074] Because MPN mononuclear cells harboring the JAK2 V617F mutation have been reported to induce inflammation in human bone marrow stromal cells, in this study, human bone marrow stromal cells were co-cultured with TGF-β1 and HEL 92.1.7 cells (a JAK2 V617F-positive MPN cell line) to mimic the cellular pattern of post-PV MF. UCMSCs were then treated and the expression levels of fibrotic and inflammatory marker genes were measured.

[0075] Briefly, human bone marrow stromal cells were divided into six groups: one normal control group, three pathological control groups, and two experimental groups (i.e., experimental groups 1 and 2), with a cell population of 4×10⁴ cells in each group. Subsequently, the human bone marrow stromal cells from pathological control group 3 and experimental groups 1 and 2 were co-cultured with 1×10⁵ HEL 92.1.7 cells in the presence of 5 ng / mL TGF-β1 for 72 hours. The human bone marrow stromal cells from pathological control group 1 were incubated with 5 ng / mL TGF-β1 for 72 hours, and the human bone marrow stromal cells from pathological control group 2 were co-cultured with 1×10⁵ HEL 92.1.7 cells for 72 hours. The human bone marrow stromal cells from the normal control group were not treated in any way. After HEL 92.1.7 cells were isolated from human bone marrow stromal cells, the human bone marrow stromal cells in experimental groups 1 and 2 were treated with UCMSCs at a cell ratio of 1:4 and 1:2, respectively, for 72 hours. The human bone marrow stromal cells in the normal control group and pathological control groups 1 to 3 remained untreated. Following removal of the UCMSCs, total RNA was extracted from each group of human bone marrow stromal cells, followed by cDNA synthesis, real-time PCR, normalization of gene expression data, and calculation of relative mRNA expression levels for COL1A1, FN1, ACTA2, IL-1β, TNF-α, and TGF-β1 using the same procedures and conditions as described in point A above. The results are shown in Figure 4.

[0076] Figure 4 shows the relative mRNA expression levels of (a) COL1A1, (b) FN1, (c) ACTA2, (d) IL-1β, (e) TNF-α, and (f) TGF-β1 in human bone marrow stromal cells from various groups. As shown in Figure 4, the relative mRNA expression levels of COL1A1, FN1, ACTA2, IL-1β, TNF-α, and TGF-β1 in pathological control group 3 were significantly higher than those in the normal control group, indicating that co-culture of human bone marrow stromal cells with HEL 92.1.7 cells in the presence of TGF-β1 induced fibrotic and inflammatory responses in the human bone marrow stromal cells. In addition, compared with those measured in the pathological control group 3, the relative mRNA expression levels of FN1, ACTA2, IL-1β, and TNF-α measured in experimental groups 1 and 2 were significantly decreased, and the relative mRNA expression levels of COL1A1 and TGF-β1 measured in experimental group 2 were significantly decreased, indicating that UCMSCs exert anti-fibrotic and anti-inflammatory effects in the human bone marrow stromal cell model co-treated with TGF-β1 and HEL 92.1.7. [C.] [UCMSCs] [In megakaryocytes] [(megakaryocyte)-] [Effects on fibrosis and inflammation induced in human bone marrow stromal cells]

[0077] Because megakaryocytes have been reported to induce bone marrow fibrosis and inflammation in post-ET MF and PMF, and MEG-01 cells have been reported to enhance fibrosis in human bone marrow stromal cells, in this study, human bone marrow stromal cells were co-cultured with MEG-01 cells and then treated with UCMSCs to measure the expression levels of fibrotic and inflammatory marker genes.

[0078] Briefly, human bone marrow stromal cells (HBMSCs) were divided into three groups: a normal control group, a pathological control group, and an experimental group, with a cell population of 4×10⁴ cells in each group. The HBMSCs from the pathological and experimental groups were then co-cultured with 1×10⁵ MEG-01 cells for 48 hours. The HBMSCs from the normal control group remained untreated. After MEG-01 cells were separated from the HBMSCs, the HBMSCs from the experimental group were treated with UCMSCs at a 1:1 ratio for 72 hours. The HBMSCs from the normal and pathological control groups remained untreated. Following the removal of the UCMSCs, the HBMSCs from each group were subjected to total RNA extraction, cDNA synthesis, real-time PCR, normalization of gene expression data, and calculation of relative mRNA expression levels for COL1A1, FN1, ACTA2, IL-1β, and IL-6 using the same procedures and conditions as described in point A above. The results are shown in Figure 5.

[0079] Figure 5 shows the relative mRNA expression levels of (a) COL1A1, (b) FN1, (c) ACTA2, (d) IL-1β, and (e) IL-6 in human bone marrow stromal cells (BMSCs) from various groups. As shown in Figure 5, the relative mRNA expression levels of COL1A1, FN1, ACTA2, IL-1β, and IL-6 in the pathological control group were higher than those in the normal control group, indicating that fibrotic and inflammatory responses were induced in BMSCs after co-culture with MEG-01 cells. Furthermore, the relative mRNA expression levels of COL1A1, FN1, ACTA2, IL-1β, and IL-6 in the experimental group were lower than those in the pathological control group, indicating that UCMSCs exert anti-fibrotic and anti-inflammatory effects in the MEG-01-treated BMSC model.

[0080] Since IL-1β has been reported to mediate myelofibrosis in SET-2 cells (megakaryocytes harboring the JAK2 V617F mutation), human bone marrow stromal cells were co-cultured with SET-2 cells in the presence of IL-1β and then treated with UCMSCs to measure the expression levels of fibrotic and inflammatory marker genes.

[0081] Briefly, human bone marrow stromal cells were divided into six groups: one normal control group, two pathological control groups, and three experimental groups (i.e., experimental groups 1 to 3), with a cell population of 4×10⁴ cells in each group. Subsequently, human bone marrow stromal cells from pathological control group 2 and experimental groups 1 to 3 were co-cultured with 1×10⁵ SET-2 cells pretreated with IL-1β (Note: SET-2 cells were first treated with 30 ng / mL IL-1β for 24 hours, and then IL-1β was removed from them) for 72 hours. Human bone marrow stromal cells from pathological control group 1 were co-cultured with 1×10⁵ SET-2 cells for 72 hours. Human bone marrow stromal cells from the normal control group were not treated in any way. After SET-2 cells were isolated from human bone marrow stromal cells (HMSCs), the HMSCs from experimental groups 1 to 3 were treated with UCMSCs at a cell ratio of 1:10, 1:4, and 1:2 for 72 hours. The HMSCs from the normal control group, pathological control group 1, and pathological control group 2 remained untreated. Following removal of the UCMSCs, total RNA was extracted from each HMSC using the same procedures and conditions as described in point A above, followed by cDNA synthesis, real-time PCR, normalization of gene expression data, and calculation of relative mRNA expression levels for COL1A1, FN1, ACTA2, IL-1β, and IL-6. The results are shown in Figure 6.

[0082] Figure 6 shows the relative mRNA expression levels of (a) COL1A1, (b) FN1, (c) ACTA2, (d) IL-1β, and (e) IL-6 in human bone marrow stromal cells from various groups. As shown in Figure 6, the relative mRNA expression levels of COL1A1, FN1, IL-1β, and IL-6 in pathological control group 2 were significantly higher than those in the normal control group, indicating that fibrotic and inflammatory responses in human bone marrow stromal cells were induced after co-culture with SET-2 cells pretreated with IL-1β. Furthermore, the relative mRNA expression levels of FN1 in experimental groups 1 to 3 were significantly lower than those in pathological control group 2, and the relative mRNA expression levels of COL1A1 and IL-6 in experimental group 3 were significantly lower, indicating that UCMSCs exert anti-fibrotic and anti-inflammatory effects in the human bone marrow stromal cell model treated with SET-2. [D.] [UCMSCs] [In human bone marrow stromal cells] [-] [Induced] [MPN] [Effects on inflammation in cells]

[0083] Because human bone marrow stromal cells have been reported to induce megakaryocytes to release inflammatory factors in post-ET MF and PMF, which is important for the pathogenic progression of myelofibrosis, in this study, an MPN cell line (i.e., MEG-01 cells) was co-cultured with human bone marrow stromal cells, followed by treatment with UCMSCs, and the expression levels of inflammatory marker genes were measured.

[0084] Briefly, MEG-01 cells were divided into three groups: a normal control group, a pathological control group, and an experimental group. Each group contained 1×10⁵ MEG-01 cells. MEG-01 cells from the pathological and experimental groups were then co-cultured with 4×10⁴ human bone marrow stromal cells for 48 hours to induce an inflammatory response. MEG-01 cells from the normal control group remained untreated. After human bone marrow stromal cells were separated from MEG-01 cells, MEG-01 cells from the experimental group were treated with 4×10⁴ UCMSCs at a 1:1 ratio of UCMSCs to MEG-01 cells for 72 hours. MEG-01 cells from the normal and pathological control groups remained untreated. After UCMSCs were removed, total RNA was extracted from each group of MEG-01 cells using the same procedures and conditions as described in point A above. cDNA synthesis, real-time PCR, normalization of gene expression data, and calculation of relative mRNA expression levels for IL-1β, IL-6, TNF-α, and TGF-β1 were performed. The results are shown in Figure 7.

[0085] Figure 7 shows the relative mRNA expression levels of (a) IL-1β, (b) IL-6, (c) TNF-α, and (d) TGF-β1 in various groups of MEG-01 cells. As shown in Figure 7, the relative mRNA expression levels of IL-1β, IL-6, TNF-α, and TGF-β1 in the pathological control group were higher than those in the normal control group, indicating that an inflammatory response was induced in MEG-01 cells after co-culture with human bone marrow stromal cells. Furthermore, the relative mRNA expression levels of IL-1β, IL-6, TNF-α, and TGF-β1 in the experimental group were lower than those in the pathological control group, indicating that UCMSCs exert anti-inflammatory effects in the MEG-01 cell model treated with bone marrow stromal cells. [E.] [UCMSCs] [In cytokines] [-] [Induced] [MPN] [Effects on inflammation in cells]

[0086] Since IL-1β has been reported to induce myelofibrosis in a post-PV cell model, in this experiment, another MPN cell line (i.e., HEL 92.1.7 cells) was cultured with IL-1β and then treated with UCMSCs to measure the expression levels of inflammatory marker genes.

[0087] Briefly, HEL 92.1.7 cells were divided into four groups: a normal control group, a pathological control group, and two experimental groups (i.e., experimental groups 1 and 2). Each group contained 2.5×10⁴ HEL 92.1.7 cells. HEL 92.1.7 cells in the pathological control group and experimental groups 1 and 2 were then treated with 30 ng / mL of IL-1β for 72 hours to induce an inflammatory response. HEL 92.1.7 cells in the normal control group remained untreated. HEL 92.1.7 cells in experimental groups 1 and 2 were then treated with UCMSCs at a ratio of 1:4 and 1:2, respectively, for 48 hours. HEL 92.1.7 cells in the normal control group remained untreated. After removing the UCMSCs, the HEL 92.1.7 cells in each group were subjected to total RNA extraction, cDNA synthesis, real-time PCR, normalization of gene expression data, and calculation of relative mRNA expression levels for IL-6 and TNF-α using the same procedures and conditions as described in point A above. The results are shown in Figure 8.

[0088] Figure 8 shows the relative mRNA expression levels of (a) IL-6 and (b) TNF-α in various groups of HEL 92.1.7 cells. As shown in Figure 8 , the relative mRNA expression levels of IL-6 and TNF-α in the pathological control group were higher than those in the normal control group, indicating that inflammatory responses were induced in HEL 92.1.7 cells after IL-1β treatment. Furthermore, the relative mRNA expression levels of IL-6 and TNF-α in experimental groups 1 and 2 were lower than those in the pathological control group, indicating that UCMSCs exert anti-inflammatory effects in HEL 92.1.7 cells treated with IL-1β. [F.] [various sources] [-] [derivative] [MSCs] [exist] [TGF-β1-] [Effects on induced fibrosis in human bone marrow stromal cells]

[0089] To validate the anti-fibrotic effects of MSCs, human bone marrow stromal cells with TGF-β1-induced fibrosis were treated with MSCs derived from different sources, including umbilical cord-derived MSCs (UCMSCs), adipose tissue-derived MSCs (AMSCs), and lung-derived MSCs (LMSCs). The expression levels of fibrosis marker genes were then measured.

[0090] Briefly, human bone marrow stromal cells (HMS) were divided into five groups: a normal control group, a pathological control group, and three experimental groups (i.e., experimental groups 1 to 3). Each group contained 4×10⁴ HMS cells. The HMS cells in the pathological control group and experimental groups 1 to 3 were then treated with 5 ng / mL TGF-β1 for 72 hours, while the HMS cells in the normal control group remained untreated. The HMS cells in experimental groups 1 to 3 were then treated with 2×10⁴ UCMSCs, 2×10⁴ AMSCs, and 2×10⁴ LMSCs, respectively, for 72 hours, while the HMS cells in the normal and pathological control groups remained untreated. Following MSC removal, total RNA was extracted from each group of HMS cells, followed by cDNA synthesis, real-time PCR, normalization of gene expression data, and calculation of relative mRNA expression levels for COL1A1 and FN1 using the same procedures and conditions as described in point A above. The results are shown in Figure 9.

[0091] Figure 9 shows the relative mRNA expression levels of (a) COL1A1 and (b) FN1 in various groups of human bone marrow stromal cells. As shown in Figure 9, the relative mRNA expression levels of COL1A1 and FN1 in the pathological control group were significantly higher than those in the normal control group, indicating that TGF-β1 treatment induced a fibrotic response in human bone marrow stromal cells. Furthermore, the relative mRNA expression levels of COL1A1 and FN1 in experimental groups 1 to 3 were lower than those in the pathological control group, indicating that UCMSCs, AMSCs, and LMSCs can each exert an anti-fibrotic effect in the TGF-β1-treated human bone marrow stromal cell model. [G.] [various sources] [-] [derivative] [MSCs] [exist] [MPN] [cell] [-] [Effects on induced fibrosis in human bone marrow stromal cells]

[0092] To further validate the anti-fibrotic effect of MSCs, we used MSCs derived from different sources (including UCMSCs, AMSCs, and LMSCs) to treat human bone marrow stromal cells induced by MPN cells in the presence of IL-1β, and then measured the expression levels of fibrosis marker genes.

[0093] Briefly, human bone marrow stromal cells (HBMSCs) were divided into five groups: a normal control group, a pathological control group, and three experimental groups (i.e., experimental groups 1 to 3). Each group contained 4×10⁴ HBMSCs. Subsequently, HBMSCs from the pathological control group and experimental groups 1 to 3 were co-cultured with 1×10⁵ SET-2 cells pre-treated with IL-1β (Note: SET-2 cells were first treated with 30 ng / mL IL-1β for 24 hours, followed by IL-1β removal) for 72 hours. The HBMSCs from the normal control group remained untreated. After SET-2 cells were isolated from the HBMSCs, the HBMSCs from experimental groups 1 to 3 were treated with 2×10⁴ UCMSCs, 2×10⁴ AMSCs, and 2×10⁴ LMSCs, respectively, for 72 hours. The HBMSCs from the normal and pathological control groups remained untreated. After removing UCMSCs, AMSCs, and LMSCs, the same procedures and conditions as described in point A above were used for total RNA extraction, cDNA synthesis, real-time PCR, normalization of gene expression data, and calculation of relative mRNA expression levels for COL1A1 and FN1. The results are shown in Figure 10.

[0094] Figure 10 shows the relative mRNA expression levels of (a) COL1A1 and (b) FN1 in various groups of human bone marrow stromal cells. As shown in Figure 10 , the relative mRNA expression levels of COL1A1 and FN1 in the pathological control group were significantly higher than those in the normal control group, indicating that fibrotic responses were induced in human bone marrow stromal cells after co-culture with SET-2 cells pretreated with IL-1β. Furthermore, the relative mRNA expression levels of COL1A1 and FN1 in experimental groups 1 to 3 were lower than those in the pathological control group, indicating that UCMSCs, AMSCs, and LMSCs can each exert anti-fibrotic effects in the human bone marrow stromal cell model treated with SET-2 cells. [Example] [3] [Optimized] [UCMSCs (primed UCMSCs)] [In remission of myelofibrosis] [(myelofibrosis)] [Evaluation of the effectiveness of]

[0095] In this example, optimized UCMSCs (i.e., indoleamine-pyrrole 2,3-dioxygenase-positive UCMSCs) were prepared and then evaluated using the myelofibrosis cell model described in Example 2 above to determine the anti-fibrotic efficacy of the optimized UCMSCs. [A.] [Optimized] [UCMSCs] Preparation

[0096] The UCMSCs cultures described in Section 2 of the General Experimental Materials were divided into six groups: one control group and five experimental groups (i.e., experimental groups 1 to 5). The number of UCMSCs in each group was 5.8×10 5 cells. UCMSCs in experimental groups 1 to 5 were then primed with different concentrations of IFN-γ (i.e., 50, 100, 200, 250, and 500 U / mL of IFN-γ) for 72 hours. UCMSCs in the control group were not treated. To identify IDO-expressing UCMSCs, cells in each group were stained with a phycoerythrin-conjugated IDO monoclonal antibody (Thermo Fisher Scientific; Catalog No. 12-9477-42). A phycoerythrin-conjugated mouse IgG1 kappa isotype control (Thermo Fisher Scientific; Catalog No. 12-4714-82) was used as a control antibody. Flow cytometry was then performed on the stained cells using a CytoFLEX flow cytometer (Beckman Coulter) to determine the percentage of IDO-expressing UCMSCs in each group. The results are shown in Figure 11.

[0097] Figure 11 shows the percentage of IDO-expressing UCMSCs in each group after treatment with various concentrations of IFN-γ for 72 hours. As shown in Figure 11 , the percentage of IDO-expressing UCMSCs (i.e., optimized UCMSCs) measured in each of Experimental Groups 1 to 5 was higher than that in the control group, and this increase was dependent on the IFN-γ concentration.

[0098] Since the above results showed that UCMSCs treated with 250 and 500 U / mL IFN-γ had a higher percentage of UCMSCs expressing IDO, in the following experiments, UCMSCs were treated with these concentrations of IFN-γ for different time periods and the percentage of UCMSCs expressing IDO was determined.

[0099] Briefly, the UCMSC cultures described in Section 2 of the General Experimental Materials were divided into nine groups: three control groups (i.e., Control Groups 1 to 3) and six experimental groups (i.e., Experimental Group 1-1, Experimental Group 1-2, Experimental Group 2-1, Experimental Group 2-2, Experimental Group 3-1, and Experimental Group 3-2). The number of UCMSCs in each group was 5.8 × 10 5 cells. Subsequently, the UCMSCs in Experimental Groups 1-1, 2-1, and 3-1 were treated with 250 U / mL of IFN-γ for 24, 48, and 72 hours, respectively. The UCMSCs in Experimental Groups 1-2, 2-2, and 3-2 were treated with 500 U / mL of IFN-γ for 24, 48, and 72 hours, respectively. The UCMSCs in Control Groups 1 to 3 were not treated and were left alone for 24, 48, and 72 hours, respectively. Subsequently, each group of optimized UCMSCs was subjected to flow cytometry according to the aforementioned steps to determine the percentage of UCMSCs expressing IDO in each group. The results are shown in FIG12 .

[0100] Figure 12 shows the percentage of IDO-expressing UCMSCs in each group after treatment with different concentrations of IFN-γ for different time periods. As shown in Figure 12 , the percentage of IDO-expressing UCMSCs (i.e., optimized UCMSCs) was higher in experimental groups 1-1 and 1-2 compared to control group 1, higher in experimental groups 2-1 and 2-2 compared to control group 2, and higher in experimental groups 3-1 and 3-2 compared to control group 3. Furthermore, the percentage of IDO-expressing UCMSCs was higher in experimental group 3-1 compared to experimental groups 2-1 and 1-1, and higher in experimental group 3-2 compared to experimental groups 2-2 and 1-2. These results suggest that the percentage of UCMSCs expressing IDO increases depending on the concentration and duration of IFN-γ treatment.

[0101] To determine whether the addition of a supplement selected from a vitamin, steroid, cytokine, double-stranded RNA, and histone deacetylase (HDAC) inhibitor could enhance the efficacy of IFN-γ in the optimization of UCMSCs, the following experiments were performed.

[0102] Briefly, the UCMSCs cultures described in Section 2 of the General Experimental Materials were divided into eight groups: a normal control group, a comparative group, and six experimental groups (i.e., experimental groups 1 to 6), with the number of UCMSCs in each group being 5.8 × 10 5 cells. Subsequently, the UCMSCs in each group were optimized, with the UCMSCs in the comparative group treated with 250 U / mL of IFN-γ for 72 hours, and the UCMSCs in experimental groups 1 to 6 treated with 250 U / mL of IFN-γ in combination with 1 μM retinoic acid, 1 μg / mL dexamethasone, 10 ng / mL TNF-α, 25 μg / mL polyinosinic acid-polycytidylic acid, 0.5 mM valproic acid, and 1 μM budesonide for 72 hours. Meanwhile, UCMSCs in the normal control group were left untreated for 72 hours. Subsequently, total RNA extraction, cDNA synthesis, and real-time PCR were performed on each group of optimized UCMSCs using the primer pairs specifically targeting the IDO gene listed in Table 3 below. Gene expression data were normalized and relative IDO mRNA expression levels were calculated using the procedures and conditions described in Example 2, Section A. The results are shown in Figure 13. Table 3 marker genes PCR primers Nucleotide sequence (5'→3') PCR product size (bp) IDO gene (GenBank accession number NM_002164) Forward Introduction IDO-F gcaagaacgggacactttgc (SEQ ID NO. 17) 167 Reverse primer IDO-R cgtctgatagctgggggttg (SEQ ID NO. 18)

[0103] Figure 13 shows the relative mRNA expression levels of the IDO gene in each group after treatment with IFN-γ combined with one of the respective supplements. As shown in Figure 13, the relative mRNA expression levels of the IDO gene measured in experimental groups 1 to 6 were higher than those in the control group, indicating that the number of optimized UCMSCs measured after treatment with IFN-γ combined with retinoic acid, dexamethasone, TNF-α, polyinosinic acid, valproic acid, or subcutaneous cortisol was even greater than that measured after treatment with IFN-γ alone. These results suggest that retinoic acid, dexamethasone, TNF-α, polyinosinic acid, valproic acid, and subcutaneous cortisol can each enhance the effectiveness of IFN-γ in optimizing UCMSCs.

[0104] Since the above results showed that combined treatment of UCMSCs with IFN-γ and adipocyte hypoglycemia showed the best increase in the relative mRNA expression level of the IDO gene, the following experiment was performed to determine the effect of treating UCMSCs with IFN-γ and adipocyte hypoglycemia for different periods of time on the percentage of UCMSCs expressing IDO.

[0105] Briefly, the UCMSC cultures described in Section 2 of the General Experimental Materials were divided into eight groups: three comparative groups (i.e., Comparative Groups 1 to 3) and five experimental groups (i.e., Experimental Group 1-1, Experimental Group 1-2, Experimental Group 2-1, Experimental Group 2-2, and Experimental Group 3-2). Each group contained 5.8×10 5 UCMSCs. The optimization procedure was performed by treating the UCMSCs with 250 U / mL of IFN-γ and / or 1 μM of hydroxybutyric acid for a total of 72 hours. The duration of IFN-γ and / or hydroxybutyric acid treatment for each group of UCMSCs is shown in Table 4 below. Table 4 Group IFN-γ (250 U / mL) Adenine cortisol (1 μM) Comparison Group 1 24 hours - Comparison Group 2 48 hours - Comparison Group 3 72 hours - Experimental group 1-1 24 hours 48 hours Experimental groups 1-2 24 hours 72 hours Experimental group 2-1 48 hours 48 hours Experimental group 2-2 48 hours 72 hours Experimental group 3-2 72 hours 72 hours

[0106] Subsequently, each group of optimized UCMSCs was subjected to flow cytometry according to the aforementioned steps to determine the relative percentage of UCMSCs expressing IDO in each group. The results are shown in FIG14 .

[0107] Figure 14 shows the relative percentage of IDO-expressing UCMSCs in each group after treatment with IFN-γ for varying durations combined with adjuvant steroid treatment. As shown in Figure 14 , the relative percentages of IDO-expressing UCMSCs (i.e., optimized UCMSCs) in experimental groups 1-1, 1-2, 2-1, 2-2, and 3-2 were higher than those in comparative groups 1 to 3, indicating that adjuvant steroid treatment can enhance the efficacy of IFN-γ in optimizing UCMSCs. Furthermore, the percentage of IDO-expressing UCMSCs in experimental group 1-2 was higher than that in experimental group 1-1, and the percentage of IDO-expressing UCMSCs in experimental group 2-2 was higher than that in experimental group 2-1, demonstrating that treatment with adjuvant steroid treatment for a relatively long period of time further enhances the efficacy of IFN-γ in optimizing UCMSCs. [B.] [Optimized] [UCMSCs] [exist] [TGF-β1-] [Induced and] [MPN] [cell] [-] [Effects on induced fibrosis in human bone marrow stromal cells]

[0108] To determine the efficacy of optimized UCMSCs compared to conventional (i.e., non-optimized) UCMSCs in a post-PV MF model, human bone marrow stromal cells were co-cultured with HEL 92.1.7 cells in the presence of TGF-β1. The cells were then treated with either conventional or optimized UCMSCs, and the expression levels of fibrotic marker genes in the human bone marrow stromal cells were measured.

[0109] Briefly, human bone marrow stromal cells (HBMSCs) were divided into six groups: a normal control group, a pathological control group, three comparative groups (i.e., Comparative Groups 1 to 3), and an experimental group. Each group contained 4×10⁴ HBMSCs. The HBMSCs from the pathological control group, comparative groups 1 to 3, and the experimental group were then co-cultured with 4×10⁴ HEL 92.1.7 cells in the presence of 5 ng / mL TGF-β1 for 72 hours to induce a fibrotic response. The HBMSCs from the normal control group remained untreated. After HEL 92.1.7 cells were isolated from human bone marrow stromal cells, the human bone marrow stromal cells from control groups 1 to 3 were treated with standard UCMSCs at a cell ratio of 1:10, 1:4, and 1:2, respectively, for 72 hours. The experimental group was treated with optimized UCMSCs at a cell ratio of 1:10 for 72 hours. The human bone marrow stromal cells from the normal control group and the pathology control group were not treated. Subsequently, after removing the standard and optimized UCMSCs, the human bone marrow stromal cells from each group were subjected to total RNA extraction, cDNA synthesis, real-time PCR, normalization of gene expression data, and calculation of relative mRNA expression levels for COL1A1, FN1, and ACTA2 using the procedures and conditions described in Example 2, point A. The results are shown in Figure 15.

[0110] Figure 15 shows the relative mRNA expression levels of (a) COL1A1, (b) FN1, and (c) ACTA2 in human bone marrow stromal cells from various groups. As shown in Figure 15 , the relative mRNA expression levels of COL1A1, FN1, and ACTA2 in the pathology control group were significantly higher than those in the normal control group, indicating that co-culture of human bone marrow stromal cells with HEL 92.1.7 cells in the presence of TGF-β1 induced a fibrotic response in the cells. Furthermore, the relative mRNA expression levels of COL1A1 in Comparison Groups 1 to 3 and FN1 in Comparison Group 3 were significantly lower than those in the pathology control group, indicating that treatment with standard UCMSCs significantly ameliorated fibrosis in human bone marrow stromal cells. In addition, compared with those measured in comparison group 1, the relative mRNA expression levels of COL1A1, FN1 and ACTA2 measured in the experimental group were significantly reduced, indicating that compared with ordinary UCMSCs, the optimized UCMSCs showed enhanced anti-fibrotic effects in human bone marrow stromal cells. [C.] [Optimized] [UCMSCs] [In megakaryocytes] [-] [Effects on induced fibrosis in human bone marrow stromal cells]

[0111] To determine the efficacy of optimized UCMSCs compared to conventional (i.e., non-optimized) UCMSCs in post-ET MF and PMF cell models, human bone marrow stromal cells were co-cultured with SET-2 cells in the presence of IL-1β. These cells were then treated with conventional or optimized UCMSCs, and the expression levels of fibrotic marker genes were measured.

[0112] Briefly, human bone marrow stromal cells (HBSCs) were divided into four groups: a normal control group, a pathological control group, a comparative group, and an experimental group. Each group contained 4 × 10 4 cells. The HBSCs from the pathological control, comparative, and experimental groups were then co-cultured with 1 × 10 5 SET-2 cells pretreated with IL-1β (SET-2 cells were first treated with 30 ng / mL IL-1β for 24 hours, followed by IL-1β removal) for 72 hours. The HBSCs from the normal control group remained untreated. After SET-2 cells were isolated from human bone marrow stromal cells, the control group's human bone marrow stromal cells were treated with standard UCMSCs at a 1:2 ratio for 72 hours, and the experimental group's human bone marrow stromal cells were treated with optimized UCMSCs at a 1:2 ratio for 72 hours. The human bone marrow stromal cells in the normal control group and the pathology control group remained untreated. Subsequently, after removing standard or optimized UCMSCs, the human bone marrow stromal cells in each group were subjected to total RNA extraction, cDNA synthesis, real-time PCR, normalization of gene expression data, and calculation of relative mRNA expression levels for COL1A1, FN1, and ACTA2 using the procedures and conditions described in Example 2, point A. The results are shown in Figure 16.

[0113] Figure 16 shows the relative mRNA expression levels of (a) COL1A1, (b) FN1, and (c) ACTA2 in human bone marrow stromal cells from various groups. As shown in Figure 16 , the relative mRNA expression levels of COL1A1 and FN1 in the pathological control group were significantly higher than those in the normal control group, indicating that the co-culture of human bone marrow stromal cells with SET-2 cells pretreated with IL-1β induced a fibrotic response in human bone marrow stromal cells. Furthermore, the relative mRNA expression levels of COL1A1 and ATCA2 in the control group were significantly lower than those in the pathological control group, indicating that treatment with standard UCMSCs significantly improved fibrosis in human bone marrow stromal cells. Furthermore, the relative mRNA expression level of COL1A1 in the experimental group was significantly lower than that in the control group, indicating that the optimized UCMSCs exhibit enhanced anti-fibrotic effects in human bone marrow stromal cells compared to standard UCMSCs.

[0114] In summary, these results demonstrate that MSCs, when administered to a mouse model of myelofibrosis, can alleviate three key clinical symptoms of myelofibrosis (i.e., anemia, splenomegaly, and bone marrow fibrosis). Furthermore, MSCs exhibit anti-inflammatory and anti-fibrotic effects in this myelofibrosis model, as demonstrated by a reduction in the relative mRNA expression levels of fibrotic and inflammatory gene markers. Furthermore, compared with conventional MSCs (i.e., non-optimized MSCs), optimized MSCs demonstrated superior anti-fibrotic effects in this myelofibrosis model. Therefore, MSCs are expected to have high potential as a therapeutic agent for alleviating bone marrow fibrosis in myelofibrosis.

[0115] In the above description, for purposes of illustration, numerous specific details have been described to provide a thorough understanding of the embodiments. However, it will be apparent to one skilled in the art that one or more other embodiments may be practiced without some of these specific details. It should also be understood that references throughout this specification to "one embodiment," "an embodiment," a numbered embodiment, and the like refer to a particular feature, structure, or characteristic that may be included in the practice of the present invention. It should be further understood that, in order to streamline the present invention and facilitate understanding of various inventive aspects, various features are sometimes grouped together in a single embodiment, figure, or illustration. When practicing the present invention, one or more features or details from one embodiment may be practiced together with one or more features or details from another embodiment, as appropriate.

[0116] Although the present invention has been described with reference to embodiments which are considered to be exemplary, it should be understood that the disclosure is not limited to the embodiments disclosed, but is intended to cover various arrangements that are to be included within the spirit and scope of the broadest interpretation so as to encompass all such modifications and equivalent arrangements.

[0117] TW202417616A_112132763_SEQL.xml

Claims

1. A composition comprising mesenchymal stem cells (MSCs) is supplied for the purpose of preparing a pharmaceutical product for alleviating myelofibrosis in an individual, wherein the individual has not undergone allogeneic stem cell transplantation (allo-SCT).

2. The use as claimed in claim 1, wherein the MSCs are selected from the group consisting of: umbilical cord-derived mesenchymal stem cells (UCMSCs), bone marrow-derived mesenchymal stem cells (BMMSCs), adipose tissue-derived mesenchymal stem cells (AMSCs), dermal-derived mesenchymal stem cells (DMSCs), epidermal-derived mesenchymal stem cells (EMSCs), synovial membrane-derived mesenchymal stem cells (SMMSCs), dental tissue-derived mesenchymal stem cells (dental MSCs), lung-derived mesenchymal stem cells (LMSCs), and combinations thereof.

3. The use as described in claim 2, wherein the MSCs are UCMSCs.

4. The use as described in claim 3, wherein the UCMSCs are unoptimized UCMSCs.

5. The use as described in claim 3, wherein the UCMSCs are optimized UCMSCs.

6. The use as described in claim 5, wherein the optimized UCMSCs are UCMSCs expressing indoleamine-pyrrole 2,3-dioxygenase (IDO).

7. The use as described in claim 6, wherein the UCMSCs exhibiting IDO are prepared by culturing unoptimized UCMSCs in a medium supplemented with IFN-γ.

8. The use as claimed in claim 7, wherein the culture medium is further supplemented with a substance selected from the group consisting of: vitamins, steroids, cytokines, double-stranded RNA, and histone deacetase (HDAC) inhibitors.

9. The use as claimed in claim 8, wherein the vitamin is retinoic acid, the steroid is dexamethasone or budesonide, the cytokine is TNF-α, the double-stranded RNA is polyinosinic acid, and the HDAC inhibitor is valproic acid.

10. The use as claimed in claim 1, wherein the myelofibrosis is selected from the group consisting of: primary myelofibrosis, post-essential thrombocythemia myelofibrosis, post-polycythemia vera myelofibrosis, and combinations thereof.

11. The use as described in claim 1, wherein the individual shows a reduction in bone marrow fibrosis or improvement in inflammation after administration of the medicine.

12. The use as described in claim 11, wherein the individual further shows improvement in splenomegaly or anemia after administration of the medicine.

Images