Translational modulating elements for mRNA molecules capped with 5'-cap analogs, mRNA molecules including the same, and methods using the same

Abstract

NOT VISIBLE DUE TO STATUS OF PATENT

Description

[0001] TRANSLATIONAL MODULATING ELEMENTS FOR mRNA MOLECULES CAPPED WITH 5’-CAP ANALOGS, mRNA MOLECULES INCLUDING THE SAME, AND

[0002] METHODS USING THE SAME

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] The present application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 531,228, filed August 07, 2023, and U.S. Provisional Patent Application No. 63 / 582,407, filed September 13, 2023, both of which are incorporated herein by reference in its entirety.

[0005] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0006] This invention was made with government support under GM101316, GM132358, ES031525, GM125955-01, and NS118616-01 Al awarded by the National Institutes of Health. The government has certain rights in the invention.

[0007] SEQUENCE LISTING

[0008] The XML file named "047162-7476WO1 Sequence Listing. xml" created on July 30, 2024, comprising 373,934 bytes, is hereby incorporated by reference in its entirety.

[0009] BACKGROUND mRNA therapeutics offer a potentially universal strategy for the efficient development and delivery of therapeutic proteins. However, this therapeutic potential is limited by the low stability and undesirable translation efficiencies of the mRNA molecules. mRNA molecules can be “capped” at the 5 ’-end thereof with moi eties different from natural mRNA 5’-caps (i.e., 5’-cap analogs) to improve stability. Such 5’-cap analogs can be introduced during the transcription of mRNA molecules (“co-transcriptional capping”), or by enzymes after the mRNA molecules have been transcribed (“enzymatic capping”). 5’ -cap analogs are known to affect the translation efficiencies of mRNA molecules. However, how these 5 ’-cap analogs modulates translation efficiencies in conjunction with the downstream mRNA sequences and what downstream sequences should be combined with 5’-cap analogs to achieve desirable translational efficiencies are largely unknown.

[0010] Accordingly, there is a need to identify mRNA sequences that, when combined with 5’- cap analogs, can result in desirable translational efficiency. The present invention addresses this need.

[0011] SUMMARY

[0012] In some aspects, the present invention is directed to the following non-limiting embodiments:

[0013] In some aspects, the present invention is directed to a non-natural mRNA molecule.

[0014] In some embodiments, the non-natural mRNA molecule comprises: a 5 ’-cap analog; a 5 ’-untranslated region (5’-UTR); and a coding sequence.

[0015] In some embodiments, the translational enhancer sequence, when combined with the 5’- cap analog, increases a translational efficiency of the mRNA.

[0016] In some embodiments, the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-400.

[0017] In some embodiments, the 5 ’-cap analog comprises G(5')ppp(5')G, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5')(2,OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, m7(3’OMeG)(5')ppp('5)m6(2’OMeA)pG, or 3'0Me-m7G(5')ppp(5')G. In some embodiments, the 5 ’-cap analog comprises m7G(5')ppp(5')(2'OMeA)pG.

[0018] In some embodiments, the mRNA molecule further comprises a modified nucleobase.

[0019] In some embodiments, the modified nucleobase comprises an N1 -methyladenosine (mlA), an N6-methyladenosine (m6A), an N6,2’-O-dimethyladenosine (m6Am), a 3- methylcytidine (m3C), an N4-acetylcytidine (ac4C), N4-methylcytidine, a 5-hydroxycytidine, a 5-methylcytosine (m5C), a 5 -formyl cytidine (f5C), a 5-hyrdoxymethylcytidine, a pseudoisocytidine, an N7-methylguanosine (m7G), an inosine (I), a dihydrouridine (D), an Nl- methylpseudouridine (mlT), an N1 -methoxymethylpseudouridine, an N1 -ethylpseudouridine, an N1 -propylpseudouridine, a pseudouridine ( ), 2-thiouridine, a 4-thiouridine, a 5- aminoallyluridine, a 5-hydroxyuridine, a 5-hydroxymethyluridine, 5-methyluridine, a 5- carb oxy uridine, 5-methoxyuridine, a 5-formyluridine, and a 2’0-methyl modification (Cm, Am, Gm, or Um). In some embodiments, the modified nucleobase comprises Nl- methylpseudouridine (mlT).

[0020] In some embodiments, a ribosome retention score (RRS) of the mRNA molecule is 3X or higher than an RRS of an mRNA molecule that does not comprise the translational enhancer sequence but otherwise has the same sequence.

[0021] In some embodiments, the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-100, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a lung cell.

[0022] In some embodiments, the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 101-200, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a kidney cell.

[0023] In some embodiments, the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 201-300, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a liver cell.

[0024] In some embodiments, the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 301-400, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a uterus cell or a cervix cell.

[0025] In some embodiments, the coding sequence encodes a therapeutic peptide or a therapeutic protein.

[0026] In some embodiments, the therapeutic peptide or the therapeutic protein comprises a vaccine.

[0027] In some aspects, the present invention is directed to a method of modulating a translational efficiency of an mRNA.

[0028] In some embodiments, the method comprises, in the case that the mRNA comprises a 5’- cap analog, modifying a 5’-UTR of the mRNA to include a translational enhancer sequence that, when combined with the 5 ’-cap analog, increases a translational efficiency of the mRNA. In some embodiments, the method comprises, in the case that the mRNA comprises the translational enhancer, modifying the mRNA to introduce the 5 ’-cap analog.

[0029] In some embodiments, the translational enhancer sequence comprises at least one sequence selected form the group consisting of SEQ ID NOs: 1-400.

[0030] In some embodiments, the 5 ’-cap analog comprises G(5')ppp(5')G, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2’OMeA)pU, m7(3’OMeG)(5')ppp('5)m6(2’OMeA)pG, or 3'0Me-m7G(5')ppp(5')G. In some embodiments, the 5 ’-cap analog comprises m7G(5')ppp(5')(2'OMeA)pG.

[0031] In some embodiments, the mRNA further comprises a modified nucleobase.

[0032] In some embodiments, the modified nucleobase comprises an N1 -methyladenosine (mlA), an N6-methyladenosine (m6A), an N6,2’-O-dimethyladenosine (m6Am), a 3- methylcytidine (m3C), an N4-acetylcytidine (ac4C), N4-methylcytidine, a 5-hydroxycytidine, a 5-methylcytosine (m5C), a 5 -formyl cytidine (f5C), a 5-hyrdoxymethylcytidine, a pseudoisocytidine, an N7-methylguanosine (m7G), an inosine (I), a dihydrouridine (D), an Nl- methylpseudouridine (mlT), an N1 -methoxymethylpseudouridine, an N1 -ethylpseudouridine, an N1 -propylpseudouridine, a pseudouridine (T), 2-thiouridine, a 4-thiouridine, a 5- aminoallyluridine, a 5-hydroxyuridine, a 5-hydroxymethyluridine, 5-methyluridine, a 5- carboxyuridine, 5-methoxyuridine, a 5-formyluridine, and a 2’0-methyl modification (Cm, Am, Gm, or Um). In some embodiments, the modified nucleobase comprises a Nl- methylpseudouridine (ml'P).

[0033] In some embodiments, a ribosome retention score (RRS) of the modified mRNA molecule is 3X or higher than an RRS of an mRNA molecule that does not comprise the translational enhancer sequence but otherwise has the same sequence.

[0034] In some embodiments, the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-100, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a lung cell.

[0035] In some embodiments, the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 101-200, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a kidney cell, or In some embodiments, the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 201-300, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a liver cell.

[0036] In some embodiments, the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 301-400, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a uterus cell or a cervix cell.

[0037] In some embodiments, the coding sequence encodes a therapeutic peptide or a therapeutic protein.

[0038] In some embodiments, the therapeutic peptide or the therapeutic protein is a vaccine.

[0039] In some aspects, the present invention is directed to a method of expressing a polypeptide or a protein.

[0040] In some embodiments, the method comprises: constructing a non-natural mRNA and translating the mRNA.

[0041] In some embodiments, the mRNA comprises: a 5 ’-cap analog; a 5 ’-untranslated region (5’-UTR) comprising a translational enhancer sequence; and a coding sequence encoding the polypeptide or the protein.

[0042] In some embodiments, the translational enhancer sequence, when combined with the 5’- cap analog, increases a translational efficiency of the mRNA.

[0043] In some embodiments, the translational enhancer sequence comprises at least one sequence selected form the group consisting of SEQ ID NOs: 1-400.

[0044] In some embodiments, the 5 ’-cap analog comprises G(5')ppp(5')G, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, m7(3’OMeG)(5')ppp('5)m6(2’OMeA)pG, or 3'0Me-m7G(5')ppp(5')G. In some embodiments, the 5 ’-cap analog comprises m7G(5')ppp(5')(2'OMeA)pG.

[0045] In some embodiments, the mRNA further comprises a modified nucleobase.

[0046] In some embodiments, the modified nucleobase comprises an N1 -methyl adenosine (mlA), an N6-methyladenosine (m6A), an N6,2’-O-dimethyladenosine (m6Am), a 3- methylcytidine (m3C), an N4-acetylcytidine (ac4C), N4-methylcytidine, a 5-hydroxycytidine, a 5-methylcytosine (m5C), a 5 -formyl cytidine (f5C), a 5-hyrdoxymethylcytidine, a pseudoisocytidine, an N7-methylguanosine (m7G), an inosine (I), a dihydrouridine (D), an Nl- methylpseudouridine (mlT), an N1 -methoxymethylpseudouridine, an N1 -ethylpseudouridine, an N1 -propylpseudouridine, a pseudouridine ( ), 2-thiouridine, a 4-thiouridine, a 5- aminoallyluridine, a 5-hydroxyuridine, a 5-hydroxymethyluridine, 5-methyluridine, a 5- carb oxy uridine, 5-methoxyuridine, a 5-formyluridine, and a 2’0-methyl modification (Cm, Am, Gm, or Um). In some embodiments, the modified nucleobase comprises an Nl- methylpseudouridine (mlT).

[0047] In some embodiments, a ribosome retention score (RRS) of the mRNA molecule is 3X or higher than an RRS of an mRNA molecule that does not comp rise the translational enhancer sequence but otherwise has the same sequence.

[0048] In some embodiments, the polypeptide or the protein is expressed in a lung cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-100.

[0049] In some embodiments, the polypeptide or the protein is expressed in a kidney cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 101-200.

[0050] In some embodiments, the polypeptide or the protein is expressed in a liver cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 201-300.

[0051] In some embodiments, the polypeptide or the protein is expressed in a uterus cell or a cervix cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 301-400.

[0052] In some embodiments, the polypeptide or the protein is a therapeutic peptide or a therapeutic protein.

[0053] In some embodiments, the therapeutic peptide or the therapeutic protein comprises a vaccine.

[0054] In some embodiments, the polypeptide or the protein is expressed in a cell of a subject. In some embodiments, the subject is a mammal, optionally a human. DETAILED DESCRIPTION

[0055] The following disclosure provides many different embodiments, or examples, for implementing different features of the provided subject matter. Specific examples of components and arrangements are described below to simplify the present disclosure. These are, of course, merely examples and are not intended to be limiting. In addition, the present disclosure may repeat reference numerals and / or letters in the various examples. This repetition is for the purpose of simplicity and clarity and does not in itself dictate a relationship between the various embodiments and / or configurations discussed.

[0056] In the present study, a high-throughput biochemical assay was used to test ribosome recruitment to tens of thousands of 5 '-untranslated regions (5’-UTR) that were co- transcriptionally capped with 5 ’-cap analogs. The ribosome recruitment assay performed in the present study is similar to the direct analysis of ribosome targeting (DART) assay described in Niederer et al. (Cell Syst. 2022 Mar 16; 13(3):256-264). The DART assay herein was performed in several types of cells and 5’-UTR sequences that resulted in highest levels of ribosome recruitment were identified as positive modulators of translational efficiency for mRNA molecules capped with 5 ’-cap analogs, such as m7G(5')ppp(5')(2'OMeA)pG (commercially available as CleanCap® Reagent AG).

[0057] Unexpectedly, the present study discovered that sequences that modulate translational efficiencies identified in the 5’-UTRs of mRNA molecules capped with 5 ’-cap analogs differ significantly from sequences that modulate translational efficiency identified in the 5’-UTRs of mRNA molecules capped enzymatically.

[0058] The identified modulators of translational efficiency can be incorporated into therapeutic mRNAs capped with 5 ’-cap analogs to modulate the potency of such therapeutic mRNAs. For example, increased translational efficiencies would allow the reduced dose that can achieve the same therapeutic outcome, thereby reducing manufacturing costs and / or the immunogenicity of the mRNA molecules per se. Increasing the mRNA potency is also likely to open new therapeutic modalities for mRNA medicine.

[0059] Accordingly, in some aspects, the present invention is directed to an mRNA molecule, such as a non-natural mRNA molecule including a 5’-cap analog and a 5’-UTR which, when combined with the 5 ’-cap analog, results in increased ribosome recruitment and translational efficiency. In some aspects, the present invention is directed to a method of modulating a translational efficiency of an mRNA molecule, which includes a 5 ’-cap analog.

[0060] In some aspects, the present invention is directed to a method of expressing a polypeptide or a protein with an mRNA that includes a 5 ’-cap analog.

[0061] Definitions

[0062] As used herein, each of the following terms has the meaning associated with it in this section. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Generally, the nomenclature used herein and the laboratory procedures in animal pharmacology, pharmaceutical science, peptide chemistry, and organic chemistry are those well-known and commonly employed in the art. It should be understood that the order of steps or order for performing certain actions is immaterial, so long as the present teachings remain operable. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference.

[0063] In the application, where an element or component is said to be included in and / or selected from a list of recited elements or components, it should be understood that the element or component can be any one of the recited elements or components and can be selected from a group consisting of two or more of the recited elements or components.

[0064] In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.

[0065] In this document, the terms "a," "an," or "the" are used to include one or more than one unless the context clearly dictates otherwise. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated. The statement "at least one of A and B" or "at least one of A or B" has the same meaning as "A, B, or A and B."

[0066] "About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, in certain embodiments ±5%, in certain embodiments ±1%, in certain embodiments ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. mRNA Molecule

[0067] In some aspects, the present invention is directed to an mRNA molecule.

[0068] In some embodiments, the mRNA molecule includes a 5 ’-cap, and a translational modulation sequence.

[0069] In some embodiments, the mRNA molecule is a non -natural mRNA molecule.

[0070] In some embodiments, the non-natural mRNA molecule includes a non-natural 5 ’-cap. Naturally, 5’-capping of mRNA molecules include Cap-0 (m7G(5')pppNipN2p), Cap-1 (m7G(5')pppNimpNp), Cap-2 (m7G(5')pppNimpN2mp), and mixtures thereof. In some embodiments, the non-natural mRNA molecule is considered non-natural for not including one or more of Cap-0, Cap-1 or Cap-2, or including all of Cap-0, Cap-1 and Cap-2 but at a non- natural ratio.

[0071] In some embodiments, the mRNA includes a 5 ’-cap analog. In some embodiments, the 5 ’-cap does not naturally exist as an mRNA 5 ’-cap. In some embodiments, the combination of the 5 ’-cap and the downstream sequence thereof does not exist naturally.

[0072] In some embodiments, the 5’-capping moiety, such as the 5’-cap analog, is introduced by a co-transcriptional approach.

[0073] In some embodiments, the 5’-capping moiety, such as the 5’-cap analog, is introduced by an enzymatic approach.

[0074] In some embodiments, the 5 ’-cap analog includes: G(5')ppp(5')G (also referred to as CAP) m7(3'OMeG)(5')ppp(5')(2'OMeA)pG (also known by the commercial name CleanCap®

[0075] Reagent AG (3' OMe)) m7G(5')ppp(5')(2'OMeA)pU (also known by the commercial name CleanCap® Reagent m7(3’OMeG)(5')ppp('5)m6(2’OMeA)pG (also known by the commercial name

[0076] CleanCap® Reagent M6)

[0077] 3'0Me-m7G(5')ppp(5')G (also referred to as Anti-Reverse Cap Analog or ARCA)

[0078] In some embodiments, the 5 ’-cap analog includes m7G(5')ppp(5')(2'OMeA)pG.

[0079] In some embodiments, the 5 ’-cap analog includes at least one modified moiety selected from the group consisting of a N7-methylguanosine-5'-triphosphate (m7GTP), Nl- methylguanosine-5'-triphosphate (rn’GTP), O6-methylguanosine-5'-triphosphate (m6GTP), 6- thioguanosine-5'-triphosphate (s6GTP), 2-amino-6-chloropurineriboside-5'-triphosphate (C16GTP), inosine-5'-triphosphate (ITP), ribavirin-5'-triphosphate (RTP), 2'-Deoxyguanosine-5'- triphosphate (dGTP), araguanosine-5'-triphosphate (araGTP), 2'-Fluoro-2'-deoxyguanosine-5'- triphosphate (fGTP), 2'-O-Methylguanosine-5'-triphosphate (Om2GTP), 3'-O-Methylguanosine- 5'-triphosphate (Om3GTP), 2'-Amino-2'-deoxyguanosine-5'-triphosphate (NH22GTP), 3'- Amino-2',3'-dideoxyguanosine-5'-triphosphate (NH23dGTP), 2'-Azido-2'-deoxyguanosine-5'- triphosphate (N32GTP), 3'-Azido-2',3'-dideoxyguanosine-5'-triphosphate (N33'dGTP), 3'-(0- Propargyl)-GTP (Opp3GTP), 3' ( / 2')-O-Anthraniloyl-GTP (Ant3 ( / 2)GTP), 3'-Desthiobiotin-GTP (DTB3GTP), 273'-O-(2-Aminoethyl-carbamoyl)-guanosine-5'-triphosphate (EDA2 3GTP).

[0080] In some embodiments, the mRNA molecule further includes a translational modulation sequence.

[0081] The present study discovered that, for mRNAs capped with 5 ’-cap analogs, there exists a set of cis-regulatory elements of translational efficiency different from that which regulates the translational efficiency in naturally capped mRNA molecules.

[0082] Using a co-transcriptionally capped mRNA model and the direct analysis of ribosome targeting (DART) assay developed previously (Niederer et al., Cell Syst. 2022 Mar 16; 13(3):256- 264), translational enhancers for analog-capped mRNA in 5’-UTR were identified in the A549 cells (a lung-derived cell line), HEK293 cells (a kidney-derived cell line), Huh7 cells (a liver- derived cell line) and HeLa cells (a uterus / cervix-derived cell line). The sequences of the top translational enhancers identified in the study are listed below in Tables 1-4:

[0083] Table 1 : Top translational enhancers identified in A549 cells

[0084] Table 2: Top translational enhancers identified in HEK293 cells

[0085] Table 3: Top translational enhancers identified in Huh7 cells

[0086] Table 4: Top translational enhancers identified in HeLa cells

[0087] In some embodiments, the translational enhancer sequence, when combined with the 5’- cap analog, increases a translational efficiency of the mRNA.

[0088] In some embodiments, the translational enhancer sequence is in the 5 ’-untranslated region (5’-UTR). In some embodiments, the translational enhancer sequence is in the coding region. In some embodiments, the translation enhancer is in the 3 ’-untranslated region (3’-UTR) In some embodiments, the mRNA molecule further includes a modified nucleobase. As used herein, the term “modified nucleobase” refers to nucleobases other than the four common nucleobases adenine (A), cytosine (C), uracil (U), and guanine (G). The term “modified nucleobase” does not exclude naturally occurring nucleobases that are found in non-mRNA molecules. For example, nucleobases like pseudouridine, 5-methylcytosine, Nl- methylpseudouridine and 2’-O-methylated exist in nature. These nucleobases are considered to be examples of modified nucleobases herein.

[0089] Non-limiting examples of modified nucleobases that can be incorporated into the mRNA molecule include an N1 -methyladenosine (ml A), an N6-methyladenosine (m6A), an N6,2’-O- dimethyladenosine (m6Am), a 3 -methylcytidine (m3C), an N4-acetylcytidine (ac4C), N4- methylcytidine, a 5-hydroxycytidine, a 5-methylcytosine (m5C), a 5-formylcytidine (f5C), a 5- hyrdoxymethylcytidine, a pseudoisocytidine, an N7-methylguanosine (m7G), an inosine (I), a dihydrouridine (D), an N1 -methylpseudouridine (ml'P), an N1 -methoxymethylpseudouridine, an N1 -ethylpseudouridine, an N1 -propylpseudouridine, a pseudouridine ( T ), 2-thiouridine, a 4- thiouridine, a 5-aminoallyluridine, a 5-hydroxyuridine, a 5-hydroxymethyluridine, 5- methyluridine, a 5-carboxyuridine, 5-methoxyuridine, a 5-formyluridine, and a 2’0-methyl modification (Cm, Am, Gm, or Um).

[0090] In some embodiments, a ribosome retention score (RRS) of the mRNA molecule is 2X or higher, such as 3X or higher, 10X or higher, 100X or higher or 1000X or higher, than an RRS of a corresponding mRNA molecule that does not include the translational enhancer or the modified nucleobase but otherwise has the same sequence. The method of calculating RRS is described in Niederer et al. (Cell Syst. 2022 Mar 16;13(3):256-264), the entirety of which is hereby incorporated herein by reference.

[0091] In some embodiments, the 5 ’-untranslated region includes at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-100, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a lung cell.

[0092] In some embodiments, the 5 ’-untranslated region includes at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 101-200, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a kidney cell. In some embodiments, the 5 ’-untranslated region includes at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 201-300, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a liver cell.

[0093] In some embodiments, the coding sequence encodes a therapeutic peptide or a therapeutic protein.

[0094] In some embodiments, the therapeutic peptide or the therapeutic protein comprises a vaccine.

[0095] Method of Modulating Translational Efficiency of mRNA

[0096] In some aspects, the present invention is directed to a method of modulating translational efficiency of an mRNA.

[0097] In some embodiments, the mRNA comprises a 5’-cap analog, and the method includes modifying a 5’-UTR of the mRNA to include a translational enhancer sequence that, when combined with the 5’-cap analog, increases a translational efficiency of the mRNA.

[0098] In some embodiments, the mRNA comprises the translational enhancer above, and the method includes modifying the mRNA to introduce the 5 ’-cap analog, such by an enzymatic method.

[0099] In some embodiments, the modified mRNA molecule is the same as or similar to those described elsewhere herein, such as the “mRNA Molecule” section.

[0100] In some embodiments, modifying the mRNA molecule includes modifying a sequence of a DNA molecule encoding the mRNA molecule.

[0101] Method of Expressing Polypeptide or Protein

[0102] In some aspects, the present invention is directed to a method of expressing a polypeptide or a protein.

[0103] In some embodiments, the method includes preparing an mRNA molecule encoding the polypeptide or the protein, and translating the mRNA molecule.

[0104] In some embodiments, translating the mRNA molecule includes contacting the mRNA molecule with a ribosome. In some embodiments, the mRNA molecule is translated by an in vitro translation. In some embodiments, the mRNA molecule is translated by being introduced into a cell. In some embodiments, the mRNA molecule is translated in a cell, a tissue, an organ, or a subject.

[0105] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0106] In some embodiments, the mRNA molecule is the same as or similar to those described elsewhere herein, such as in the “mRNA Molecule” section.

[0107] Examples

[0108] The instant specification further describes in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless so specified. Thus, the instant specification should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

[0109] Example 1 : Material and Methods

[0110] Cell-free extract preparation

[0111] 1. HEK293T and Huh7.5.1 were cultured in DMEM (Thermo 2523101), supplemented with 10% Heat-inactivated FBS (Sigma 12306C) and 1% Penicillin-Streptomycin (Thermo 1514022). A549 were cultured in DMEMTT2 (Thermo 2537072), supplemented with 10% Heat-inactivated FBS and 1% Penicillin-Streptomycin. The cells were split every 3 days.

[0112] 2. Cells were allowed to grow until 80% confluence. To collect the cells, the culture were washed with PBS and dissociated with 0.25% Trypsin-EDTA (Thermo 25200056). The dissociated cells were collected in culture medium and pelleted at 1000 rpm for 5 minutes.

[0113] 3. The cell pellets were then washed once with ice-cold PBS and once with ice-cold isotonic buffer (16 mM HEPES-KOH pH 7.4, 100 mM KC1, 0.5 mM MgCh).

[0114] 4. Cells were then resuspended in equal volume of hypotonic buffer (16 mM HEPES-KOH pH 7.4, 10 mM KC1, 0.5 mM MgCh, and 5 mM DTT). To facilitate the hypotonic lysis, the suspension was triturated through a 27G needle for 10 times on ice. 5. After hypotonic lysis, the suspensions were centrifuged at 13000 rpm, 4°C for 1 minute. The supernatant, which is the translation-potent extract, was collected and frozen in - 80°C until use.

[0115] DART RNA pool preparation

[0116] 1. The DNA pool was amplified with primer set: fwd: GCTAATACGACTCACTATAAGG (SEQ ID NO: 401) rev:

[0117] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTCCTTGGTGCCCGAGTG (SEQ ID NO: 402)

[0118] 2. The PCR products were purified with DNA Clean & Concentrator-5 (Zymo D4014), and eluted with 7 pL H2O.

[0119] 3. the RNA pool was in vitro transcribed with MEGAshortscript T7 kit (Thermo AM1354) in supplement with CleanCapAG (6 mM, Trilink N7133).

[0120] 4. After overnight incubation, 4 units of TURBO DNase (Thermo, AM2238) were added to the reaction to deplete DNA templates.

[0121] 5. In vitro transcription products were mixed 1 : 1 to RNA loading dye and the pool RNAs were purified by denaturing PAGE electrophoresis.

[0122] In vitro initiation and sucrose gradient separation

[0123] 1. The 5% and 50% sucrose solution were prepared with gradient buffer (20 mM HEPES-KOH pH 7.4, 2 mM magnesium glutamate salt, 100 mM potassium glutamate salt, 1% Triton XI 00, 3 mM DTT, and 100 pg / mL cycloheximide). The 5-50% gradient was established with Biocomp Gradient Master.

[0124] 2. In vitro translation reactions were set up with 80 nM pool RNAs and 100 uL cell- free extracts in the translation buffer (cycloheximide 500 pg / mL, Creatine kinase 0.33 mg / mL, DTT 1.6 pM, HEPES-KOH 16 mM, Spermidine 0.1 mM, ATP 0.8 mM, GTP 0.1 mM, potassium Glutamate 40 mM, magnesium Glutamate 2 mM, Creatine phosphate 20 mM, PMSF 2 pM, and supplemented with SUPERase inhibitor and cOmplete protease inhibitor).

[0125] 3. The reaction mixtures were incubate at 37°C for 30 minutes.

[0126] 4. The reaction mixtures were loaded onto the top of 5-50% sucrose gradient. 5. The gradient was formed by centrifuging with SW41Ti rotor at 36000 rpm, 4°C for 3 hours.

[0127] 6. The 80S fractions were collected with Biocomp fraction collector.

[0128] 7. Each gradient fraction was dilute 1 : 1 with water, then add with 0.5% SDS and 500 pg Proteinase K.

[0129] 8. The mixtures were incubated at 50°C for 30 minutes.

[0130] 9. The RNA was extract with acid-phenol:chloroform.

[0131] Library construction

[0132] 1. The RNA was resuspend in 11 pL of water.

[0133] 2. 1 pL of 10 pM RT primer was added (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, SEQ ID NO: 403).

[0134] 3. The mixture was heated at 65 °C for 5 minutes, then step down by 5 °C every 2 minutes to 45 °C to anneal the primer.

[0135] 4. Reverse transcribed with SuperScript III (Thermo 18080093). Incubate at 50°C for 1 hour.

[0136] 5. Added 2 pL of IM NaOH and incubate at 98C for 15 minutes to degrade RNA.

[0137] 6. Neutralized with 2 pL of IM HC1.

[0138] 7. Added 24 pL of 2X formamide loading buffer, denature at 80°C for 2 minutes.

[0139] 8. cDNA was purified with non-denaturing PAGE electrophoresis.

[0140] 9. cDNA was resuspend in 5pL of 10 mM Tris-HCl pH 7.5.

[0141] 10. 0.8 pL of 80 pM 5' adapter was added (ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNN, SEQ ID NO:404) and luL of 100% DMSO

[0142] 11. Heated at 75 °C for 2 minutes, and cooled down on ice.

[0143] 12. The cDNA was ligated with 5' adapter with T4 RNA ligase 1 (NEB M0437). Incubated at room temperature for overnight with 1000 RPM shaking on thermomixer.

[0144] 13. The ligation product was cleaned-up with Dynabeads SILANE beads (Thermo 37002D) and eluted in 27 pL of 10 mM Tris-HCl pH 7.5.

[0145] 14. The libraries were amplified by PCR and indexed with NEBNext Multiplex Oligos for Illumina® (Index Primers Set 2, E7500). 15. PCR products were purified with AMPure beads (Beckman Coulter), producing libraries ready for sequencing.

[0146] In vitro translation of luciferase reporter mRNA

[0147] 1. For each reaction, in vitro translation reactions were setup with 4 pL cell-free extracts and 5 nM reporter mRNA in translation buffer (16 mM HEPES-KOH pH 7.4, 0.1 mM Spermidine, 0.8 mM ATP, 0.1 mM GTP, 40 mM potassium Glutamate, 2 mM magnesium Glutamate, 20 mM Creatine phosphate and 0.1 mg / mL Creatine Kinase). The total reaction volume was 10 pL.

[0148] 2. The reaction was incubate at 37°C for 30 minutes.

[0149] 3. The reaction was terminated by adding lx Passive Lysis buffer (Promega E1941).

[0150] 4. 10 pL of terminated reaction was mixed with 20 pL Bright-Glo Luciferase reagent (Promega E2610).

[0151] 5. The luminescence levels were detected using Promega GloMax Discover plate reader (GM3000).

[0152] Enumerated Embodiments

[0153] In some aspects, the present invention is directed to the following non-limiting embodiments:

[0154] Embodiment 1 : A non-natural mRNA molecule, comprising: a 5’-cap analog; a 5’- untranslated region (5’-UTR); and a coding sequence, wherein the translational enhancer sequence, when combined with the 5’-cap analog, increases a translational efficiency of the mRNA.

[0155] Embodiment 2: The mRNA molecule of Embodiment 1, wherein the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-400.

[0156] Embodiment 3: The mRNA molecule of any one of Embodiments 1-2, wherein the 5 ’-cap analog comprises G(5')ppp(5')G, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, m7(3’OMeG)(5')ppp('5)m6(2’OMeA)pG, or 3'0Me-m7G(5')ppp(5')G. Embodiment 4: The mRNA molecule of any one of Embodiments 1-3, further comprises a modified nucleobase.

[0157] Embodiment 5: The mRNA molecule of Embodiment 4, wherein the modified nucleobase comprises an N1 -methyladenosine (mlA), an N6-methyladenosine (m6A), an N6,2’- O-dimethyladenosine (m6Am), a 3 -methylcytidine (m3C), an N4-acetylcytidine (ac4C), N4- methylcytidine, a 5-hydroxycytidine, a 5-methylcytosine (m5C), a 5-formylcytidine (f5C), a 5- hyrdoxymethylcytidine, a pseudoisocytidine, an N7-methylguanosine (m7G), an inosine (I), a dihydrouridine (D), an N1 -methylpseudouridine (ml'P), an N1 -methoxymethylpseudouridine, an N1 -ethylpseudouridine, an N1 -propylpseudouridine, a pseudouridine ( ), 2-thiouridine, a 4- thiouridine, a 5-aminoallyluridine, a 5-hydroxyuridine, a 5-hydroxymethyluridine, 5- methyluridine, a 5-carboxyuridine, 5-methoxyuridine, a 5-formyluridine, and a 2’0-methyl modification (Cm, Am, Gm, or Um).

[0158] Embodiment 6: The mRNA molecule of any one of Embodiments 1-5, wherein a ribosome retention score (RRS) of the mRNA molecule is 3X or higher than an RRS of an mRNA molecule that does not comprise the translational enhancer sequence but otherwise has the same sequence.

[0159] Embodiment 7: The mRNA molecule of any one of Embodiments 1-6, wherein (a) the 5’- untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-100, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a lung cell, (b) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 101-200, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a kidney cell, (c) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 201-300, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a liver cell, or (d) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 301-400, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a uterus cell or a cervix cell.

[0160] Embodiment 8: The mRNA molecule of any one of Embodiments 1-7, wherein the coding sequence encodes a therapeutic peptide or a therapeutic protein. Embodiment 9: The mRNA molecule of Embodiment 8, wherein the therapeutic peptide or the therapeutic protein comprises a vaccine.

[0161] Embodiment 10: A method of modulating a translational efficiency of an mRNA, the method comprising: (a) in the case that the mRNA comprises a 5’-cap analog, modifying a 5’- UTR of the mRNA to include a translational enhancer sequence that, when combined with the 5 ’-cap analog, increases a translational efficiency of the mRNA, or (b) in the case that the mRNA comprises the translational enhancer, modifying the mRNA to introduce the 5’-cap analog.

[0162] Embodiment 11 : The method of Embodiment 10, wherein the translational enhancer sequence comprises at least one sequence selected form the group consisting of SEQ ID NOs: 1- 400.

[0163] Embodiment 12: The method of any one of Embodiments 10-11, wherein the 5 ’-cap analog comprises G(5')ppp(5')G, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, m7(3’OMeG)(5')ppp('5)m6(2’OMeA)pG, or 3'0Me-m7G(5')ppp(5')G.

[0164] Embodiment 13: The method of any one of Embodiments 10-12, wherein the mRNA further comprises a modified nucleobase.

[0165] Embodiment 14: The method of Embodiment 13, wherein the modified nucleobase comprises an N1 -methyladenosine (mlA), an N6-methyladenosine (m6A), an N6,2’-O- dimethyladenosine (m6Am), a 3-methylcytidine (m3C), an N4-acetylcytidine (ac4C), N4- methylcytidine, a 5-hydroxycytidine, a 5-methylcytosine (m5C), a 5-formylcytidine (f5C), a 5- hyrdoxymethylcytidine, a pseudoisocytidine, an N7-methylguanosine (m7G), an inosine (I), a dihydrouridine (D), an N1 -methylpseudouridine (ml ), an N1 -methoxymethylpseudouridine, an N1 -ethylpseudouridine, an N1 -propylpseudouridine, a pseudouridine (T), 2-thiouridine, a 4- thiouridine, a 5-aminoallyluridine, a 5-hydroxyuridine, a 5-hydroxymethyluridine, 5- methyluridine, a 5-carboxyuridine, 5 -methoxyuridine, a 5-formyluridine, and a 2’O-methyl modification (Cm, Am, Gm, or Um).

[0166] Embodiment 15: The method of any one of Embodiments 10-14, wherein a ribosome retention score (RRS) of the modified mRNA molecule is 3X or higher than an RRS of an mRNA molecule that does not comprise the translational enhancer sequence but otherwise has the same sequence. Embodiment 16: The method of any one of Embodiments 10-15, wherein (a) the 5’- untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-100, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a lung cell, (b) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 101-200, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a kidney cell, (c) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 201-300, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a liver cell, or (d) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 301-400, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a uterus cell or a cervix cell.

[0167] Embodiment 17: The method of any one of Embodiments 10-16, wherein the coding sequence encodes a therapeutic peptide or a therapeutic protein.

[0168] Embodiment 18: The method of Embodiment 17, wherein the therapeutic peptide or the therapeutic protein is a vaccine.

[0169] Embodiment 19: A method of expressing a polypeptide or a protein, the method comprising: constructing a non-natural mRNA, which comprises: a 5’-cap analog; a 5’- untranslated region (5’-UTR) comprising a translational enhancer sequence; and a coding sequence encoding the polypeptide or the protein; and translating the mRNA, wherein the translational enhancer sequence, when combined with the 5 ’-cap analog, increases a translational efficiency of the mRNA.

[0170] Embodiment 20: The method of Embodiment 19, wherein the translational enhancer sequence comprises at least one sequence selected form the group consisting of SEQ ID NOs: 1- 400.

[0171] Embodiment 21 : The method of any one of Embodiments 19-20, wherein the 5 ’-cap analog comprises G(5')ppp(5')G, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, m7(3’OMeG)(5')ppp('5)m6(2’OMeA)pG, or 3'0Me-m7G(5')ppp(5')G. Embodiment 22: The method of any one of Embodiments 19-21, wherein the mRNA further comprises a modified nucleobase.

[0172] Embodiment 23: The method of Embodiment 22, wherein the modified nucleobase comprises an N1 -methyladenosine (ml A), an N6-methyladenosine (m6A), an N6,2’-O- dimethyladenosine (m6Am), a 3 -methylcytidine (m3C), an N4-acetylcytidine (ac4C), N4- methylcytidine, a 5-hydroxycytidine, a 5-methylcytosine (m5C), a 5-formylcytidine (f5C), a 5- hyrdoxymethylcytidine, a pseudoisocytidine, an N7-methylguanosine (m7G), an inosine (I), a dihydrouridine (D), an N1 -methylpseudouridine (ml'P), an N1 -methoxymethylpseudouridine, an N1 -ethylpseudouridine, an N1 -propylpseudouridine, a pseudouridine ( ), 2-thiouridine, a 4- thiouridine, a 5-aminoallyluridine, a 5-hydroxyuridine, a 5-hydroxymethyluridine, 5- methyluridine, a 5-carboxyuridine, 5-methoxyuridine, a 5-formyluridine, and a 2’0-methyl modification (Cm, Am, Gm, or Um).

[0173] Embodiment 24: The method of any one of Embodiments 19-23, wherein a ribosome retention score (RRS) of the mRNA molecule is 3X or higher than an RRS of an mRNA molecule that does not comprise the translational enhancer sequence but otherwise has the same sequence.

[0174] Embodiment 25: The method of any one of Embodiments 19-24, wherein (a) the polypeptide or the protein is expressed in a lung cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1- 100, (b) the polypeptide or the protein is expressed in a kidney cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 101-200, (c) the polypeptide or the protein is expressed in a liver cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 201-300, or (d) the polypeptide or the protein is expressed in a uterus cell or a cervix cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 301-400.

[0175] Embodiment 26: The method of any one of Embodiments 19-25, wherein the polypeptide or the protein is a therapeutic peptide or a therapeutic protein.

[0176] Embodiment 27: The method of Embodiment 26, wherein the therapeutic peptide or the therapeutic protein comprises a vaccine. Embodiment 28: The method of any one of Embodiments 19-27, wherein the polypeptide or the protein is expressed in a cell of a subject.

[0177] Embodiment 29: The method of Embodiment 28, wherein the subject is a mammal, optionally a human.

[0178] The foregoing outlines features of several embodiments so that those skilled in the art may better understand the aspects of the present disclosure. Those skilled in the art should appreciate that they may readily use the present disclosure as a basis for designing or modifying other processes and structures for carrying out the same purposes and / or achieving the same advantages of the embodiments introduced herein. Those skilled in the art should also realize that such equivalent constructions do not depart from the spirit and scope of the present disclosure, and that they may make various changes, substitutions, and alterations herein without departing from the spirit and scope of the present disclosure.

Claims

CLAIMSWhat is claimed is:

1. A non-natural mRNA molecule, comprising: a 5 ’-cap analog; a 5 ’-untranslated region (5’-UTR); and a coding sequence, wherein the translational enhancer sequence, when combined with the 5 ’-cap analog, increases a translational efficiency of the mRNA.

2. The mRNA molecule of claim 1 , wherein the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-400.

3. The mRNA molecule of any one of claims 1-2, wherein the 5’-cap analog comprises G(5')ppp(5')G, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, m7(3’OMeG)(5')ppp('5)m6(2’OMeA)pG, or 3'0Me-m7G(5')ppp(5')G.

4. The mRNA molecule of any one of claims 1 -3, further comprises a modified nucleobase.

5. The mRNA molecule of claim 4, wherein the modified nucleobase comprises an N1 -methyladenosine (mlA), an N6-methyladenosine (m6A), an N6,2’-O- dimethyladenosine (m6Am), a 3-methylcytidine (m3C), an N4-acetylcytidine (ac4C), N4-methylcytidine, a 5-hydroxycytidine, a 5-methylcytosine (m5C), a 5-formylcytidine (f5C), a 5-hyrdoxymethylcytidine, a pseudoisocytidine, an N7-methylguanosine (m7G), an inosine (I), a dihydrouridine (D), an N1 -methylpseudouridine (mlT), an Nl- methoxymethylpseudouridine, an Nl-ethylpseudouridine, an N1 -propylpseudouridine, a pseudouridine ( ), 2-thiouridine, a 4-thiouridine, a 5-aminoallyluridine, a 5- hydroxyuridine, a 5-hydroxymethyluridine, 5-methyluridine, a 5-carboxyuridine, 5-methoxyuridine, a 5-formyluridine, and a 2’0-methyl modification (Cm, Am, Gm, or Um).

6. The mRNA molecule of any one of claims 1-5, wherein a ribosome retention score (RRS) of the mRNA molecule is 3X or higher than an RRS of an mRNA molecule that does not comprise the translational enhancer sequence but otherwise has the same sequence.

7. The mRNA molecule of any one of claims 1 -6, wherein(a) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-100, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a lung cell,(b) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 101-200, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a kidney cell,(c) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 201-300, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a liver cell, or(d) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 301-400, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a uterus cell or a cervix cell.

8. The mRNA molecule of any one of claims 1-7, wherein the coding sequence encodes a therapeutic peptide or a therapeutic protein.

9. The mRNA molecule of claim 8, wherein the therapeutic peptide or the therapeutic protein comprises a vaccine.

10. A method of modulating a translational efficiency of an mRNA, the method comprising:(a) in the case that the mRNA comprises a 5’-cap analog, modifying a 5’-UTR of the mRNA to include a translational enhancer sequence that, when combined with the 5 ’-cap analog, increases a translational efficiency of the mRNA, or(b) in the case that the mRNA comprises the translational enhancer, modifying the mRNA to introduce the 5 ’-cap analog.

11. The method of claim 10, wherein the translational enhancer sequence comprises at least one sequence selected form the group consisting of SEQ ID NOs: 1-400.

12. The method of any one of claims 10-11, wherein the 5’-cap analog comprises G(5')ppp(5')G, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5l)(2lOMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, m7(3 ’OMeG)(5')ppp('5)m6(2’OMeA)pG, or 3'0Me-m7G(5')ppp(5')G.

13. The method of any one of claims 10-12, wherein the mRNA further comprises a modified nucleobase.

14. The method of claim 13, wherein the modified nucleobase comprises an Nl- methyladenosine (mlA), an N6-methyladenosine (m6A), an N6,2’-O-dimethyladenosine (m6Am), a 3-methylcytidine (m3C), an N4-acetylcytidine (ac4C), N4-methylcytidine, a 5-hydroxycytidine, a 5-methylcytosine (m5C), a 5-formylcytidine (f5C), a 5- hyrdoxymethylcytidine, a pseudoisocytidine, an N7-methylguanosine (m7G), an inosine (I), a dihydrouridine (D), an N1 -methylpseudouridine (mlT), an Nl - methoxymethylpseudouridine, an N1 -ethylpseudouridine, an N1 -propylpseudouridine, a pseudouridine (T), 2-thiouridine, a 4-thiouridine, a 5-aminoallyluridine, a 5- hydroxyuridine, a 5-hydroxymethyluridine, 5-methyluridine, a 5-carboxyuridine, 5- methoxyuridine, a 5-formyluridine, and a 2’O-methyl modification (Cm, Am, Gm, or Um).

15. The method of any one of claims 10-14, wherein a ribosome retention score (RRS) of the modified mRNA molecule is 3X or higher than an RRS of an mRNAmolecule that does not comprise the translational enhancer sequence but otherwise has the same sequence.

16. The method of any one of claims 10-15, wherein(a) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-100, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a lung cell,(b) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 101-200, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a kidney cell,(c) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 201-300, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a liver cell, or(d) the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 301-400, and the translational enhancer sequence increases the translational efficiency of the mRNA molecule in a uterus cell or a cervix cell.

17. The method of any one of claims 10-16, wherein the coding sequence encodes a therapeutic peptide or a therapeutic protein.

18. The method of claim 17, wherein the therapeutic peptide or the therapeutic protein is a vaccine.

19. A method of expressing a polypeptide or a protein, the method comprising: constructing a non-natural mRNA, which comprises: a 5 ’-cap analog; a 5 ’-untranslated region (5’-UTR) comprising a translational enhancer sequence; and a coding sequence encoding the polypeptide or the protein; and translating the mRNA,wherein the translational enhancer sequence, when combined with the 5’-cap analog, increases a translational efficiency of the mRNA.

20. The method of claim 19, wherein the translational enhancer sequence comprises at least one sequence selected form the group consisting of SEQ ID NOs: 1-400.

21. The method of any one of claims 19-20, wherein the 5’-cap analog comprises G(5')ppp(5')G, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5,)(2,OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, m7(3’OMeG)(5')ppp('5)m6(2’OMeA)pG, or 3'0Me-m7G(5')ppp(5')G.

22. The method of any one of claims 19-21, wherein the mRNA further comprises a modified nucleobase.

23. The method of claim 22, wherein the modified nucleobase comprises an Nl- methyladenosine (mlA), an N6-methyladenosine (m6A), an N6,2’-O-dimethyladenosine (m6Am), a 3-methylcytidine (m3C), an N4-acetylcytidine (ac4C), N4-methylcytidine, a 5-hydroxycytidine, a 5-methylcytosine (m5C), a 5-formylcytidine (f5C), a 5- hyrdoxymethylcytidine, a pseudoisocytidine, an N7-methylguanosine (m7G), an inosine (I), a dihydrouridine (D), an N1 -methylpseudouridine (ml ), an Nl- methoxymethylpseudouridine, an Nl-ethylpseudouridine, an N1 -propylpseudouridine, a pseudouridine (T), 2-thiouridine, a 4-thiouridine, a 5-aminoallyluridine, a 5- hydroxyuridine, a 5-hydroxymethyluridine, 5-methyluridine, a 5-carboxyuridine, 5- methoxyuridine, a 5-formyluridine, and a 2’0-methyl modification (Cm, Am, Gm, or Um).

24. The method of any one of claims 19-23, wherein a ribosome retention score (RRS) of the mRNA molecule is 3X or higher than an RRS of an mRNA molecule that does not comprise the translational enhancer sequence but otherwise has the same sequence.

25. The method of any one of cl aims 19-24, wherein(a) the polypeptide or the protein is expressed in a lung cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 1-100,(b) the polypeptide or the protein is expressed in a kidney cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 101-200,(c) the polypeptide or the protein is expressed in a liver cell, and the 5 ’-untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 201-300, or(d) the polypeptide or the protein is expressed in a uterus or a cervix, and the 5’- untranslated region comprises at least one translational enhancer sequence selected from the group consisting of SEQ ID NOs: 301-400.

26. The method of any one of claims 19-25, wherein the polypeptide or the protein is a therapeutic peptide or a therapeutic protein.

27. The method of claim 26, wherein the therapeutic peptide or the therapeutic protein comprises a vaccine.

28. The method of any one of claims 19-27, wherein the polypeptide or the protein is expressed in a cell of a subject.

29. The method of claim 28, wherein the subject is a mammal, optionally a human.